JP7194950B2 - Manufacture of hydroxytyrosol - Google Patents

Description

The present disclosure relates to microorganisms and methods for producing hydroxytyrosol.

Hydroxytyrosol (hereinafter sometimes abbreviated as “HTY”) is obtained from natural products such as olives, but it is extremely difficult to purify and is very expensive (1 million yen/kg). Although it is possible to produce a high-purity product by chemical synthesis, the price is still high (200,000 yen/kg). Therefore, a new method for synthesizing hydroxytyrosol using biotechnology is being investigated.
There are two methods of synthesis using biotechnology: bioconversion and fermentation. Relatively high yields of hydroxytyrosol can be obtained in bioconversion (∼6 g/L, Non-Patent Document 1, Non-Patent Document 2). However, tyrosine, tyrosol, and DOPA, which are substrates in bioconversion, are very expensive (several thousand yen to several tens of thousands of yen/kg), which causes the production price of hydroxytyrosol to soar. Moreover, tyrosol is derived from fossil resources, and its use is socially unfavorable because it deviates from the framework for promoting recent Sustainable Development Goals (SDGs).
On the other hand, the sugar used as the raw material in the fermentation method is inexpensive (several hundred yen/kg), but the amount of hydroxytyrosol produced by the fermentation method is low (~0.65 g/L, Non-Patent Document 3). It was impossible to produce tyrosol cheaply.

On the other hand, a method for efficiently producing aromatic compounds such as tyrosine, phenylalanine, and 2-phenylethanol (phenethyl alcohol, 2PE) from sugars such as glucose using recombinant E. coli with an enhanced shikimate pathway has been reported. (Patent Document 1).
In addition, a method for efficiently producing aromatic compounds such as tyrosol (4-hydroxyphenylethanol, 4HPE) and 2PE from sugars such as glucose using recombinant E. coli with an extended shikimate pathway was reported (non Patent Document 4).
This non-patent document 4 discloses that the phenylalanine-auxotrophic recombinant E. coli (ΔpheA) in which the pheA gene is deleted suppresses by-products and doubles the yield of tyrosol (4HPE) (id. Table 5, and page 6211, right column, first paragraph, etc.).

WO2019/030808

Z. Bouallagui and S. Sayadi, Bioconversion of p-Tyrosol into Hydroxytyrosol under Bench-Scale Fermentation, BioMed Research International Volume 2018, Article ID 7390751 Chaozhi Li et al., Efficient Synthesis of Hydroxytyrosol from l-3,4-Dihydroxyphenylalanine Using Engineered Escherichia coli Whole Cells, J. Agric. Food Chem., 2019, 67, 24, 6867-6873 Xianglai Li et al., Establishing an Artificial Pathway for Efficient Biosynthesis of Hydroxytyrosol, ACS Synth Biol. 2018, 16;7(2):647-654 Koma et al., Production of Aromatic Compounds by Metabolically Engineered Escherichia coli with an Expanded Shikimate Pathway, Appl. Environ. Microbiol. 78:6203-6216, 2012

FIG. 1 shows an outline of synthetic routes from glucose to tyrosol (4HPE), 2-phenylethanol (2PE), and hydroxytyrosol (HTY) using the shikimate pathway and the extended shikimate pathway. FIG. 1.
In order to synthesize hydroxytyrosol (HTY), tyrosol (4HPE), 2-phenylethanol (2PE), etc. from carbohydrate raw materials in Escherichia coli, at least 4-hydroxyphenylpyruvic acid (4HPP) or A pathway is required to convert phenylpyruvate (PP) to 4-hydroxyphenylacetaldehyde (4HPAAL) or phenylacetaldehyde (PAAL), respectively. For that pathway, a phenylpyruvate decarboxylase gene (pdc gene) from a foreign species is introduced (extended shikimate pathway).
In addition, in order to improve the yield of tyrosol (4HPE), which is an upstream compound of hydroxytyrosol (HTY), it is preferable to delete the phenylalanine synthesis pathway of the strain (ΔpheA) (Table 5 of Non-Patent Document 4). , and page 6211, right column, first paragraph, etc.).

The present inventors enhanced the expression of genes related to the shikimate pathway and the extended shikimate pathway and deleted the pheA gene according to the teachings described in Non-Patent Document 4 and Patent Document 1. A hydroxytyrosol-producing recombinant E. coli strain was generated (see Figure 2). In Figure 2, bold arrows indicate that overexpression is inducible.
A hydroxytyrosol-producing recombinant E. coli strain introduced with a pdc gene and having a phenylalanine auxotrophy (ΔpheA) as shown in FIG. Hydroxytyrosol could be produced. However, the present inventors have found a new problem that this strain cannot be used for industrial production of hydroxytyrosol because the strain itself grows poorly in large-scale culture in a jar fermenter even when phenylalanine is added. Found it.

The present disclosure provides a recombinant strain capable of improving the productivity of hydroxytyrosol and a method for producing hydroxytyrosol using the strain.

The present disclosure provides that an exogenous gene encoding an enzyme having 4-hydroxyphenylpyruvate decarboxylase activity is expressably introduced, the endogenous pheA gene is disrupted, the endogenous tyrB gene is disrupted, and hydroxytyrosol It relates to a transformant of the genus Escherichia, which has the ability to produce

The present disclosure relates to a method for producing hydroxytyrosol, comprising reacting a carbohydrate raw material with a transformant according to the present disclosure.

According to the present disclosure, it is possible to provide a transformant of the genus Escherichia capable of improving the productivity of hydroxytyrosol, and a method for producing hydroxytyrosol using the transformant.

FIG. 1 outlines synthetic routes from glucose to aromatic compounds such as phenylalanine, 2-phenylethanol (2PE), tyrosine, tyrosol (4HPE), and hydroxytyrosol (HTY). The shikimate pathway and the extended shikimate pathway (such as an introduced exogenous pdc gene) are utilized. FIG. 2 shows an outline of the HTY synthesis route in a strain (Example F strain) in which an attempt was made to improve the productivity of HTY based on the prior art (Non-Patent Document 4). In the F strain, gene expression of the shikimate pathway and the extended shikimate pathway is enhanced (induction of expression, bold line and bolded part). The F strain is also phenylalanine auxotrophic (ΔpheA) due to the deletion of the pheA gene. Strains with enhanced shikimate pathway and extended shikimate pathway gene expression and ΔpheA have worse growth potential in large-scale culture. FIG. 3 shows an outline of the Ehrlich pathway (dotted arrow) responsible for the deterioration of its proliferative capacity. Due to the action of the Ehrlich pathway, the strain quickly depletes phenylalanine even when phenylalanine is added, resulting in poor growth and accumulation of 2PE in the culture medium. FIG. 4 outlines the synthetic route from carbohydrate raw materials to HTY in transformant strains according to the present disclosure. Since the tyrB gene is disrupted in the transformed strain according to the present disclosure, the Ehrlich pathway does not function, phenylalanine is not consumed, and the growth of the strain is improved. On the other hand, even when the tyrB gene is disrupted, it does not become tyrosine auxotrophic when complemented by other amino acid aminotransferases such as IlvE, AlaC and AspC. FIG. 5 is a graph showing the observation of the growth of strain F in Examples and the production of hydroxytyrosol by glucose fed-batch culture (fermentation). ● indicates the number of bacteria (OD ₆₆₀ ). △, ■, ◇, and 〇 are the hydroxytyrosol concentration (g/L), tyrosol concentration (g/L), 2-phenylethanol concentration (g/L), and Phenylalanine concentration (g/L) is shown. FIG. 6 is a graph showing observations of the growth of strain G in Examples and the production of hydroxytyrosol by glucose fed-batch culture (fermentation). ● indicates the number of bacteria (OD ₆₆₀ ). △, ■, ◇, and 〇 are the hydroxytyrosol concentration (g/L), tyrosol concentration (g/L), 2-phenylethanol concentration (g/L), and Phenylalanine concentration (g/L) is shown. FIG. 7 is a graph showing observations of the growth of strain G in Examples and the production of hydroxytyrosol by glucose fed-batch culture (fermentation). ● indicates the number of bacteria (OD ₆₆₀ ). Δ, ▪, and ◯ indicate the hydroxytyrosol concentration (g/L), tyrosol concentration (g/L), and phenylalanine concentration (g/L) in the reaction solution (or medium), respectively.

In order to improve the efficiency of producing hydroxytyrosol from glucose, the present inventors enhanced the gene expression of the shikimate pathway and the extended shikimate pathway and prepared strains modified to require phenylalanine. However, although this strain does not appear to have any problems with growth when cultured in a test-tube level, it presents a new problem of markedly reduced growth when cultured in large amounts in a jar fermenter (bioreactor) or the like. served.
The present disclosure is based on the finding that this new problem is solved by a strain with a modification that disrupts the tyrB gene.
The use of this strain can produce a particularly remarkable effect that the efficiency of hydroxytyrosol production from carbohydrate raw materials can be improved in a large-scale culture system such as a jar fermenter.

