JP7301332B2 - Method for producing eukaryotic cells with edited DNA and kit for use in the method - Google Patents

Description

The present invention relates to methods for producing DNA-edited eukaryotic cells, animals, and plants, and kits for use in such methods.

Bacteria and archaea have adaptive immune mechanisms that specifically recognize and eliminate invading organisms such as phages. This system, called the CRISPR-Cas system, first incorporates the genomic information of a foreign organism into its own genome (adaptation). Then, when the same foreign organism tries to invade again, the information incorporated into the self genome and the complementarity of the genome sequence are used to cleave and eliminate the foreign genome (interference).

Recently, genome editing (DNA editing) technology has been developed using the above CRISPR-Cas system as a "tool for DNA editing" (Non-Patent Document 1).

The CRISPR-Cas system is roughly divided into "class 1" consisting of multiple Cas and "class 2" consisting of a single Cas, the effector acting in the process of cleaving DNA. In particular, as a class 1 CRISPR-Cas system, Cas3 and cascade complex (meaning a complex of cascade and crRNA. Same below.) Involved "type I" is widely known, class 2 As a CRISPR-Cas system, "type II" involving Cas9 is widely known (hereinafter, with respect to the CRISPR-Cas system, "class 1 type I" and "class 2 type II" are simply referred to as "type I" and sometimes referred to as "type II"). And what has been widely used in DNA editing technology so far is the class 2 CRISPR-Cas system involving Cas9 (hereinafter sometimes referred to as "CRISPR-Cas9 system"). For example, Non-Patent Document 1 reports a class 2 CRISPR-Cas system that uses Cas9 to cleave DNA.

On the other hand, the class 1 CRISPR-Cas system (hereinafter sometimes referred to as "CRISPR-Cas3 system"), which cleaves DNA using Cas3 and a cascade complex, despite many efforts, There have been no reports of successful genome editing in nuclear cells. For example, in Non-Patent Documents 2 and 3, simply by using the CRISPR-Cas3 system, target DNA was completely degraded in a cell-free system, and a specific E. coli strain could be selectively removed. However, these do not imply successful genome editing, and none have been demonstrated in eukaryotic cells. In addition, in Patent Document 1, the CRISPR-Cas3 system degrades the target DNA in E. coli due to the helicase activity and exonuclease activity of Cas3 (Example 5, Figure 6). It is proposed to perform genome editing using FokI nuclease instead of Cas3 (Example 7, Figure 7, Figure 11). In addition, in Patent Document 2, the CRISPR-Cas3 system degrades the target DNA in E. coli (Fig. 4), so that cas3 is deleted or inactivated Cas3 (Cas3' and Cas3'') is proposed to be repurposed for programmable gene suppression (eg, Example 15, claim 4(e)).

Japanese Patent Publication No. 2015-503535 Japanese Patent Publication No. 2017-512481

Jinek M et al. (2012) A Programmable Dual-RNA Guided DNA Endonuclease in Adaptive Bacterial Immunity, Science, Vol. 337 (Issue 6096), pp. 816-821 Mulepati S & Bailey S (2013) In Vitro Reconstitution of an Escherichia coli RNA-guided Immune System Reveals Unidirectional, ATP-dependent Degradation of DNA Target, Journal of Biological Chemistry, Vol. 288 (No. 31), pp. 22184-22192 Ahmed A. Gomaa et al. (2014) Programmable Removable of Bacterial Strains by Use of Genome Targeting CRISPR-Cas Systems, mbio. asm. org, Volume 5, Issue 1, e00928-13

The present invention has been made in view of such circumstances, and its purpose is to establish the CRISPR-Cas3 system in eukaryotic cells.

The present inventors have made intensive studies to achieve the above objects, and finally succeeded in establishing the CRISPR-Cas3 system in eukaryotic cells. The most widely used CRISPR-Cas9 system, which has been used successfully for genome editing in various eukaryotic cells, usually uses mature crRNA as the crRNA. However, surprisingly, in the CRISPR-Cas3 system, when mature crRNA is used, genome editing is difficult in eukaryotic cells. For the first time, efficient genome editing was possible. That is, in order for the CRISPR-Cas3 system to function in eukaryotic cells, it was found that cleavage of crRNA by proteins constituting the cascade is important. The CRISPR-Cas3 system using this pre-crRNA could be widely applied not only to the type IE system but also to the type IF and type IG systems. In addition, by adding a nuclear localization signal to Cas3, in particular, a bipartite nuclear localization signal, it was possible to further improve the genome editing efficiency of the CRISPR-Cas3 system in eukaryotic cells. In addition, the present inventors have found that, according to the CRISPR-Cas3 system, unlike the CRISPR-Cas9 system, it contains a PAM sequence, or in its upstream region, it is possible to cause a large deletion, and the present invention. Completed.

That is, the present invention relates to the CRISPR-Cas3 system in eukaryotic cells, and more specifically provides the following inventions.

[1] A method for producing a eukaryotic cell with edited DNA, comprising introducing a CRISPR-Cas3 system into the eukaryotic cell, wherein the CRISPR-Cas3 system includes the following (A) ~ (C) Method.

(A) a Cas3 protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide;
(B) a cascade protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide; and (C) a crRNA, a polynucleotide encoding said crRNA, or an expression vector comprising said polynucleotide [2] DNA is A method of producing an edited animal (but not human) or plant, comprising introducing a CRISPR-Cas3 system into the animal (but not human) or plant, wherein the CRISPR-Cas3 system comprises (A ) to (C).

(A) a Cas3 protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide;
(B) a cascade protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide, and (C) a crRNA, a polynucleotide encoding said crRNA, or an expression vector comprising said polynucleotide [3] Eukaryotic After introducing the CRISPR-Cas3 system into the cell, the method according to [1] or [2], which comprises the step of cleaving the crRNA by a protein that constitutes the cascade protein.

[4] The method of [1] or [2], wherein the crRNA is pre-crRNA.

[5] The method according to any one of [1] to [4], wherein a nuclear localization signal is added to the Cas3 protein and/or cascade protein.

[6] The method of [5], wherein the nuclear localization signal is a bipartite nuclear localization signal.

[7] A kit for use in the method according to any one of [1] to [6], including the following (A) and (B).

(A) a Cas3 protein, a polynucleotide encoding the protein, or an expression vector comprising the polynucleotide, and (B) a cascade protein, a polynucleotide encoding the protein, or an expression vector comprising the polynucleotide [8] crRNA , a polynucleotide encoding said crRNA, or an expression vector comprising said polynucleotide.

[9] The kit of [8], wherein the crRNA is pre-crRNA.

[10] The kit according to any one of [7] to [9], wherein a nuclear localization signal is added to the Cas3 protein and/or the cascade protein.

[11] The kit of [10], wherein the nuclear localization signal is a bipartite nuclear localization signal.

As used herein, the term "polynucleotide" intends a polymer of nucleotides and is used synonymously with the terms "gene", "nucleic acid" or "nucleic acid molecule". A polynucleotide can exist in the form of DNA (eg, cDNA or genomic DNA) or RNA (eg, mRNA). The term "protein" is also used synonymously with "peptide" or "polypeptide."

By using the CRISPR-Cas3 system of the present invention, it has become possible to edit DNA in eukaryotic cells.

It is the result of an SSA assay measuring the cleaving activity against exogenous DNA. Schematic representation of the location of target sequences in the CCR5 gene. It is a diagram showing the CCR5 gene (clone 1) in which part of the base sequence is deleted by the CRISPR-Cas3 system. It is a diagram showing the CCR5 gene (clone 2) in which part of the base sequence is deleted by the CRISPR-Cas3 system. It is a diagram showing the CCR5 gene (clone 3) in which part of the nucleotide sequence is deleted by the CRISPR-Cas3 system. It is a diagram showing the CCR5 gene (clone 4) in which part of the base sequence is deleted by the CRISPR-Cas3 system. (a) is a schematic diagram showing the structure of a cascade plasmid. (b) is a schematic diagram showing the structure of the Cas3 plasmid. (c) is a schematic diagram showing the structure of the pre-crRNA plasmid. (d) is a schematic diagram showing the structure of the reporter vector (including the target sequence). Schematic representation of the location of target sequences in the EMX1 gene. By CRISPR-Cas3 system, it is a diagram showing the EMX1 gene (clone 1) in which a part of the nucleotide sequence is deleted. It is a diagram showing the EMX1 gene (clone 2) in which another part of the base sequence is deleted by the CRISPR-Cas3 system. Schematic representation of the structure of the bpNLS-added Cas3/cascade plasmid. Schematic representation of the structure of the cascade (2A) plasmid. It is the result of an SSA assay measuring the cleaving activity against exogenous DNA. FIG. 2 shows the structures of pre-crRNA (LRSR and RSR) and mature crRNA used in this example. An underline in the figure indicates a 5' handle (Cas5 handle), and a double underline indicates a 3' handle (Cas6 handle). FIG. 2 shows the results of SSA assay using pre-crRNA (LRSR and RSR) and mature crRNA. FIG. 3 depicts the results of SSA assays using one NLS or two NLS (bpNLS) in plasmids for expression of Cas3/cascade genes. Effect of PAM sequences on DNA cleavage activity of the CRISPR-Cas3 system. Effect of a single spacer mismatch on the DNA-cleaving activity of the CRISPR-Cas3 system. Effect of Cas3 mutations at HD nuclease domain (H74A), SF2 helicase domain motif 1 (K320A), motif 3 (S483/T485A). FIG. 3 depicts a comparison of DNA cleavage activity of Type IE, Type IF, and Type IG CRISPR-Cas3 systems. FIG. 10 depicts the size of deletions by the CRISPR-Cas3 system detected by sequencing of TA cloning samples of PCR products. FIG. 13 depicts the locations of deletions by the CRISPR-Cas3 system detected by extensive sequencing of TA clones (n=49). FIG. 4 depicts the number detected by deletion size by the CRISPR-Cas3 system using microarray-based capture sequencing of >1000 kb around the targeted EMX1 locus. FIG. 4 depicts the number detected by deletion size by the CRISPR-Cas3 system utilizing microarray-based capture sequencing of >1000 kb around the targeted CCR5 locus.

[1] DNA-edited eukaryotic cells, animals, methods for producing plants The method of the present invention includes introducing the CRISPR-Cas3 system into eukaryotic cells, and the CRISPR-Cas3 system is the following (A) It is a method including ~ (C).

(A) a Cas3 protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide;
(B) a cascade protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide; and (C) a crRNA, a polynucleotide encoding said crRNA, or an expression vector comprising said polynucleotide, Class 1 CRISPR- The Cas system is classified into type I and type III, and type I is classified into type IA, type IA, type It is classified into six types: IB, type IC, type ID, type IE, and type IF, and type IG, which is a subtype of type IB (for example, [ van der Oost J et al.(2014) Unraveling the structural and mechanical basis of CRISPR-Cas systems, Nature Reviews Microbiology, Vol.12 (No.7), pp.479-49 2], [Jackson RN et al. ) Fitting CRISPR-associated Cas3 into the Helicase Family Tree, Current Opinion in Structural Biology, Vol.24, pp.106-114]).

