JP7239965B2 - A determination method for determining the presence or absence of two or more specific oligonucleotides, and a method for determining that a test subject suffers from or is at risk of small cell lung cancer or bile duct cancer using the determination method - Google Patents

Description

The present invention provides a determination method for determining the presence or absence of two or more specific oligonucleotides, and a test subject using the determination method that is suffering from or at risk of small cell lung cancer, cholangiocarcinoma, and diabetes. It relates to a method for determining

Liquid biopsy is known as a method for detecting a specific target oligonucleotide or the like from a bodily fluid sample such as blood. Liquid biopsy is attracting attention as a method for detecting multiple types of oligonucleotides such as microRNAs that are differentially expressed in cancer.

A nanopore analysis technique is known as a technique for detecting specific oligonucleotides. Here, the nanopore analysis technique is a technique for analyzing biomolecules based on changes in current observed when the biomolecules pass through the through-holes of proteins having nano-sized through-holes.

For example, Patent Documents 1 and 2 disclose a nanopore analysis technique using a probe containing a sequence complementary to a target oligonucleotide and having terminal extensions at the 3′ end, 5′ end or both ends. A method for detection of oligonucleotides based on .

Japanese Patent Publication No. 2013-540423 Japanese Patent Publication No. 2017-6135

However, in conventional nanopore analysis techniques, when two or more types of oligonucleotides are targeted for detection, it is difficult to determine the presence or absence of each of these two or more types of oligonucleotides. In particular, it is known that two or more types of oligonucleotides are differentially expressed in cancer, and it is required to simply and accurately determine the presence or absence of two or more types of oligonucleotides. Accordingly, an object of the present invention is to provide a method for easily and accurately determining the presence or absence of two or more specific oligonucleotides.

Specific means for solving the above problems include the following embodiments.

<1> (1) a first step of mixing probes having sequences complementary to two or more specific oligonucleotides with a measurement sample to obtain a mixture;
(2) applying a voltage between a first solution containing the mixture and a second solution separated from each other by a lipid bilayer membrane having nanopores, and a second step of measuring over time the current intensity of the current flowing between to obtain current change data over time;
(3-1) obtaining a plurality of interval times from the current change data over time;
(3-2) performing processing based on the central limit theorem for the plurality of interval times to obtain a frequency distribution;
(3-3) identifying a containing pattern derived from the two or more specific oligonucleotides based on the frequency distribution,
(3-4) a third step of determining the presence or absence of each of the two or more specific oligonucleotides in the measurement sample from the content pattern;
including,
A determination method for determining the presence or absence of two or more specific oligonucleotides.

<2> The determination method according to <1>, wherein the probe is a probe containing all sequences complementary to each of the two or more specific oligonucleotides in one molecule.

<3> The order of the sequences complementary to the two or more specific oligonucleotides in the probe is selected so that the free energy of the complex between the probe and the two or more specific oligonucleotides is the lowest. there is
The determination method according to <2>.

<4> The determination method according to <1>, wherein the probe comprises two or more probes complementary to different specific oligonucleotides.

<5> Between the first step and the second step,
Annealing the mixture,
The determination method according to any one of <1> to <4>.

<6> the specific oligonucleotide is miRNA,
wherein the probe is an oligodeoxyribonucleotide
The determination method according to any one of <1> to <5>.

<7> The probe has a polydeoxycytosine structure at the 3′ end,
The determination method according to any one of <1> to <6>.

<8> The probe has a hairpin structure at the 5′ end,
The determination method according to any one of <1> to <7>.

<9> The third step is
The frequency distribution is the first frequency distribution,
A second frequency distribution obtained by performing the above (3-1) and (3-2) using a solution in which the presence or absence of each of the two or more specific oligonucleotides is known as the measurement sample; comparing the first frequency distribution with
The determination method according to any one of <1> to <8>.

<10> The third step is
Based on the first frequency distribution, further comprising determining the content of each of the two or more specific oligonucleotides in the measurement sample,
The determination method according to <9>.

<11> The third step is
A third frequency distribution obtained by performing the above (3-1) and (3-2) using a solution in which the content of each of the two or more specific oligonucleotides is known as the measurement sample; and , with the first frequency distribution,
The determination method according to <10>.

<12> Equipped with a CPU and a memory,
(3-1A) a first solution and a second solution containing a mixture of a probe having a sequence complementary to two or more specific oligonucleotides and a measurement sample separated from each other by a lipid bilayer membrane having a nanopore; Obtaining a plurality of interval times from current change data over time of the current intensity of the current flowing between the first solution and the second solution obtained by applying a voltage during
(3-2A) obtaining a frequency distribution by performing processing based on the central limit theorem for the plurality of interval times;
(3-3A) identifying a containing pattern derived from the two or more specific oligonucleotides based on the frequency distribution;
(3-4A) determining the presence or absence of each of the two or more specific oligonucleotides in the measurement sample from the content pattern;
A determination device configured to determine the presence or absence of two or more specific oligonucleotides by a process comprising:

<13> (1) A probe having a sequence complementary to two or more specific oligonucleotides that are differentially expressed or not in small cell lung cancer and a sample derived from the test subject are mixed to obtain a mixture. process and
(2) applying a voltage between a first solution containing said mixture and a second solution separated from each other by a lipid bilayer membrane having a nanopore; a second step of measuring over time the current intensity of the current flowing through to obtain current time course data;
(3-1) obtaining a plurality of interval times from the current change data over time;
(3-2) performing processing based on the central limit theorem for the plurality of interval times to obtain a first frequency distribution;
(3-3) By performing (1) to (3-2) using the first frequency distribution and a sample derived from a healthy subject not suffering from small cell lung cancer instead of the sample Third frequency distribution obtained by performing the above (1) to (3-2) using the obtained second frequency distribution and / or a sample derived from a patient suffering from small cell lung cancer and a third step of determining that the test subject suffers from or is at risk for small cell lung cancer by comparing
A method for determining that a test subject has or is at risk of small cell lung cancer.

<14> (1) A first step of obtaining a mixture by mixing probes having sequences complementary to two or more specific oligonucleotides that are or are not differentially expressed in cholangiocarcinoma with a sample derived from a test subject process and
(2) applying a voltage between a first solution containing said mixture and a second solution separated from each other by a lipid bilayer membrane having a nanopore; a second step of measuring over time the current intensity of the current flowing through to obtain current time course data;
(3-1) obtaining a plurality of interval times from the current change data over time;
(3-2) performing processing based on the central limit theorem for the plurality of interval times to obtain a first frequency distribution;
(3-3) By performing the above (1) to (3-2) using the first frequency distribution and a sample derived from a healthy subject not suffering from bile duct cancer instead of the sample The second frequency distribution obtained and/or the third frequency distribution obtained by performing the above (1) to (3-2) using a sample derived from a patient suffering from cholangiocarcinoma and a third step of determining that the test subject suffers from or is at risk of cholangiocarcinoma by comparing
A method for determining that a test subject is suffering from or at risk of bile duct cancer.

<15> A probe having the base sequence of SEQ ID NO:8.

<16> A probe set comprising a probe having the nucleotide sequence of SEQ ID NO:9 and a probe having the nucleotide sequence of SEQ ID NO:10.

According to one aspect of the present invention, it is possible to provide a method for simply and accurately determining the presence or absence of two or more specific oligonucleotides.

1 is a schematic cross-sectional view showing an example of an analysis device used for the nanopore analysis technique according to the present disclosure; FIG. 4 is a graph showing an example of current change data over time in a nanopore analysis technique according to the present disclosure; (A-1) to (C-1) are conceptual diagrams showing examples of interactions between complexes and nanopores in the nanopore analysis technique according to the present disclosure. (A-2) to (C-2) are examples of current change data over time observed in cases (A-1) to (C-1), respectively. 10 is a flow chart showing the steps from obtaining time-varying current data in the first step to obtaining a frequency distribution of averages of a plurality of samples in Example 1. FIG. 4 is a graph showing the frequency distribution of the interval time of each containing pattern for two specific oligonucleotides in each of Example 1 and Comparative Example 1. FIG. 4 is a graph showing the frequency distribution of interval times obtained by processing based on the central limit theorem for each of seven types of inclusion patterns regarding five types of specific oligonucleotides in Example 2. FIG. (A) is a graph showing the frequency distribution of interval times obtained by processing healthy subject samples based on the central limit theorem in Example 3; (B) is a graph showing the frequency distribution of the interval time obtained by processing the cholangiocarcinoma patient samples based on the central limit theorem in Example 3; 1 is a block diagram showing an example of a determination device including a determination device according to the present disclosure in its configuration; FIG.

DETAILED DESCRIPTION OF THE INVENTION Embodiments for carrying out the present invention will be described in detail below. However, the present invention is not limited to the following embodiments. The following embodiments are exemplary, and their constituent elements (including elemental steps, etc.) are not essential unless otherwise specified. The same applies to numerical values and their ranges, which do not limit the present invention. In addition, various changes and modifications by those skilled in the art are possible within the scope of the technical idea of the present disclosure.
In the present disclosure, the numerical range indicated using "-" includes the numerical values before and after "-" as the minimum and maximum values, respectively.
In the numerical ranges described step by step in the present disclosure, the upper limit or lower limit of one numerical range may be replaced with the upper or lower limit of another numerical range described step by step. . Moreover, in the numerical ranges described in the present disclosure, the upper or lower limits of the numerical ranges may be replaced with the values shown in the examples.
In the present disclosure, the term "process" includes a process that is independent of other processes, and even if the purpose of the process is achieved even if it cannot be clearly distinguished from other processes. .
In the present disclosure, each component may contain multiple types of applicable substances. When there are multiple types of substances corresponding to each component, the content of each component means the total content of the multiple types of substances unless otherwise specified.
It will also be apparent to those skilled in the art that the present invention may be practiced without some or all of the specific details described in this disclosure. In other instances, well-known points may not be described or illustrated in detail to avoid obscuring aspects of the invention.
Also, the sizes of the members in the drawings are conceptual, and the relative sizes of the members are not limited thereto. In addition, members having substantially the same functions are given the same reference numerals throughout the drawings, and overlapping explanations may be omitted.

Hereinafter, the determination method for determining the presence or absence of two or more specific oligonucleotides according to the present disclosure will be described in detail.