Although the details of the mechanism of the above effect in the present disclosure are not clear, it is presumed as follows. The Ehrlich pathway is presumed to be responsible for the reduced growth of strains with enhanced shikimate and extended shikimate pathways and altered phenylalanine auxotrophy (ΔpheA) (FIG. 3). That is, the added phenylalanine is consumed and depleted for synthesis of 2-phenylethanol and the like rather than for protein synthesis (proliferation of bacterial cells). In the transformant according to the present disclosure, the tyrB gene is disrupted so that the Ehrlich pathway does not function, the consumption of phenylalanine is suppressed, the proliferation of the cells is restored, and the productivity of HTY is improved ( Figure 4).
However, the present disclosure may not be construed as being limited to this mechanism.

[Transformant]
A transformant according to the present disclosure is a transformant of a fungus belonging to the genus Escherichia.
In one or more embodiments, Escherichia bacteria include Escherichia coli (Escherichia coli).
E. coli includes E. coli K12 and B strains, and strains derived therefrom. Strains derived from the E. coli K12 strain include MG1655, W3110, W1330, JM109, HST02, HB101, DH5α, and DE3 strains in which the lambda DE3 gene is integrated into their chromosomes. Strains derived from the B strain include BL21, BL21(DE3), and the like.
Escherichia coli may be naturally occurring mutants derived from these strains or artificially genetically modified strains.

In the present disclosure, gene names refer to E. coli gene names unless otherwise specified. In the present disclosure, genes may include orthologues (homologues derived from other species) of the E. coli gene. In the present disclosure, unless otherwise specified, the gene sequences are those of the wild type (for example, K-12 strain in the case of Escherichia coli), or are registered in databases (NCBI GENBANK, etc.) at the time of filing the application. However, the sequence may be different within the range that it performs the same function as the wild type or encodes the same protein as the wild type, and it may be an orthologous sequence. The gene may also be codon optimized for expression in the host.
In the present disclosure, "orthologue" means a related gene with a homologous function that exists in different organisms.
In the present disclosure, the term “derived enzyme” refers to, in one or more embodiments, having an identity of 70% or more, 80% or more, 90% or more, 95% or more, 96% or more to the amino acid sequence of the original enzyme. , 97% or more, 98% or more, or 99% or more of the amino acid sequence.

[pdc gene]
The transformant of the present disclosure has introduced an exogenous gene encoding an enzyme having 4-hydroxyphenylpyruvate decarboxylase activity so that it can be expressed.
In the present disclosure, 4-hydroxyphenylpyruvate decarboxylase activity refers to an enzymatic activity capable of catalyzing the reaction of 4-hydroxyphenylpyruvate (4HPP) to 4-hydroxyphenylacetaldehyde (4HPAAL). A gene encoding an enzyme having such enzymatic activity is referred to as a pdc gene in the present disclosure.
In one or more embodiments, the enzyme having 4-hydroxyphenylpyruvate decarboxylase activity is an enzyme that is not possessed by the host fungus of the genus Escherichia, that is, an exogenous enzyme, from the viewpoint of improving HTY productivity. is preferably
In one or more embodiments, the enzyme having 4-hydroxyphenylpyruvate decarboxylase activity is phenylpyruvate decarboxylase of bacteria of the genus Azospirillum or yeast of the genus Saccharomyces, and derived from these enzymes.
Phenylpyruvate decarboxylase of bacteria of the genus Azospirillum includes phenylpyruvate decarboxylase of Azospirillum brasilense (NBRC102289) (GenBank ALJ36000.1) and enzymes derived therefrom.
Saccharomyces yeast phenylpyruvate decarboxylase includes S. ARO10 of S. cerevisiae (GenBank DAA12223.1) and enzymes derived therefrom.
The pdc gene introduced into the transformant according to the present disclosure is, in one or more embodiments, an exogenous gene encoding the above enzyme or an orthologue thereof.
Introduction of an exogenous pdc gene expands the shikimate pathway, converts PP and 4HPP from the shikimate pathway to PAAL and 4HPAAL, respectively, and enables the production of various aromatic compounds (extended shikimate pathway, Fig. 1).

In the present disclosure, the method of “introducing a gene to be expressible” is not particularly limited, but in one or more embodiments, it includes a method of introducing the gene together with an expression regulatory sequence such as a promoter capable of inducing enhanced expression of the gene. .
In the present disclosure, a gene introduced together with an expression-inducible promoter may be a single gene or an operon capable of expressing multiple genes.
In one or a plurality of embodiments, a T7 promoter is an example of a promoter that can induce increased gene expression. When using a T7 promoter for expression induction, the host microorganism is preferably a strain having the T7 RNA polymerase gene. Host microorganisms, in one or more embodiments, include the DE3 strain, which is a lysogenized λDE3 phage.
Promoters capable of inducible gene expression enhancement include, in one or more embodiments, phage PL promoter of λ phage (promoter whose expression is induced by heat), arabinose promoter of arabinose operon (promoter whose expression is induced by arabinose ), tet promoter (a promoter whose expression is induced by tetracycline), promoters of constitutive proteins such as tyrR, and constitutive artificial promoters.
The method of introducing the gene into the host is not particularly limited, but in one or more embodiments, a method of introducing with a plasmid and a method of integrating into the host chromosome can be mentioned.
In the present disclosure, the method of introducing a gene into a chromosome together with an expression-inducible promoter is not particularly limited, but in one or more embodiments, the method described in the example (Koma et al. 2012. Appl. Microbiol. 93: 815-829). The contents of this document are incorporated by reference as forming part of the present disclosure.
When the introduced gene is integrated on the chromosome, the locus of the gene may be the locus of the gene originally provided in the host genome, or the locus of the host chromosome other than the locus of the gene may be introduced.

[Phenylalanine auxotrophy]
A transformant according to the present disclosure has a disrupted pheA gene in the host genome, that is, the endogenous pheA gene.
In the present disclosure, the "pheA" gene is a gene encoding chorismate mutase and prephenate dehydratase, which in one or more embodiments is GENBANK GeneID: 947081.
In the present disclosure, disruption of the pheA gene means that, in one or more embodiments, mutation of the pheA gene or its expression regulatory sequence (addition, substitution, and/or deletion of base sequence, etc.) causes the pheA gene or that the function of the gene product of the wild-type pheA gene is suppressed or lost, or that the transformant becomes phenylalanine auxotrophic (ΔpheA) It means that there is

It is known that 4HPE productivity is improved when a mutation that causes phenylalanine auxotrophy (ΔpheA) is introduced in a strain having a shikimate pathway and an extended shikimate pathway (Non-Patent Document 4. Table 5, page 6211, right column, first paragraph, etc.). Therefore, it was assumed that the productivity of HTY located downstream of 4HPE on the synthetic pathway would also be improved by using ΔpheA as the HTY-producing strain (FIG. 2).
Therefore, when a strain was prepared with ΔpheA as the HTY-producing strain, no problem was observed in the proliferation of this strain when cultured at the test tube level. However, when this strain is cultured on a large scale such as a jar fermenter, the growth rate is remarkably reduced. was found by the inventors (Example F strain, Figure 5).
In large-scale culture, the effect of the Ehrlich pathway becomes greater, depleting phenylalanine, which is thought to adversely affect growth (Fig. 3).

[Disruption of endogenous tyrB gene]
A transformant according to the present disclosure has a disrupted tyrB gene in the host genome, ie, a disrupted endogenous tyrB gene.
In the present disclosure, the "tyrB" gene is a gene encoding tyrosine aminotransferase, and in one or more embodiments, GENBANK GeneID: 945031.
In the present disclosure, disruption of the tyrB gene means that, in one or more embodiments, mutation of the tyrB gene or its expression regulatory sequence (addition, substitution, and/or deletion of base sequence, etc.) causes the tyrB gene to Alternatively, it means that the function of the gene product of the wild-type tyrB gene is suppressed or lost.

Shikimate pathway, and strains that have an extended shikimate pathway and are phenylalanine auxotrophic (ΔpheA), since the phenylalanine added to the medium is consumed by the Ehrlich pathway (Fig. 3), large-scale culture However, disruption of the endogenous tyrB gene can overcome the problem of the Ehrlich pathway (Fig. 4).
Disruption of the tyrB gene was thought to result in tyrosine auxotrophy, but may not result in tyrosine auxotrophy. For example, the presence of other amino acid aminotransferases such as IlvE, AlaC, AspC complements the function of the tyrB gene product and renders it non-tyrosine auxotrophic. A transformant according to the present disclosure, in one or more embodiments, is not tyrosine-requiring.
The presence of amino acid aminotransferases such as IlvE, AlaC and AspC does not inhibit growth. This is probably because the Phe→PP activity of these enzymes is not high and the Ehrlich pathway does not work easily.