The type I CRISPR-Cas system has the function of cleaving DNA through the cooperation of Cas3 (a protein with nuclease and helicase activity), cascade and crRNA. Since Cas3 is used as a nuclease, it is referred to as "CRISPR-Cas3 system" in the present invention.

By using the CRISPR-Cas3 system of the present invention, for example, the following advantages are obtained.

First, the crRNA used in the CRISPR-Cas3 system generally recognizes target sequences of 32-37 bases (Ming Li et al., Nucleic Acids Res. 2017 May 5; 45(8): 4642- 4654). In contrast, the crRNAs used in the CRISPR-Cas9 system generally recognize target sequences of 18-24 bases. Therefore, it is believed that the CRISPR-Cas3 system can recognize target sequences more accurately than the CRISPR-Cas9 system.

In addition, the PAM sequence of the CRISPR-Cas9 system, which is a class 2 type II system, is "NGG (N is any base)" adjacent to the 3' side of the target sequence. Also, the PAM sequence of the CRISPR-Cpf1 system, which is a class 2 type V system, is the 'AA' that flanks the 5' side of the target sequence. In contrast, the PAM sequence of the CRISPR-Cas3 system of the present invention is "AAG" or a nucleotide sequence similar thereto (e.g., "AGG", "GAG", "TAC", "ATG", "TAG", etc.) (FIG. 12). Therefore, by using the CRISPR-Cas3 system of the present invention, it is believed that regions that could not be recognized by conventional methods can be targeted for DNA editing.

Furthermore, unlike the Class 2 CRISPR-Cas system, the CRISPR-Cas3 system causes DNA cleavage at multiple sites. Therefore, using the CRISPR-Cas3 system of the present invention, it is possible to generate a wide range of deletion mutations ranging from one hundred to several thousand bases, possibly more (FIGS. 3, 6, 16-18). It is thought that this function can be used for knocking out long genomic regions or knocking in long DNAs. When performing knock-in, donor DNA is usually used, and the donor DNA is also a molecule that constitutes the CRISPR-Cas3 system of the present invention.

In addition, in this specification, when simply described as "Cas3", it shall mean "Cas3 protein". The same is true for cascade proteins.

The CRISPR-Cas3 system of the present invention encompasses all six subtypes of Type I. That is, the proteins that make up the CRISPR-Cas3 system may have slightly different configurations depending on the subtype (eg, different proteins that make up the cascade), but the present invention includes all of these proteins. . Actually, in this example, it was found that genome editing is possible not only in the type IE system, but also in the type 1-G and type IF systems (Fig. 15).

The Type I-E CRISPR-Cas3 system, which is common among Type I CRISPR-Cas3 systems, co-operates crRNA with Cas3 and cascades (Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7) This cuts the DNA.

Type IA system has Cas8a1, Csa5 (Cas11), Cas5, Cas6, and Cas7 as cascades, and Type IB has Cas8b1, Cas5, Cas6, and Cas7 as cascades, and type In IC, Cas8c, Cas5, and Cas7 as cascades, in Type ID, Cas10d, Csc1 (Cas5), Cas6, and Csc2 (Cas7) as cascades, and in Type I-F , with Csy1 (Cas8f), Csy2 (Cas5), Cas6, and Csy3 (Cas7) as cascades, and in type IG systems, Cst1 (Cas8a1), Cas5, Cas6, and Cst2 (Cas7) as cascades. be a component. In the present invention, Cas3 and cascades are collectively referred to as "Cas protein family".

Hereinafter, the type IE CRISPR-Cas3 system will be described as a representative example, but for other types of CRISPR-Cas3 systems, the cascades that make up the system may be read as appropriate.

-Cas protein group-
In the CRISPR-Cas3 system of the present invention, the Cas protein group is introduced into a eukaryotic cell in the form of a protein, in the form of a polynucleotide encoding the protein, or in the form of an expression vector containing the polynucleotide. can be done. When Cas proteins are introduced into eukaryotic cells in the form of proteins, the amount of each protein can be adjusted as appropriate, which is advantageous in terms of handling. In addition, taking into consideration the intracellular cleavage efficiency and the like, it is also possible to first form a complex of the Cas protein group and then introduce it into eukaryotic cells.

In the present invention, it is preferable to add a nuclear localization signal to the Cas protein group. The nuclear localization signal can be added to the N-terminal side and/or C-terminal side of the Cas protein group (5'-terminal side and/or 3'-terminal side of the polynucleotide encoding each Cas protein group). Thus, by adding a nuclear localization signal to the Cas protein group, localization to the nucleus is promoted within the cell, resulting in the advantage of efficient DNA editing.

The nuclear localization signal is a peptide sequence consisting of several to several tens of basic amino acids, and the sequence is not particularly limited as long as it translocates the protein into the nucleus. Specific examples of such nuclear localization signals are described, for example, in [Wu J et al. (2009) The Intracellular Mobility of Nuclear Import Receptors and NLS Cargoes, Biophysical journal, Vol. 96 (Issue 9), pp. 3840-3849] and commonly used in the art can be used in the present invention.

The nuclear localization signal can be, for example, PKKKRKV (SEQ ID NO:52) (encoded by the sequence CCCAAGAAGAAGCGGAAGGTG (SEQ ID NO:53)). When using the nuclear localization signal, for example, it is preferable to place a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 53 at the 5' end of each polynucleotide encoding the Cas protein group. The nuclear localization signal can also be, for example, KRTADGSEFESPKKKRKVE (SEQ ID NO: 54) (encoded by the nucleotide sequence AAGCGGACTGCTGATGGCAGTGAATTTGAGTCCCAAAGAAGAAGAAGAGAAAGGTGGAA (SEQ ID NO: 55)). When using the nuclear localization signal, for example, placing a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 55 at both ends of each polynucleotide encoding the Cas protein group (i.e., "bipartite nuclear localization signal (bpNLS)" use) is preferred.

Such modifications, together with the use of pre-crRNA described below, are important for efficient expression and function of the CRISPR-Cas3 system of the present invention in eukaryotic cells.

One preferred embodiment of the Cas protein group used in the present invention is as follows.
Cas3; protein Cse1 (Cas8) encoded by the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 7; protein Cse2 encoded by the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 8 (Cas11); Protein Cas5 encoded by a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 9; Protein Cas6 encoded by a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 10; Protein Cas7 encoded by a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 11; protein encoded by a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 12 (1) wild-type E. coli Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, the N-terminal of Cas7, protein added PKKKRKV (SEQ ID NO: 52) as a nuclear localization signal, or (2) wild-type E. coli Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, to the N-terminus and C-terminus of Cas7, KRTADGSEFESPKKKRKVE (SEQ ID NO: 54) as a nuclear localization signal protein. The Cas protein group can be translocated into the nucleus of eukaryotic cells by using a protein having such an amino acid sequence. The Cas protein group thus translocated into the nucleus cleaves the target DNA. In addition, it is possible to edit the target DNA even in a DNA region with a strong structure (such as heterochromatin), which is considered difficult with the CRISPAR-Cas9 system.

Another aspect of each protein of the Cas protein group used in the present invention is a protein encoded by a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of the Cas protein group. Another aspect of each protein of the Cas protein group used in the present invention is encoded by a polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of the Cas protein group. It is a protein that Each of the above proteins has DNA-cleaving activity when forming a complex with other proteins that constitute the Cas protein group. The meanings of terms such as "sequence identity" and "stringent conditions" will be described later.

-Polynucleotides encoding Cas protein group-
Polynucleotides encoding wild-type proteins that constitute the type IE CRISPR-Cas system include polynucleotides that have been modified for efficient expression in eukaryotic cells. That is, a modified polynucleotide that encodes the Cas protein group can be used. One preferred aspect of modification of a polynucleotide is modification to a base sequence suitable for expression in eukaryotic cells, for example, optimizing codons for expression in eukaryotic cells.

One preferred embodiment of the polynucleotide encoding the Cas protein group used in the present invention is as follows.
Cas3; Polynucleotide Cse1 (Cas8) consisting of the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 7; Polynucleotide Cse2 (Cas11) consisting of the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 8; SEQ ID NO: 3 or SEQ ID NO Polynucleotide Cas5 consisting of the nucleotide sequence shown in 9; Polynucleotide Cas6 consisting of the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 10; Polynucleotide Cas7 consisting of the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 11; 6 or a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 12 These are the nucleotide sequences encoding the wild-type Cas protein group of E. coli (Cas3; SEQ ID NO: 13, Cse1 (Cas8); SEQ ID NO: 14, Cse2 (Cas11); SEQ ID NO: 15, Cas5; SEQ ID NO: 16, Cas6; SEQ ID NO: 17, Cas7; SEQ ID NO: 18) is artificially modified so that it can be expressed and functioned in mammalian cells.

Artificial modification of the above-mentioned polynucleotide is to modify the base sequence to be suitable for expression in eukaryotic cells and to add a nuclear localization signal. Modification of nucleotide sequences and addition of nuclear localization signals are as described above. As a result, a more sufficient increase in the expression level of the Cas protein group and an increase in function can be expected.

Another aspect of the polynucleotide encoding the Cas protein group used in the present invention is a wild-type Cas protein group consisting of a nucleotide sequence having a sequence identity of 90% or more with the nucleotide sequence of the Cas protein group. It is a polynucleotide whose coding base sequence has been modified. Proteins expressed from these polynucleotides have DNA-cleaving activity when complexed with proteins expressed from other polynucleotides constituting the Cas protein group.

The sequence identity of the base sequences is at least 90% or more, more preferably 95% or more (e.g., 95%, 96%, 97%, 98%, 99% or more). The identity of nucleotide sequences can be determined using programs such as BLASTN ([Altschul SF (1990) Basic local alignment search tool, Journal of Molecular Biology, Vol. 215 (Issue 3), pp. 403 -410]). An example of parameters for analyzing a base sequence by BLASTN is setting score=100 and wordlength=12. Specific techniques for performing BLASTN analysis are known to those skilled in the art. Additions or deletions (such as gaps) may be allowed in order to optimally align the base sequences to be compared.

Moreover, "having DNA cleaving activity" intends to be capable of cleaving a polynucleotide chain at at least one site.

The CRISPR-Cas3 system of the present invention preferably specifically recognizes the target sequence and cleaves DNA. Whether the CRISPR-Cas3 system specifically recognizes the target sequence can be known, for example, by the dual-Luciferase assay described in Example A-1.

Another aspect of the polynucleotide encoding the Cas protein group used in the present invention is a polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of the Cas protein group. be. Proteins expressed from these polynucleotides have DNA-cleaving activity when complexed with proteins expressed from other polynucleotides constituting the Cas protein group.