[Determination method for determining the presence or absence of two or more specific oligonucleotides]
The determination method for determining the presence or absence of two or more specific oligonucleotides according to the present disclosure includes: (1) mixing a probe having a sequence complementary to two or more specific oligonucleotides and a measurement sample to obtain a mixture; and (2) applying a voltage between a first solution containing said mixture and a second solution separated from each other by a lipid bilayer membrane having a nanopore, wherein said first solution and said second A second step of measuring over time the current intensity of the current flowing between the solution and obtaining current change data over time, (3-1) obtaining a plurality of interval times from the current change over time data, (3- 2) performing processing based on the central limit theorem for the plurality of interval times to obtain a frequency distribution, and (3-3) identifying a containing pattern derived from the two or more specific oligonucleotides based on the frequency distribution. and (3-4) a third step of determining the presence or absence of each of the two or more specific oligonucleotides in the measurement sample from the content pattern.

The flow of nanopore analysis technology according to the present disclosure will be described with reference to the drawings.
FIG. 1 shows a schematic cross-sectional view of an example of an analysis device used for the nanopore analysis technique according to the present disclosure. As shown in FIG. 1, this analyzer includes, for example, a nanopore 1N, a lipid bilayer membrane 2, a first solution 3, a second solution 4, a specific oligonucleotide 5A contained in a measurement sample, and 5B, probe 6, and voltage application means 7. FIG. Also, the first solution 3 and the second solution 4 contain electrolytes. The first solution and the second solution are contained within the container. Incidentally, analysis devices used in the nanopore analysis technique include analysis devices disclosed in JP-A-2015-77559, JP-A-2014-10062, and the like.

The first solution 3 and the second solution 4 are separated from each other by a lipid bilayer membrane 2 . The lipid bilayer membrane 2 has nanopores 1N penetrating perpendicularly to the thickness direction of the lipid bilayer membrane 2 . The nanopore 1N has a through hole 1P penetrating perpendicularly to the thickness direction of the lipid bilayer membrane 2 .

A mixture of the probe 6 and the specific oligonucleotides 5A and 5B contained in the measurement sample is contained in the first solution 3 . In the mixture, probe 6 hybridizes with two specific oligonucleotides 5A and 5B at different regions in probe 6 to form complex HYB2.

The voltage applying means 7 is connected to each of the first solution 3 and the second solution 4, and applies a voltage between the first solution 3 and the second solution 4 (that is, via the lipid bilayer membrane 2). can be applied. Although not shown, electrodes are provided at the ends of the voltage applying means 7 connected to the first solution 3 and the second solution 4, respectively. Also, the voltage applying means 7 may be electrically connected to a power source. The voltage applying means 7 may be electrically connected to a voltmeter.

The complex HYB2 penetrates from the first solution 3 into the through-hole 1P of the nanopore 1N and advances toward the second solution 4 by applying a voltage. At this time, the pore size of the through-hole 1P is a pore size through which only a single-stranded oligonucleotide can pass. Therefore, as the complex HYB2 moves in the direction of the second solution 4 in the through-hole 1P by voltage application, the double strand with the specific oligonucleotides 5A and 5B is eliminated, and the single strand of the probe 6 , it advances in the direction of the second solution through the through hole 1P. Finally, the probe 6 moves through the through-hole 1P to the second solution 4. FIG.

The change in current accompanying this nanopore analysis will be described below. For example, when a voltage is applied between the first solution 3 and the second solution 4 by the voltage applying means 7, a current passing through the through-hole 1P is observed. Next, when the complex HYB2 intrudes into the through-hole 1P, passage of current through the through-hole 1P is inhibited, and a decrease in current intensity is observed. Then, when the complex HYB2 that has entered the through-hole 1P dissolves the complex with the specific oligonucleotides 5A and 5B, and the probe 6 passes through the through-hole 1P, the blocked current flows through the through-hole 1P again. , the current intensity rises again. The phenomenon in which the current intensity fluctuates with the behavior of the complex HYB2 in the nanopore 1N is also observed in the probe 6 alone.

FIG. 2 shows a graph representing an example of current change-over-time data in the nanopore analysis technique according to the present disclosure.
As shown in FIG. 2, in the current time course data, the time _T during which the current through the through-hole 1P of the nanopore IN is not inhibited and the time _T during which the current through the through-hole 1P of the nanopore IN is inhibited are Observed. In the nanopore measurement technology of the present disclosure, the time T _C (hereinafter also referred to as “interval time”) during which the current passing through the through-hole 1P of the nanopore IN is inhibited is read from the above-described current change over time data, and The presence or absence of the specific oligonucleotide in the measurement sample is determined by performing processing based on the central limit theorem.

FIGS. 3A-1 to 3C-1 show conceptual diagrams showing examples of interactions between each complex and a nanopore.
FIG. 3 (C-1) shows that all five specific oligonucleotides 5A to 5E hybridize to probe 6 having a sequence complementary to five specific oligonucleotides 5A to 5E to form a complex HYB5. An example of the interaction between nanopore 1N and the complex HYB5. As shown in FIG. 3 (C-1), by applying a voltage, HYB5 that has entered the through hole 1P of the nanopore 1N moves in the direction of the second solution 4 and complexes with the specific oligonucleotides 5A to 5E. is expected to be phased out.

FIG. 3 (B-1) shows a complex HYB3 in which three specific oligonucleotides 5A, 5C and 5E hybridize to a probe 6 having a sequence complementary to five specific oligonucleotides 5A, 5A to 5E. It is an example of the interaction between nanopore 1N and the complex HYB5 when forming . As shown in FIG. 3(B-1), similar to HYB5, HYB3, which has penetrated into the through-hole 1P of the nanopore 1N due to the application of voltage, migrates in the direction of the second solution 4 and moves toward the specific oligonucleotide 5A. It is thought that the combination with ~5E will be gradually eliminated.

FIG. 3 (A-1) shows the case where only one specific oligonucleotide 5E hybridizes to a probe 6 having a sequence complementary to five specific oligonucleotides 5A to 5E to form a complex HYB1. An example of the interaction between nanopore 1N and complex HYB5. As shown in FIG. 3(A-1), by applying voltage, HYB1 that has entered the through-hole 1P of the nanopore 1N moves in the direction of the second solution 4 and dissolves the complex with the specific oligonucleotide 5E. It is thought that it will continue.

When the behaviors of the above complexes HYB5, HYB3 and HYB1 in the nanopore are taken as respective current change data over time, the interval time INT- HYB5 tends to be longer than the interval time INT-HYB3 of HYB3 and the interval time INT-HYB1 of HYB1. Further, the interval time INT-HYB3 of HYB3 tends to be longer than the interval time INT-HYB1 of HYB1 and shorter than INT-HYB5. That is, the interval time tends to be influenced by the combination of complexes formed by probes 6 . In addition, the interval time tends to become longer as the number of specific oligonucleotides complexed with the probe 6 increases. Here, the specific oligonucleotide refers to an oligonucleotide to be measured that is complexed with the probe 6, and its sequence is not particularly limited.

However, in practice, the difference in these interval times can be read directly from the current time course data as shown in FIGS. is difficult to determine. Factors for this include, for example, 1) the interval time tends to vary even for the same complex (HYB5, etc.), and 2) the difference in the interval time between different complexes is visually observed with respect to the above variation. , etc., and thus the observed intervals cannot be assigned with sufficient reliability as interval times unique to each specific oligonucleotide.

On the other hand, the determination method according to the present disclosure can easily and accurately determine the presence or absence of each of two or more specific oligonucleotides. Specifically, in the determination method according to the present disclosure, for example, statistical processing based on the central limit theorem is performed on a plurality of interval times obtained from the current change data over time obtained by the above-described method. By processing based on this central limit theorem, even if there is a variation in the interval time in the original current change data over time, it is possible to obtain a frequency distribution with a narrow distribution as a normal distribution. As a result, even if the difference in interval time between different complexes such as HYB2 and HYB5 is small, assignment can be made with sufficient reliability based on a normal distribution with greatly reduced variability. In other words, it facilitates determination of the difference in the interval time attributed to each complex. Thereby, the presence or absence of each of the two or more specific oligonucleotides in the measurement sample can be easily and accurately determined.

Each step will be described in detail below.

(First step)
A determination method according to the present disclosure includes a first step.
In the first step, probes having sequences complementary to two or more specific oligonucleotides and a measurement sample are mixed to obtain a mixture.

A measurement sample according to the present disclosure may or may not contain a specific oligonucleotide. By using the determination method according to the present disclosure for a measurement sample, the presence or absence of each of two or more specific oligonucleotides in the measurement sample can be determined.

The measurement sample may be solid or liquid. When the sample to be measured is solid, it is preferable to use a diluent obtained by suspending, dispersing or dissolving the solid in a solution medium. The solution medium is not particularly limited, and examples thereof include water, buffer solutions, and the like.

Examples of measurement samples include samples derived from test subjects such as humans and non-human animals (mammals other than humans).
Examples of the sample derived from the subject to be examined include a specimen derived from a living body. Specimens derived from a living body are not particularly limited, and include urine, blood, saliva, and the like. Blood samples include, for example, red blood cells, whole blood, serum, and plasma.
The sample obtained from the test subject may be liquid or solid. For example, an undiluted sample obtained from a test subject may be used as it is, or a diluted solution obtained by suspending, dispersing, or dissolving the sample in a medium may be used. When the sample obtained from the test subject is solid, it is preferable to use, as the liquid sample, a diluted solution obtained by suspending, dispersing, or dissolving the sample in a solution medium. The solution medium is not particularly limited, and examples thereof include water, buffer solutions, and the like. The liquid specimen thus obtained can be used as the first solution, or added to the first solution in the determination method described above.

The concentration ratio between each specific oligonucleotide and the probe is not particularly limited, and may be appropriately set according to the concentration of the measurement sample. For example, when a specific oligonucleotide is contained in a measurement sample, from the viewpoint of favorably forming a complex between the specific oligonucleotide and the probe, the concentration ratio between each specific oligonucleotide and the probe is 1/20 or more. It is preferably 50,000,000/1 or less, more preferably 1/10 or more and 5,000,000/1 or less, and even more preferably 1/2 or more and 500,000/1 or less.

A specific oligonucleotide represents an oligonucleotide having a specific sequence to be detected.