In the present disclosure, the method for disrupting the host genome gene (endogenous gene) is not particularly limited, and in one or more embodiments, site-specific recombination is performed. Site-specific recombination, in one or more embodiments, a method using a CRIM plasmid, a method using the Cre / LoxP system, a method using the budding yeast recombinase FLP and FRT sequences, a CRISPR / Cas9 system A method using P1 transduction, a method using P1 transduction, and the like.

[Production capacity of hydroxytyrosol]
A transformant according to the present disclosure has the ability to produce hydroxytyrosol (HTY). A transformant according to the present disclosure, in one or more embodiments, has the ability to produce HTY from a carbohydrate raw material.
From the viewpoint of efficient production of HTY, the transformant according to the present disclosure, in one or more embodiments, introduces a gene encoding an enzyme having 4-hydroxyphenylethanol-3-hydroxylase activity so that it can be expressed. It is preferable that
From the viewpoint of efficient production of HTY, the transformant according to the present disclosure, in one or more embodiments, contains an expressible gene encoding an enzyme having 4-hydroxyphenylacetaldehyde reductase activity. is preferred.

[Enzyme having 4-hydroxyphenylethanol-3-hydroxylase activity]
Enzymes with 4-hydroxyphenylethanol-3-hydroxylase activity in the present disclosure are those capable of catalyzing the chemical reaction of tyrosol (4HPE) to hydroxytyrosol (HTY) (Figure 1).
As an enzyme having 4-hydroxyphenylethanol-3-hydroxylase activity, in one or more embodiments, 4-hydroxyphenylacetate-3-hydroxylase (4-hydroxyphenylacetate-3-monooxygenase) can be used. .
The enzyme having 4-hydroxyphenylethanol-3-hydroxylase activity in the present disclosure is not limited as long as it has the catalytic function described above, but from the viewpoint of efficiently producing HTY, in one or more embodiments, Binary enzymes are preferred, and more preferred are _two -component FAD-dependent monooxygenases that use the reduced form of the flavin adenine nucleotide (FAD), FADH2, as a coenzyme.

From the viewpoint of efficiently producing HTY, the enzyme having 4-hydroxyphenylethanol-3-hydroxylase activity in the present disclosure is the gene product of the hpaBC gene of Escherichia coli (hpaB: GenBank ACT46003.1, hpaC: GenBank ACT46002.1). ), and enzymes derived therefrom or gene products of their orthologs.
In one or more embodiments, the enzyme includes the gene product of the hpaAC gene of Pseudomonas aeruginosa (hpaA: GenBank AAG07478.1, hpaC: GenBank AAG07479.1), or the phenol- 2-hydroxylase (component A: GenBank AAF66546.1, component B: GenBank AAF66547.1), and enzymes derived therefrom or gene products of orthologs thereof.

[Enzyme having 4-hydroxyphenylacetaldehyde reductase activity]
Enzymes with 4-hydroxyphenylacetaldehyde reductase activity in the present disclosure are those capable of catalyzing the chemical reaction of 4-hydroxyphenylacetaldehyde (4HPAAL) to tyrosol (4HPE) (Figure 1).
The enzyme having 4-hydroxyphenylacetaldehyde reductase activity is not limited as long as it has the above catalytic function. gene products (GenBank AAC77226.2), E. coli yqhD (GenBank AAC76047.1) and enzymes derived therefrom, or gene products of orthologs thereof.
Among these, yahK and yjgB are more preferable, and yahK is even more preferable, from the viewpoint of efficiently producing HTY.

[Enhancement of shikimate pathway]
From the viewpoint of efficiently producing HTY, the transformant according to the present disclosure preferably has enhanced expression of a gene (group) related to the shikimate pathway in one or more embodiments. ) is preferably introduced so that it can be expressed, and more preferably introduced into the host chromosome so that it can be expressed.

From the viewpoint of efficient production of HTY, the transformant according to the present disclosure preferably has all of the following five genes (1) to (5) introduced so that they can be expressed on the host chromosome. It is more preferable that it is introduced as possible.
(1) aroA
(2) aroB
(3) aroC
(4) aroG ^fbr or aroF ^fbr
(5) tyrA ^fbr
In addition to the above (4) and (5), introduction of all of the above (1) to (3) so that they can be expressed can reduce the metabolic load due to the above expression enhancement of (4) and (5).

In the present disclosure, the “aroA” gene is a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase, and in one or more embodiments, GENBANK GeneID: 945528.
In the present disclosure, the “aroB” gene is a gene encoding 3-dehydroquinate synthase, and in one or more embodiments, GENBANK GeneID: 947927.
In the present disclosure, the "aroC" gene is a gene encoding chorismate synthase, and in one or more embodiments, GENBANK GeneID: 946814.
In the present disclosure, the “aroG” gene is a gene encoding 3-deoxy-D-arabino-7-phosphohepturonate synthase, and in one or more embodiments, GENBANK GeneID: 645605.
In the present disclosure, the “aroG ^fbr ” gene refers to the feedback-inhibiting desensitizing mutant of aroG. For the aroG ^fbr , one disclosed in JP-A-05-236947 can be used in one or more embodiments. The contents of this document are incorporated by reference as forming part of the present disclosure.
In the present disclosure, the “aroF” gene is a gene encoding 3-deoxy-D-arabino-7-phosphohepturonate synthase, and in one or more embodiments, GENBANK GeneID: 947084.
In the present disclosure, the “aroF ^fbr ” gene refers to the feedback-inhibiting desensitizing mutant of aroF. For aroF ^fbr , in one or more embodiments, the one disclosed in JP-A-05-236947 can be used.
In the present disclosure, the "tyrA" gene is a gene encoding chorismate mutase and prephenate dehydrogenase, and in one or more embodiments, GENBANK GeneID: 947115.
In the present disclosure, the “tyrA ^fbr ” gene refers to the feedback-inhibiting desensitizing mutant of tyrA. For tyrA ^fbr , in one or more embodiments, one disclosed in JP-A-05-076352 can be used. The contents of this document are incorporated by reference as forming part of the present disclosure.

From the viewpoint of efficiently producing HTY, the transformant according to the present disclosure can express the following two genes (6) and (7) in addition to the above five genes (1) to (5). It is preferably introduced, and more preferably introduced into the host chromosome so that it can be expressed.
(6) ppsA
(7) tktA
Here, when a T7 promoter is used as an expression-inducible promoter, the (7) tktA promoter should be a mutant T7 promoter with reduced expression-inducibility from the viewpoint of improving the productivity of the target aromatic compound. is preferred.

In the present disclosure, the "ppsA" gene is a gene encoding phosphoenolpyruvate synthase, and in one or more embodiments, GENBANK GeneID: 946209.
In the present disclosure, the "tktA" gene is a gene encoding transketolase 1, and in one or more embodiments, GENBANK GeneID: 947420.

From the viewpoint of efficiently producing HTY, the transformant according to the present disclosure has at least one of the following (8) to (10) in addition to the above seven genes (1) to (7), more preferably It is preferable that two, more preferably three genes are introduced so that they can be expressed, and more preferably that they are introduced into the host chromosome so that they can be expressed.
(8) aroD
(9) aroE or ydiB
(10) aroL or aroK
Although aroE or ydiB in (9) above can be substituted for each other, aroE is preferable as the gene in (9) above from the viewpoint of efficient production of HTY.
Although aroL or aroK in (10) above can be substituted for each other, aroL is preferable as the gene in (10) above from the viewpoint of efficient production of HTY.

In the present disclosure, the "aroD" gene is a gene encoding 3-dehydroquinate dehydratase, and in one or more embodiments, GENBANK GeneID: 946210.
In the present disclosure, the “aroE” gene is a gene encoding dehydroshikimate reductase, and in one or more embodiments, GENBANK GeneID: 947776.
In the present disclosure, the “ydiB” gene is a gene encoding quinate/shikimate 5-dehydrogenase, and in one or more embodiments, GENBANK GeneID: 946200.
In the present disclosure, the "aroL" gene is a gene encoding shikimate kinase II, and in one or more embodiments, GENBANK GeneID: 945031.
In the present disclosure, the "aroK" gene is a gene encoding shikimate kinase I, and in one or more embodiments, GENBANK GeneID: 2847759.