Here, the term "stringent conditions" refers to conditions in which two polynucleotide chains form a double-stranded polynucleotide specific to a base sequence, but do not form a non-specific double-stranded polynucleotide. Say. "Hybridize under stringent conditions" means, in other words, a temperature 15°C lower than the melting temperature (Tm value) of nucleic acids with high sequence identity (e.g. perfectly matched hybrid), preferably 10°C lower It can be said that the temperature, more preferably a temperature range up to a temperature lower by 5° C., is a condition under which hybridization is possible.

An example of stringent conditions is as follows. First, in a buffer solution (pH 7.2) consisting of 0.25 M Na ₂ HPO ₄ , 7% SDS, 1 mM EDTA, and 1× Denhardt's solution, at 60 to 68° C. (preferably 65° C., more preferably 68° C.). , for 16-24 hours, to allow the two polynucleotides to hybridize. After that, two 15 minute washes were performed at 60 to 68°C (preferably 65°C, more preferably 68°C) in a buffer solution (pH 7.2) consisting of 20mM Na ₂ HPO ₄ , 1% SDS and 1mM EDTA. times.

Other examples include the following method. First, hyaluronic acid containing 25% formamide (50% formamide for more stringent conditions), 4x SSC (sodium chloride/sodium citrate), 50 mM Hepes (pH 7.0), 10x Denhardt's solution, 20 µg/mL denatured salmon sperm DNA. After overnight prehybridization in a hybridization solution at 42°C, a labeled probe is added and incubated overnight at 42°C to allow hybridization of the two polynucleotides.

Next, washing is performed under any of the following conditions. Normal conditions: washing at about 37° C. with 1×SSC and 0.1% SDS as a washing solution. harsh conditions; Wash at about 42° C. with 5×SSC and 0.1% SDS washing solution. More stringent conditions; washing at about 65° C. using 0.2×SSC and 0.1% SDS as a washing solution.

Thus, the stricter the washing conditions for hybridization, the higher the specificity of hybridization. It should be noted that the above combination of SSC, SDS and temperature conditions is merely an example. Stringency similar to the above can be achieved by appropriately combining the above factors that determine hybridization stringency or other factors (e.g., probe concentration, probe length, hybridization reaction time, etc.). can. This is described, for example, in [Joseph Sambrook & David W. Russell, Molecular cloning: a laboratory manual 3rd Ed. , New York: Cold Spring Harbor Laboratory Press, 2001].

-Expression vector containing a polynucleotide encoding a Cas protein group-
In the present invention, an expression vector for expressing the Cas protein group can be used. Various commonly used vectors can be used as the base vector for the expression vector, and can be appropriately selected according to the cell to be introduced or the method of introduction. Specifically, plasmids, phages, cosmids and the like can be used. The specific type of vector is not particularly limited, and a vector that can be expressed in host cells may be appropriately selected.

Examples of the expression vectors mentioned above include phage vectors, plasmid vectors, viral vectors, retroviral vectors, chromosomal vectors, episomal vectors and virus-derived vectors (bacterial plasmids, bacteriophages, yeast episomes, etc.), yeast chromosomal elements and viruses (baculoviruses). viruses, papovaviruses, vaccinia viruses, adenoviruses, avian poxviruses, pseudorabies viruses, herpesviruses, lentiviruses, retroviruses, etc.), and vectors derived from combinations thereof (cosmids, phagemids, etc.).

The expression vector further contains sites for transcription initiation and termination, and preferably contains a ribosome binding site in the transcribed region. The coding portion of the mature transcript in the vector will contain a transcription initiation codon AUG at the beginning of the polypeptide to be translated and an appropriately positioned stop codon at the end.

In the present invention, the expression vector for expressing the Cas protein group may contain a promoter sequence. The above promoter sequence may be appropriately selected according to the type of eukaryotic host cell. Expression vectors may also contain sequences for enhancing transcription from DNA, such as enhancer sequences. Enhancers include, for example, the SV40 enhancer (located 100-270 bp downstream of the replication origin), the cytomegalovirus early promoter enhancer, the polyoma enhancer located downstream of the replication origin, and the adenovirus enhancer. mentioned. The expression vector may also contain sequences for stabilizing the transcribed RNA, such as poly-A addition sequences (polyadenylation sequences, polyA). Examples of poly A addition sequences include growth hormone gene-derived poly A addition sequences, bovine growth hormone gene-derived poly A addition sequences, human growth hormone gene-derived poly A addition sequences, SV40 virus-derived poly A addition sequences, human or A poly A addition sequence derived from the rabbit β-globin gene is included.

The number of polynucleotides encoding the Cas protein group incorporated into the same vector is not particularly limited as long as the function of the CRISPR-Cas system can be exhibited in the host cell into which the expression vector has been introduced. For example, it is possible to design that the polynucleotide encoding the Cas protein group is mounted on one (same) vector, and further, all or part of the polynucleotide encoding each Cas protein group is separately It can also be designed to be mounted on a vector. For example, it is possible to design a polynucleotide encoding a cascade protein on one (identical) vector and a polynucleotide encoding Cas3 on another vector. Preferably, from the viewpoint of expression efficiency and the like, a method of loading polynucleotides encoding each Cas protein group into six different vectors is used.

In addition, multiple polynucleotides encoding the same protein may be mounted in the same vector for purposes such as regulating the expression level. For example, it is possible to design a Cas3-encoding polynucleotide at two locations within one (same) vector.

In addition, it contains a plurality of nucleotide sequences encoding Cas proteins, and between the plurality of nucleotide sequences, a nucleotide sequence encoding an amino acid sequence (2A peptide, etc.) that is cleaved by intracellular proteases is inserted. (see, eg, vector construction in FIG. 8). When a polynucleotide having such a nucleotide sequence is transcribed and translated, a single linked polypeptide chain is expressed in the cell. After that, the Cas protein group is separated by the action of intracellular protease, and after becoming individual proteins, a complex is formed and functions. Thereby, the quantitative ratio of the Cas protein group expressed in cells can be adjusted. For example, from the "expression vector containing one nucleotide sequence encoding Cas3 and one nucleotide sequence encoding Cse1 (Cas8)", Cas3 and Csel (Cas8) are predicted to be expressed in equal amounts. In addition, since it is possible to express a plurality of Cas protein groups with one type of expression vector, it is advantageous in terms of excellent handleability. On the other hand, from the viewpoint of high DNA cleavage activity, it is usually better to express Cas proteins using different expression vectors.

Expression vectors used in the present invention can be produced by known techniques. Examples of such techniques include the techniques described in various guidebooks, in addition to the techniques described in the implementation manuals attached to kits for constructing vectors. For example, [Joseph Sambrook & David W. Russell, Molecular cloning: a laboratory manual 3rd Ed. , New York: Cold Spring Harbor Laboratory Press, 2001] is a comprehensive guide.

-crRNA, a polynucleotide encoding said crRNA, or an expression vector comprising said polynucleotide-
The CRISPR-Cas3 system of the present invention includes crRNA, polynucleotides encoding crRNA, or expression vectors containing such polynucleotides for targeting DNA for genome editing.

crRNAs are RNAs that form part of the CRISPR-Cas system and have base sequences complementary to target sequences. The CRISPR-Cas3 system of the present invention enables crRNA to specifically recognize and cleave a target sequence. In the CRISPR-Cas system typified by the CRISPR-Cas9 system, conventionally mature crRNA has been used as cRNA. However, in the case of making the CRISPR-Cas3 system function in eukaryotic cells, although the reason is not clear, it became clear that the use of mature crRNA is not suitable. Surprisingly, it was found that it is possible to perform genome editing in eukaryotic cells with high efficiency by using pre-crRNA instead of mature crRNA. This fact is evident from contrast experiments between mature crRNA and pre-crRNA (Fig. 10). Therefore, it is particularly preferable to use pre-crRNA as the crRNA of the present invention.

The pre-crRNA used in the present invention typically has a structure of “leader sequence-repeat sequence-spacer sequence-repeat sequence (LRSR structure)” or “repeat sequence-spacer sequence-repeat sequence (RSR structure)”. The leader sequence is an AT-rich sequence and functions as a promoter to express the pre-crRNA. A repeat sequence is a sequence that is repeated via a spacer sequence, and the spacer sequence is a sequence designed in the present invention as a complementary sequence to the target DNA (originally, a foreign DNA-derived sequences). The pre-crRNA becomes mature crRNA when cleaved by proteins that compose the cascade (eg, Cas6 for types IA, B, DE and Cas5 for types IC).

Typically, the chain length of the leader sequence is 86 bases and the chain length of the repeat sequence is 29 bases. The length of the spacer sequence is, for example, 10-60 bases, preferably 20-50 bases, more preferably 25-40 bases, typically 32-37 bases. Therefore, in the case of the LRSR structure, the chain length of the pre-crRNA used in the present invention is, for example, 154 to 204 bases, preferably 164 to 194 bases, more preferably 169 to 184 bases, typically 176 to 181 bases. is. In the case of the RSR structure, it is, for example, 68-118 bases, preferably 78-108 bases, more preferably 83-98 bases, typically 90-95 bases.

In order for the CRISPR-Cas3 system of the present invention to function in eukaryotic cells, the process in which the repeat sequences of pre-crRNA are cleaved by proteins constituting the cascade is considered to be important. Therefore, it should be understood that the repeat sequence can be shorter or longer than the chain length above, as long as such cleavage occurs. That is, the pre-crRNA can be said to be a crRNA in which a sequence sufficient for cleavage by a cascade-constituting protein is added to both ends of the mature crRNA described later. A preferred embodiment of the method of the present invention thus includes a step of cleaved crRNA by proteins that compose the cascade after introduction of the CRISPR-Cas3 system into eukaryotic cells.

On the other hand, the mature crRNA produced by cleaving the pre-crRNA has a structure of "5' handle sequence-spacer sequence-3' handle sequence". Typically, the 5' handle sequence consists of 8 bases from positions 22-29 of the repeat sequence held by Cas5. Also, typically, the 3 'handle sequence consists of the 1st to 21st 21 bases of the repeat sequence, forms a stem loop structure at the 6th to 21st bases, and is held by Cas6. Therefore, the length of the mature crRNA is usually 61-66 bases. However, depending on the type of CRISPR-Cas3 system, some mature crRNAs do not have a 3' handle sequence, so in this case the chain length is shortened by 21 bases.

The RNA sequence may be appropriately designed according to the target sequence for which DNA editing is desired. Alternatively, synthesis of RNA can be performed using any method known in the art.

- Eukaryotic cells -
"Eukaryotic cells" in the present invention include, for example, animal cells, plant cells, algae cells, and fungal cells. Animal cells include, for example, mammalian cells, as well as fish, bird, reptile, amphibian, and insect cells.

