JP2022079337A - Method for producing hydroxytyrosol - Google Patents

Abstract

To provide a method for producing hydroxytyrosol with improved productivity.SOLUTION: A method for producing hydroxytyrosol includes the step of reacting tyrosol with a microorganism, wherein the microorganism is a microorganism modified so that a gene encoding 4-hydroxyphenyl acetate-3-hydroxylase is incorporated into a chromosome in an expressible manner.SELECTED DRAWING: Figure 1

Description

The present disclosure relates to a method for producing hydroxytyrosol.

Hydroxytyrosol is a high value compound and there is an increasing demand for stable and sustainable production of high purity hydroxytyrosol. Hydroxytyrosol is one of the most potent antioxidants with potential biological functions as an antitumor, antiatherome, anti-inflammatory and / or anti-platelet flocculant, functional foods, nutrition. It has a wide range of potential uses in industries such as supplements, cosmetics, and animal feeds.

In addition to being produced from olive extract, hydroxytyrosol has also been proposed to be produced by bioconversion using microorganisms and enzymes (Patent Documents 1 and 2, Non-Patent Documents 1 and 2).
As a method for producing hydroxytyrosol from tyrosol, a method using Pseudomonas aeruginosa (Non-Patent Document 1) and a method using tyrosinase enzyme of Ralstonia solanacreaum have been reported. (Patent Document 1).
As a method for producing hydroxytyrosol using L-3,4-dihydroxyphenylalanine (L-DOPA) as a raw material, a method using a variant of Escherichia coli has been reported (Patent Document 2, Non-Patent Document 2). ).

Japanese Patent Publication No. 2017-538432 Special Table 2019-524076 Gazette

Z. Bouallagui and S. Sayadi, Bioconversion of of p-Tyrosol into Hydroxytyrosol under Bench-Scale Fermentation, BioMed Research InternationalVolume 2018, Article ID 7390751 Chaozhi Li et al., Efficient Synthesis of Hydroxytyrosol from l-3,4-Dihydroxyphenylalanine Using Engineered Escherichia coli Whole Cells, J. Agric. Food Chem., 2019, 67, 24, 6867-6873

The method using Pseudomonas aeruginosa (Non-Patent Document 1) has a problem that mass culture is not preferable because Pseudomonas aeruginosa is a pathogenic bacterium. (Patent Document 1) has been proposed.
However, in order to prepare an enzyme, it takes time and effort to increase the number of microorganisms that produce the enzyme and purify the enzyme from the microorganism. In particular, if enzymes are purified, the cost will increase significantly. When a coenzyme is required for an enzyme, it is necessary to add the coenzyme to the reaction solution or to construct a regeneration system for the coenzyme, but the coenzyme is generally expensive. In addition, in order to construct a regeneration system for coenzymes, another enzyme is required for that purpose.
Further, although a method using live bacteria using L-DOPA as a raw material has been proposed (Patent Document 2 and Non-Patent Document 2), the raw material L-DOPA is very expensive. Further, even if the step of causing the fungus to produce L-DOPA is adopted, it is difficult to mass-produce L-DOPA by this method.

The present disclosure provides a method for producing hydroxytyrosol, which uses live bacteria and improves productivity.

The present disclosure comprises a step of reacting tyrosol with a microorganism, wherein the microorganism is a modified microorganism in which a gene encoding 4-hydroxyphenylacetate-3-hydroxylase is vulnerably integrated into a chromosome so that it can be expressed. The present invention relates to a method for producing hydroxytyrosol.

According to the present disclosure, it is possible to provide a method for producing hydroxytyrosol having improved productivity by using live bacteria.

FIG. 1 is a graph showing the progress of production of hydroxytyrosol by tyrosol fed-batch culture of a strain in which the hpaBC gene has been introduced into an Escherichia coli chromosome. FIG. 2 is a graph showing the progress of production of hydroxytyrosol by tyrosol fed-batch culture of Escherichia coli: MG1655 (DE3) / pET21a-FRT-hpaBC strain carrying the hpaBC gene in a plasmid.