[Method for producing hydroxytyrosol]
The method for producing hydroxytyrosol according to the present disclosure relates to a production method including a step of reacting a carbohydrate raw material with a transformant according to the present disclosure.
This "reaction" in the present disclosure can also be called "culture" or "fermentation."
Carbohydrate raw materials to be reacted with the transformant according to the present disclosure include sugars and sugar alcohols. Sugars include glucose, xylose, arabinose, blackstrap molasses, and the like. Sugar alcohols include glycerin and the like.
In one or more embodiments, the reaction between the sugar raw material and the transformant according to the present disclosure is performed by inducing expression introduced into the transformant according to the present disclosure cultured in a liquid medium up to a predetermined amount, and then , can be carried out by adding a saccharide raw material to the medium during culture.
Cultivation of the transformant according to the present disclosure can be performed under the conditions of ordinary culture methods, except that the transformant is phenylalanine auxotrophic, and the reaction step can also be performed under conventional fermentation or reaction conditions.
The culture medium contains phenylalanine and other components such as a carbon source, a nitrogen source, a phosphorus source, a sulfur source, minerals and vitamins, and is not particularly limited as long as the microorganism of the present disclosure can grow. The content (initial concentration) of phenylalanine in the medium is, in one or more embodiments, 0.2 to 10 mM or 1 to 8 mM.
Cultivation of the transformant according to the present disclosure is preferably carried out in an apparatus capable of large-scale cultivation, such as a jar fan mentor or a bioreactor, from the viewpoint of improving the production of hydroxytyrosol.
Cultivation of the transformant according to the present disclosure is preferably fed-batch culture in which carbohydrate raw materials are added during the culture, from the viewpoint of improving the production of hydroxytyrosol.

For the method for producing hydroxytyrosol by fed-batch culture of carbohydrate raw materials, for example, the methods in Examples can be referred to. Briefly, preculture is performed, inoculated in a minimal medium at a concentration of 1 to 10%, cultured, and when OD ₆₆₀ reaches 0.5 to 20, expression is induced (for example, 1 mM isopropyl After adding β-D-thiogalactopyranoside (IPTG)) and culturing for 2 to 5 hours, the sugar solution as a raw material was fed at a predetermined feeding speed and reacted for 20 to 35 hours, and the culture solution was added. and/or to obtain hydroxytyrosol within the fungus.

[Incubation temperature]
Examples include temperatures at which microorganisms can grow. From the viewpoint of growth rate, the optimum culture temperature for the organism is preferred. For E. coli, in one or more embodiments, 25°C to 40°C or 30°C to 37°C is mentioned.
[Culture medium]
There are no restrictions as long as the medium can grow microorganisms. The medium, in one or more embodiments, is a liquid medium. Natural media such as LB medium to which phenylalanine is added, and synthetic media such as M9 and HCF medium in Examples to which phenylalanine is added are included. Synthetic media are preferred when purification of compounds is considered.
[Culture pH]
The culture pH ranges from 6.0 to 7.5 in one or more embodiments, and around 7.0 or from 6.2 to 7.2 in other aspects.
[Amount of saccharide raw material added to medium (flow rate)]
The amount of sugar solution to be added is adjusted depending on the type of bacteria, the amount of cells, and the culture conditions. In one or more embodiments, it is preferable to feed the sugar raw material so that as much of the added sugar raw material as possible is converted to HTY. In one or a plurality of embodiments, it is preferable to add acetic acid or the like within a range where the amount of by-products such as acetic acid can be suppressed.
In one or more embodiments, the carbohydrate raw material is added so that the concentration in the medium is in the range of 0-2 g/L, preferably 0.1-1 g/L.
The total amount of the sugar raw material to be added varies depending on the type of bacteria and the culture conditions, but the amount is preferably such that almost all of the added sugar raw material is consumed by the cells. In the case of E. coli, in one or more embodiments, about 100 to 300 g / L [Culture time]
As for the culture time, in one or a plurality of embodiments, it is preferable to culture until the sugar raw material fed is exhausted.
However, culture conditions are not limited to these.

The present disclosure, in one or more embodiments, may relate to;
<1> introducing an exogenous gene encoding an enzyme having 4-hydroxyphenylpyruvate decarboxylase activity so that it can be expressed;
the endogenous pheA gene is disrupted,
the endogenous tyrB gene is disrupted, and
A transformant of the genus Escherichia having the ability to produce hydroxytyrosol.
<2> The transformant according to <1>, wherein the enzyme having 4-hydroxyphenylpyruvate decarboxylase activity is phenylpyruvate decarboxylase of bacteria of the genus Azospirillum or yeast of the genus Saccharomayces.
<3> The transformant of <1> or <2>, further comprising an expressible gene encoding an enzyme having 4-hydroxyphenylethanol-3-hydroxylase activity.
<4> The transformant according to any one of <1> to <3>, further comprising an expressible gene encoding an enzyme having 4-hydroxyphenylacetaldehyde reductase activity.
<5> The transformant according to any one of <1> to <4>, wherein the following five genes (1) to (5) are introduced so as to be expressible.
(1) aroA
(2) aroB
(3) aroC
(4) aroG ^fbr or aroF ^fbr
(5) tyrA ^fbr
<6> The transformant according to any one of <1> to <5>, wherein the genes of (6) and (7) below are introduced so as to be expressible.
(6) ppsA
(7) tktA
<7> The transformant according to any one of <1> to <6>, wherein at least one of the following genes (8) to (10) is introduced in an expressible manner.
(8) aroD
(9) aroE or ydiB
(10) aroL or aroK
<8> A method for producing hydroxytyrosol, comprising the step of reacting the carbohydrate raw material with the transformant according to any one of <1> to <7>.
<9> The production method according to <8>, wherein the reaction is performed by fed-batch culture of the saccharide raw material.

EXAMPLES The present disclosure will be described in more detail below with reference to examples, but these are examples and the present disclosure is not limited to these examples.

The strains used in the examples are shown in Table 1.
In the present disclosure, "T7p" means T7lac promoter (T7 promoter with lac repressor added). In the present disclosure, "T7p _(-8TC) " means mutant T7p with reduced ability to induce expression. In this disclosure, "T7t" means the T7 terminator.

1. Preparation of A strain (tyrA insertion strain) (1) Preparation of plasmid pET21a-FRT-tyrA ^fbr EcTyrA-F (CCAACCATATGGTTGCTGAATTGACCGC, SEQ ID NO: 1) and EcTyrA-RM1 (CGCGAGGCCAAGATAGATGCCTCGGCGC, SEQ ID NO: 2) were prepared using E. coli MG1655 genomic DNA as a template. ）プライマーペア、ＥｃＴｙｒＡ－ＦＭ１（ＧＣＧＣＧＡＧＧＣＡＴＣＴＡＴＣＴＴＧＧＣＣＴＣＧＣＧ，配列番号３）とＥｃＴｙｒＡ－ＲＭ２（ＣＴＣＴＧＡＡＡＡＣＧＣＴＧＴＡＣＧＴＡＡＴＣＧＣＣＧＡＡＣ，配列番号４）プライマーペア、及びＥｃＴｙｒＡ－ＦＭ２（ＧＴＴＣＧＧＣＧＡＴＴＡＣＧＴＡＣＡＧＣＧＴＴＴＴＣＡＧＡＧ，配列番号５）とＥｃＴｙｒＡ－Ｒ（ＣＡＣＴＣＧＡＧＴＴＡＣＴＧＧＣＧＡＴＴＧＴＣＡＴＴＣＧＣＣ，配列番号６） Using the primer pairs, three DNA fragments were amplified with Phusion Hot Start II DNA polymerase. The conditions for the PCR reaction were based on the basic conditions described in the manual. Next, using the three amplified fragments as templates and a primer pair of EcTyrA-F and EcTyrA-R, overlap extension PCR was performed with Phusion Hot Start II DNA polymerase, and methionine at position 53 was replaced with isoleucine, and 354 A DNA (tyrA ^fbr ) encoding TyrA in which the th alanine was substituted with valine was obtained.
The amplified DNA and pET21a-FRT vector (Koma et al. 2012. Appl. Microbiol. Biotechnol. 93: 815-829) were digested with NdeI and XhoI, respectively, and the DNA was separated by 1% agarose gel electrophoresis, The DNA of interest was extracted and purified from the gel using the QIAquick Gel Extraction kit. The purified DNA was ligated by a conventional method, and the reaction solution was mixed with E. coli DH5α competent cells (manufactured by GMbiolab) and allowed to stand on ice for 40 minutes. After allowing to stand for 30 minutes, 900 μL of LB liquid medium was added and the mixture was incubated at 37° C. for 30 minutes. An appropriate amount of the bacterial solution was spread on an LB agar medium containing 20 µg/mL of kanamycin and cultured overnight at 37°C. Colony direct PCR was performed using a T7 promoter primer (TAATACGACTCACTATAGGG, SEQ ID NO: 7) and a T7 terminator primer (ATGCTAGTTATTGCTCAGCGG, SEQ ID NO: 8) to select a strain having the desired plasmid. OneTaq (manufactured by New England BioLabs) was used for colony direct PCR. Finally, the strain having the target plasmid was cultured overnight at 37°C using LB liquid medium containing 20 µg/mL kanamycin, and the target plasmid was extracted and purified using NucleoSpin Plasmid QuickPure.
Composition of LB agar medium (same below in this example): 10 g/L high polypeptone, 5 g/L powdered yeast extract D3-H, 10 g/L sodium chloride, 20 g/L agar, pH 7.0
Composition of LB liquid medium (same below in this example): 10 g/L high polypeptone, 5 g/L powdered yeast extract D3-H, 10 g/L sodium chloride, pH 7.0