"Animal cells" include, for example, cells that constitute an individual animal, cells that constitute an organ or tissue isolated from an animal, cultured cells derived from animal tissue, and the like. Specifically, for example, germ cells such as oocytes and sperm; embryonic cells of embryos at each stage (e.g., 1-cell stage embryo, 2-cell stage embryo, 4-cell stage embryo, 8-cell stage embryo, 16-cell stage embryos, morula stage embryos, etc.); stem cells such as induced pluripotent stem (iPS) cells and embryonic stem (ES) cells; fibroblasts, hematopoietic cells, neurons, muscle cells, osteocytes, hepatocytes, pancreatic cells , brain cells, and somatic cells such as kidney cells. Pre-fertilization and post-fertilization oocytes can be used as oocytes used to generate genome-edited animals, but post-fertilization oocytes, ie, fertilized eggs, are preferred. Particularly preferably, the fertilized egg is a pronuclear stage embryo. Oocytes that have been cryopreserved can be thawed and used.

In the present invention, the term "mammal" is a concept that includes both human and non-human mammals. Examples of non-human mammals include artiodactyls such as bovines, wild boars, pigs, sheep and goats, peri-hoofed animals such as horses, rodents such as mice, rats, guinea pigs, hamsters and squirrels, and lagomorphs such as rabbits. , dogs, cats, and meats such as ferrets. The non-human mammals mentioned above may be domestic or companion animals, or may be wild animals.

"Plant cells" include, for example, cells of cereals, oil crops, fodder crops, fruits and vegetables. The term “plant cell” includes, for example, cells that constitute an individual plant, cells that constitute an organ or tissue separated from a plant, cultured cells derived from a plant tissue, and the like. Plant organs and tissues include, for example, leaves, stems, shoot apexes (growing points), roots, tubers, callus, and the like. Examples of plants include rice, corn, bananas, peanuts, sunflowers, tomatoes, rape, tobacco, wheat, barley, potatoes, soybeans, cotton, carnations, etc., and their propagation materials (e.g., seeds, tubers, tubers, etc.). ) are also included.

-Editing DNA-
In the present invention, “editing eukaryotic DNA” may be a step of editing eukaryotic DNA in vivo or in vitro. In addition, "editing DNA" intends operations exemplified in the following types (including combinations thereof).

In this specification, the DNA used in the above context includes not only DNA present in the cell nucleus, but also DNA present outside the cell nucleus such as mitochondrial DNA, and foreign DNA.
1. Cuts the DNA strand at the target site.
2. Deletion of bases in the DNA strand at the target site.
3. A base is inserted into the DNA strand at the target site.
4. It replaces the bases of the DNA strand at the target site.
5. It modifies the bases of the DNA strand at the target site.
6. Regulates transcription of DNA (genes) at target sites.

One embodiment of the CRISPR-Cas3 system of the present invention utilizes proteins with enzymatic activity to modify target DNA in ways other than introducing DNA breaks. This aspect can be achieved, for example, by fusing Cas3 or Cascade with a heterologous protein having the desired enzymatic activity to form a chimeric protein. Therefore, "Cas3" and "cascade" in the present invention also include such fusion proteins. Enzymatic activities of the fused protein include, for example, deaminase activity (e.g., cytidine deaminase activity, adenosine deaminase activity), methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, Including, but not limited to, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, photolyase activity, and glycosylase activity. In this case, since the nuclease activity and helicase activity of Cas3 is not necessarily required, as Cas3, mutants that lack some or all of these activities (e.g., D domain H74A mutant (dnCas3), A K320N mutant of SF2 domain motif 1 (dhCas3) and a double S483A/T485A mutant of SF2 domain motif 3 (dh2Cas3) are available. For example, by using a fusion protein of a mutant and deaminase that has lost some or all of the nuclease activity of Cas3 as a component of the CRISPR-Cas3 system of the present invention, without causing a large deletion at the target site , base substitution enables precise genome editing. Techniques for applying deaminase to the CRISPR-Cas system are known (Nishida K. et al., Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems, Science, DOI: 10. 1126/science.aaf8729, (2016) ), which can be applied to the CRISPR-Cas3 system of the present invention.

In another aspect of the CRISPR-Cas3 system of the invention, it modulates transcription of genes at the binding site of the system without cutting the DNA. This aspect can be achieved, for example, by fusing Cas3 or Cascade with a desired transcriptional regulatory protein to form a chimeric protein. Therefore, "Cas3" and "cascade" in the present invention also include such fusion proteins. Examples of transcription regulatory proteins include, but are not limited to, light-induced transcription factors, small molecule/drug-responsive transcription factors, transcription factors, transcription repressors, and the like. In this case, since the nuclease activity and helicase activity of Cas3 is not necessarily required, as Cas3, mutants that lack some or all of these activities (e.g., D domain H74A mutant (dnCas3), A K320N mutant of SF2 domain motif 1 (dhCas3) and a double S483A/T485A mutant of SF2 domain motif 3 (dh2Cas3) are available. Techniques for applying transcriptional regulatory proteins to the CRISPR-Cas system are known to those skilled in the art.

Also, in the CRISPR-Cas3 system of the present invention, for example, when using a mutant that has deleted some or all of the nuclease activity of Cas3, a protein having other nuclease activity Cas3 or even if fused with the cascade good. Such aspects are also included in the present invention.

It should be noted that, in the CRISPR-Cas3 system of the present invention, using a mutant that has deleted some or all of the nuclease activity of Cas3, in the editing of DNA, when using the activity of other proteins, the present specification "DNA cleaving activity" in the book shall be appropriately read as various activities possessed by the other protein.

DNA editing may also be performed on DNA contained in specific cells within an individual. Such DNA editing can be performed, for example, by targeting specific cells among the cells that constitute individual animals and plants.

The method for introducing molecules that constitute the CRISPR-Cas3 system of the present invention into eukaryotic cells in the form of polynucleotides or expression vectors containing the polynucleotides is not particularly limited. Examples include methods such as electroporation, calcium phosphate, liposomes, DEAE dextran, microinjection, cationic lipid-mediated transfection, electroporation, transduction, and infection with viral vectors. Such methods are described in many standard laboratory manuals, such as "Leonard G. Davis et al., Basic methods in molecular biology, New York: Elsevier, 1986".

The method for introducing the CRISPR-Cas3 system of the present invention into eukaryotic cells in the form of protein is not particularly limited. Examples include electroporation, cationic lipid-mediated transfection, microinjection, and the like.

DNA editing according to the present invention can be applied to various fields. Applications include, for example, gene therapy, breeding, generation of transgenic animals or cells, production of useful substances, life science research, and the like.

A known method can be used as a method for producing a non-human individual from cells. Germ cells or pluripotent stem cells are usually used to generate non-human individuals from cells in animals. For example, a molecule that constitutes the CRISPR-Cas3 system of the present invention is introduced into an oocyte, and the resulting oocyte is then transplanted into the uterus of a female non-human mammal in a pseudopregnant state, and then a offspring is produced. obtain. Transplantation can be performed with fertilized eggs of 1-, 2-, 4-, 8-, 16-, or morula stage embryos. Oocytes can be cultured under suitable conditions until implantation, if desired. Oocyte transplantation and culture can be performed based on conventionally known techniques (Nagy A. et al., Manipulating the Mouse Embryo. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, 2003). Progeny or clones in which the desired DNA is edited can also be obtained from the obtained non-human individuals.

In plants, it has long been known that the somatic cells thereof have totipotency, and in various plants, methods for regenerating plant bodies from plant cells have been established. Therefore, for example, by introducing a molecule that constitutes the CRISPR-Cas3 system of the present invention into a plant cell and regenerating the plant body from the obtained plant cell, a plant body in which the desired DNA is knocked in can be obtained. . Progeny, clones, or propagation material in which the desired DNA has been edited can also be obtained from the resulting plant. As a method for redifferentiating plant tissues by tissue culture to obtain individuals, a method established in this technical field can be used (transformation protocol [Plants], Yutaka Tabei, edited by Kagaku Dojin, pp. 340- 347 (2012)).

[2] Kit used in the CRISPR-Cas3 system The kit used in the CRISPR-Cas3 system of the present invention includes the following (A) and (B).

(A) a Cas3 protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide; and (B) a cascade protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide, further crRNA, A polynucleotide encoding the crRNA or an expression vector containing the polynucleotide may be included.

The constituent elements of the kit of the present invention may be mixed in whole or in part, or may be independent of each other.

The kit of the present invention can be used, for example, in fields such as pharmaceuticals, foods, livestock, fisheries, industry, bioengineering, and life science research.

Hereinafter, the kit of the present invention will be described assuming a pharmaceutical (medicine). When the above kit is used in fields such as animal husbandry, bioengineering, and life science research, it can be implemented by appropriately replacing the following description based on common technical knowledge in the field.

Using the CRISPR-Cas3 system of the present invention, pharmaceuticals for editing the DNA of animal cells, including humans, can be prepared by conventional methods. More specifically, the molecules constituting the CRISPR-Cas3 system of the present invention can be prepared by, for example, compounding them with pharmaceutical additives.

The term "pharmaceutical excipients" as used herein means substances other than active ingredients contained in pharmaceuticals. Pharmaceutical excipients are substances contained in pharmaceuticals for purposes such as facilitating formulation, stabilizing quality, and enhancing usefulness. In one example, the pharmaceutical excipients include excipients, binders, disintegrants, lubricants, fluidizers (anti-solidification agents), colorants, capsule shells, coating agents, plasticizers, flavoring agents, sweeteners, Flavoring agents, solvents, solubilizers, emulsifiers, suspending agents (adhesives), thickening agents, pH adjusters (acidifying agents, alkalinizing agents, buffering agents), wetting agents (solubilizing agents), antibacterial agents preservatives, chelating agents, suppository bases, ointment bases, hardeners, softeners, medical waters, propellants, stabilizers, preservatives. These excipients can be readily selected by those skilled in the art according to the intended dosage form and route of administration and standard pharmaceutical practice.

In addition, pharmaceuticals for editing animal cell DNA using the CRISPR-Cas3 system of the present invention may contain additional active ingredients. The further active ingredient is not particularly limited and can be appropriately designed by those skilled in the art.

Specific examples of the active ingredients and pharmaceutical additives described above can be known, for example, from standards established by the US Food and Drug Administration (FDA), the European Medicines Agency (EMA), and the Ministry of Health, Labor and Welfare of Japan.

Methods for delivering pharmaceuticals to desired cells include, for example, viral vectors that target the cells (adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, Sendai viral vectors, etc.), A method using an antibody or the like can be mentioned. Pharmaceuticals can take any dosage form depending on the purpose. In addition, the above pharmaceuticals are appropriately prescribed by doctors or medical professionals.

Preferably, the kit of the present invention further comprises instructions for use.

EXAMPLES The present invention will be described in more detail below with reference to examples, but the present invention is not limited only to the following examples.

A. Establishment of CRISPR-Cas3 system in eukaryotic cells [Materials and methods]
[1] Preparation of Reporter Vector Containing Target Sequence The target sequences were the human CCR5 gene-derived sequence (SEQ ID NO: 19) and the E. coli CRISPR spacer sequence (SEQ ID NO: 22).