The present disclosure describes a form in which a gene encoding 4-hydroxyphenylacetate-3-hydroxylase is introduced into a chromosome in a microorganism used for producing hydroxytyrosol from tyrosol, as compared with a form introduced as a plasmid. Based on the finding that the productivity of hydroxytyrosol is significantly improved in the case of.

[Microorganisms]
The microorganism used in the present disclosure, that is, the microorganism of the host to which the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is modified to be expressively integrated into the chromosome is not particularly limited.
Examples of one or more embodiments of the microorganism include yeast and bacteria.

Examples of the yeast include Saccharomyces cerevisiae, Pichia pastoris, Schizosaccharomyces pombe and the like.
Examples of the bacterium include Escherichia coli (Escherichia coli), Pseudomonas, Corynebacterium and the like.
Examples of Escherichia coli include Escherichia coli K12 strain and B strain, and strains derived from these strains. Examples of the strain derived from the Escherichia coli K12 strain include MG1655, W3110, W1330, JM109, HST02, HB101, DH5α, and the DE3 strain in which the lambda DE3 gene is integrated into these chromosomes. Examples of the strain derived from the B strain include BL21, BL21 (DE3) and the like.
The Escherichia coli may be a natural mutant strain derived from these strains or an artificially modified strain.

[4-Hydroxyphenylacetate-3-hydroxylase]
In the present disclosure, 4-hydroxyphenylacetate-3-hydroxylase refers to an enzyme also also referred to as 4-hydroxyphenylacetate-3-monooxygenase.
The 4-hydroxyphenylacetate-3-hydroxylase in the present disclosure can catalyze the chemical reaction in which tyrosol becomes hydroxytyrosol.
4-Hydroxyphenylacetate-3-hydroxylase is not limited as long as it has the above-mentioned catalytic function, but is a two-component enzyme in one or more embodiments, and a coenzyme in one or more embodiments. It is a two-component FAD-dependent monooxygenase that uses the reduced flavin adenine nucleotide (FAD), ie FADH ₂ .

The 4-hydroxyphenylacetate-3-hydroxylase in the present disclosure is, in one or more embodiments, a gene product of the hpaBC gene of Escherichia coli, a gene product of its ortholog, or a bicomponent enzyme derived thereto.
The amino acid sequence of the HpaB protein, which is the product of the HpaB gene of E. coli, is represented by SEQ ID NO: 11 in one or more embodiments.
The amino acid sequence of the HpaC protein, which is the product of the HpaC gene of E. coli, is represented by SEQ ID NO: 12 in one or more embodiments.
In the present disclosure, "ortholog" means a related gene having a homologous function existing in a different organism.
In the present disclosure, "derived enzyme" means, in one or more embodiments, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more identity with respect to the amino acid sequence of the original enzyme. , 97% or more, 98% or more, or 99% or more amino acid sequence.
As used herein, the term "derived enzyme" refers to an enzyme having, in one or more embodiments, the ability to "catalyze the chemical reaction of tyrosol to hydroxytyrosol" to the same extent as the original enzyme. The same degree means that the difference in activity is within ± 25%, ± 20%, ± 15%, ± 10%, or ± 5% in one or more embodiments.

[Gene encoding 4-hydroxyphenylacetate-3-hydroxylase]
In the present disclosure, as the gene introduced into the host microorganism, the gene encoding the above-mentioned 4-hydroxyphenylacetate-3-hydroxylase can be used.
When 4-hydroxyphenylacetate-3-hydroxylase is an enzyme composed of two or more components, the "gene encoding 4-hydroxyphenylacetate-3-hydroxylase" in the present disclosure is referred to as "gene encoding 4-hydroxyphenylacetate-3-hydroxylase". In one or more embodiments, it is composed of a number of genes for the component. In that case, the "gene encoding 4-hydroxyphenylacetate-3-hydroxylase" can be regarded as being composed of a plurality of genes or as one gene composed of a plurality of genes. ..