The specific oligonucleotide is preferably a single-stranded oligonucleotide because it easily hybridizes with the probe to form a complex. For example, a single-stranded oligonucleotide that is differentially expressed or not depending on the presence or absence of a specific disease, that is, an oligonucleotide whose expression is differential with respect to the presence or absence of a specific disease, may be selected as a measurement sample. good.

The specific oligonucleotide is preferably a single-stranded nucleotide having a base length of 15 or more and 30 or less. The single-stranded nucleotide having a base length of 15 or more and 30 or less may be, for example, single-stranded DNA or single-stranded RNA such as microRNA (miRNA). Among the above, the specific oligonucleotide is preferably miRNA, for example, from the viewpoint of determining morbidity or risk of morbidity with a particular disease. When the specific oligonucleotide is miRNA, the probe can be an oligodeoxyribonucleotide having a sequence complementary to miRNA.

The probes according to the present disclosure are not particularly limited as long as they are single-stranded polynucleotides having sequences complementary to two or more specific oligonucleotides. Probes may contain sequences other than those complementary to a particular oligonucleotide.

A “complementary sequence” represents a sequence having a predetermined degree or more of complementarity to the entire length of each specific oligonucleotide sequence in the measurement sample.

The complementarity of the probe to each of the two or more specific oligonucleotides is not particularly limited as long as the probe and the two or more specific oligonucleotides can hybridize to form a complex. For example, the probe may contain a sequence having 80% or more complementarity, 90% or more complementarity, or 95% or more complementarity to the sequence of each specific oligonucleotide. A sequence having complementarity may be included, and a sequence having 100% or more complementarity (that is, a sequence completely complementary to the entire length of the specific oligonucleotide) may be included. Alternatively, the probes may contain up to 5 base additions, deletions or substitutions to the perfectly complementary sequence of each specified oligonucleotide. The number of added, deleted or substituted bases of the probe to the sequence completely complementary to each specific oligonucleotide is preferably 3 or less, more preferably 1 or less, and still more preferably 0.

From the viewpoint of reducing non-specific hybridization and increasing the efficiency of specific hybridization, the probe preferably has a sequence completely complementary to each base sequence of each specific oligonucleotide.

By using a probe having a sequence completely complementary to each base sequence of each specific oligonucleotide, for example, for a plurality of complexes with different numbers of specific oligonucleotides hybridized to the probe, at each interval time , can make a difference.

The kind of probe may be one kind or a plurality of kinds.
When the type of probe is one, the probe has sequences complementary to two or more specific oligonucleotides in different regions.

A probe may consist of two or more probes each complementary to a different specific oligonucleotide. When there are two or more types of probes, it is not necessary for one probe to contain all of the two or more sequences complementary to the two or more specific oligonucleotides, and the probes complementary to each specific oligonucleotide are Any one or more of two or more types of probes may contain it. For example, two or more probes having sequences complementary to specific oligonucleotides with different sequences may be used. In this case, the number of types of probes to be used can be the number of types of target specific oligonucleotides. Moreover, when two or more probes are used, the probes may be modified with polyethylene glycol or the like, if necessary, in order to adjust the difference in interval time due to each probe.

The probe may be a probe containing all sequences complementary to each of the two or more specific oligonucleotides in one molecule.
When the probe is a probe containing all sequences complementary to each of the two or more specific oligonucleotides in one molecule, the interval time of various complexes formed by the two or more specific oligonucleotides and the probe. tends to be easier to adjust.

The probes may be a group of multiple probes each containing a sequence complementary to at least one of the two or more specific oligonucleotides.
When the probe is a plurality of probe groups each containing a sequence complementary to at least one of the two or more specific oligonucleotides, each probe is designed and / or modified to produce two or more specific oligonucleotides and probes It tends to be easier to adjust the interval time of various complexes formed by and.

A sequence complementary to one particular oligonucleotide in a probe may be divided into multiple portions, each portion being present in a separate probe. In this case, when the separate probes coexist, complementary sequences are formed across the probes. For example, probes 2-1 and 2-2, which will be described later, have a complementary sequence to miR-20a and a complementary sequence to miR-17-5a in a form that connects probes 2-1 and 2-2. . Such cases are also included within the scope of "probes having complementary sequences" in the present disclosure.

The concentration of the probe contained in the mixed solution is not particularly limited, and may be appropriately set according to the concentration of the specific oligonucleotide and the like. For example, from the viewpoint of facilitating hybridization of the probe to a small amount of a specific oligonucleotide, it is preferably 0.01 μmol/L or more and 10 μmol/L or less, and 0.05 μmol/L or more and 5 μmol/L or less. more preferably 0.1 μmol/L or more and 1 μmol/L or less.

The order of sequences complementary to the two or more specific oligonucleotides in the probe is preferably selected so that the free energy of the complex between the probe and the two or more specific oligonucleotides is minimized.

When the order of the sequences complementary to each specific oligonucleotide is selected so that the free energy of the complex between the probe and the two or more specific oligonucleotides is the lowest, the probe and the two or more specific oligonucleotides A complex formed by hybridization with and tends to exist stably. Therefore, the fluctuation of the interval time in the nanopore analysis of each complex tends to be suppressed.

The free energy of the probe is determined by NUPACK from Caltech (California Institute of Technology).

The probe preferably has a polydeoxycytosine structure at its 3' end.
When the probe has a polydeoxycytosine structure at its 3′ end, the complex tends to enter the through-hole of the nanopore more easily when voltage is applied to the 3′ end of the probe.

The polydeoxycytosine structure is not particularly limited as long as it is a polymer having deoxycytosine as a structural unit. For example, for the purpose of favorably presenting the complex in the through-hole of the nanopore, it is preferably polydeoxycytosine in which 20 deoxycytosines are linked and the length in the thickness direction of the through-hole of the nanopore is longer.

The probe preferably has a hairpin structure at its 5' end.
Since the hairpin structure is bulky, it tends to be difficult for the 5′ end of probe 1 to enter the through-hole of the nanopore. That is, when the 5' end of the probe has a hairpin structure, it suppresses the penetration of the probe into the through-hole of the nanopore from the 5'-end side, and penetrates into the through-hole of the nanopore from only one direction on the 3' end side. can be made easier. As a result, the variation in the interval time in the nanopore analysis of each complex tends to be suppressed.

(Step of annealing treatment)
The determination method according to the present disclosure may include a step of annealing the mixture between the first step and the second step described later.

When the step of annealing the mixture is performed between the first step and the second step described later, when the probe and the specific oligonucleotide contained in the measurement sample hybridize in the mixture, Even if mismatches occur and unstable complexes are formed, they tend to be able to rearrange to thermally more stable complexes. Therefore, it tends to be possible to suppress the occurrence of unevenness in the interval time of the obtained composite.

The annealing temperature is preferably 70° C. or higher and 100° C. or lower, more preferably 80° C. or higher and 100° C. or lower, and even more preferably 90° C. or higher and 100° C. or lower.
The annealing time is preferably 1 minute or more and 20 minutes or less, more preferably 1 minute or more and 15 minutes or less, and even more preferably 1 minute or more and 10 minutes or less.

(Second step)
A determination method according to the present disclosure includes a second step.
In a second step, a voltage is applied between a first solution and a second solution separated from each other by a lipid bilayer membrane with nanopores, and a voltage is applied between the first solution and the second solution. Current intensity of the current flowing through is measured over time to obtain current change data over time. The first solution contains a mixture of the probe obtained in the first step and the measurement sample.

The nanopore is not particularly limited as long as it has a through-hole that penetrates the thickness direction of the lipid bilayer membrane, ion channels (e.g., α-hemolysin transmembrane proteins such as α-hemolysin derived from Staphylococcus aureus), synthetic You may use public items as appropriate. For example, it is preferable to use an α-hemolysin transmembrane protein or an ion channel having a pore size similar to this, because it has a pore size that prevents the passage of double-stranded nucleic acids and allows the passage of only single-stranded nucleic acids.

The lipid that forms the lipid bilayer membrane is not particularly limited as long as it can stably form the lipid bilayer membrane at room temperature, and suitable lipids may be used as appropriate. Lipids forming a lipid bilayer membrane include, for example, diphthanoyl-sn-glycero-3-phosphocholine (DPhPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl -sn-glycero-3-phosphocholine (DMPC), diphytanoylphosphatidylethanolamine (DPhPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero -3-phosphoethanolamine (DPPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) and the like. Among the above, the lipid that forms the lipid bilayer membrane is preferably diphthanoyl-sn-glycero-3-phosphocholine (DPhPC), which has a high phase transition temperature, from the viewpoint of obtaining a more stable lipid bilayer membrane at room temperature. The lipid bilayer membrane may contain a steroid compound such as cholesterol, if necessary.

As a method for producing a lipid bilayer membrane, public production methods such as JP-A-2015-77559 and JP-A-2014-10062 may be applied.

Nanopore analysis may be performed using commercially available products as long as they have the configuration of the present disclosure. Examples of commercially available products capable of nanopore analysis include MinION, GridION _X5 , SmidgION, PromethION and the like manufactured by Oxford Nanopore Technologies.

As the first solution, the undiluted solution of the mixture may be used as the first solution, or the mixture diluted with a pH buffer solution or the like may be used as the first solution.

The concentration of the probe contained in the first solution is not particularly limited, and may be appropriately set according to the scale of the first solution. For example, from the viewpoint of adjusting the observation frequency of the interval time derived from each specific oligonucleotide, it is preferably 0.01 μmol / L or more and 10 μmol / L or less, and 0.05 μmol / L or more and 5 μmol / L or less. More preferably, it is 0.1 μmol/L or more and 1 μmol/L or less.

The first solution contains a mixture of the probe and the measurement sample obtained in the first step.
The first solution and the second solution are not particularly limited as long as the electric current passing through the through-hole of the nanopore can be observed, and suitable electrolytic solutions may be applied as appropriate. KCl, NaCl, etc. are mentioned as a kind of electrolyte contained in electrolyte solution. In addition, when an electrolytic solution is used, the concentration of the electrolyte may be, for example, 1000 mM or more and 10 M or less from the viewpoint of obtaining sufficient current intensity.

