JP7191301B2 - Growth inhibitor for cancer cells with poor prognosis - Google Patents

Description

TECHNICAL FIELD The present invention relates to a growth inhibitor for cancer cells with poor prognosis. In particular, it is an effective anti-proliferative agent against various cancers in which fibrillarin is highly expressed (colon cancer, ovarian cancer, breast cancer, lung adenocarcinoma, glial adenocarcinoma, renal cancer, etc.). It relates to a therapeutic agent for cancer diseases to be used. The present invention also relates to a method for examining the prognosis of cancer.

Fibrillarin is a component of snoRNP (nucleolar small ribonucleic acid protein) localized in the nucleolus in the cell nucleus, and its role is involved in methylation of rRNA and transcription from DNA. It is known to carry out subsequent methylation of rRNA precursors. The fibrillarin amino acid sequences of many vertebrates are known, and they are widely conserved among vertebrates.
In particular, human-derived fibrillarin is a protein consisting of 321 amino acids (National Center for Biotechnology Information (NCBI) http://www.ncbi.nlm.nih.gov/) and is available in monkeys, cattle, dogs, rats, and There is about 90% or more homology in amino acid sequence with fibrillarin of mammals such as mice. Its function is known to be involved in ribosome biogenesis, biosynthesis of small nucleolar ribonucleic acid proteins, and mRNA processing (Patent Document 1).

A typical example of a compound that suppresses or inhibits the above function of fibrillarin is an anti-fibrillarin antibody. In addition, it has been reported that a peptide fragment having no fibrillarin activity derived from the fibrillarin protein often acts as a fibrillarin activity inhibitor (Patent Document 1). Recently, yamamarin, a peptide derived from wild silkworms, and its derivatives form a complex with fibrillarin (Non-Patent Document 1, Patent Document 2), inhibit the action of fibrillarin, exhibit a cell growth inhibitory effect, and mitochondrial NADH. It has been reported that it inhibits respiration (Non-Patent Documents 2 and 3).
The cytostatic activity caused by inhibition of the action of fibrillarin shortens the S phase, which corresponds to the DNA replication phase, and extends the stationary phase to suppress cell growth. is not intended to suppress That is, it has been reported that cell proliferation is suppressed by controlling the cell cycle (Patent Document 2).
Substances that suppress the expression and activity of fibrillarin include agents for suppressing the proliferation of or killing undifferentiated stem cells such as ES cells and iPS cells (Patent Document 1), and polycythemia vera caused by the proliferation of erythroid progenitor cells. Or it was reported that it can be used as a therapeutic agent for essential thrombocythemia caused by proliferation of megakaryocyte progenitor cells (Patent Document 2). However, even if fibrillarin is controlled, it is thought that it is difficult to induce the cell cycle control to the death of cancer cells. was not considered by

JP 2009-072186 A JP 2011-051917 A

Masakatsu Kamiya, Hokkaido University May 26, 2014 Grant-in-Aid for Scientific Research Report "Elucidation and Application of the Molecular Basis of Cell Proliferation-Inhibitory Activity of Wild Silkworm-Derived Bioactive Peptides" Interdisciplinary research support project for creation of bio-industry (FY 2011 project) Research results collection pp. 47-48 "Development of cytostatic agent using Yamamarin derived from wild silkworm as lead compound" Insect Biotech 82(2), 73-78 (2013)

An object of the present invention is to provide a growth inhibitor for cancer cells with poor prognosis and a therapeutic agent for cancer cell diseases. Another object of the present invention is to provide a test method that can easily predict the prognosis of cancer.

The present inventors have found that cancer cells with a high fibrillarin expression level (output level) have a poor prognosis (low survival rate) after starting treatment for cancer patients. Therefore, the use of fibrillarin siRNA to suppress the fibrillarin expression level (output level) was investigated.
The present inventors have found that cancer cell proliferation can be suppressed by suppressing the expression level (output level) of fibrillarin using siRNA. Furthermore, by administering fibrillarin siRNA to the transplanted cancer cells, growth suppression of cancer cells could be achieved. That is, by suppressing the expression or activity of fibrillarin, it is possible to suppress the proliferation of cancer cells, especially cancer cells of cancers with poor prognosis (cancer cells with high fibrillarin expression (production)). It has been found that it is possible to treat cancer diseases.
The present inventor completed the present invention based on the above knowledge.