Examples of the gene include the hpaBC gene of Escherichia coli or an ortholog thereof in one or more embodiments.
The hpaBC gene of Escherichia coli may be a wild-type gene or one registered in a database (NCBI GENBANK, etc.) at the time of filing of the present application, and has a range of functions equivalent to that of the wild-type or a protein equivalent to that of the wild-type. The sequence may be different as long as it encodes, or it may be an ortholog sequence as described above. The gene may also be codon-optimized for expression in the host microorganism.
The hpaBC gene of Escherichia coli is one in which the hpaB gene and the hpaC gene form an operon, the hpaB gene is represented by SEQ ID NO: 9 in the sequence listing in one or more embodiments, and the hpaC gene is one or more. In a plurality of embodiments, it is represented by SEQ ID NO: 10 in the sequence listing.
Therefore, as the gene, in one or more embodiments, a gene containing two base sequences represented by SEQ ID NOs: 9 and 10 in the sequence listing, or a base represented by SEQ ID NOs: 9 and 10 in the sequence listing. Examples include genes containing two nucleotide sequences in which one or more of the sequences are deleted, substituted, and / or added and encode a protein capable of functioning as 4-hydroxyphenylacetate-3-hydroxylase. Be done.
The term "plurality" means, in one or more embodiments, 2 to 100, 2 to 90, 2 to 60, 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 15, 2 to 10, 2 -7, 2-6, 2-5, 2-4, or 2-3.
When the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is composed of a plurality of genes, they may be introduced into the chromosome as an operon, and they may be introduced into the chromosome independently or separately. May be done.

[Integration into chromosomes]
The integration of the gene encoding 4-hydroxyphenylacetate-3-hydroxylase into the chromosome of the host microorganism is not particularly limited as long as it can be introduced in an expressive manner.
Chromosome integration is performed in one or more embodiments by site-specific recombination.
Site-specific recombination includes, in one or more embodiments, a method utilizing a CRISPR plasmid, a method utilizing a Cre / LuxP system, a method utilizing the budding yeast recombinant enzymes FLP and FRT sequences, a CRISPR / Cas9 system. The method of using it can be mentioned.
Examples of the method for introducing a gene into an expressible manner include a method for introducing a gene together with an expression-regulating sequence such as a promoter capable of inducing upregulation of the gene.
When the host microorganism is Escherichia coli, the promoter capable of inducing the upregulation of the gene includes the T7 promoter in one or more embodiments. When the T7 promoter is used for expression induction, the host microorganism is preferably a strain having a T7 RNA polymerase gene. Host microorganisms include, in one or more embodiments, the DE3 strain lysed from λDE3 phage.
In one or more other embodiments, the promoters capable of inducing gene expression enhancement include the PL promoter of λ phage (promoter whose expression is induced by heat) and the arabinose promoter of arabinose operon (promoter whose expression is induced by arabinose). ), Tet promoter (promoter whose expression is induced by tetracycline), promoters of constituent proteins such as tyrR, and constitutive artificial promoters.
In the present disclosure, the method for introducing a gene into a chromosome together with a promoter capable of inducing expression is not particularly limited, but in one or more embodiments, the method described in Examples (Koma et al. 2012. Appl. Microbiol. Biotechnol). 93: 815-829.).