A synthetic polynucleotide (SEQ ID NO: 20) containing the target sequence (SEQ ID NO: 19) from the human CCR5 gene and a synthetic sequence complementary to said target sequence (SEQ ID NO: 19) for inserting the target sequence into a vector A polynucleotide (SEQ ID NO: 21) was provided. Similarly, a synthetic polynucleotide (SEQ ID NO: 23) comprising a target sequence (SEQ ID NO: 22) derived from the spacer sequence of E. coli CRISPR, and a synthetic polynucleotide (SEQ ID NO: 22) comprising a sequence complementary to the target sequence (SEQ ID NO: 22) (sequence No. 24) was prepared. All of the above synthetic polynucleotides were obtained from Hokkaido System Science Co., Ltd.

The above polynucleotides were synthesized according to [Sakuma T et al. (2013) Efficient TALEN construction and evaluation methods for human cells and animal applications, Genes to Cells, Vol. 18 (Issue 4), pp. 315-326] into a reporter vector. The outline is as follows. First, polynucleotides having sequences complementary to each other (polynucleotide of SEQ ID NO: 20 and polynucleotide of SEQ ID NO: 21; polynucleotide of SEQ ID NO: 23 and polynucleotide of SEQ ID NO: 24) were heated at 95°C for 5 minutes. , then cooled to room temperature and allowed to hybridize. A block incubator (BI-515A, Astec) was used for the above steps. Next, the polynucleotide hybridized to form a double-stranded structure was inserted into a base vector to form a reporter vector.

The sequences of the prepared reporter vectors are shown in SEQ ID NO: 31 (reporter vector containing target sequence derived from human CCR5 gene) and SEQ ID NO: 32 (reporter vector containing target sequence derived from E. coli CRISPR spacer sequence). In addition, the structure of the reporter vector is shown in FIG. 4(d).

[2] Preparation of Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, Cas7 and crRNA expression vectors [Insert amplification and preparation]
Polynucleotides with modified base sequences encoding Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6 and Cas7 (SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively) ), first, the polynucleotide linked in the order of SEQ ID NO: 2-SEQ ID NO: 3-SEQ ID NO: 6-SEQ ID NO: 4-SEQ ID NO: 5 in the order of Cse1 (Cas8)-Cse2 (Cas11)-Cas7-Cas5-Cas6 , and polynucleotides in which nucleotide sequences encoding each of them are ligated) were contracted to Genscript and obtained. Cse1 (Cas8) -Cse2 (Cas11) -Cas7-Cas5-Cas6 between the nucleotide sequences encoding each protein, 2A peptide (amino acid sequence: GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 58)) was linked.

The nucleotide sequence encoding the 2A peptide was slightly different depending on the Cas protein junction, and was as follows. Sequence between Cse1 (Cas8) and Cse2 (Cas11): GGAAGCGGAGCAACCAACTTCAGCCTGCTGAAGCAGGCCGGCGATGTGGAGGAGAATCCAGGCCCC (SEQ ID NO: 59). Sequence between Cse2 (Cas11) and Cas7: GGCTCCGGCGCCACCAATTTTTCTCTGCTGAAGCAGGCAGGCGATGTGGAGGAGAACCCAGGACCT (SEQ ID NO: 60). Sequence between Cas7 and Cas5: GGATCTGGAGCCCACCAATTTCAGCCTGCTGAAGCAAGCAGGCGACGTGGAAGAAAAACCCAGGACCA (SEQ ID NO: 61). Sequence between Cas5 and Cas6: GGATCTGGGGCTACTAATTTTTCTCTGCTGAAGCAAGCCGGCGACGTGGAAGAGAATCCAGGACCG (SEQ ID NO: 62).

Then, each polynucleotide was amplified under the PCR conditions (primers and time course) shown in the table below. 2720 Thermal cycler (applied biosystems) was used for PCR.

A polynucleotide having the following complementary sequence was obtained as a polynucleotide having a base sequence for expressing crRNA.
1. Polynucleotides for expressing crRNA corresponding to sequences derived from the human CCR5 gene (SEQ ID NOs: 25 and 26, obtained from Hokkaido System Science)
2. Polynucleotides for expressing crRNA corresponding to the spacer sequence of CRISPR of E. coli (SEQ ID NOs: 27 and 28, obtained from Hokkaido System Science Co., Ltd.)
3. Polynucleotides for expressing crRNAs corresponding to sequences from the human EMX1 gene (SEQ ID NOS:29 and 30, obtained from Fasmac).

[Ligation and transformation]
As a base plasmid, pPB-CAG-EBNXN (provided by Sanger Center) was used. In NEB buffer, 1.6 μg of the base plasmid, 1 μl of restriction enzyme BglII (New England Biolabs) and 0.5 μl of XhoI (New England Biolabs) were mixed and reacted at 37° C. for 2 hours. The cleaved base plasmid was purified using a Gel extraction kit (Qiagen).

The base plasmid prepared in this manner and the insert were ligated using the Gibson Assembly system. The ligation was carried out according to the protocol of the Gibson Assembly system so that the ratio of the base plasmid to the insert was 1:1 (at 50° C. for 25 minutes, the total volume of the reaction solution: 8 μL).

Then, using 6 μL of the plasmid solution (ligation reaction solution) obtained above and competent cells (prepared by Takeda Laboratory), transformation was performed by a conventional method.

After that, the plasmid vector was purified from the transformed Escherichia coli by the alkaline prep method. Briefly, the plasmid vector was recovered using QIAprep Spin Miniprep Kit (Qiagen), purified by ethanol precipitation, and then adjusted to a concentration of 1 µg/µL in TE buffer. .

The structure of each plasmid vector is shown in (a) to (c) of FIG. In addition, the base sequences of the pre-crRNA expression vector are SEQ ID NO: 33 (expression vector for expressing crRNA corresponding to the sequence derived from the human CCR5 gene), SEQ ID NO: 34 (expressing crRNA corresponding to the spacer sequence of CRISPR of E. coli) expression vector) and SEQ ID NO: 35 (expression vector expressing crRNA corresponding to sequence derived from human EMX1 gene).

[3] Preparation of Cas3 expression vector A polynucleotide having a modified base sequence encoding Cas3 (SEQ ID NO: 1) was obtained from Genscript. Specifically, a pUC57 vector incorporating the above polynucleotide was obtained from Genscript.

The above vector was cleaved with restriction enzyme NotI. Next, 2U of Klenow Fragment (Takara Bio Inc.) and 1 μL of 2.5 mM dNTP Mixture (Takara Bio Inc.) were used to smooth the stump of the fragment. The fragment was then purified using Gel extraction (Qiagen). The purified fragment was further cleaved with restriction enzyme XhoI and purified using Gel extraction (Qiagen).

The purified fragment was ligated using a base plasmid (pTL2-CAG-IRES-NEO vector, produced by Takeda Laboratory) and a ligation kit (Mighty Mix, Takara Bio Inc.). ligated. Then, transformation and purification were performed by the same procedure as [2]. The recovered plasmid vector was adjusted to a concentration of 1 μg/μL in TE buffer.

[4] Preparation of plasmid vector containing BPNLS Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6 and Cas7 expression vectors were prepared by ligating BPNLS to the 5' and 3' ends (see FIG. 7 reference).

Thermo Fisher Scientific was commissioned to generate inserts for each Cas protein group containing BPNLS at both ends. The specific sequence of the insert is (AGATCTTAATACGACTCACTATAGGGAGAGCCGCCACCATGGCC: SEQ ID NO: 56)-(any one of SEQ ID NOS: 7-12)-(TAATATCCTCGAG: SEQ ID NO: 57). SEQ ID NO: 56 is a sequence with a BgIII cleavage site. SEQ ID NO: 57 is a sequence with an XhoI cleavage site.

The pMK vector containing the above sequence was cleaved with restriction enzymes BgIII and XhoI and purified using Gel extraction (Qiagen). The purified fragment was ligated using a base plasmid (pPB-CAG-EBNXN, provided by Sanger Center) and a ligation kit (Mighty Mix, Takara Bio Inc.). Then, transformation and purification were performed by the same procedure as [2]. The recovered plasmid vector was adjusted to a concentration of 1 μg/μL in TE buffer.

[5] Preparation of plasmid vector containing cascade (2A) Cse1 (Cas8), Cse2 (Cas11), Cas7, Cas5 and Cas6 were linked in this order to prepare an expression vector having a nucleotide sequence. More specifically, (NLS-Cse1 (Cas8): SEQ ID NO: 2) -2A- (NLS-Cse2 (Cas11): SEQ ID NO: 3) -2A- (NLS-Cas7: SEQ ID NO: 6) -2A- (NLS An expression vector arranged in the order of -Cas5: SEQ ID NO: 4) -2A- (NLS-Cas6: SEQ ID NO: 5) was produced (see FIG. 8). The amino acid sequence of NLS is PKKKRKV (SEQ ID NO: 52), and the base sequence is CCCAAGAAGAAGCGGAAGGTG (SEQ ID NO: 53). The amino acid sequence of 2A peptide is GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 58) (corresponding base sequences are SEQ ID NOS: 59-62, respectively).

A polypeptide having the nucleotide sequence described above was obtained from GenScript. The pUC57 vector containing the above sequence was cleaved with restriction enzyme EcoRI-HF and purified using Gel extraction (Qiagen). The purified fragment was ligated using a base plasmid (pTL2-CAG-IRES-Puro vector, produced by Takeda Laboratory) and a ligation kit (Mighty Mix, Takara Bio Inc.). Then, transformation and purification were performed by the same procedure as [2]. The recovered plasmid vector was adjusted to a concentration of 1 μg/μL in TE buffer.

[Example A-1]
Modified base sequence, Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6 and Cas7 added with a nuclear localization signal, and crRNA HEK (human embryonic kidney) to express 293T cells, exogenous DNA of Target sequence cleavage activity was assessed.

HEK293T cells were cultured in 10 cm dishes prior to transfection. HEK293T cells were cultured in EF medium (GIBCO) at 37° C. in a 5% CO ₂ atmosphere. The density of HEK293T cells in EF medium was adjusted to 3×10 ⁴ /100 μL.

In addition, the above reporter vector 100 ng; Cas3 plasmid, Cse1 (Cas8) plasmid, Cse2 (Cas11) plasmid, Cas5 plasmid, Cas6 plasmid, Cas7 plasmid and crRNA plasmid each 200 ng; pRL-TK vector (capable of expressing Renilla luciferase, Promega) ); and 300 ng of pBluescriptII KS(+) vector (Agilent Technologies) were mixed in 25 μL of Opti-MEM (Thermo Fisher Scientific). The condition using a reporter vector having a CCR5-derived target sequence as the reporter vector corresponds to 1 in FIG. 1, and the condition using a reporter vector having a CRISPR spacer sequence of E. coli corresponds to 10 in FIG.