That is, the gist of the present invention is as follows.
[1] A cancer cell growth inhibitor containing an inhibitor of fibrillarin expression or activity as an active ingredient.
[2] The cancer cell growth inhibitor of [1], wherein the cancer cells are cancer cells that highly express fibrillarin.
[3] The above-mentioned cancer cells with high fibrillarin expression are cancer cells with a fibrillarin RNA expression level equal to or higher than the median fibrillarin RNA expression level determined from a patient database for each cancer type, according to [2]. Growth inhibitor for cancer cells.
[4] the cancer cells are colon cancer cells, ovarian cancer cells, breast cancer cells, lung adenocarcinoma cells, glial adenocarcinoma cells, or renal cancer cells; [1] or The cancer cell growth inhibitor of [2].
[5] The cancer cell proliferation inhibitor of [4], wherein the cancer cells are renal cancer cells.
[6] Proliferation of cancer cells according to any one of [1] to [5], wherein the inhibitor of fibrillarin expression or activity is fibrillarin siRNA, shRNA, or antisense, or a modified form thereof. inhibitor.
[7] The fibrillarin siRNA contains an RNA sequence (SEQ ID NO: 1: ggucgaggcggagggcuuua) corresponding to the nucleotide sequence of positions 103 to 121 of the nucleotide sequence of the human fibrillarin gene, or 1 or 2 in SEQ ID NO: 1 The cancer cell growth inhibitor of [6], which contains an RNA base sequence in which one base is substituted, inserted, or deleted, and which suppresses the expression of human fibrillarin.
[8] The cancer cell proliferation inhibitor of [7], wherein the fibrillarin siRNA has 19 to 25 bases.
[9] A therapeutic agent for cancer, comprising the cancer cell growth inhibitor according to any one of [1] to [8] above as an active ingredient.
[10] A fibrillarin siRNA comprising a base sequence of up to 25 bases including the base sequence of SEQ ID NO: 1: ggucgaggcggagaggcuuua, or a modified form thereof.
[11] A method for inhibiting cancer cell proliferation, comprising administering an inhibitor of fibrillarin expression or activity to a cancer patient in an amount effective for inhibiting cancer cell proliferation.
[12] A method for treating cancer, comprising administering to a cancer patient an inhibitor of fibrillarin expression or activity in an amount effective for cancer treatment.
[13] Use of an inhibitor of fibrillarin expression or activity for producing a cancer cell growth inhibitor.
[14] Use of an inhibitor of fibrillarin expression or activity for the production of a therapeutic agent for cancer.
[15] An inhibitor of fibrillarin expression or activity for use in suppressing the growth of cancer cells.
[16] an inhibitor of fibrillarin expression or activity for use in cancer therapy;
[17] a step of measuring the fibrillarin expression level in cancer tissue of a cancer patient, a step of comparing the measured value with a median value of the fibrillarin expression level determined in advance for each type of cancer, and determining that the prognosis is poor when the measured value is equal to or higher than the median value, and determining that the prognosis is good when the measured value is lower than the median value.

The inhibitor of fibrillarin expression or activity of the present invention can suppress the growth of cancer cells even in malignant cancer cells with high fibrillarin expression and poor prognosis, and kill cancer cells. be able to. As a result, even cancer diseases with poor prognosis and low survival rates can be treated by using the fibrillarin expression or activity inhibitor of the present invention.

FIG. 2 is a diagram showing fibrillarin gene expression levels in cancer tissues of various cancer-bearing patients. FIG. 3 is a diagram showing the relationship between the amount of fibrillarin expressed in colorectal cancer and changes in patient survival rate. FIG. 4 is a diagram showing the relationship between the amount of fibrillarin expressed in ovarian cancer and changes in patient survival rate. FIG. 2 is a diagram showing the relationship between the amount of fibrillarin expressed in breast cancer and changes in patient survival rate. FIG. 2 is a diagram showing the relationship between fibrillarin expression level and change in patient survival rate in lung adenocarcinoma. FIG. 4 is a diagram showing the relationship between the amount of fibrillarin expressed in glial adenocarcinoma and changes in patient survival rate. FIG. 3 shows the effect of fibrillarin expression (production) suppression by fibrillarin siRNA in renal cell carcinoma lines. FIG. 2 shows a test method for suppressing the growth of xenograft renal cell carcinoma by suppressing the amount of fibrillarin expression (production). FIG. 10 shows the results of growth inhibition test of xenograft renal cell carcinoma by suppressing fibrillarin expression level (production level).