[Reaction process between tyrosol and microorganisms]
Hydroxytyrosol is produced by contacting and reacting a microorganism (hereinafter, also referred to as the microorganism of the present disclosure) integrated into a chromosome capable of expressing a gene encoding 4-hydroxyphenylacetate-3-hydroxylase with tyrosol. do. This "reaction" in the present disclosure can also be referred to as "fermentation".
The reaction between tyrosol and the microorganism of the present disclosure, in one or more embodiments, induces the expression of 4-hydroxyphenylacetate-3-hydroxylase in the microorganism of the present disclosure cultured to a predetermined amount, and then tyrosol. Can be done by adding.
The microorganisms of the present disclosure can be cultured under the conditions of a normal culture method, and the reaction step can also be performed under the conditions of conventional fermentation or reaction. The culture / reaction medium contains other components such as a carbon source, a nitrogen source, a phosphorus source, a sulfur source, minerals, and vitamins, and is not particularly limited as long as the microorganisms of the present disclosure can grow.
From the viewpoint of improving the production amount of hydroxytyrosol, it is preferable to culture and react the microorganisms of the present disclosure in a device capable of mass culturing such as a jarfamentor or a bioreactor.
The culturing and reaction of the microorganisms of the present disclosure are preferably fed-batch culture in which tyrosol, which is a raw material, is added during the reaction from the viewpoint of improving the production amount of hydroxytyrosol.

As a method for producing hydroxytyrosol by fed-batch culture of tyrosol, for example, the method of Examples can be referred to. Briefly, preculture is performed, inoculated into a minimum medium at a concentration of 1%, and cultured, and when OD ₆₆₀ reaches 0.5 to 20, expression is induced (for T7 promoter, for example, 1 mM isopropyl-β-. After adding D-thiogalactopyranoside (IPTG) and culturing for 2 to 5 hours, the tyrosol solution as a raw material is poured at a predetermined supply speed and reacted for 20 to 35 hours, and then the reaction solution and / or Obtain hydroxytyrosol in the fungus.

[Culture temperature]
The temperature at which microorganisms can grow can be mentioned. From the viewpoint of growth rate, the optimum culture temperature of the organism is preferable. In the case of Escherichia coli, in one or more embodiments, 25 ° C to 40 ° C or 30 ° C to 37 ° C can be mentioned.
[Culture medium]
It is not limited as long as it is a medium in which microorganisms can grow. Examples thereof include natural media such as LB medium and synthetic media such as M9 and HCF medium of Examples. When considering the purification of the compound, a synthetic medium is preferable.
[Culture pH]
The culture pH may range from 6.0 to 7.5 in one or more embodiments. In the case of Escherichia coli, in one or more embodiments, around 7.0, or 6.2 to 7.2 can be mentioned.

[Reaction temperature]
It can be the same as the above culture temperature.
[Reaction medium]
It can be the same as the above culture medium.
[Amount of tyrosol added to reaction medium (flow acceleration)]
The amount of tyrosol added is adjusted depending on the type of bacteria, the amount of cells, and the reaction conditions. In one or more embodiments, the tyrosol should be fed at such a rate that the added tyrosol is rapidly converted to hydroxytyrosol. In the case of Escherichia coli, if OD ₆₆₀ is about 40, it may be added at a rate of 5 to 100 mg / L / min or 10 to 80 mg / L / min.
The total amount of tyrosol to be added varies depending on the type of fungus, but it is preferable that almost all of the added tyrosol is converted to hydroxytyrosol. In the case of Escherichia coli, in one or more embodiments, about 10-25 g / L can be mentioned.
[Reaction pH]
It can be the same as the above culture pH.
[Reaction time]
The reaction time is preferably, in one or more embodiments, the reaction is carried out until the applied tyrosol is exhausted.
However, the culture / reaction conditions are not limited to these.