1.5 μL of Lipofectamine2000 (Thermo Fisher Scientific) and 25 μL of OptiMEM (Thermo Fisher Scientific) were mixed and incubated at room temperature for 5 minutes. After that, the above plasmid+OptiMEM mixture and Lipofectamine2000+OptiMEM mixture were mixed and incubated at room temperature for 20 minutes. The resulting mixture was mixed with 1 mL of the above EF medium containing HEK293T cells and plated in a 96-well plate (1 well for each vector combination, 12 wells in total).

After culturing for 24 hours at 37° C. in a 5% CO ₂ atmosphere, dual-Luciferase assay was performed according to the protocol of Dual-Glo Luciferase assay system (Promega). Centro XS ³ LB 960 (BERTHOLD TECHNOLOGIES) was used to measure luciferase and renilla luciferase.

As a control experiment, a similar experiment was conducted under the following conditions.
1. Instead of any one of Cas3 plasmid, Cse1 (Cas8) plasmid, Cse2 (Cas11) plasmid, Cas5 plasmid, Cas6 plasmid or Cas7 plasmid, the same amount of pBluescriptII KS (+) vector (Agilent Technologies) was mixed and expressed (2 to 7 in FIG. 1).
2. Instead of the crRNA plasmid used in the above procedure, a plasmid expressing crRNA that is not complementary to the target sequence was mixed. That is, for the target sequence derived from the CCR5 gene, a plasmid that expresses crRNA corresponding to the E. coli CRISPR spacer sequence is mixed (8 in FIG. 1), and when the E. coli CRISPR spacer sequence is targeted, Plasmids expressing crRNA corresponding to sequences derived from the CCR5 gene were mixed and expressed (11 in FIG. 1).
3. As negative controls, only the reporter vector having the CCR5-derived target sequence (9 in FIG. 1) and the reporter vector only having the E. coli CRISPR spacer sequence (12 in FIG. 1) were expressed.

(result)
The results of the dual-Luciferase assay are shown in the upper graph of FIG. 1, and the experimental conditions are shown in the lower table of FIG. In FIG. 1(b), “CCR5-target” and “spacer-target” represent the CCR5-derived target sequence and E. coli CRISPR spacer sequence, respectively. "CCR5-crRNA" and "spacer-crRNA" represent sequences complementary to the above CCR5-target and spacer-target, respectively.

In FIG. 1, the system introduced with all of the Cas3 plasmid, Cse1 (Cas8) plasmid, Cse2 (Cas11) plasmid, Cas5 plasmid, Cas6 plasmid and Cas7 plasmid, and the crRNA plasmid complementary to the target sequence is different from the other systems. Comparatively, they exhibited high cleavage activity (compare 1 with 2-8 and 10 with 11, respectively). Therefore, by using the expression vector according to one embodiment of the present invention, Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6 and Cas7 can be expressed in human cells. rice field.

It was also suggested that introduction of the above expression vector into human cells forms a complex of Cas3, cascade and crRNA in human cells to cleave the target sequence.

Furthermore, comparing 8 and 9, and 11 and 12 in FIG. 1, in the system expressing crRNA that is not complementary to the target sequence, the level of cleavage activity was comparable to that of the negative control. That is, it was suggested that the CRISPR-Cas3 system of the present invention can specifically cleave sequences complementary to crRNA in mammalian cells.

[Example A-2]
An experiment was conducted to evaluate whether endogenous DNA of human cells can be cleaved by the type I CRISPR-Cas system using a method similar to that of Example A-1.

Specifically, modified nucleotide sequences in human cells, expressed Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6 and Cas7 added with a nuclear localization signal, and pre-crRNA, endogenous to the cell It was evaluated whether sequences of the sex CCR5 gene were cleaved.

The same HEK239T cells as in Example A-1 were seeded in a 24-well plate at a density of 1×10 ⁵ cells/well and cultured for 24 hours.

1 μg of Cas3 plasmid, 1.3 μg of Cse1 (Cas8) plasmid, 1.3 μg of Cse2 (Cas11) plasmid, 1.1 μg of Cas5 plasmid, 0.8 μg of Cas6 plasmid, 0.3 μg of Cas7 plasmid, and 1 μg of crRNA plasmid were added to Opti-MEM ( Thermo Fisher Scientific) 50 μL. A mixture of 5 μL Lipofectamine® 2000 (Thermo Fisher Scientific), 50 μL Opti-MEM (Thermo Fisher Scientific), and 1 mL EF medium was then added to the above DNA mixture. 1 mL of the resulting mixture was then added to the 24-well plate.

After culturing for 24 hours at 37° C. in a 5% CO ₂ atmosphere, the medium was replaced with 1 mL of EF medium. 48 hours after transfection (24 hours after medium change), cells were harvested and adjusted to a concentration of 1×10 ⁴ cells/5 μL in PBS.

The cells were heated at 95°C for 10 minutes. Next, 10 mg of proteinase K was added and incubated at 55° C. for 70 minutes. Furthermore, the one heat-treated at 95° C. for 10 minutes was used as a template for PCR.

10 μL of the template was amplified by 35 cycles of 2-step PCR. At this time, primers having sequences of SEQ ID NOS: 47 and 48 were used as PCR primers. KOD FX (Toyobo Co., Ltd.) was used as the DNA polymerase, and the two-step PCR procedure followed the protocol attached to KOD FX. The product amplified by PCR was purified using QIAquick PCR Purification Kit (QIAGEN). Specific procedures followed the protocol attached to the kit.

dA was added to the 3' end of the obtained purified DNA using rTaq DNA polymerase (Toyobo). The purified DNA was subjected to electrophoresis in a 2% agarose gel, and a band of about 500 to 700 bp was excised. DNA was extracted and purified from the excised gel using a Gel extraction kit (QIAGEN). Next, TA cloning was performed using pGEM-T easy vector Systems (Promega) to clone the above DNA. Finally, the cloned DNA was extracted by the alkaline prep method and analyzed by Sanger sequencing. BigDye (registered trademark) Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) and Applied Biosystems 3730 DNA Analyzer (Thermo Fisher Scientific) were used for the analysis.

An outline of the endogenous CCR5 gene sequence targeted by the CRISPR-Cas system in this example is described based on FIG. In FIG. 2, exons are indicated by capital letters and introns are indicated by lower case letters.

In this example, a sequence within the CCR5 gene located in the short arm (P) 21 region of chromosome 3 was targeted (Fig. 2; SEQ ID NO: 46 shows the full length of the base sequence of CCR5). Specifically, the sequence within exon 3 of the CCR5 gene was used as the target sequence. As a control, the Cas9 target sequence was also placed at approximately the same position. That is, the entire underlined sequence is the type I CRISPR-Cas system target sequence (AAG followed by 32 bases), and the double underlined sequence is the Cas9 target sequence (CGG followed by 20 bases). . The sequence of the crRNA was designed to allow guidance of the type I CRISPR-Cas system to the target sequence (AAG followed by 32 bases).

(result)
As a result of the above experiment, compared to the original nucleotide sequence, clone 1 with 401 bp deleted, clone 2 with 341 bp deleted, clone 3 with 268 bp deleted, and 344 bp deleted clone 4 was obtained (FIGS. 3A-D). This indicated that the endogenous DNA of human cells could be deleted by the CRISPR-Cas3 system of the present invention. That is, it was suggested that the CRISPR-Cas system enables editing of human cell DNA.

In this example, clones lacking base pairs were observed. This fact supports that DNA cleavage occurs at multiple sites according to the CRISPR-Cas3 system of the present invention.

Several hundred base pairs (268-401 bp) of DNA were deleted by the CRISPR-Cas3 system of the present invention. This was more extensive than the deletions obtained by the CRISPR-Cas system with Cas9, which usually cuts at only one site on the DNA.

[Example A-3]
An experiment was conducted to assess whether the CRISPR-Cas3 system can cleave endogenous DNA of human cells using a method similar to that of Example A-1.

Specifically, modified nucleotide sequences in human cells, expressed Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6 and Cas7 added with a nuclear localization signal, and pre-crRNA, endogenous to the cell It was evaluated whether sequences of the sex EMX1 gene were truncated.

The same HEK293T cells as in Example A-1 were seeded in a 24-well plate at a density of 1×10 ⁵ cells/well and cultured for 24 hours.

500 ng of Cas3 plasmid, 500 ng of Cse1 (Cas8) plasmid, 1 μg of Cse2 (Cas11) plasmid, 1 μg of Cas5 plasmid, 1 μg of Cas6 plasmid, 3 μg of Cas7 plasmid, and 500 μg of crRNA plasmid were mixed in 50 μL of Opti-MEM (Thermo Fisher Scientific). To the above mixture, 4 μL of Lipofectamine® 2000 (Thermo Fisher Scientific) and 50 μL of Opti-MEM (Thermo Fisher Scientific) were further added and mixed. The resulting mixture was incubated at room temperature for 20 minutes and then added to the HEK293T cells.

Here, the structure of the Cas protein group expression vector used in Example A-3 is shown in FIG. As shown in FIG. 7, the expression vector is obtained by flanking the sequence encoding the Cas protein group with BPNLS (bipartite NLS) ([Suzuki K et al. (2016) In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration, Nature, Vol.540 (Issue 7631), pp.144-149]). BPNLS has an amino acid sequence of KRTADGSEFESPKKKRKVE (SEQ ID NO: 54) and a base sequence of AAGCGGACTGCTGATGGCAGTGAATTTGAGTCCCCAAAGAAGAAGAGAAAGGTGGAA (SEQ ID NO: 55).

After the HEK293T cells were cultured at 37° C. in a 5% CO ₂ atmosphere for 24 hours, the medium was replaced with 1 mL of EF medium (1 mL per well). 48 hours after transfection (24 hours after medium change), cells were harvested and adjusted to a concentration of 1×10 ⁴ cells/5 μL in PBS.

The cells were heated at 95°C for 10 minutes. Next, 10 mg of proteinase K was added and incubated at 55° C. for 70 minutes. Furthermore, the one heat-treated at 95° C. for 10 minutes was used as a template for PCR.

10 μL of the template was amplified by 40 cycles of 3-step PCR. At this time, primers having sequences of SEQ ID NOS: 50 and 51 were used as PCR primers. Hotstartaq (QIAGEN) was used as the DNA polymerase, and the procedure of 3-step PCR followed the protocol attached to Hotstartaq. The product amplified by PCR was subjected to electrophoresis in a 2% agarose gel, and a band of about 900 to 1100 bp was excised. DNA was extracted and purified from the excised gel using a Gel extraction kit (QIAGEN). . Specific procedures followed the protocol attached to the kit.

Next, TA cloning was performed using pGEM-T easy vector Systems (Promega) to clone the above DNA. Finally, the cloned DNA was extracted by the alkaline prep method and analyzed by Sanger sequencing. BigDye (registered trademark) Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) and Applied Biosystems 3730 DNA Analyzer (Thermo Fisher Scientific) were used for the analysis.

A summary of the endogenous EMX1 gene sequence targeted by the CRISPR-Cas3 system in Example A-3 is provided based on FIG. In FIG. 5, exons are indicated by capital letters and introns are indicated by lower case letters.