(2) Preparation of A strain Introduction of the tyrA ^fbr gene into the E. coli chromosome was performed according to a previous report (Koma et al. 2012. Appl. Microbiol. Biotechnol. 93: 815-829). First, a solution containing DNA fragments to be introduced into chromosomes was prepared.上記で作製したプラスミドｐＥＴ２１ａ－ＦＲＴ－ｔｙｒＡ ^fbrを鋳型ＤＮＡとして、ｄｅｌｔａ－ｌｄｈＡ－ｆｅａＢ－Ｆ（ＡＡＡＴＡＴＣＴＧＴＴＴＴＡＡＣＴＡＡＴＴＧＧＣＧＴＴＧＣＡＧＴＡＣＡＴＧＣＡＡＣＧＣＣＡＡＴＴＡＧＡＴＴＣＣＧＧＧＧＡＴＣＣＧＴＣＧＡＣＣ，配列番号９）とｄｅｌｔａ－ｆｅａＢ－ＦＲＴ－Ｒ（ＴＧＣＣＧＴＴＴＴＴＴＡＣＴＴＡＴＧＡＧＣＧＡＡＣＣＡＧＡＴＴＡＡＴＡＣＣＧＴＡＣＡＣＡＣＡＣＣＧＡＡＴＴＣＧＣＣＡＡＴＣＣＧＧＡＴＡＴＡＧ，配列番号１０）のプライマーセットを用いA tyrA ^fbr gene (FRT-Km-FRT-T7p-tyrA ^fbr -T7t) containing two flipase recognition sequences (FRT) and a kanamycin resistance gene sequence (Km) was amplified by PCR. PrimeStar GXL (manufactured by Takara Bio Inc.) was used as the PCR enzyme, and the reaction was carried out according to the attached instructions. After purifying the amplified product by PCR using QIAquick PCR Purification Kit (manufactured by Qiagen), digesting it overnight with restriction enzyme DpnI, again, purified with QIAquick PCR Purification Kit (manufactured by Qiagen) for chromosome introduction was used as a DNA solution.
Next, an E. coli electroporation cell was prepared. Escherichia coli MG1655(DE3)/pKD46 strain was cultured in LB liquid medium containing 10 mM L-arabinose and 100 μg/mL carbenicillin at 30° C. until OD ₆₆₀ reached about 0.5. Next, 2 mL of the bacterial solution was centrifuged at 5,000 rpm and 4° C. for 5 minutes, the supernatant was discarded, and the bacterial cells were recovered. The cells were suspended in 1 mL of ice-cooled sterilized distilled water, centrifuged at 5,000 rpm and 4°C for 5 minutes, the supernatant was discarded, and the cells were collected. The cells were again suspended in 1 mL of ice-cooled sterilized distilled water, centrifuged at 5,000 rpm and 4°C for 5 minutes, the supernatant was discarded, and the cells were collected. The cells were suspended in 50 μL of ice-cooled sterilized distilled water to prepare an electroporation cell.
Next, 100 to 200 ng (about 1 μL) of a DNA fragment was added to the electroporation cell, the solution was transferred to an electroporation cuvette, and electroporation was performed using a MicroPulser electroporator (manufactured by Bio-Rad). . After adding 1 mL of LB liquid medium to the electroporation cuvette, the bacterial suspension was transferred to a 1.5 mL tube and shaken at 37° C. for about 2 hours. The bacterial solution was spread on an LB agar medium containing 50 µg/mL of kanamycin and cultured overnight at 37°C. From the colonies that appeared, Escherichia coli harboring the tyrA ^fbr gene at the ldhA-feaB locus was selected by colony direct PCR. According to the instructions attached to EmeraldAmp PCR Master Mix (manufactured by Takara Bio Inc.), a primer set of K2 (CGGTGCCCTGAATGAACTGC, SEQ ID NO: 11) and Down-feaB (CTGTTGAGTAACCCGAACAAAG, SEQ ID NO: 12) was added to the reaction solution, and colonies were converted to template DNA. PCR was performed in addition as After the reaction, electrophoresis was performed using 1% agarose gel to confirm a strain (A strain) in which the tyrA ^fbr gene was inserted at the ldhA-feaB locus.

2. Preparation of strain B (pdc insertion strain) (1) Preparation of plasmid pET21a-FRT-pdc An artificially synthesized pdc gene (SEQ ID NO: 13, with NdeI and XhoI sites added to the ends during synthesis) and pET21a-FRT. The DNA was digested with NdeI and XhoI, separated by 1% agarose gel electrophoresis, and purified using the QIAquick Gel Extraction kit. The purified DNA was ligated by a conventional method, transformed into Escherichia coli DH5α, and cultured overnight at 37° C. using LB agar medium containing 20 μg/mL kanamycin. Colony direct PCR was performed using a T7 promoter primer and a T7 terminator primer to select strains having the desired plasmid. Finally, the strain having the target plasmid was cultured overnight at 37°C using LB liquid medium containing 20 µg/mL kanamycin, and the target plasmid was extracted and purified using NucleoSpin Plasmid QuickPure.

配列番号１３：ATGAAACTGGCTGAAGCTCTGCTGCGTGCCCTGAAAGACCGTGGTGCTCAAGCGATGTTTGGTATTCCGGGTGATTTTGCTCTGCCGTTTTTCAAAGTGGCGGAAGAAACCCAGATTCTGCCGCTGCATACGCTGAGCCACGAACCGGCCGTTGGTTTTGCGGCCGATGCAGCTGCGCGTTATAGCTCTACCCTGGGTGTGGCAGCAGTTACGTACGGCGCTGGTGCGTTCAACATGGTCAATGCCGTGGCAGGTGCTTATGCGGAAAAATCACCGGTGGTTGTCATCTCGGGTGCACCGGGCACCACGGAGGGTAACGCTGGTCTGCTGCTGCATCACCAGGGTCGTACCCTGGATACGCAGTTTCAAGTCTTCAAAGAAATTACCGTGGCACAAGCACGTCTGGATGACCCGGCTAAAGCACCGGCAGAAATCGCACGTGTGCTGGGTGCTGCGCGTGCGCAGTCTCGTCCGGTTTACCTGGAAATTCCGCGTAACATGGTCAATGCGGAAGTTGAACCGGTCGGTGATGACCCGGCATGGCCGGTTGATCGTGACGCTCTGGCCGCATGCGCGGATGAAGTGCTGGCTGCGATGCGTAGTGCGACCTCCCCGGTTCTGATGGTTTGTGTCGAAGTGCGTCGCTATGGTCTGGAAGCGAAAGTGGCAGAACTGGCACAGCGTCTGGGTGTTCCGGTGGTTACCACGTTTATGGGCCGTGGTCTGCTGGCAGATGCTCCGACCCCGCCGCTGGGCACGTACATTGGTGTTGCTGGCGACGCGGAAATCACCCGTCTGGTCGAAGAATCAGATGGTCTGTTTCTGCTGGGCGCCATTCTGAGCGACACCAACTTCGCAGTGTCTCAGCGCAAAATTGACCTGCGTAAAACGATCCATGCCTTTGATCGCGCAGTCACCCTGGGTTATCACACGTACGCCGATATCCCGCTGGCAGGCCTGGTTGACGCTCTGCTGGAACGTCTGCCGCCGTCG GATCGTACCACGCGTGGCAAAGAACCGCATGCATATCCGACCGGTCTGCAGGCAGACGGTGAACCGATTGCACCGATGGATATCGCGCGTGCGGTGAATGACCGTGTTCGCGCGGGTCAAGAACCGCTGCTGATTGCCGCAGATATGGGCGACTGCCTGTTTACCGCGATGGATATGATCGACGCTGGTCTGATGGCGCCGGGCTATTACGCCGGTATGGGTTTCGGTGTCCCGGCAGGTATTGGTGCACAGTGCGTGTCAGGCGGTAAACGTATCCTGACCGTCGTGGGTGATGGCGCGTTTCAAATGACGGGTTGGGAACTGGGCAACTGTCGTCGCCTGGGTATTGATCCGATTGTGATCCTGTTCAACAATGCCAGTTGGGAAATGCTGCGCACCTTTCAGCCGGAATCCGCATTCAATGATCTGGATGACTGGCGTTTTGCGGACATGGCTGCGGGTATGGGTGGTGATGGTGTTCGTGTCCGTACCCGTGCGGAACTGAAAGCCGCACTGGATAAAGCATTTGCTACGCGCGGTCGTTTCCAACTGATTGAAGCCATGATCCCGCGTGGCGTGCTGTCGGATACCCTGGCTCGCTTCGTCCAAGGTCAAAAACGTCTGCATGCTGCCCCGCGTGAATAA

(2) Preparation of B strain A strain in which the pdc gene was inserted into the mtlA locus of the chromosomal DNA (B strain) was prepared in the same manner as the A strain.
In order to amplify the gene cassette for inserting the pdc gene into the chromosome by PCR, the plasmid pET21a-FRT-pdc was used as the template DNA, and delta-mtlA-F (TCGGGCTTCCAGCCTGCGCGACAGCAAAACATAGAAGGGGGTGTTTTTATGATTCCGGGGATCCGTCGACC, SEQ ID NO: 14) and delta-mtlA-FRT-F were used as the primers. A primer set of R (CTTCTCCATGTGGAGAGGGTGGGATTGGATTACTTACGACCTGCCAGCAGATTCGCCAATCCGGATATAG, SEQ ID NO: 15) was used. To confirm the insertion of the pdc gene into the mtlA locus, a primer set of K2 and Down-mtlA (GATCAACGACATCATCACCAATGC, SEQ ID NO: 16) was used.