The present disclosure further relates to the following, but not limited to, one or more embodiments:
[1] Including the step of reacting tyrosol with a microorganism.
The microorganism is a microorganism modified so that the gene encoding 4-hydroxyphenylacetate-3-hydroxylase can be expressed and integrated into the chromosome.
Method for manufacturing hydroxytyrosol.
[2] The production method according to [1], wherein 4-hydroxyphenylacetate-3-hydroxylase is a two-component FAD-dependent monooxygenase.
[3] The production method according to [1] or [2], wherein 4-hydroxyphenylacetate-3-hydroxylase is a gene product of the hpaBC gene of Escherichia coli or a gene product of its ortholog.
[4] The production method according to any one of [1] to [3], wherein the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is the hpaBC gene of Escherichia coli or an ortholog thereof.
[5] The gene encoding 4-hydroxyphenylacetate-3-hydroxylase is a gene containing two base sequences represented by SEQ ID NOs: 9 and 10 in the sequence listing, or a gene containing SEQ ID NOs: 9 and 10 in the sequence listing. Two base sequences in which one or more of the represented base sequences are deleted, substituted, and / or added and encode a protein capable of functioning as 4-hydroxyphenylacetate-3-hydroxylase. The production method according to any one of [1] to [4], which is a gene containing the gene.
[6] The production method according to any one of [1] to [5], wherein the microorganism is Escherichia coli.
[7] The production method according to any one of [1] to [6], wherein the reaction is fed-batch culture of tyrosol.

Hereinafter, the present disclosure will be described in more detail by way of examples, but these are exemplary and the present disclosure is not limited to these examples.

1. 1. Preparation of plasmid pET21a-FRT-hpaBC Using the chromosomal DNA of Escherichia coli BL21 strain as a template, hpaBC-F (GTTTAACTTTAAGAAGGAGATATACATATGAAACCAGAAGATTTCCGC: SEQ ID NO: 1) and hpaBC-R (GTGGTGGTGGTGCTCGAGTTAAATCGCAGCTTCCATTTC: sequence number 2) Amplified with. As the PCR enzyme, Phusion Hot Start 2 DNA Polymerase (manufactured by Thermo Fisher Scientific) was used, and the reaction was carried out according to the attached instructions. The amplification product in PCR was purified using a QIAquick PCR Purification Kit (manufactured by Qiagen) and then digested with restriction enzymes NdeI and XhoI (Koma et al. 2012. Appl. Microbiol. Biol. Biol. Biol. -829) and Gibson Assembly Master Mix (manufactured by New England Biolabs) were used for reaction. The reaction solution was mixed with Escherichia coli DH5α competent cell (manufactured by GMbiolab) and allowed to stand on ice for 40 minutes, then heat shocked at 42 ° C. for 45 seconds, allowed to stand again on ice for 2 minutes, and then LB liquid medium (10 g / 10 g /). 900 μL of L high polypeptone, 5 g / L powdered yeast extract D3-H, 10 g / L sodium chloride, pH 7.0) was added, and the mixture was kept at constant temperature at 37 ° C. for 30 minutes. An appropriate amount of the bacterial solution was applied to an LB agar medium containing 50 μg / mL kanamycin (LB liquid medium to which agar was added to a ratio of 2%), and the cells were cultured at 37 ° C. overnight.
From the cultured colonies, those having the desired plasmid were selected by colony direct PCR. According to the instructions attached to EmeraldAmp PCR Master Mix (manufactured by Takara Bio Inc.), add a specified amount of T7 promoter primer (TAATACGACTCACTATAGGG: SEQ ID NO: 3) and T7 terminator primer (ATGCTAGTTATTGCTCAGCGG: SEQ ID NO: 4) to the reaction solution to mold the colony. PCR was performed in addition to DNA. After the reaction, electrophoresis was performed using a 1% agarose gel, and the one in which the insert of hpaBC was confirmed was used as a candidate strain.
Candidate strains were cultured overnight at 37 ° C. in LB liquid medium containing 50 μg / mL kanamycin, and plasmid extraction was performed using NucleoSpin Plasmamid QuickPure (manufactured by Machrai Nagel) to obtain pET21a-FRT-hpaBC. ..