In Example A-3, a sequence within the EMX1 gene located in the short arm (P) 13 region of chromosome 2 was targeted (FIG. 5; SEQ ID NO: 49 shows the full-length base sequence of EMX1). Specifically, the sequence within exon 3 of the EMX1 gene was used as the target sequence. As a control, the Cas9 target sequence was also placed at approximately the same position. That is, the more upstream underlined sequence is the type I CRISPR-Cas system target sequence (AAG followed by 32 bases), and the more downstream underlined sequence is the Cas9 target sequence (TGG and 20 bases). The sequence of the crRNA used in Example A-3 was designed to allow guidance to the target sequence (AAG followed by 32 bases) of the CRISPR-Cas3 system.

(result)
As a result of the above experiment, clone 1 with two deletions of 513 bp and 363 bp and clone 2 with 694 bp deletion compared to the original base sequence were obtained (FIGS. 6A and 6B). This experimental result also demonstrated that the CRISPR-Cas3 system of the present invention can delete the endogenous DNA of human cells. That is, it was suggested that the CRISPR-Cas3 system allows editing of human cell DNA.

Further, the double-stranded DNA was cleaved at two or more sites and several hundred base pairs of DNA were deleted, as in Example A-2. Therefore, the results of Example A-3 more strongly support the suggestions obtained from Example A-2.

[Example A-4]
HEK293T cells expressed the CRISPR-Cas3 system, in which the base sequence was modified and the base sequence encoding the cascade protein was linked, and the activity of cleaving the target sequence of exogenous DNA was evaluated.

In Example A-4, 100 ng of reporter vector; 200 ng each of Cas3 plasmid, cascade (2A) plasmid and crRNA plasmid; pRL-TK vector (capable of expressing Renilla luciferase, Promega) 60 ng; 300 ng of vector (Agilent Technologies) was mixed with 25 μL of Opti-MEM (Thermo Fisher Scientific). As the reporter vector, the conditions using a reporter vector having a CCR5-derived target sequence correspond to 1 in (b) of FIG. ) corresponds to 6.

Here, two types of reporter vectors produced in [1] of [Manufacturing Example] (that is, vectors having the structure shown in FIG. 4(d)) were used. As the cascade (2A) plasmid, the expression vector produced in [4] of [Manufacturing Example] (that is, the vector having the structure shown in FIG. 8) was used.

A dual-Luciferase assay was performed in the same manner as in Example A-1, except that the above expression vector was used.

Also, as a control experiment, a similar experiment was conducted under the following conditions.
1. Instead of either Cas3 plasmid or cascade (2A) plasmid, the same amount of pBluscriptII KS(+) vector (Agilent Technologies) was mixed and expressed (2 and 3 in FIG. 9).
2. Instead of the crRNA plasmid used in the above procedure, a plasmid expressing crRNA that is not complementary to the target sequence was mixed. That is, for the target sequence derived from the CCR5 gene, a plasmid that expresses crRNA corresponding to the E. coli CRISPR spacer sequence is mixed (4 in FIG. 9), and when the E. coli CRISPR spacer sequence is targeted, Plasmids expressing gRNAs corresponding to sequences derived from the CCR5 gene were mixed and expressed (7 in FIG. 9).
3. As negative controls, only a reporter vector having a CCR5-derived target sequence (5 in FIG. 9) and only a reporter vector having a spacer sequence of E. coli CRISPR (8 in FIG. 9) were expressed.

(result)
The results of the dual-Luciferase assay are shown in the upper graph of FIG. 9, and the experimental conditions are shown in the lower table of FIG. In FIG. 9, “CCR5-target” and “spacer-target” represent the CCR5-derived target sequence and E. coli CRISPR spacer sequence, respectively. "CCR5-crRNA" and "spacer-crRNA" represent sequences complementary to the above CCR5-target and spacer-target, respectively.

As shown in Figure 9, the system incorporating both the Cas3 and Cascade (2A) plasmids and the crRNA plasmid complementary to the target sequence showed significantly higher cleavage activity compared to the other systems. (compare 1 with 2-5 and 6 with 7-8, respectively). From this, even in a system in which a nucleotide sequence encoding a cascade protein is linked and expressed, according to the CRISPR-Cas system according to one embodiment of the present invention, a sequence complementary to crRNA is generated in mammalian cells. It was suggested that it can be cleaved specifically.

B. Verification of factors affecting genome editing by the CRISPR-Cas3 system in eukaryotic cells [Materials and methods]
[1] Construction of Cas gene and crRNA bpNLS was added to each 5' side and 3' side, Cas3 derived from E. coli K-12 strain and cascade constituent genes (Cse1, Cse2, Cas5, Cas6, Cas7) are designed and cloned into mammalian cells by gene synthesis after codon optimization. These genes are pPB-CAG. It was subcloned downstream of the CAG promoter in the EBNXN plasmid. Cas3 mutants such as H74A (dead nickase; dn), K320N (dead helicase; dh), S483A and T485A double mutants (dead helicase ver.2; dh2) can self-ligate PrimeSTAR MAX PCR products made with For the crRNA expression plasmid, a crRNA sequence having two BbsI restriction enzyme sites at the position of the spacer under the U6 promoter was synthesized. All crRNA expression plasmids were generated by inserting a 32 base pair double stranded oligo of the target sequence into the BbsI restriction enzyme site.

The Cas9-sgRNA expression plasmid, pX330-U6-Chimeric_BB-CBh-hSpCas9, was obtained from Addgene. To design gRNAs, we used the CRISPR web tool, the CRISPR design tool, and/or CRISPRdirect, which predicts unique target sites in the human genome. Target sequences were cloned into the sgRNA scaffold of pX330 according to the Feng Zhang laboratory protocol.

An SSA reporter plasmid containing two BsaI restriction enzyme sites was donated by Professor Suguru Yamamoto of Hiroshima University. The target sequence of the genomic region was inserted at the BsaI site. As a Renilla luciferase vector, pRL-TK (Promega) was obtained. All plasmids were prepared by the midiprep or maxiprep method using the PureLink HiPure Plasmid Purification Kit (Thermo Fisher).

[2] Evaluation of DNA cleaving activity in HEK293T cells SSA assay was performed in the same manner as in Example A in order to detect DNA cleaving activity in mammalian cells. HEK293T cells were cultured in high-glucose Dulbecco's modified Eagle's medium (Thermo Fisher) supplemented with 10% fetal bovine serum at 37° C. under 5% CO ₂ . 0.5×10 ⁴ cells were seeded in wells of a 96-well plate and after 24 hours, Cas3, Cse1, Cse2, Cas7, Cas5, Cas6, crRNA expression plasmids (100 ng each), SSA reporter vector (100 ng), Renilla luciferase vector (60 ng) was transfected into HEK293T cells using lipofectamine2000 and OptiMEM (Life Technologies) following a slightly modified protocol. Twenty-four hours after transfection, a dual-luciferase assay was performed using the Dual-Glo luciferase assay system (Promega) according to the protocol.

[3] Detection of indels in HEK293T cells Cas3, Cse1, Cse2, Cas7, Cas5, Cas6, crRNA expression plasmids (250 ng each) were added 24 hours after seeding 2.5 x 10 ⁴ cells in wells of a 24-well plate. , lipofectamine2000 and OptiMEM (Life Technologies) were used to transfect HEK293T cells according to a slightly modified protocol. Two days after transfection, total DNA was extracted from the harvested cells using Tissue XS kit (Takara-bio) according to the protocol. Target loci were amplified using Gflex (Takara bio) or Quick Taq HS DyeMix (TOYOBO) and electrophoresed on an agarose gel. To detect small insertion/deletion mutations in PCR products, the SURVEYOR Mutation Detection Kit (Integrated DNA Technologies) was used according to the protocol. In TA cloning, pCR4Blunt-TOPO plasmid vector (Life Technologies) was used according to the protocol. BigDye Terminator Cycle Sequencing Kit and ABI PRISM 3130 Genetic Analyzer (Life Technologies) were used for sequence analysis.

To detect a variety of rare mutations, a DNA library of PCR amplification products was prepared using the TruSeq Nano DNA Library Prep Kit (Illumina) and amplicon sequenced on MiSeq (2 x 150 bp) according to Macrogen's standard procedures. rice field. Raw reads of each sample were mapped to hg38 of the human genome by BWA-MEM. Coverage data were visualized with the Integrative Genomics Viewer (IGV) and histograms over target regions were extracted.

Reporter HEK293T cells with mCherry-P2A-EGFP c321C>G for detecting SNP-KI (snip knock-in) in mammalian cells were donated by Professor Shinichiro Nakata. Reporter cells were incubated with 1 μg/ml puromycin. 500 ng of donor plasmid or single-stranded DNA was co-transfected with CRISPR-Cas3 as described above. All cells were harvested 5 days after transfection and subjected to FACS analysis using AriaIIIu (BD). GFP-positive cells were sorted and total DNA was extracted as described above. SNP exchanges in the genome were detected by PCR amplification using HiDi DNA polymerase (myPOLS Biotec).

[4] Detection of Off-Target Site Candidates Off-target candidates of type IE CRISPR were detected in hg38 of the human genome using GGGenome by two different procedures. PAM candidate sequences have been reported (Leenay, RT, et al. Mol. Cell 62, 137-147 (2016), Jung, et al. Mol. Cell. 2017 Jung et al., Cell 170, 35-47 (2017)), AAG, ATG, AGG, GAG, TAG, AAC were selected. Since it has been reported that positions multiple of 6 are not recognized as target sites (Kunne et al., Molecular Cell 63, 1-13 (2016)), in the first approach, 32 of the target sequences excluding these Those with fewer mismatches were selected for the base pairs. In the next approach, perfect matching regions to the PAM 5' end of the target sequence were detected and listed in descending order.

[5] Deep sequencing for off-target analysis For whole genome sequencing, genomic DNA was extracted from transfected HEK293T cells and digested using a Covaris sonicator. A DNA library was prepared using TruSeq DNA PCR-Free LT Library Prep Kit (Illumina), and genome sequencing was performed using HiSeq X (2×150 bp) according to Takara Bio's standard procedures. Raw reads of each sample were mapped to hg38 of the human genome by BWA-MEM and cleaned by the Trimmomatic program. Discordant read pairs and split reads were excluded by samtools and Lumpy-sv, respectively. To detect only large deletions on the same chromosome, the Genome Analysis Toolkit program's BadMateFilter was used to remove read pairs that mapped to different chromosomes. The total number of discordant read pairs or split reads in each 100 kb region was counted with Bedtools, and the error rate with the negative control was calculated. To enrich for off-target candidates prior to sequencing, SureSelectXT custom DNA probes were designed under moderately stringent conditions by SureDesign and manufactured by Agilent Technologies. Target regions were selected as follows. Probes near the target region covered 800 kb upstream and 200 kb downstream of the PAM. Near the off-target region of CRISPR-Cas3, we covered 9 kb upstream and 1 kb downstream of the PAM candidate. In the vicinity of the off-target region of CRISPR-Cas9, 1 kb upstream and downstream of PAM was covered. After preparation of the DNA library using the SureSelectXT reagent kit and custom probe kit, genome sequencing was performed using Hiseq 2500 (2×150 bp) according to Takara Bio's standard procedures. Discordant read pairs and split reads on the same chromosome were excluded as described above. The total number of discordant read pairs or split reads in each 10 kb region was counted with Bedtools, and the error rate with the negative control was calculated.