The types of the first solution and the second solution are not particularly limited as long as nanopore analysis is possible, and suitable solutions may be used as appropriate. For example, when the specific oligonucleotide is miRNA, a pH buffer solution that adjusts the pH to 6.0 or more and 8.0 or less may be used as the first solution and the second solution. The pH buffer contained in the pH buffer solution is not particularly limited, but examples include 2-morpholinoethanesulfonic acid (MES), 3-morpholinopropanesulfonic acid (MOPS), piperazine-N,N'-bis(2- ethanesulfonic acid) (PIPES), 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES), 2-hydroxy-3-[4-(2-hydroxyethyl)-1-piperazinyl ] Propanesulfonic acid (HEPPSO), 3-[4-(2-hydroxyethyl)-1-piperazinyl]propanesulfonic acid (EPPS), and the like.

The first solution and the second solution are preferably contained in containers, wells, or the like.

A method of applying a voltage between the first solution and the second solution is not particularly limited as long as the voltage can be applied over time between the first solution and the second solution. For example, an electrode may be provided for each of the first solution and the second solution, and a voltage may be applied through these two electrodes. The electrodes may also be electrically connected to a controller that controls the power supply and voltage. The electrodes may be electrically connected to a monitoring device that obtains current time course data.

The voltage applied between the first solution and the second solution is not particularly limited as long as the complex of the probe and the specific oligonucleotide can penetrate into the through-hole of the nanopore. For example, regarding the interval time of complexes of two or more specific oligonucleotides and probes, from the viewpoint of making it easier to determine each type of complex while shortening the passage time through the through-hole, the first solution and the second The voltage applied between the solutions is preferably 50 mV or more and 300 mV or less, more preferably 100 mV or more and 200 mV or less, and still more preferably 100 mV or more and 160 mV or less.

(Third step)
A determination method according to the present disclosure includes a third step.
In the third step,
(3-1) obtaining a plurality of interval times from the current change data over time;
(3-2) performing processing based on the central limit theorem for the plurality of interval times to obtain a frequency distribution;
(3-3) identifying a containing pattern derived from the two or more specific oligonucleotides based on the frequency distribution,
(3-4) Determine the presence or absence of each of the two or more specific oligonucleotides in the measurement sample from the content pattern.

Each step (3-1) to (3-4) will be described in detail below.

In step (3-1), a plurality of interval times are obtained from the current change data over time obtained in the second step.

The interval time is "the time during which the current passing through the through-hole of the nanopore is inhibited by the intrusion of the complex of the probe and the specific oligonucleotide or the single specific oligonucleotide into the through-hole of the nanopore". . More specifically, in the current change data over time, it represents the time from the intensity of the current passing through the through-hole of the nanopore until the intensity of the current decreases and then increases again.

The current intensity passing through the through-hole of the nanopore is observed when a voltage is applied in a state where the probe and the specific oligonucleotide are not present in the first solution, that is, in a state where the through-hole of the nanopore is not blocked. represents the intensity of the electric current passing through the nanopore.

A decrease in current intensity means that the complex of the probe and the specific oligonucleotide or the specific oligonucleotide alone has penetrated into the through-hole of the nanopore, and the current passing through the through-hole of the nanopore is inhibited, and the through-hole of the nanopore is It represents a state in which the intensity of the current is lower than the intensity of the passing current.

As a state in which the current intensity is lower than the current intensity passing through the through-hole of the nanopore, a set value is provided as a judgment criterion, and when the current intensity is lower than the set value, the current intensity is lowered. It may be judged that there is For example, in the current change data over time, the current value of the current passing through the through-hole of the nanopore is set to _I0 , and the current value is less than the set value of 75% compared to this current value _I0 . may be judged as a state in which the

When the current intensity rises again, the complex between the probe and the specific oligonucleotide is eliminated as it moves through the through hole of the nanopore, and the probe alone passes to the second solution side, so that the blocked nanopore It represents the state in which the current passing through the through-hole is observed again. For example, in the current change data over time, the current intensity is defined as a state in which the current value is lower than the set value 75% compared to the current value _I0 , and the current value increases to the current value _I0 again. You may judge as a state to rise again.

The number of samples of the interval time obtained from the current change data over time, that is, the number of samples in the population, may be more than one, and if the frequency distribution obtained by the processing based on the central limit theorem described later shows normality, it is particularly limited. not. For example, the number of interval time values obtained from current change data over time is preferably 50 or more, more preferably 100 or more, and further preferably 100 or more and 15,000 or less, Most preferably, the number is 100 or more and 1,000 or less. Note that the number of samples in the interval time corresponds to the number of raw data, which is considered a population in the present disclosure.

In step (3-2), the plurality of interval times are processed based on the central limit theorem to obtain a frequency distribution.

The processing based on the central limit theorem includes a step A of randomly selecting n interval times from a plurality of interval times as a population to form a sample group, a step B of obtaining the sample average of the sample group, The process includes a step C in which the steps A and B are repeated. Processing based on the central limit theorem may include other steps. Note that n represents an integer of 2 or more.

In step A, n interval times are randomly selected from a plurality of interval times that are a population to create a sample group. It should be noted that the n interval times randomly extracted from the population may be redundantly selected from the population, and the sample population may be larger in number than the number of data in the population.

The number n of interval time samples randomly selected from a plurality of interval times that are a population is preferably 500 or more, more preferably 1,000 or more, and 10,000 or more. is more preferred.

When the number of samples n in the sample population is large (for example, 500 or more), the distribution of the sample mean obtained by averaging the sample population tends to be a normal distribution.

In step B, the sample mean of the sample population is obtained.
Sample mean means the arithmetic mean value for n randomly selected samples as described above.

In step C, the steps A and B are repeated.

The number of repetitions of steps A and B is not particularly limited, and may be appropriately set according to the dispersibility of the population mean frequency distribution in the population. For example, the number of repetitions of Step A and Step B is preferably 10,000 times or more, more preferably 50,000 times or more, and even more preferably 100,000 times or more.

When the number of repetitions of steps A and B is large (for example, 10,000 times or more), the frequency distribution tends to become a normal distribution. As a result, for example, even if the difference in interval time between various complexes is small, a normal distribution with greatly reduced variation is obtained, so that highly reliable determination is possible.

In step (3-3), the content pattern derived from the two or more specific oligonucleotides is identified based on the frequency distribution.

The frequency distribution may be a frequency distribution table in which each sample mean value is a class and the frequency of each sample mean value is a frequency, or the frequency distribution table may be a histogram.

Identifying a containing pattern derived from two or more specific oligonucleotides based on the frequency distribution means that the frequency distribution obtained in the previous step is referred to as "a frequency distribution pattern unique to each specific oligonucleotide" or "each specific The frequency distribution pattern unique to the oligonucleotide-probe complex represents its identification.

The third step is to use the frequency distribution as the first frequency distribution and use a solution in which the presence or absence of each of two or more specific oligonucleotides is known as the measurement sample, the above (3-1) and (3- A step of comparing the second frequency distribution obtained by performing 2) with the first frequency distribution may be included.

By including the step of comparing the second frequency distribution and the first frequency distribution in the third step, the containing pattern of various specific oligonucleotides can be obtained more clearly.

Preferably, the second frequency distribution is determined for all possible types of complexes formed between the specific oligonucleotide and the probe.

As a method of comparing the first frequency distribution and the second frequency distribution, for example, the confidence intervals of each sample mean may be compared, and the confidence interval and median of each sample mean may be compared. good too.

Confidence intervals for sample means are determined by t-test.

The confidence interval of the sample mean is preferably 90% or more, more preferably 95% or more, and even more preferably 99% or more.
When the confidence interval of the sample average is 90% or more, it is considered that the presence or absence of two or more specific oligonucleotides in the measurement sample can be determined with higher accuracy.

As a method of comparing the first frequency distribution and the second frequency distribution, for example, the following aspects may be used. First, from the second frequency distribution, we obtain known information that, for example, 2250 ms to 2750 ms is the 95% confidence interval for the inclusion pattern A of the complex in which all five specific oligonucleotides are hybridized to the probe. Next, when the median value in the first frequency distribution is, for example, 2500 ms, it is included in the confidence interval of the inclusion pattern A, so it is determined to be the inclusion pattern A.

Note that in a normal distribution, the median value and the mean value are the same, but in consideration of the case where the distribution is not completely normal distribution, the mean value may be used instead of the median value.

In step (3-4), the presence or absence of each of the two or more specific oligonucleotides in the measurement sample is determined from the content pattern.

When the measurement sample does not contain all of the various specific oligonucleotides, the frequency distribution peculiar to the probe alone is identified as the pattern of the peculiar frequency distribution when the first solution does not contain all of the various specific oligonucleotides. You can

The third step may further comprise determining the content of each of the two or more specific oligonucleotides in the measurement sample based on the first frequency distribution.

In the third step, when the content of each of the two or more specific oligonucleotides in the measurement sample is determined, obtaining quantitative information on the two or more specific oligonucleotides that are differentially expressed or not in cancer, etc. can be done.

In the third step, the method for determining the content of each of the two or more specific oligonucleotides in the measurement sample is not particularly limited. For example, the third step is obtained by performing the above (3-1) and (3-2) using a solution in which the content of the two or more specific oligonucleotides is known as the measurement sample. comparing the third frequency distribution obtained with the first frequency distribution.

By comparing the third frequency distribution containing quantitative information on two or more specific oligonucleotides with the first frequency distribution, the quantitative information on the two or more specific oligonucleotides in the measurement sample can be obtained more accurately. can get to

Moreover, for example, even if a specific oligonucleotide is contained in the measurement sample, the specific oligonucleotide does not necessarily hybridize to the probe. In other words, it is believed that the specific oligonucleotide hybridizes to the probe and forms a complex with a probability that depends on the concentration of the specific oligonucleotide in the first solution. Therefore, when the concentration of the specific oligonucleotide in the measurement sample increases, the proportion of the complex tends to increase, and it is expected that the frequency distribution of the interval time will also fluctuate. Therefore, by obtaining quantitative information on two or more specific oligonucleotides through the above steps, it is possible to determine the abundance of the specific oligonucleotides. In addition, it is also possible to estimate the concentration at which the detection limit of the specific oligonucleotide is reached.

Incidentally, instead of the second frequency distribution and/or the criterion based thereon, a frequency distribution and/or the criterion obtained by simulation or the like may be used. Also, instead of the third frequency distribution and/or the criteria based thereon, a frequency distribution and/or criteria obtained by simulation or the like may be used.