2. 2. Preparation of plasmid bacterium MG1655 (DE3) / pET21a-FRT-hpaBC strain Escherichia coli MG1655 (DE3) strain was cultured at 37 ° C. using 5 mL of LB liquid medium, and when the value of OD ₆₆₀ reached about 0.5, it was in ice. Cooled with. 1 mL of the bacterial solution was centrifuged at 10,000 rpm for 3 minutes, the supernatant was discarded, and the bacterial cells were collected. The cells were suspended in 90 μL of TSS solution (adding PEG4000 to 100 g / L, DMSO to 5%, and MgCl ₂ to 20 mM in LB liquid medium). 10 μL of KCM solution (1 M KCl, 0.3 M CaCl ₂ , 0.5 M MgCl ₂ ) and 1 μL of plasmid solution were added, and the mixture was allowed to stand on ice for 40 minutes. After heat-shocking at 42 ° C. for 90 seconds, the mixture was allowed to stand on ice again for 2 minutes, 900 μL of LB liquid medium was added, and the temperature was kept constant at 37 ° C. for 30 minutes. An appropriate amount of the bacterial solution was applied to LB agar medium containing 50 μg / mL kanamycin and cultured at 37 ° C. overnight. The emerging colonies were again applied to LB agar medium containing 50 μg / mL kanamycin, cultured overnight at 37 ° C., and the emerging colonies were used as MG1655 (DE3) / pET21a-FRT-hpaBC.

3. 3. Preparation of Chromosome-Introduced Strain (Strain A) The introduction of the hpaBC gene into the Escherichia coli chromosome was carried out according to a previously reported report (Koma et al. 2012. Appl. Microbiol. Biotechnol. 93: 815-829). First, a solution containing a DNA fragment for introduction into a chromosome was prepared. Using pET21a-FRT-hpaBC as template DNA, delta-pflBA-F (CGAAGTACGCAGTAAATAAAAAATCCACTTAAGAAGGTAGGTGTTACATGATTCCGGGGATCCGTCGACC: SEQ ID NO: 5) and delta-pflBA-FRT-R (CTCAATAAAGTTGCCGCTACTAG) The hpaBC gene (FRT-Km-FRT-P _T7 -hpaBC-T _T7 ) containing the FRT) and canamycin resistance gene sequence (Km) was amplified by PCR. PrimeStar GXL (manufactured by Takara Bio Inc.) was used as the PCR enzyme, and the reaction was carried out according to the attached instructions. The amplified product in PCR was purified using QIAquick PCR Purification Kit (manufactured by Qiagen), digested overnight with the restriction enzyme DpnI, and purified again by QIAquick PCR Purification Kit (manufactured by Qiagen) for chromosome transfer. DNA solution. Next, an E. coli electroporation cell was prepared. Escherichia coli MG1655 (DE3) / pKD46 strain was cultured in LB liquid medium containing 10 mM L-arabinose and 100 μg / mL carbenicillin at 30 ° C. until OD ₆₆₀ reached about 0.5. Next, 2 mL of the bacterial solution was centrifuged at 5,000 rpm at 4 ° C. for 5 minutes, the supernatant was discarded, and the bacterial cells were collected. The cells were suspended in 1 mL of ice-cooled sterile distilled water, centrifuged at 5,000 rpm at 4 ° C for 5 minutes, the supernatant was discarded, and the cells were collected. Again, the cells were suspended in 1 mL of ice-cooled sterile distilled water, centrifuged at 5,000 rpm at 4 ° C for 5 minutes, the supernatant was discarded, and the cells were collected. The cells were suspended in 50 μL of ice-cooled sterile distilled water to form an electroporation cell. Next, 100-200 ng (about 1 μL) of DNA fragment was added to the electroporation cell, the solution was transferred to an electroporation cuvette, and electroporation was performed using a MicroPulser electroporator (manufactured by Bio-Rad). .. After adding 1 mL of LB liquid medium to the electroporation cuvette, the bacterial suspension was transferred to a 1.5 mL tube and shaken at 37 ° C. for about 2 hours. The bacterial solution was applied to LB agar medium containing 50 μg / mL kanamycin and cultured at 37 ° C. overnight. From the colonies that appeared, Escherichia coli having the hpaBC gene at the pflBA locus was selected by colony direct PCR. According to the instructions attached to EmeraldAmp PCR Master Mix (manufactured by Takara Bio Inc.), add the primer sets of K2 (CGGTGCCCTGAATGAACTGC: SEQ ID NO: 7) and Down-pflBA (CGTTATTCTCCAGAGGTTCATCAGC: SEQ ID NO: 8) to the reaction solution, and use the colony as a template DNA. In addition, PCR was performed. After the reaction, electrophoresis was performed using a 1% agarose gel, and a strain (Strain A) in which the hpaBC gene was inserted at the pflBA locus was confirmed.