[Example B-1] Influence of type of crRNA and nuclear localization signal on DNA cleavage activity In Example A, by chance, the crRNA includes pre-crRNA (LRSR; leader sequence-repeat sequence-spacer sequence-repeat sequence). Genome editing in eukaryotic cells was successfully performed using the CRISPR-Cas3 system. Here, the present inventor believes that the reason why genome editing in eukaryotic cells using the CRISPR-Cas3 system has not been successful for many years is that mature crRNA has been used as crRNA. I wondered. Therefore, as crRNA, in addition to pre-crRNA (LRSR), pre-crRNA (RSR; repeat sequence-spacer sequence-repeat sequence) and mature crRNA (5' handle sequence-spacer sequence-3' handle sequence) were prepared and carried out. Genome editing efficiency was verified by the reporter system of Example A (Fig. 10A, B). The nucleotide sequences of pre-crRNA (LRSR), pre-crRNA (RSR) and mature crRNA are shown in SEQ ID NOs: 63, 64 and 65, respectively.

As a result, target DNA cleavage activity was not observed in the CRISPR-Cas3 system using mature crRNA. On the other hand, surprisingly, when pre-crRNA (LRSR, RSR) was used, a very high target DNA cleaving activity was observed. This result in the CRISPR-Cas3 system is in contrast to the CRISPR-Cas9 system where high DNA cleavage activity is observed using mature crRNA. This fact also suggests that one of the main reasons why the CRISPR-Cas3 system has not succeeded in genome editing in eukaryotic cells so far is that mature crRNA has been used.

In addition, as a nuclear localization signal to be added to Cas3, verification was also performed using the SV40 nuclear localization signal and the bipartite nuclear localization signal (Fig. 11). As a result, higher target DNA cleavage activity was observed when the bipartite nuclear localization signal was used.

Therefore, in subsequent experiments, pre-crRNA (LRSR) was used as crRNA, and bipartite nuclear localization signal was used as nuclear localization signal.

[Example B-2] Effect of PAM Sequence on DNA Cleavage Activity In order to confirm the target specificity of the CRISPR-Cas3 system, the effect of various PAM sequences on DNA cleavage activity was examined (Fig. 12). In the SSA assay, different PAM sequences resulted in variable DNA cleavage activity. 5'-AAG PAM showed the highest activity, and AGG, GAG, TAC, ATG and TAG also showed remarkable activity.

[Example B-3] Effect of mismatch between crRNA and spacer sequence on DNA-cleavage activity In previous studies of the crystal structure of the E. coli cascade, a heteroduplex of 5 base segments is formed between crRNA and spacer DNA. It has been shown that this is due to base-pairing disruption at every sixth position by the Cas7 effector thumb element (FIG. 13). The effect of mismatches between crRNA and spacer sequences on DNA cleavage activity was evaluated (Fig. 1g). Any single mismatch in the seed region (positions 1-8) reduced the cleavage activity dramatically, except for bases not recognized as targets (position 6).

[Example B-4] Verification of the requirement of each domain of Cas3 for DNA-cleaving activity In vitro characterization of the catalytic characteristics of the Cas3 protein showed that the N-terminal HD nuclease domain cleaves the single-stranded region of the DNA substrate. Subsequently, it was revealed that the C-terminal SF2 helicase domain unwinds from the 3' to 5' direction on the target DNA in an ATP-dependent manner. Three Cas3 mutants, namely the HD domain H74A mutant (dnCas3), the SF2 domain motif 1 K320N mutant (dhCas3), and the SF2 domain motif 3 S483A/T485A double mutant (dh2Cas3) generated to verify whether the Cas3 domain is required for DNA cleavage (Figure 14). As a result, all three Cas3 protein mutants completely lost the DNA-cleaving activity, indicating that Cas3 can cleave target DNA through the HD nuclease domain and the SF2 helicase domain.

[Example B-5] Verification of DNA cleavage activity in various types of CRISPR-Cas3 systems Type 1 CRISPR-Cas3 systems are highly diversified (7 types of type 1 A to G). In the above example, the DNA cleavage activity in eukaryotic cells in the type I-E CRISPR-Cas3 system was verified, but in this example, other type 1 CRISPR-Cas3 systems (type I-F and type IG) was verified for DNA cleavage activity. Specifically, type IF Shewanella putrefaciens Cas3, Cas5-7, and type IG Pyrococcus furiosus Cas5-8 were codon-optimized and cloned (FIG. 15). As a result, in the SSA assay using 293T cells, these type 1 CRISPR-Cas3 systems also exhibited DNA cleavage activity, although there was a difference in the strength of the DNA cleavage activity.

[Example B-6] Verification of mutations introduced into endogenous genes by CRISPR-Cas3 system Mutations introduced into endogenous genes by the CRISPR-Cas3 system were verified using the type IE system. The EMX1 gene and the CCR5 gene were selected as target genes and a pre-crRNA (LRSR) plasmid was prepared. Lipofection of 293T cells with pre-crRNA and plasmids encoding six Cas (3,5-8,11) effectors revealed that CRISPR-Cas3 caused deletions of hundreds to thousands of base pairs, mainly in the spacer sequence of the target region. was found to occur in the upstream direction of the 5' PAM of . A 5-10 base pair microhomology at the repaired junction can be identified and may have occurred due to annealing of complementary strands by an annealing-dependent repair pathway. In the mature crRNA plasmid, no genome editing was observed in the EMX1 and CCR5 regions.

To better characterize genome editing by Cas3 by TA cloning and Sanger sequencing of PCR products, 96 TA clones were picked and compared by sequencing with the sequence of wild-type EMX1 (Fig. 17). Of the 49 clones in which sequence insertion could be confirmed, 24 clones showed a minimum deletion of 596 base pairs, a maximum deletion of 1447 base pairs, and an average deletion of 985 base pairs (46.3% efficiency). Half of the clones (n=12) had a large deletion involving the PAM and spacer sequences, and the other half had a deletion upstream of the PAM.

Further Cas3 characterization was performed by next-generation sequencing on PCR amplification products with primer sets in broader regions of the EMX1 gene, 3.8 kb, and CCR5, 9.7 kb. We also validated multiple PAM sites (AAG, ATG, TTT) for targeting with Type IE CRISPR. Amplicon sequencing showed 38.2% for AAG and 56.4% for ATG, indicating extensive upstream PAM sites compared to 86.4% for TTT and 86.4% for Cas9 targeting EMX1. The coverage rate in the genomic region was greatly reduced. The reduction in coverage was similar when targeting the CCR5 region. In contrast, Cas9 induced small insertions, small deletions (indels) at the target site, while Cas3 had no PAM or small indel mutations at the target site. These results suggested that the CRISPR-Cas3 system causes deletion in a broad region upstream of the target site in human cells.

Given the limitations of PCR analysis, such as amplifications <10 kb and strong bias in favor of shorter PCR fragments, we utilized microarray-based capture sequencing of >1000 kb around the targeted EMX1 and CCR5 loci (Fig. 18A,B). . Deletions of up to 24 kb at the EMX1 locus and up to 43 kb at the CCR5 locus were observed, whereas 90% of EMX1 and 95% of CCR5 mutations were <10 kb. These results suggested that the CRISPR-Cas3 system could also have potent nuclease and helicase activity in the eukaryotic genome.

It should be noted that the ability to induce unwanted off-target mutations in non-targeted genomic regions, as shown in the CRISPR-Cas9 system, is a major concern, especially for clinical applications, whereas in the CRISPR-Cas3 system, significant off-target No effect was seen.

Since the CRISPR-Cas3 system of the present invention can edit the DNA of eukaryotic cells, fields where genome editing is required, such as medicine, agriculture, forestry and fisheries, industry, life sciences, bioengineering, gene therapy, etc. It can be widely used in the field.

Claims (9)

A method for producing DNA-edited eukaryotic cells (but excluding cells existing in the human body, human germ cells, and human embryonic cells) or animals (but excluding humans), comprising: CRISPR-Cas3 capable of editing DNA in eukaryotic cells or in animals, in cells (but excluding cells in the human body, human germ cells, and human embryonic cells) or animals (but excluding humans) A method comprising introducing a system, wherein the CRISPR-Cas3 system includes the following (A) to (C) (however, when the CRISPR-Cas3 system is type ID, eukaryotic cells are mammalian cells and the animal is a mammal).
(A) a Cas3 protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide;
(B) a cascade protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide, and (C) a pre-crRNA, a polynucleotide encoding said crRNA, or an expression vector comprising said polynucleotide A method for producing a DNA-edited plant, comprising introducing into the plant a CRISPR-Cas3 system capable of editing DNA in the plant, wherein the CRISPR-Cas3 system performs the following (A) to (C) Methods including, except when the CRISPR-Cas3 system is type ID.
(A) a Cas3 protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide;
(B) a cascade protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide, and (C) a pre-crRNA, a polynucleotide encoding said crRNA, or an expression vector comprising said polynucleotide 3. The method according to claim 1 or 2, comprising the step of cleaving the crRNA by proteins that make up the cascade protein after introducing the CRISPR-Cas3 system into eukaryotic cells , animals, or plants . The method according to any one of claims 1 to 3, wherein a nuclear localization signal is added to Cas3 protein and/or cascade protein. 5. The method of claim 4, wherein the nuclear localization signal is a bipartite nuclear localization signal. A kit for use in the production of DNA-edited eukaryotic cells or animals, comprising the following (A) to (C) constituting a CRISPR-Cas3 system capable of editing DNA in eukaryotic cells or animals (wherein the eukaryotic cell is a mammalian cell and the animal is a mammal if the CRISPR-Cas3 system is type ID).
(A) a Cas3 protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide;
(B) a cascade protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide; and (C) a pre-crRNA, a polynucleotide encoding said crRNA, or an expression vector comprising said polynucleotide A kit for use in producing a DNA-edited plant, comprising the following (A) to (C) constituting a CRISPR-Cas3 system capable of editing DNA in a plant (however, the CRISPR-Cas3 system is type ID).
(A) a Cas3 protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide;
(B) a cascade protein, a polynucleotide encoding said protein, or an expression vector comprising said polynucleotide; and (C) a pre-crRNA, a polynucleotide encoding said crRNA, or an expression vector comprising said polynucleotide The kit according to claim 6 or 7, wherein a nuclear localization signal is added to Cas3 protein and/or cascade protein. 9. The kit of claim 8, wherein the nuclear localization signal is a bipartite nuclear localization signal.

Images