3. Preparation of C strain (yahK insertion strain) (1) Preparation of plasmid pET21a-FRT-yahK Using the genomic DNA of E. coli MG1655 as a template, yahK-Nde (CCAACCATATGAAGATCAAAGCTGTTGGTG, SEQ ID NO: 17) and yahK-Xho (CACTCGAGTCAGTCTGTTAGTGTGCG, SEQ ID NO: 18) DNA containing the yahK gene was amplified with Phusion Hot Start II DNA polymerase using the primer pair of . The conditions for the PCR reaction were based on the basic conditions described in the manual. The amplified DNA and pET21a-FRT vector were digested with NdeI and XhoI, respectively, the DNA was separated by 1% agarose gel electrophoresis, and then the corresponding DNA was extracted and purified from the gel using the QIAquick Gel Extraction kit. The purified DNA was ligated by a conventional method, transformed into Escherichia coli DH5α, and cultured overnight at 37° C. using LB agar medium containing 20 μg/mL kanamycin. Colony direct PCR was performed using a T7 promoter primer and a T7 terminator primer to select strains having the desired plasmid. Finally, the strain having the target plasmid was cultured overnight at 37°C using LB liquid medium containing 20 µg/mL kanamycin, and the target plasmid was extracted and purified using NucleoSpin Plasmid QuickPure.

(2) Preparation of C strain A strain (C strain) in which the yahK gene was inserted into the pykA locus of the chromosomal DNA was prepared in the same manner as the A strain.染色体に挿入するための遺伝子カセットをＰＣＲで増幅するために、鋳型ＤＮＡにプラスミドｐＥＴ２１ａ－ＦＲＴ－ｙａｈＫ、プライマーにｄｅｌｔａ－ｐｙｋＡ－Ｆ（ＴＴＴＣＡＴＧＴＴＣＡＡＧＣＡＡＣＡＣＣＴＧＧＴＴＧＴＴＴＣＡＧＴＣＡＡＣＧＧＡＧＴＡＴＴＡＣＡＴＧＡＴＴＣＣＧＧＧＧＡＴＣＣＧＴＣＧＡＣＣ，配列番号１９）とｄｅｌｔａ－ｐｙｋＡ－ＦＲＴ－Ｒ（ＴＧＧＣＧＴＴＴＴＣＧＣＣＧＣＡＴＣＣＧＧＣＡＡＣＧＴＡＣＴＴＡＣＴＣＴＡＣＣＧＴＴＡＡＡＡＴＡＣＧＡＴＴＣＧＣＣＡＡＴＣＣＧＧＡＴＡＴＡＧ , SEQ ID NO: 20) was used. To confirm the insertion of the yahK gene into the pykA locus, a primer set of K2 and Down-pykA (GTACTGGGGATATTATTTACCCG, SEQ ID NO: 21) was used.

4. Preparation of strain D (hpaBC insertion strain) (1) Preparation of plasmid pET21a-FRT-hpaBC Using the chromosomal DNA of Escherichia coli BL21 as a template, hpaBC-F (GTTTAACTTTAAGAAGGAGATACATATGAAACCAGAAGATTTCCGC, SEQ ID NO: 22) and hpaBC-R (GTGGTGGGTGGTGGCTCGAGTTCCTGCT3, SEQ ID NO: 22) The hpaBC operon was amplified by PCR using the primer set of . Phusion Hot Start II DNA Polymerase (manufactured by Thermo Fisher Scientific) was used as a PCR enzyme, and the reaction was carried out according to the attached instructions. After purifying the PCR amplification product using QIAquick PCR Purification Kit (manufactured by Qiagen), reaction was performed using pET21a-FRT vector digested with restriction enzymes NdeI and XhoI and Gibson Assembly Master Mix (manufactured by New England Biolabs). let me E. coli DH5α was transformed with the reaction solution and cultured overnight at 37° C. using LB agar medium containing 20 μg/mL kanamycin.
Colonies having the target plasmid were selected from the cultured colonies by colony direct PCR. According to the instructions attached to EmeraldAmp PCR Master Mix (manufactured by Takara Bio Inc.), specified amounts of T7 promoter primer and T7 terminator primer were added to the reaction solution, colonies were added as template DNA, and PCR was performed. After the reaction, electrophoresis was performed using 1% agarose gel, and strains in which the hpaBC insert was confirmed were selected as candidate strains.
The candidate strain was cultured overnight at 37° C. in LB liquid medium containing 50 μg/mL of kanamycin, and plasmid extraction was performed using NucleoSpin Plasmid QuickPure (manufactured by Macharei Nagel) to obtain pET21a-FRT-hpaBC. .

(2) Preparation of D strain A strain (D strain) in which the hpaBC gene was inserted into the pheA locus of the chromosomal DNA was prepared in the same manner as the A strain.染色体に挿入するための遺伝子カセットをＰＣＲで増幅するために、鋳型ＤＮＡにｐＥＴ２１ａ－ＦＲＴ－ｈｐａＢＣ、プライマーにｄｅｌｔａ－ｐｈｅＡ－Ｆ（ＣＴＣＣＣＡＡＡＴＣＧＧＧＧＧＧＣＣＴＴＴＴＴＴＡＴＴＧＡＴＡＡＣＡＡＡＡＡＧＧＣＡＡＣＡＣＴＡＴＧＡＴＴＣＣＧＧＧＧＡＴＣＣＧＴＣＧＡＣＣ，配列番号２４）とｄｅｌｔａ－ｐｈｅＡ－ＦＲＴ－Ｒ（ＧＡＴＧＡＴＴＣＡＣＡＴＣＡＴＣＣＧＧＣＡＣＣＴＴＴＴＣＡＴＣＡＧＧＴＴＧＧＡＴＣＡＡＣＡＧＧＣＡＣＡＴＴＣＧＣＣＡＡＴＣＣＧＧＡＴＡＴＡＧ， A primer set of SEQ ID NO: 25) was used. To confirm the insertion of the hpaBC gene into the pheA locus, a primer set of K2 and Down-pheA (CATACCAATGGTTTCTGGAGCAAAT, SEQ ID NO: 26) was used.

5. Preparation of E strain (lacI ^Q1 and hpaBC insertion strain) (1) Preparation of plasmid pET21a-FRT-lacI ^Q1 -hpaBC Using pET21a-FRT as a template, pET21a-FRT-lacIQ1-F (CAACACCATGGAGCGGGCATGCATTTACGTTGACACCACCTTTCGCGGTATGGCATGATAG) and pET217-pSEQ ID NO: 217 DNA was amplified with Phusion Hot Start II DNA polymerase using the primer pair FRT-lacIQ-R (CAACACCATGGCGGGATCTCGACGCTCTCC, SEQ ID NO: 28). The conditions for the PCR reaction were based on the basic conditions described in the manual. Amplified DNA was purified using the QIAquick Gel Extraction kit. The purified DNA was digested with NcoI and DpnI, respectively, and the corresponding DNA was extracted from gel and purified. The purified DNA was self-ligated by a conventional method, transformed into Escherichia coli DH5α, and cultured overnight at 37° C. using LB agar medium containing 20 μg/mL kanamycin. The strain was grown overnight at 37° C. in LB liquid medium containing 20 μg/mL kanamycin, and plasmid pET21a-FRT-lacI ^Q1 was extracted and purified using NucleoSpin Plasmid QuickPure.
Next, using pET21a-FRT-hpaBC as a template, hpaBC operon DNA was amplified by PCR using a primer set of hpaBC-F and hpaBC-R. Phusion Hot Start 2 DNA Polymerase (manufactured by Thermo Fisher Scientific) was used as a PCR enzyme, and the reaction was carried out according to the attached instructions. After purifying the amplified product by PCR using QIAquick PCR Purification Kit (manufactured by Qiagen), pET21a-FRT-lacI ^Q1 vector digested with restriction enzymes NdeI and XhoI and Gibson Assembly Master Mix (manufactured by New England Biolabs) were added. was used to react. The reaction mixture was mixed with Escherichia coli DH5α competent cells (manufactured by GMbiolab), allowed to stand on ice for 40 minutes, subjected to heat shock at 42°C for 45 seconds, allowed to stand again on ice for 2 minutes, and then 900 µL of LB liquid medium was added. and incubate at 37°C for 30 minutes. An appropriate amount of the bacterial solution was spread on an LB agar medium containing 50 µg/mL of kanamycin and cultured overnight at 37°C.
Colonies having the target plasmid were selected from the cultured colonies by colony direct PCR. According to the instructions attached to EmeraldAmp PCR Master Mix (manufactured by Takara Bio Inc.), specified amounts of T7 promoter primer and T7 terminator primer were added to the reaction solution, colonies were added as template DNA, and PCR was performed. After the reaction, electrophoresis was performed using 1% agarose gel, and strains in which the hpaBC insert was confirmed were selected as candidate strains.
The candidate strain was cultured overnight at 37° C. in LB liquid medium containing 50 μg/mL of kanamycin, plasmid extraction was performed using NucleoSpin Plasmid QuickPure (manufactured by Macharei Nagel), and pET21a-FRT-lacI ^Q1 -hpaBC. got