4. Tyrosol fed-batch culture MG1655 (DE3) / pET21a-FRT-hpaBC or A strain was inoculated into LB liquid medium and cultured at 30 ° C. overnight. The culture was started by inoculating 1% of the culture solution into a 3 L volume of Jarfamentor containing 1.5 L of HCF medium. When culturing the MG1655 (DE3) / pET21a-FRT-hpaBC strain, kanamycin was added to the LB liquid medium and the HCF medium so as to be 50 μg / mL.
As the jar famenter, Bioneer series MDL-8C manufactured by Maruhishi Bioengineering Co., Ltd. was used.
The composition of the HCF medium is 1268 mL of distilled water, 150 mL of 10 x phosphoric acid / citrate buffer, 3.6 mL of 50% magnesium sulfate heptahydrate solution, 15 mL of 100 x trace metal solution, 63.4 mL. A 70% glucose solution and a 340 μL 2% thiamine hydrochloride solution were added.
Distilled water and 10 × phosphoric acid / citrate buffer were placed in the vessel of the Jarfamentor and sterilized by autoclave. After the sterilized solution returned to room temperature, the magnesium sulfate solution was separately sterilized by autoclave. A glucose solution, and a thiamine hydrochloride solution and a trace metal solution that had been filtered and sterilized were added.
The composition of the 10 × phosphate / citrate buffer is 133 g / L potassium dihydrogen phosphate, 40 g / L 2 ammonium hydrogen phosphate, 17 g / L citrate, and the pH is 6.3 using 5 M NaOH. Adjusted to. The composition of the 100 × trace metal solution is 10 g / L iron citrate (III), 0.25 g / L cobalt chloride hexahydrate, 1.5 g / L manganese chloride tetrahydrate, 0.15 g / L copper chloride. Dihydrate, 0.3 g / L boric acid, 0.25 g / L sodium molybdate dihydrate, 1.3 g / L zinc acetate dihydrate, 0.84 g / L ethylenediamine tetraacetic acid disodium salt di It is a hydrate.
The culture was carried out at 30 ° C., the aeration rate was 3 L / min, and the rotation speed was automatically adjusted so that the value of the dissolved oxygen amount was 30%. The pH was initially controlled at 6.8 and at 6.5 after the start of fed-batch culture of tyrosol. 28% aqueous ammonia was used to control the pH.
After the start of the culture, when the OD ₆₆₀ value of the strain reached 15 to 20, isopropyl-β-D-thiogalactopyranoside (IPTG) was added so as to be 1 mM, and the culture was continued for another 3 to 4 hours. Later, 300 mL of tyrosol solution (100 g / L) was added at a rate of 0.4 mL / min. When glucose was depleted or was about to be depleted on the way, a feed solution was added in a timely manner so that the glucose concentration was about 10 g / L.
The feed solution was sterilized by autoclaving by adding 280 g of glucose to 186 mL of distilled water, and after the solution had cooled to about room temperature, 16 mL of another sterilized 50% magnesium sulfate heptahydrate aqueous solution was filtered and sterilized. It was prepared by adding 4 mL of a 100 × trace metal solution and 900 μL of a 2% thiamine hydrochloride solution that had been sterilized by filtration.
The reaction solution was sampled at appropriate times, and the value of OD ₆₆₀ was measured by a spectrophotometer, and tyrosol and hydroxytyrosol were quantified by HPLC.
For quantification by HPLC, the method for quantifying aromatic compounds described in the previous report (Koma et al. 2012. Appl. Microbiol. Biotechnol. 93: 815-829) was used, and hydroxytyrosol and tyrosol preparations were used for the preparation of the calibration curve. Made by Tokyo Chemical Industry Co., Ltd.) was used.