(probe)
According to the present disclosure, there is provided a "probe 1" (hereinafter referred to as "probe 1, which is a DNA having a base sequence of SEQ ID NO: 8: GTCGAACGTTTTCGTTCGACCCTCATCTCGCCCGCAAAGACCCACCCTACCTGCACTGTAAGCACTTTTCCCAAACCATTATGTGCTGCTACCCCACTTATCAGGTTGTATTATAACCAACGGAACCACTAGTGACTTGCCCCCCCCCCCCCCCCCC".

Probe 1, for example, miR-193, miR-106a, miR-15a, miR-374 and miR-224 differentially expressed in cholangiocarcinoma, for determining the presence or absence of one or more miRNA It can be used as a probe.

Probe 1 has a base sequence completely complementary to miR-193, miR-106a, miR-15a, miR-374 and miR-224 in this order from the 3' end side, and a poly at the 3' end side. It has a deoxycytosine structure and a hairpin structure on the 5' end side.

Probe 1 has a base sequence completely complementary to miR-193, miR-106a, miR-15a, miR-374 and miR-224. Therefore, when probe 1 is applied as a probe in miRNA measurement using nanopore analysis, the interval time can be suitably controlled.

Moreover, probe 1 has complementary nucleotide sequences to miR-193, miR-106a, miR-15a, miR-374 and miR-224 in this order. Therefore, the complexes of probe 1 and miR-193, miR-106a, miR-15a, miR-374 and miR-224 have the lowest free energy and tend to exist stably. As a result, variations in interval time in the nanopore analysis technique for each complex are suppressed.

Probe 1 has a polydeoxycytosine structure at the 3' end. Therefore, when probe 1 is applied as a probe in miRNA measurement using nanopore analysis, the 3' end side of probe 1 tends to penetrate more easily into the through-hole of the nanopore when a voltage is applied. In addition, the number of cytosines in the polydeoxycytosine structure (that is, the number of polymerizations) may be appropriately changed as necessary.

Hairpin structures are bulky. Therefore, when probe 1 is applied as a probe in miRNA measurement using nanopore analysis, the 5' end of probe 1 is less likely to enter the through-hole of the nanopore. As a result, the penetration of the probe 1 from the 5'-end side into the through-hole of the nanopore is suppressed, and there is a tendency for the probe 1 to penetrate into the through-hole of the nanopore from only one direction from the 3'-end side.

(probe set)
The probe set according to the present disclosure includes a DNA probe (hereinafter referred to as “probe 2-1”) having the nucleotide sequence of SEQ ID NO: 9 “ACTACCTGCACTGTAAGACTATAAGCACTTTA” and a DNA having the nucleotide sequence of SEQ ID NO: 10 “CTACCTGCCACTTTG”. a certain probe (hereinafter referred to as "probe 2-2"); The probe set may further include other probes.

A probe set having probes 2-1 and 2-2, for example, among miR-20a and miR-17-5p differentially expressed in small cell lung cancer, the presence or absence of one or more miRNA It can be used as a probe set for determination.

Probe 2-1 and probe 2-2 in the probe set have sequences complementary to miR-20a and miR-17-5p, respectively, split between both probes. More specifically, when probe 2-1 and probe 2-1 coexist, a complementary sequence to miR-20a and a complementary sequence to miR-17-5a are present in a form that connects both probes. .

A complex formed only when all of miR-20a and miR-17-5p and probe 2-1 and probe 2-2 are present at the same time, and either miR-20a or miR-17-5p and both probes The complex formed when only probe 2-1 and probe 2-2 are present can be clearly distinguished and measured in miRNA measurement using nanopore analysis.

[Determination device configured to determine the presence or absence of two or more specific oligonucleotides]
A determination device for determining the presence or absence of two or more specific oligonucleotides according to the present disclosure includes a CPU and a memory,
(3-1A) a first solution and a second solution containing a mixture of a probe having a sequence complementary to two or more specific oligonucleotides and a measurement sample separated from each other by a lipid bilayer membrane having a nanopore; Obtaining a plurality of interval times from current change data over time of the current intensity of the current flowing between the first solution and the second solution obtained by applying a voltage during
(3-2A) obtaining a frequency distribution by performing processing based on the central limit theorem for the plurality of interval times;
(3-3A) identifying a containing pattern derived from the two or more specific oligonucleotides based on the frequency distribution;
(3-4A) determining the presence or absence of each of the two or more specific oligonucleotides in the measurement sample from the content pattern;
is configured to determine the presence or absence of two or more specific oligonucleotides by a process comprising:

FIG. 8 shows a block diagram of a determination device 100 as an example of a determination device according to the present disclosure. As shown in FIG. 8, the determination device 100 includes a CPU (Central Processing Unit) 101, a ROM (Read Only Memory) 102, a RAM (Random Access Memory) 103, a nonvolatile memory 104, and an input/output interface (I/O). 106 are connected to each other via a bus 105 . The I/O 106 is connected to a current intensity time course measurement device 120 via an intranet 110 .

A program for executing the process of determining the presence or absence of two or more specific oligonucleotides can be stored in advance in the nonvolatile memory 104, for example. In this case, the CPU 101 reads and executes a program stored in the nonvolatile memory 104 for determining the presence or absence of two or more specific oligonucleotides. Alternatively, a program for executing the process of determining the presence or absence of two or more specific oligonucleotides may be recorded in a storage medium such as a CD-ROM, and the program may be read by a CD-ROM drive or the like and executed.

The analyzer shown in FIG. 1 can be used as the current intensity time course measuring instrument 120 . In addition, it is also possible to use the analyzers described in JP-A-2013-540423, JP-A-2016-517275, JP-A-2017-6135, and the like.
Current intensity temporal change data obtained by the current intensity temporal change measuring device 120 is transmitted to the determination device 100 via the intranet 110 . The CPU 101 performs processing based on the central limit theorem as exemplified by S11 to S13 in FIG. 4 on the current intensity change data over time to obtain a sample average frequency distribution. Of course, the size of the population and sample population, the number of extracted interval times, the number of repetitions in step S12, and the like in the processing based on the central limit theorem in FIG. 4 are merely examples, and may be set as appropriate based on the present disclosure. For example, see the description of the third step above.

The frequency distribution of sample averages obtained as a result of this is compared with a combination of existing specific oligonucleotides stored in advance in nonvolatile memory 104 and a criterion for the frequency distribution of sample averages (for example, a 95% confidence interval of the median value). The particular oligonucleotide combination present in the measurement sample is identified by matching with the corresponding data. Thereby, the presence or absence of two or more specific oligonucleotides can be determined. Data indicating the correspondence between the combination of specific oligonucleotides present and the criterion for the frequency distribution of the sample average may be preset data, or a standard sample in which the combination of specific oligonucleotides present is known, The sample mean frequency distribution data obtained by processing based on the central limit theorem may be sent from the I/O 106 to the nonvolatile memory 104 for storage.

The above determination result may be output and displayed on a display device 130 such as a monitor connected to the I/O 106 . The object to be determined is not limited to the presence or absence of the specific oligonucleotide, and may include the abundance of the specific oligonucleotide. The data stored in advance in the nonvolatile memory 104 is data indicating the correspondence between the combination of the abundance of specific oligonucleotides and the criterion for the frequency distribution of the sample average (for example, the 95% confidence interval of the median value). Such determination is possible.

In FIG. 8, the current intensity temporal change data is transmitted via the intranet 110, but the determining device 100 may be directly connected to the current intensity temporal change measuring device 120 to form a single device. Alternatively, as exemplified in FIG. 8, the determination device 100 may constitute a determination system for determining the presence or absence of two or more specific oligonucleotides together with the current intensity time course measuring device 120 .

Further, according to the present disclosure, a computer program that causes a computer to execute a process for determining the presence or absence of two or more specific oligonucleotides, wherein the process includes the following (3-1) to (3-4) Provided is a computer program containing:
(3-1A) a first solution and a second solution containing a mixture of a probe having a sequence complementary to two or more specific oligonucleotides and a measurement sample separated from each other by a lipid bilayer membrane having a nanopore; A step of obtaining a plurality of interval times from the current change data over time of the current intensity of the current flowing between the first solution and the second solution obtained by applying a voltage during
(3-2A) a step of performing processing based on the central limit theorem for the plurality of interval times to obtain a frequency distribution;
(3-3A) identifying a containing pattern derived from the two or more specific oligonucleotides based on the frequency distribution;
(3-4A) A step of determining the presence or absence of each of the two or more specific oligonucleotides in the measurement sample from the content pattern.

The memory and CPU in the determination device according to the present disclosure are not particularly limited, and suitable and well-known ones may be applied.

[Method for determining that a test subject is suffering from or at risk of small cell lung cancer]
The method for determining that the test subject according to the present disclosure is suffering from or at risk of small cell lung cancer includes (1) two or more specific oligonucleotides that are differentially expressed or not in small cell lung cancer A first step of mixing a probe having a complementary sequence and a sample derived from a test subject to obtain a mixture, and (2) a first solution containing the mixture, separated from each other by a lipid bilayer membrane having nanopores. A second step of applying a voltage between and a second solution, measuring the current intensity of the current flowing between the first solution and the second solution over time to obtain current change data over time; , (3-1) obtaining a plurality of interval times from the current temporal change data, (3-2) performing processing based on the central limit theorem for the plurality of interval times to obtain a first frequency distribution, (3 -3) Obtained by performing the above (1) to (3-2) using the first frequency distribution and a sample derived from a healthy subject not suffering from small cell lung cancer instead of the sample A third frequency distribution obtained by performing the above (1) to (3-2) using a second frequency distribution and / or a sample derived from a patient suffering from small cell lung cancer; and a third step of determining that the test subject suffers from or is at risk for small cell lung cancer by comparing

Subjects to be tested include, for example, humans and non-human animals. Examples of non-human animals include mammals other than humans.

Samples obtained from subjects to be examined include, for example, specimens derived from living organisms. Specimens derived from a living body are not particularly limited, and include urine, blood, saliva, and the like. Blood samples include, for example, red blood cells, whole blood, serum, and plasma.

The sample obtained from the test subject may be liquid or solid. For example, an undiluted sample obtained from a test subject may be used as it is, or a diluted solution obtained by suspending, dispersing, or dissolving the sample in a medium may be used. When the sample obtained from the test subject is solid, it is preferable to use, as the liquid sample, a diluted solution obtained by suspending, dispersing, or dissolving the sample in a solution medium. The solution medium is not particularly limited, and examples thereof include water, buffer solutions, and the like. The liquid specimen thus obtained can be used as the first solution, or added to the first solution in the determination method described above.