(2) Preparation of E strain A strain (E strain) in which the lacI ^Q1 and hpaBC genes were inserted into the tyrB locus of the chromosomal DNA was prepared in the same manner as the A strain. In order to amplify the gene cassette for insertion into the chromosome by PCR, the plasmid pET21a-FRT-lacI ^Q1 -hpaBC was used as the template DNA, and the primers Delta-tyrBQF (GTTTATTGTGTTTTAACCACCTGCCCGTAAACCTGGAGAACCATCGCGTGGTGCGGCGACGATAGTCATG, SEQ ID NO: 29) and delta-tyrB-tyr A primer set of FRT-R (GCTGGGTAGCTCCAGCCTGCTTTCCTGCATTACATCACCGCAGCAAACGCATTCGCCAATCCGGATATAG, SEQ ID NO: 30) was used. To confirm the insertion of the lacI ^Q1 and hpaBC genes into the tyrB locus, a primer set of K2 and Down-tyrB (CGCTTTGCTGTTTTGCCGAG, SEQ ID NO: 31) was used.

6. Preparation of P1 phage lysate A strain A, B strain, C strain, D strain, or E strain is inoculated into 5 mL of LB liquid medium containing 20 μg/mL of kanamycin, and the OD ₆₆₀ becomes approximately 0.1 at 37°C. cultured up to 50 μL of 1M calcium chloride was added, and 100 μL of P1 phage solution (>10 ⁸ pfu/mL) was added and cultured at 37° C. for about 3 to 4 hours. P1 phage lysate was obtained by centrifuging at 10,000 rpm for 5 minutes and filtering the supernatant through a sterile filter with a pore size of 0.2 μm.

7. Preparation of hydroxytyrosol-producing strain F The phenylalanine-producing strain P was cultured overnight at 37°C using 5 mL of LB liquid medium. After adding 50 μL of 1M calcium chloride and stirring well, 200 μL was transferred to a 1.5 mL tube. 20 μL of P1 phage lysate of strain A was added thereto, mixed, and incubated at 37° C. for 20 minutes. After adding 100 μL of 1 M trisodium citrate solution and 700 μL of LB liquid medium and mixing, the mixture was further incubated at 37° C. for 40 minutes. The bacterial solution was spread on an LB agar medium containing 20 µg/mL of kanamycin and cultured overnight at 37°C. Colony direct PCR was performed using a primer pair of K2 and Down-feaB to confirm that FRT-Km-FRT-T7p-tyrA ^fbr was inserted at the feaB-ldhA locus of the resulting strain.
The P strain corresponds to the Phe13 strain of Patent Document 1 and can be prepared with reference to the same document. Also, Koma et al. (2020) Appl. Environ. Microbiol. 86:e00525-20. These documents are incorporated by reference.
Next, this strain was cultured in LB liquid medium containing 20 μg/mL of kanamycin until the OD ₆₆₀ value reached about 0.5. After ice-cooling the culture solution, 1 mL of the culture solution was centrifuged at 10,000 rpm and 4° C. for 3 minutes, and the supernatant was discarded. The cells were suspended in 100 μL of TSS solution (10% polyethylene glycol 3350, 5% dimethyl sulfoxide, 70 mM magnesium chloride, 0.1 M potassium chloride, 30 mM calcium chloride), 1 μL of 50 ng/μL pCP20 plasmid solution was added, and the mixture was cooled on ice. It was left to stand for 30 minutes. After heat-shocking at 42° C. for 90 seconds, the mixture was allowed to stand in ice for 2 minutes, 900 μL of LB medium was added, and 100 μL of the mixture was spread on an LB agar medium containing 50 μg/mL of ampicillin. After overnight culture at 30°C, the colonies that appeared were streaked on LB agar medium and cultured at 42°C overnight. The colonies that appeared were then streaked onto fresh LB agar medium and cultured overnight at 37°C. A primer pair of Down-ldhA2 (GTCTGTTTGCCGGTCGC, SEQ ID NO: 32) and Down-feaB was used to confirm that the kanamycin resistance gene was removed from FRT-Km-FRT-tyrA ^fbr inserted at the feaB-ldhA locus.
Next, the obtained strain was reacted with the C strain P1 phage lysate in the same manner as above. Colony direct PCR was performed using a primer pair of K2 and Down-pykA, and it was confirmed that FRT-Km-FRT-T7p-yahK was inserted at the pykA locus of the obtained strain. Next, pCP20 was used to remove the kanamycin resistance gene from FRT-Km-FRT-T7p-yahK inserted at the pykA locus according to the same method as above. Removal was confirmed by colony direct PCR using a primer set of UP-pykA (ACGCATGAGTTGTATGAATTGTAG, SEQ ID NO: 33) and Down-pykA.
Next, the obtained strain was reacted with the B strain P1 phage lysate in the same manner as above. Colony direct PCR was performed using a primer pair of K2 and Down-mtlA, and it was confirmed that FRT-Km-FRT-T7p-pdc was inserted at the mtlA locus of the obtained strain. Next, pCP20 was used to remove the kanamycin resistance gene from FRT-Km-FRT-T7p-pdc inserted at the mtlA locus according to the same method as above. Removal was confirmed by colony direct PCR using a primer set of UP-mtlA (GCCAGAAGGGAGTCAGGCTG, SEQ ID NO: 34) and Down-mtlA.
Next, the obtained strain was reacted with the P1 phage lysate of strain D according to the same method as above. Colony direct PCR was performed using a primer pair of K2 and Down-pheA, and it was confirmed that FRT-Km-FRT-T7p-hpaBC was inserted at the pheA locus of the obtained strain. Next, according to the same method as above, pCP20 was used to remove the kanamycin resistance gene from FRT-Km-FRT-T7p-hpaBC inserted at the pheA locus to obtain F strain of hydroxytyrosol-producing strain. Removal was confirmed by colony direct PCR using a primer set of UP-pheA (CTGATTAATCCACATATCATTCTGTC, SEQ ID NO: 35) and Down-pheA.

8. Preparation of hydroxytyrosol-producing strain G The F strain was reacted with the P1 lysate of the E strain in the same manner as in the preparation of the hydroxytyrosol-producing F strain. Colony direct PCR was performed using a primer pair of K2 and Down-tyrB, and it was confirmed that FRT-Km-FRT-lacI ^Q1 -T7p-hpaBC was inserted at the tyrB locus of the obtained strain. Next, pCP20 was used to remove the kanamycin resistance gene from FRT-Km-FRT-lacI ^Q1 -T7p-hpaBC inserted at the tyrB locus to obtain the G strain of hydroxytyrosol-producing strain. Removal was confirmed by colony direct PCR using a primer set of UP-tyrB (CAGTGCTGGTGAACGGTCG, SEQ ID NO: 36) and Down-tyrB.