5. Results Figure 1 shows the results of the production of hydroxytyrosol by tyrosol fed-batch culture of strain A in which the hpaBC gene was introduced into the E. coli chromosome.
FIG. 2 shows the results of production of hydroxytyrosol by tyrosol fed-batch culture of Escherichia coli carrying the hpaBC gene in a plasmid: MG1655 (DE3) / pET21a-FRT-hpaBC strain.
The horizontal axis of FIGS. 1 and 2 is the time (h) from the start of culturing in the jar famenter. The left side of the vertical axis is the absorbance (OD ₆₆₀ ), and the right side of the vertical axis is the concentration (g / L) of tyrosol and hydroxytyrosol (HTY).
Although strain A in which the hpaBC gene is introduced into the E. coli chromosome and E. coli carrying the hpaBC gene in a plasmid are both induced to be expressed from the same promoter (T7 promoter), there is a significant difference in the production of hydroxytyrosol. There was (Fig. 1 and Fig. 2).
The strain A in which the hpaBC gene was introduced into the E. coli chromosome converted tyrosol into hydroxytyrosol so efficiently that the added tyrosol did not remain (Fig. 1). On the other hand, in Escherichia coli carrying the hpaBC gene with a plasmid, tyrosol remained (Fig. 2).
The strain A in which the hpaBC gene was introduced into the E. coli chromosome showed twice the amount of hydroxytyrosol produced as that of Escherichia coli carrying the hpaBC gene in a plasmid (FIGS. 1 and 2).
In the method for producing hydroxytyrosol using live bacteria, it was the highest value so far that it was produced from tyrosol at a concentration of 5.8 g / L using the pathogen Pseudomonas aeruginosa (non-patent document). 1). Further, in the non-pathogenic bacterium (Escherichia coli), only 5.6 g / L of hydroxytyrosol was produced even by using L-DOPA, which is a very expensive raw material (Non-Patent Document 2).
On the other hand, in this example, as shown in FIG. 1, it was possible to show an exceptionally remarkable productivity of 16 g / L.

Claims (7)

Including the step of reacting tyrosol with microorganisms, including
The microorganism is a microorganism modified so that the gene encoding 4-hydroxyphenylacetate-3-hydroxylase can be expressed and integrated into the chromosome.
Method for manufacturing hydroxytyrosol. The production method according to claim 1, wherein 4-hydroxyphenylacetate-3-hydroxylase is a two-component FAD-dependent monooxygenase. The production method according to claim 1 or 2, wherein 4-hydroxyphenylacetate-3-hydroxylase is a gene product of the hpaBC gene of Escherichia coli or a gene product of the ortholog thereof. The production method according to any one of claims 1 to 3, wherein the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is the hpaBC gene of Escherichia coli or an ortholog thereof. The gene encoding 4-hydroxyphenylacetate-3-hydroxylase is represented by a gene containing two base sequences represented by SEQ ID NOs: 9 and 10 in the sequence listing, or by SEQ ID NOs: 9 and 10 in the sequence listing. A gene containing two base sequences encoding a protein in which one or more of the base sequences are deleted, substituted, and / or added and can function as 4-hydroxyphenylacetate-3-hydroxylase. The manufacturing method according to any one of claims 1 to 4. The production method according to any one of claims 1 to 5, wherein the microorganism is Escherichia coli. The production method according to any one of claims 1 to 6, wherein the reaction is fed-batch culture of tyrosol.

Images