Specific oligonucleotides that are differentially expressed in small cell lung cancer include, for example, miR-20a, miR-17-5p, and the like.

Specific oligonucleotides that are not differentially expressed in small cell lung cancer include, for example, miR-193, miR-374, and the like.

A probe having a sequence complementary to two or more specific oligonucleotides differentially expressed in small cell lung cancer is, for example, two or more specific oligonucleotides differentially expressed in small cell lung cancer exemplified above is a probe having a sequence complementary to

A probe having a sequence complementary to two or more specific oligonucleotides that are not differentially expressed in small cell lung cancer is, for example, two or more specific oligonucleotides that are not differentially expressed in small cell lung cancer exemplified above is a probe having a sequence complementary to

The probe in the method for determining whether one has small cell lung cancer or is at risk of small cell lung cancer according to the present disclosure is a sequence complementary to two or more specific oligonucleotides that are differentially expressed or not in small cell lung cancer The same configuration as the probe in the above-described method for determining the presence or absence of a specific oligonucleotide may be applied except for having

In the method for determining that one has or is at risk for small cell lung cancer according to the present disclosure, (3-1) to (3-) in the first step, the second step, and the third step In 2), except that the measurement sample is "a sample derived from the test subject" and the probe is "a probe having a sequence complementary to two or more specific oligonucleotides that are differentially expressed or not expressed in cell lung cancer". is the first step, the second step, and the third step in the determination method for determining the presence or absence of the two or more specific oligonucleotides described above (3-1) ~ (3-2) the same steps may be

In the method for determining that the patient has small cell lung cancer or is at risk of small cell lung cancer according to the present disclosure, in step (3-3), the first frequency distribution and cell lung cancer instead of the sample Second frequency distribution obtained by performing the above (1) to (3-2) using a sample derived from a healthy subject who does not have and / or from a patient suffering from cell lung cancer By comparing the third frequency distribution obtained by performing the above (1) to (3-2) using the sample, the test subject is afflicted with cell lung cancer or the risk thereof determine that it has

A healthy subject who is not affected by small cell lung cancer means an individual that is previously known not to be differentially expressed in two or more specific oligonucleotides that are differentially expressed in small cell lung cancer. do.

A patient suffering from small cell lung cancer means an individual previously known to differentially express two or more specific oligonucleotides that are differentially expressed in small cell lung cancer. do.

A method of comparing a first frequency distribution obtained using a sample derived from a test subject and a second frequency distribution obtained using a sample derived from a healthy subject not suffering from small cell lung cancer. Alternatively, the confidence intervals of the sample means in the frequency distribution of each sample may be compared, the confidence intervals of the sample means and the median may be compared, or the medians may be compared. For example, from the viewpoint of more accurately determining that the test subject is suffering from or at risk of small cell lung cancer, the comparison of the first frequency distribution and the second frequency distribution is performed in the frequency distribution of each sample. It is preferable to compare the confidence intervals of the sample means.

A confidence interval for each frequency distribution is determined by a t-test.

The confidence interval in each frequency distribution is preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, and most preferably 99% or more.

When the confidence interval in each frequency distribution is 80% or more, it is considered that it is possible to more accurately determine that the test subject is suffering from or at risk of small cell lung cancer.

The second frequency distribution and the third frequency distribution may be frequency distributions obtained by actual measurement or frequency distributions predicted by referring to papers or the like.

When determining samples derived from a plurality of different test subjects, the step of obtaining the second frequency distribution using samples derived from healthy individuals not suffering from small cell lung cancer does not have to be performed each time. More specifically, a second frequency distribution is obtained in advance using a sample derived from a healthy subject not suffering from small cell lung cancer, and this second frequency distribution is obtained from a plurality of different test subjects. It may be determined by comparing with the sample to be used.

When determining samples from multiple different test subjects, the step of obtaining the third frequency distribution using samples from patients with small cell lung cancer need not be performed each time. More specifically, a third frequency distribution is obtained in advance using a sample derived from a patient suffering from small cell lung cancer, and this third frequency distribution is obtained from a plurality of different test subjects. It may be determined by comparing with the sample to be used.

The first frequency distribution obtained using the sample derived from the test subject may be appropriately corrected according to the age, physiological parameters, etc. of the test subject.

The criteria for determination will be described below.

As a criterion for determining that the test subject has a risk of suffering from small cell lung cancer, the area of the histogram of the confidence interval in the first frequency distribution obtained using the sample derived from the test subject and the small cell Compare the area of the histogram of the confidence interval in the second frequency distribution obtained using a sample derived from a healthy subject not suffering from lung cancer, and if the two areas do not overlap, the test subject is small It may be determined that the patient is at risk of suffering from cell lung cancer.

As a criterion for determining that the test subject does not have a risk of being afflicted with small cell lung cancer, the area of the histogram of the confidence interval in the first frequency distribution obtained using a sample derived from the test subject, Compare the area of the histogram of the confidence interval in the second frequency distribution obtained using samples derived from healthy subjects not suffering from small cell lung cancer, and the areas of both overlap by 50% or more ( more preferably 60% or more), it may be determined that the test subject does not have a risk of suffering from small cell lung cancer.

In addition, the confidence interval of the first frequency distribution obtained using the sample derived from the test subject and the second frequency distribution obtained using the sample derived from healthy subjects not suffering from small cell lung cancer and the median value, and it may be determined that the test subject does not have the risk of being afflicted with small cell lung cancer even when the confidence interval includes the median value.

As a criterion for determining that a test subject has small cell lung cancer, the first frequency distribution obtained using a sample derived from the test subject and the When comparing the third frequency distribution obtained using a sample with , it may be determined that the test subject is suffering from small cell lung cancer.

In particular, comparing the area of the histogram of the confidence interval in the second frequency distribution obtained using samples derived from healthy subjects and the area of the histogram of the confidence interval in the first frequency distribution, If there is no overlap, it may be determined that the test subject has small cell lung cancer.

In addition, the median of the first frequency distribution obtained using samples derived from the test subject and the third frequency distribution obtained using samples derived from patients suffering from small cell lung cancer It may be determined that the test subject has a risk of being afflicted with small cell lung cancer even when the median value and the median value match.

For example, this determination method may be specifically performed in the following manner. First, from the second frequency distribution, known information is obtained that, for example, 900 ms to 1200 ms is a 95% confidence interval in the frequency distribution of samples derived from healthy subjects not suffering from small cell lung cancer. Next, information is obtained from the first frequency distribution that, for example, 2250 ms to 2750 ms is a 95% confidence interval in the frequency distribution of samples derived from the test object. Comparing the 95% confidence intervals of the first frequency distribution and the second frequency distribution, the 95% confidence intervals of both do not overlap 100%. Therefore, it is determined that the test subject has a risk of suffering from small cell lung cancer.

Incidentally, instead of the second frequency distribution and/or the criterion based thereon, a frequency distribution and/or the criterion obtained by simulation or the like may be used. Also, instead of the third frequency distribution and/or the criteria based thereon, a frequency distribution and/or criteria obtained by simulation or the like may be used.

Note that in a normal distribution, the median value and the mean value are the same, but in consideration of the case where the distribution is not completely normal distribution, the mean value may be used instead of the median value.

[Method for Determining Whether a Test Subject Has Bile Duct Cancer or Is at Risk of Bile Duct Cancer]
The method for determining that a test subject according to the present disclosure is suffering from or at risk of cholangiocarcinoma includes (1) two or more specific oligonucleotides that are differentially expressed or not in cholangiocarcinoma; A first step of mixing a probe having a complementary sequence and a sample derived from a test subject to obtain a mixture, and (2) a first solution containing the mixture, separated from each other by a lipid bilayer membrane having nanopores. A second step of applying a voltage between and a second solution, measuring the current intensity of the current flowing between the first solution and the second solution over time to obtain current change data over time; , (3-1) obtaining a plurality of interval times from the current temporal change data, (3-2) performing processing based on the central limit theorem for the plurality of interval times to obtain a first frequency distribution, (3 -3) Obtained by performing the above (1) to (3-2) using the first frequency distribution and a sample derived from a healthy subject not suffering from bile duct cancer instead of the sample a third frequency distribution obtained by performing the above (1) to (3-2) using a second frequency distribution and / or a sample derived from a patient suffering from cholangiocarcinoma; and a third step of determining that the test subject suffers from or is at risk of bile duct cancer by comparing

The test subject and the sample obtained from the test subject include the same test subject as exemplified in the method for determining the possibility of small cell lung cancer disease.

Oligonucleotides that are differentially expressed in cholangiocarcinoma include, for example, miR-374, miR-15a, miR-224, miR-106a, miR-193, and the like.

Oligonucleotides that are not differentially expressed in cholangiocarcinoma include, for example, miR-20a, miR-17-5p, and the like.

Probes having sequences complementary to two or more specific oligonucleotides differentially expressed in cholangiocarcinoma are, for example, two or more specific oligonucleotides differentially expressed in cholangiocarcinoma exemplified above. is a probe having a sequence complementary to

Probes having sequences complementary to two or more specific oligonucleotides that are not differentially expressed in cholangiocarcinoma include, for example, two or more specific oligonucleotides that are not differentially expressed in cholangiocarcinoma exemplified above. is a probe having a sequence complementary to

The probe in the method for determining a person suffering from or at risk of cholangiocarcinoma according to the present disclosure is a sequence complementary to two or more specific oligonucleotides that are differentially expressed or not in cholangiocarcinoma The same configuration as the probe in the above-described method for determining the presence or absence of a specific oligonucleotide may be applied except for having

In the method for determining a person suffering from or at risk of bile duct cancer according to the present disclosure, (3-1) to (3-) in the first step, the second step, and the third step In 2), the sample to be measured is "a sample derived from a test subject" and the probe is "a probe having a sequence complementary to two or more specific oligonucleotides that are differentially expressed or not expressed in cholangiocarcinoma". Except for the above-mentioned first step, second step, and third step in the determination method for determining the presence or absence of two or more specific oligonucleotides (3-1) ~ (3-2) It is good as a process.

The step (3-3) in the method for determining a person suffering from or at risk of cholangiocarcinoma according to the present disclosure is described above, except that the description of small cell lung cancer is replaced with cholangiocarcinoma. It may be the same step as the step (3-3) in the method for determining the presence of or risk of small cell lung cancer.