9. Glucose fed-batch culture 1
The F strain or G strain grown on the LB agar medium was inoculated into the LB liquid medium and cultured with shaking at 33° C. for 8 hours. Cultivation was started by inoculating 15 mL of the culture solution into a 3 L jar fermenter containing 1.5 L of HCF (+Phe) medium.
As a jar fermenter, Marubishi Bioengineering's Bioneer series MDL-8C was used.
The composition of HCF(+Phe) medium is 1168 mL of distilled water, 150 mL of 10× phosphate/citrate buffer, 3.6 mL of 500 g/L magnesium sulfate heptahydrate aqueous solution, 15 mL of 100× trace metal solution, 63.4 mL of 700 g/L glucose solution, 340 μL of 20 g/L thiamine hydrochloride solution, and 100 mL of 1.24 g/100 mL phenylalanine solution were added (phenylalanine concentration in medium is 5 mM).
Distilled water and 10x phosphate/citrate buffer were placed in a vessel of a jar fermenter and sterilized by autoclaving. Glucose solution and filter sterilized thiamine hydrochloride solution, trace metal solution, and phenylalanine solution were added.
The composition of the 10× phosphate/citrate buffer was 133 g/L potassium dihydrogen phosphate, 40 g/L diammonium hydrogen phosphate, 17 g/L citric acid and was brought to pH 6.3 using 5M NaOH. adjusted to The composition of the 100X trace metal solution is 10 g/L iron(III) citrate, 0.25 g/L cobalt chloride hexahydrate, 1.5 g/L manganese chloride tetrahydrate, 0.15 g/L copper chloride dihydrate, 0.3 g/L boric acid, 0.25 g/L sodium molybdate dihydrate, 1.3 g/L zinc acetate dihydrate, 0.84 g/L ethylenediaminetetraacetic acid disodium salt di It is a hydrate.

Cultivation was performed at 33° C., the aeration rate was 3 L/min, and the rotation speed was automatically adjusted so that the dissolved oxygen content was 30%. The pH was controlled at 6.8, and 28% aqueous ammonia was used to control the pH. After the start of culture, when the OD ₆₆₀ value of the strain reached 17 to 29, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to 1 mM, the culture temperature was 30°C, and the pH was 6. .5. When culturing the F strain, 1.24 g/100 mL of phenylalanine solution was added three times as needed to increase the number of bacteria.
When the glucose was depleted or about to be depleted, feed solution (+Phe) was added at appropriate times so that the glucose concentration was about 10 g/L. The feed solution (+Phe) was prepared by adding 280 g of glucose to 136 mL of distilled water, sterilizing the solution in an autoclave, cooling the solution to about 50°C, and adding 16 mL of a 500 g/L magnesium sulfate heptahydrate aqueous solution that had been separately sterilized. Add 4 mL of filter-sterilized 100× trace metal solution, 900 μL of filter-sterilized 20 g/L thiamine hydrochloride solution, and 50 mL of filter-sterilized 0.66 g/50 mL phenylalanine solution. It was prepared by

The culture medium was sampled at appropriate times, the OD ₆₆₀ value was measured with a spectrophotometer, and tyrosol, hydroxytyrosol, phenylalanine and 2-phenylethanol were quantified by HPLC.
Quantitation by HPLC uses the method for quantifying aromatic compounds described in a previous report (Koma et al. 2012. Appl. Microbiol. Biotechnol. 93: 815-829), and hydroxytyrosol, tyrosol, phenylalanine and 2 - A standard of phenylethanol (manufactured by Tokyo Chemical Industry Co., Ltd.) was used.

10. Glucose fed-batch culture 2
The G strain grown on the LB agar medium was inoculated into the LB liquid medium and cultured with shaking at 33°C for 8 hours. Cultivation was started by inoculating 15 mL of the culture solution into a 3 L jar fermenter containing 1.5 L of HCF (+Phe) medium. The culture conditions, the setting of the jar fermenter, and the like were the same as those of the glucose fed-batch culture 1. However, IPTG was added when the medium was depleted of glucose (OD ₆₆₀ was 29.0). Immediately after the addition of IPTG, 50 mL of autoclave-sterilized 150 g/L powdered yeast extract D3-H solution was added and cultured in a glucose depleted state for 100 minutes, after which glucose fed-batch culture was started. Glucose feeding was carried out according to glucose fed-batch culture 1. When IPTG was added, the pH was changed to 6.5, but the culture temperature was kept at 33°C.
The culture solution was sampled at appropriate times, the OD ₆₆₀ value was measured with a spectrophotometer, and tyrosol, hydroxytyrosol and phenylalanine were quantified by HPLC.

11. Results (1) F strain of glucose fed-batch culture 1 The results of glucose fed-batch culture 1 of F strain are shown in FIG.
• In HCF(+Phe) medium, the _OD660 value stopped at 9.2 after 16 hours. Addition of phenylalanine (Phe) after 16.5 hours started to improve the _OD660 values. Phenylalanine was added because the OD ₆₆₀ value stopped after 19 hours. When IPTG was added 20 hours later, phenylalanine was added because protein for synthesizing hydroxytyrosol (HTY) could not be produced in a state in which phenylalanine was depleted.
• More than 2 g/L of 2-phenylethanol (2PE) accumulated in the medium.
・The production amount of tyrosol was 5.7 g/L.
・The production amount of hydroxytyrosol was 2.6 g/L.
• _OD660 improved only to 21.6. Addition of phenylalanine is thought to improve the reaction a little more, but at the same time, it is thought that the accumulation of 2-phenylethanol, which is a by-product, also increases.
• The low OD ₆₆₀ values and accumulation of 2PE in the F strain were unexpected results in test tube culture.
The F strain, which is phenylalanine auxotrophic (Δphe), has poor growth ability and 2PE accumulates because the added phenylalanine is consumed by the Ehrlich pathway (the dotted arrow in FIG. 3) and converted to 2-phenylethanol. This is thought to be because
* When F strain was cultured in a test tube, OD ₆₆₀ was 2.6 and hydroxytyrosol concentration was 1.3 g/L after 48 hours of culture using HCF medium + 5 mM Phe medium. The result was good as a test tube culture, and although the growth was somewhat poor, a high HTY concentration was observed.

(2) G strain of glucose fed-batch culture 1 The results of glucose fed-batch culture 1 of G strain are shown in FIG.
・_OD660 exceeded 35. Although the amount of phenylalanine (Phe) added to the medium was limited to the initial amount and the amount added to the feed solution, the growth ability of the strain was greatly improved compared to the F strain.
・The accumulated amount of 2-phenylethanol (2PE) was 0.35 g/L.
・The production of tyrosol was 1.5 g/L and that of hydroxytyrosol (HTY) was 6.3 g/L.
・In the G strain, the Ehrlich pathway of the F strain was disrupted (the tyrB gene was disrupted) (Fig. 4), thereby suppressing the consumption of phenylalanine and significantly improving the growth ability of the G strain compared to the F strain. However, the amount of 2PE accumulated was greatly reduced compared to the F strain, and the productivity of HTY was improved.
- Although the tyrB gene was disrupted in the G strain, it showed the growth ability as described above even without the separate addition of tyrosine. However, the G strain, like the F strain, is phenylalanine auxotrophic (Δphe).

(3) G strain of glucose fed-batch culture 2 The results of glucose fed-batch culture 2 of G strain are shown in FIG.
・_OD660 exceeded 35.
・An attempt was made to improve the conversion ability of tyrosol to hydroxytyrosol by adding powdered yeast extract D3-H after adding IPTG to promote the synthesis of HpaBC protein. As a result, the production amount of tyrosol was 1.0 g/L and that of hydroxytyrosol (HTY) was 8.7 g/L, and the productivity of HTY was further improved.

Claims (8)

an exogenous gene encoding an enzyme having 4-hydroxyphenylpyruvate decarboxylase activity is expressably introduced;
the endogenous pheA gene is disrupted,
the endogenous tyrB gene is disrupted, and
A transformant of the genus Escherichia having the ability to produce hydroxytyrosol ,
Furthermore, a transformant into which the following five genes (1) to (5) are introduced so as to be expressible.
(1) aroA
(2) aroB
(3) aroC
(4) aroG ^fbr or aroF ^fbr
(5) tyrA ^fbr 2. The transformant according to claim 1, wherein the enzyme having 4-hydroxyphenylpyruvate decarboxylase activity is phenylpyruvate decarboxylase of bacteria of the genus Azospirillum or yeast of the genus Saccharomayces. 3. The transformant according to claim 1, wherein a gene encoding an enzyme having 4-hydroxyphenylethanol-3-hydroxylase activity is introduced so as to be expressible. 4. The transformant according to any one of claims 1 to 3, wherein a gene encoding an enzyme having 4-hydroxyphenylacetaldehyde reductase activity is introduced so as to be expressible. 5. The transformant according to any one of claims 1 to 4 , wherein the following genes (6) and (7) are introduced so as to be expressible.
(6) ppsA
(7) tktA 6. The transformant according to any one of claims 1 to 5 , wherein at least one of the following genes (8) to (10) is introduced so as to be expressible.
(8) aroD
(9) aroE or ydiB
(10) aroL or aroK A method for producing hydroxytyrosol, comprising the step of reacting a carbohydrate raw material with the transformant according to any one of claims 1 to 6 . 8. The production method according to claim 7 , wherein the reaction is carried out by fed-batch culture of the saccharide raw material.

Images