EXAMPLES The present invention will be described in more detail below based on examples, but the present invention is not limited to the following examples. "Parts" means "parts by mass" unless otherwise specified.

- Preparation of materials -
The following materials were used.

(Preparation of specific oligonucleotide (miRNA))
Each miRNA having the base sequences shown below was synthesized by high-performance liquid chromatography grade (DNA FASMAC Co., Ltd.) and used as a 65 μg/mL solution.

・miR-374
SEQ ID NO: 1: UUAUAAUACAACCUGAUAGUG
・miR-15a
SEQ ID NO: 2: UAGCAGCACAUAAUGGUUUGUG
・miR-224
SEQ ID NO: 3: CAAGUCACUAGUGGUUCCGUU
・miR-106a
SEQ ID NO: 4: AAAAGUGCUUACAGUGCAGGUAG
・miR-193
SEQ ID NO: 5: UGGGUCUUUGCGGGCGAGAUGA
・miR-20a
SEQ ID NO: 6: UAAAGUGCUUAUAGUGCAGGUAG
・miR-17-5p
SEQ ID NO: 7: CAAAGUGCUUACAGUGCAGGUAGU

(buffer solution)
A buffer solution of 1.0 M KCl, 10 mM MOPS, pH 7.0 was used.

(Preparation of probe 1)
The nucleotide sequence of probe 1 was designed using NUPACK from Caltech (California Institute of Technology), which is capable of designing nucleic acid bases and the like. The base sequences of the probes are for five specific oligonucleotides miR-193, miR-106a, miR-15a, miR-374 and miR-224, which are known to be differentially expressed in cholangiocarcinoma. It was designed so that it would be a completely complementary sequence from the 3' end in order. Next, oligonucleotides having this designed nucleotide sequence were synthesized by high performance liquid chromatography grade (DNA FASMAC Co., Ltd.). A hairpin structure was introduced at the 5′ end of the obtained oligonucleotide, and polydeoxycytosine with 20 deoxycytosines was introduced at the 3′ end. Probe 1 has a base sequence of SEQ ID NO: 8 from the 5′ end side, “GTCGAACGTTTTCGTTCGACCCTCATCTCGCCCGCAAAGACCCACCCTACCTGCACTGTAAGCACTTTTCCCACAAACCATTATGTGCTGCTACCCACTTATCAGGTTGTATTATAACCAACGGAACCACTAGTGACTTGCCCCCCCCCCCCCCCCCCCC”. Probe 1 used was adjusted to 484.8 µg/mL in a buffer solution (hereinafter referred to as "probe 1 solution").

(Preparation of probe 2-1)
The nucleotide sequence of probe 2-1 was designed using NUPACK manufactured by Caltech (California Institute of Technology), which is capable of designing nucleic acid bases and the like.
Probe 2-1 has, at its 3′ end, a base sequence completely complementary to the specific oligonucleotide miR-20a, which is known to be differentially expressed in small cell lung cancer. In addition, probe 2-1 has a base sequence completely complementary to a specific oligonucleotide miR-17-5p, which is known to be differentially expressed in small cell lung cancer similar to miR-20a, at 5' It has it on the terminal side. Probe 2-1 has the base sequence of SEQ ID NO: 9 “ACTACCTGCACTGTAAGACTATAAGCACTTTA” from the 5′ end side. Next, an oligonucleotide having this designed nucleotide sequence was synthesized by high performance liquid chromatography grade (DNA FASMAC Co., Ltd.) to obtain probe 2-1. Probe 2-1 was adjusted to 1888 μg/mL in a buffer solution (hereinafter referred to as "probe 2-1 solution").

(Preparation of probe 2-2)
The nucleotide sequence of probe 2-2 was designed using NUPACK manufactured by Caltech (California Institute of Technology), which is capable of designing nucleic acid bases and the like.
Probe 2-2 has a base sequence completely complementary to miR-20a at the 3' end. In addition, probe 2-2 has a base sequence completely complementary to miR-17-5p on the 5' end side. Probe 2-2 has the base sequence of SEQ ID NO: 10 “CTACCTGCCACTTTG” from the 5′ end side. Next, an oligonucleotide having this designed nucleotide sequence was synthesized by high performance liquid chromatography grade (DNA FASMAC Co., Ltd.) to obtain probe 2-2. Probe 2-2 was adjusted to 447.9 μg/mL in a buffer solution (hereinafter referred to as "probe 2-2 solution").

(Preparation of nanopores)
A lipid bilayer membrane with nanopores is provided on one well using diphthanoyl-sn-glycero-3-phosphocholine (DPhPC, Avanti Polar Lipids, Inc.) as the lipid, and the lipid bilayer membrane separates the solution in the well. was separated into the first solution and the second solution. 1 M KCl and 10 mM MOPS (pH 7.0) were then added to each of the first and second solutions (4.7 μL each) separated by a lipid bilayer membrane. For the nanopore, wild-type αHL (Sigma-Aldrich, St. Louis, MO and USA, List Biological Laboratories, Campbell, CA, USA), which is a monomeric polypeptide isolated from Staphylococcus aureus, is used. bottom.

- Determination of two miRNAs differentially expressed in small cell lung cancer -
[Example 1]

(First step)
(Preparation of mixture containing only probe 2-1 and probe 2-2, not containing specific oligonucleotide)
A mixture was prepared by mixing 1 μL of the probe 2-1 solution and 1 μL of the probe 2-2 solution. An annealing treatment was then performed by heating the mixture to 95° C. for 5 minutes and then slowly cooling to room temperature (25° C.). The mixture after this annealing treatment was used as the complex HYB0.

(Preparation of a 1:1 mixture of two specific oligonucleotides and probes 2-1 and 2-2)
A mixture was prepared by mixing 1 μL of miR-20a solution, 1 μL of probe 2-1 solution, and 1 μL of probe 2-2 solution as a measurement sample. An annealing treatment was then performed by heating the mixture to 95° C. for 5 minutes and then slowly cooling to room temperature (25° C.). The mixture after this annealing treatment was used as the complex HYB1-20a. For the other specific oligonucleotide miR-17-5p, a corresponding mixture: HYB1-17-5p was prepared and annealed in the same manner as for HYB1-20a.

(Preparation of a 2:2 mixture of two specific oligonucleotides and probes 2-1 and 2-2)
A mixture was prepared by mixing 1 μL each of the miR-20a solution and miR-17-5p solution, 1 μL of the probe 2-1 solution, and 1 μL of the probe 2-2 solution, which were measurement samples. An annealing treatment was then performed by heating the mixture to 95° C. for 5 minutes and then slowly cooling to room temperature (25° C.). The mixture after this annealing treatment was used as the complex HYB2DUO.

(Second step)
4.7 μL of complex HYB1-20a solution was added into the first solution. A constant voltage of +150 mV was then applied in the direction from the first solution to the second solution and the current time course data were analyzed with a Clampex 9.0 (Molecular Devices) equipped with a Digidata 1440A analog-to-digital converter (Molecular Devices). obtained by using The applied current was recorded using an Axopatch 200B Amplifier (Molecular Devices, San Jose, Calif., USA). Similar to mixture HYB-193, current time course data were obtained for other mixtures: HYB0, HYB1-17-5p and HYB2DUO, respectively.

(Third step)
A frequency distribution was obtained based on the current time course data for the complex HYB1-20a obtained in the second step. A detailed flowchart is shown in FIG. First, 300 interval times were obtained from the current change data S10 and used as a population (S11). Next, 10,000 interval times were selected at random from the 300 interval times, and this was used as a sample group (S12A). After that, an arithmetic mean was calculated for this sample group and used as a sample mean (S12B). As shown in FIG. 4, the step (S12) of creating this sample population and obtaining the sample average was repeated 65536 times to obtain a frequency distribution. For the frequency distribution of the obtained 65,536 sample averages, a histogram was created in which the interval time is represented logarithmically (S13 and see FIG. 5 (B-2)). The histogram of HYB0 prepared in the same manner as the complex HYB1-20a is shown in FIG. 5 (B-1), the histogram of HYB1-17-5p is shown in FIG. 5 (B-3), and the histogram of HYB2DUO is shown in FIG. 4), respectively. In addition, in this disclosure, the population is used to mean measured data before statistical processing.

[Comparative Example 1]
(First and second steps)
Current change data over time was obtained in the same manner as in Example 1.

(Third step)
300 interval times were obtained from the current time course data for the complex HYB1-20a obtained in the second step, and this was used as a population. The arithmetic mean for this population was then determined. A histogram in which the interval time is displayed logarithmically was prepared for the frequency distribution of the obtained arithmetic mean (see FIG. 5(A-2)). The histogram of HYB0 prepared in the same manner as the complex HYB1-20a is shown in FIG. 5 (A-1), the histogram of HYB1-17-5p is shown in FIG. 5 (A-3), and the histogram of HYB2DUO is shown in FIG. 4), respectively.

-Determination of 5 miRNAs differentially expressed in cholangiocarcinoma-
[Example 2]
(First step)
(Preparation of a 1:1 mixture of each of the five specific oligonucleotides and probe 1)
A mixture was prepared by mixing 1 μL of miR-193 solution as a measurement sample and 1 μL of probe 1 solution. An annealing treatment was then performed by heating the mixture to 95° C. for 5 minutes and then slowly cooling to room temperature (25° C.). The mixture after this annealing treatment was used as the complex HYB1-193. For other specific oligonucleotides miR-106a, miR-15a, miR-374, and miR-224, in the same manner as for miR-193, the corresponding mixtures: HYB1-106a, HYB1-15a, HYB1-374 and HYB1-224 was prepared and subjected to the same annealing treatment as HYB1-193.

(Preparation of a 3:1 mixture of all three specified oligonucleotides and probe 1)
A mixture was prepared by mixing 1 μL each of miR-193 solution, miR-15a solution and miR-224 solution, which are measurement samples, and 1 μL of probe 1 solution. An annealing treatment was then performed by heating the mixture to 95° C. for 5 minutes and then slowly cooling to room temperature (25° C.). The mixture after this annealing treatment was used as the complex HYB3.

(Preparation of a 5:1 mixture of all five specific oligonucleotides and probe 1)
1 μL each of the five specific oligonucleotide solutions (miR-193 solution, miR-106a solution, miR-15a solution, miR-374 solution and miR-224 solution), which is a measurement sample, mixed with 1 μL of probe 1 solution and a mixture was prepared. An annealing treatment was then performed by heating the mixture to 95° C. for 5 minutes and then slowly cooling to room temperature (25° C.). The mixture after this annealing treatment was used as complex HYB5.

(Second step)
4.7 μL of complex HYB1-193 solution was added into the first solution. A constant voltage of +150 mV was then applied in the direction from the first solution to the second solution and the current time course data were analyzed with a Clampex 9.0 (Molecular Devices) equipped with a Digidata 1440A analog-to-digital converter (Molecular Devices). obtained by using The applied current was recorded using an Axopatch 200B Amplifier (Molecular Devices, San Jose, Calif., USA). Similar to mixture HYB-193, current time course data were also obtained for other mixtures: HYB1-106a, HYB1-15a, HYB1-374, HYB1-224, HYB3 and HYB5.

(Third step)
Based on the current time course data for the complex HYB1-193 obtained in the second step, a histogram with the interval time expressed logarithmically for the frequency distribution of the sample average of 65536 samples obtained in the same manner as in Example 1. created (see FIG. 6). Similar to conjugate HYB-193, histograms were also prepared for other conjugates: HYB1-106a, HYB1-15a, HYB1-374, HYB1-224, HYB3 and HYB5 (see FIG. 6). In addition, in the histogram of each complex, the frequency (frequency) on the vertical axis indicates a value normalized by the median value of each normal distribution.

- Determination of 5 miRNAs differentially expressed in cholangiocarcinoma from plasma samples -
[Example 3]
(Samples derived from healthy subjects: first and second steps)
In Example 1, the measurement sample was 5 μL of a solution containing miRNA extracted from plasma of a healthy subject. Otherwise, current change data over time was obtained in the same manner as in Example 1. Plasma was also obtained by centrifuging blood from healthy subjects. A solution containing miRNA was extracted from plasma using NucleoSpin miRNA Plasma (product number 740981.10, manufactured by Macharei Nagel).

(Samples derived from healthy subjects: third step)
For the frequency distribution of 65,536 sample averages obtained in the same manner as in Example 1, a histogram was created in which the interval time was displayed logarithmically (see FIG. 7A).

(Sample derived from test object: first and second steps)
In Example 1, the measurement sample was a solution containing miRNA extracted from the plasma of a person previously known to have bile duct cancer. Otherwise, current change data over time was obtained in the same manner as in Example 1. Plasma was also obtained by centrifuging blood from healthy subjects. A solution containing miRNA was extracted from plasma using NucleoSpin miRNA Plasma (product number 740981.10, manufactured by Macharei Nagel).

(Sample derived from test subject: third step)
For the frequency distribution of 65,536 sample averages obtained in the same manner as in Example 1, a histogram was created in which the interval time was displayed logarithmically (see FIG. 7B).

Two probes are used in the determination of two specific oligonucleotides that are differentially expressed in small cell lung cancer. By using these two types of probes 2-1 and 2-2, two types of specific oligonucleotides differentially expressed in small cell lung cancer, miR-20a and miR-17-5p and the two types of probes , and a complex HYB1-20a or HYB1-17-5p that forms only when only one of miR-20a or miR-17-5p is present, can be differentiated more clearly.

As shown in Example 1 and FIGS. 5 (B-1) to (B-4), various complexes (HYB0, HYB1-20a, HYB1 -17-5p and HYB2DUO), histograms showing a narrow distribution and a normal distribution were obtained, respectively. Specifically, when comparing the 90% confidence intervals in the histograms of each complex, these confidence intervals do not overlap. As such, histograms of different complexes can be compared and distinguished from each other with sufficient confidence.

On the other hand, as shown in FIGS. 5A-1 to 5A-4, in Comparative Example 1 in which normal population averaging processing was performed without performing processing based on the central limit theorem according to the present disclosure , broad distribution histograms were obtained for various complexes of the two specific oligonucleotides and the probe, respectively. Specifically, when comparing the 90% confidence intervals in the histograms of the respective complexes, these confidence intervals all overlap. Therefore, even if the histograms of various complexes are compared, it is almost impossible to distinguish each complex.
From these results, according to the determination method for determining the presence or absence of two or more specific oligonucleotides according to the present disclosure, the presence or absence of each of the two or more specific oligonucleotides, which was nearly impossible in Comparative Example 1, can be easily performed. , and can be determined with high accuracy.

Furthermore, as shown in FIG. 6, in the determination of five specific oligonucleotides that are differentially expressed in cholangiocarcinoma, the current change data over time is processed based on the central limit theorem according to the present disclosure. For each of the various complexes (HYB1, HYB3 and HYB5 for each of the five species), histograms showing narrow and normal distributions were obtained, respectively. Specifically, when comparing the 90% confidence intervals in the histograms of each complex, these confidence intervals do not overlap. As such, histograms of different complexes can be compared and distinguished from each other with sufficient confidence.

In addition, in the method for determining the presence of cholangiocarcinoma or the risk of cholangiocarcinoma using this determination method, a histogram (Fig. 7 (B )) shows a large difference in the distribution position (interval time) compared to the histogram (FIG. 7(A)) using samples derived from healthy subjects. Specifically, when comparing the 90% confidence intervals in both histograms, these confidence intervals do not overlap. Therefore, the test subject was determined to have a risk of suffering from bile duct cancer.

The histogram of Example 2 using a sample derived from a patient suffering from cholangiocarcinoma (Fig. 7 (B)) and the five specific oligonucleotides differentially expressed in the same cholangiocarcinoma There is a difference in the interval time at which the frequency distribution is observed between the histogram of Example 1 (FIG. 5-all 5 types) using the synthetic product and the difference in the concentration of the specific oligonucleotide. However, the histogram when using samples derived from patients with cholangiocarcinoma (Fig. 7(B)) is similar to that when using samples derived from patients without cholangiocarcinoma. Compared to the histogram (FIG. 7A), the 90% confidence intervals of both histograms do not overlap, so it can be said that there is a sufficient difference for the purpose of discrimination.

1N nanopore 1P nanopore through hole 2 lipid bilayer membrane 3 first solution 4 second solution 5A, 5B, 5C, 5D, 5E specific oligonucleotide 6 probe 7 voltage application means 100 determination device 101 CPU
102 ROMs
103 RAM
104 nonvolatile memory 105 bus 106 input/output interface (I/O)
110 Intranet 120 Current intensity time course measuring device 130 Display device

Claims (12)

(1) a first step of obtaining a mixture by mixing a probe having a sequence complementary to two or more specific oligonucleotides and a measurement sample, which is a nucleic acid solution or a solution obtained by extracting nucleic acid from a clinical sample; ,
(2) applying a voltage between a first solution containing the mixture and a second solution separated from each other by a lipid bilayer membrane having nanopores, and a second step of measuring over time the current intensity of the current flowing between to obtain current change data over time;
(3-1) obtaining a plurality of interval times from the current change data over time;
(3-2) For the plurality of interval times, a step A of randomly selecting a plurality of interval times from a population of the plurality of interval times as a sample group based on the central limit theorem; A frequency distribution is obtained by performing a process including a step B of obtaining the sample average of the population and a step C of repeating the steps A and B,
(3-3) identifying a containing pattern derived from the two or more specific oligonucleotides based on the frequency distribution,
(3-4) a third step of determining the presence or absence of each of the two or more specific oligonucleotides in the measurement sample from the content pattern;
including
The probe is designed such that the interval time differs depending on the type of the two or more specific oligonucleotides.
A determination method for determining the presence or absence of two or more specific oligonucleotides. 2. The determination method according to claim 1, wherein the probe is a probe containing all sequences complementary to each of the two or more specific oligonucleotides in one molecule. The order of sequences complementary to the two or more specific oligonucleotides in the probe is selected so that the free energy of the complex between the probe and the two or more specific oligonucleotides is the lowest. , the determination method according to claim 2. 2. The determination method according to claim 1, wherein the probe comprises two or more probes complementary to different specific oligonucleotides. Between the first step and the second step,
Annealing the mixture,
The determination method according to any one of claims 1 to 4. The specific oligonucleotide is miRNA,
wherein the probe is an oligodeoxyribonucleotide
The determination method according to any one of claims 1 to 5. The probe has a polydeoxycytosine structure at the 3' end,
The determination method according to any one of claims 1 to 6. The probe has a hairpin structure at the 5' end,
The determination method according to any one of claims 1 to 7. The third step is
The frequency distribution is the first frequency distribution,
A second frequency distribution obtained by performing the above (3-1) and (3-2) using a solution in which the presence or absence of each of the two or more specific oligonucleotides is known as the measurement sample; comparing the first frequency distribution with
The determination method according to any one of claims 1 to 8. The third step is
Based on the first frequency distribution, further comprising determining the content of each of the two or more specific oligonucleotides in the measurement sample,
The determination method according to claim 9. The third step is
A third frequency distribution obtained by performing the above (3-1) and (3-2) using a solution in which the content of each of the two or more specific oligonucleotides is known as the measurement sample; and , with the first frequency distribution,
The determination method according to claim 10. comprising a CPU and a memory,
The memory stores a program for determining the presence or absence of two or more specific oligonucleotides in a process including the following (3-1A) to (3-4A):
(3-1A) the first solution and the second solution obtained by applying a voltage between the first solution and the second solution separated from each other by a lipid bilayer membrane having nanopores; Determining a plurality of interval times from the current time course data of the current intensity of the current flowing between , a nucleic acid solution or a measurement sample that is a solution obtained by extracting nucleic acid from a clinical sample,
(3-2A) For the plurality of interval times, a step A of randomly selecting a plurality of interval times from a population of the plurality of interval times as a sample group based on the central limit theorem; Obtaining a frequency distribution by performing a process including a step B of obtaining the sample average of the population and a step C of repeating the steps A and B;
(3-3A) identifying a containing pattern derived from the two or more specific oligonucleotides based on the frequency distribution;
(3-4A) determining the presence or absence of each of the two or more specific oligonucleotides in the measurement sample from the content pattern;
A determination device configured to determine the presence or absence of two or more specific oligonucleotides by the process including the above (3-1A) to (3-4A), wherein the probe has the interval time of the two types A determination device designed to differ depending on the type of the above specific oligonucleotide.

Images