The “agent for suppressing fibrillarin expression or activity” of the present invention refers to a drug capable of suppressing the expression of fibrillarin in cancer cells or a drug capable of suppressing or inhibiting the function or activity of fibrillarin.
Agents capable of suppressing the expression of fibrillarin, that is, agents capable of suppressing the expression of the fibrillarin gene include antisense, siRNA, and shRNA that target fibrillarin (for example, human fibrillarin), siRNA, and shRNA (nucleic acids that target or bind to mRNA). compounds), miRNA, decoys, aptamers, nucleic acid compounds such as CpG oligonucleotides, and low-molecular-weight compounds such as actinomycin D that regulate transcription of rRNA.
Nucleic acid compounds such as antisense and siRNA may have 14 to 45 bases, and a suitable number of bases may be used depending on the type of nucleic acid compound. For example, antisense has 14 to 30 bases, siRNA has 19 to 25 bases, miRNA has 19 to 25 bases, decoy has 16 to 24 bases, and aptamer has 26 to 45 bases. and 16 to 24 bases in the CpG oligonucleotide, respectively.

The nucleic acid sequence of the nucleic acid compound for suppressing the expression of fibrillarin is not particularly limited, and an appropriate one can be used according to the type of nucleic acid compound used. For example, in the case of siRNA, one consisting of an RNA base sequence (SEQ ID NO: 1: ggucgaggcggaggcuuua) corresponding to the base sequence of positions 103-121 in the human fibrillarin gene sequence can be mentioned. In addition, those consisting of an RNA base sequence of 19 to 25 bases including the base sequence of SEQ ID NO: 1 can also be mentioned. Furthermore, shRNA containing these base sequences can also be used, and can be used as siRNA for suppressing the expression of fibrillarin in cells.
Further, the antisense RNA includes the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence of 19 to 30 nucleotides containing the nucleotide sequence. The antisense DNA consists of a nucleotide sequence of positions 103-121 (SEQ ID NO: 2: ggtcgaggcggagggcttta) in the human fibrillarin gene sequence, or a nucleotide sequence of 19-30 nucleotides including the nucleotide sequence. are mentioned.
In addition, siRNA consists of an RNA base sequence in which 1 to 2 bases, especially 1 base is substituted, inserted or deleted in SEQ ID NO: 1, or an RNA base sequence containing 19 to 25 bases thereof. can also be used as long as they suppress the expression of fibrillarin. Further, as the antisense RNA, in SEQ ID NO: 1, an RNA base sequence in which 1 to 2, particularly 1 base is substituted, inserted or deleted, or an RNA base sequence containing 19 to 30 Anything can be used as long as it suppresses the expression of fibrillarin. The antisense DNA consists of a DNA sequence in which 1 to 2, especially 1 base is substituted, inserted or deleted in SEQ ID NO: 2, or a 19 to 30 DNA sequence containing such a sequence. can also be used as long as they suppress the expression of fibrillarin. Suppressing the expression of fibrallin includes not only preventing the expression but also reducing the amount of expression.

When the nucleic acid compound is RNA, it may be designed so that it can be produced in vivo. For example, DNA encoding the RNA can be inserted into an expression vector for mammalian cells. Examples of such expression vectors include viral vectors and animal cell expression plasmids.

Moreover, when the nucleic acid compound is RNA, it may be chemically modified for stability improvement. Examples of chemically modified RNA include phosphorothioate, morpholinophosphorodiamidate, boranophosphate, RNA containing nucleic acid analogs such as LNA (Locked Nucleic Acid), 2'-O-methylated RNA, 2'-O- Methoxyethylated RNA and the like are included.

A drug that can suppress or inhibit the function or activity of fibrillarin refers to a drug that suppresses or inhibits the function of fibrillarin and a drug that suppresses or inhibits the activity of fibrillarin. Fibrillarin has a function of methylation modification of rRNA, and rRNA undergoes methylation modification and matures to participate in the formation of liposomes, which are protein factories. Therefore, if the methylation modification of rRNA is inhibited, ribosome formation cannot be performed and the function of fibrillarin is inhibited.
Human rRNA has about 200 methylation modification sites. The introduced methyl group generally has the effect of providing a local hydrophobic environment and weakening hydrogen bonding. 2'-O-methylation of ribose plays a role in fixing the twisted structure of ribose to the C3'-end type and contributes to the local structure formation of rRNA. Thus, the chemical properties of rRNA methylation modification play various roles in ribosome biosynthesis and function (Seikagaku Vol. 85, No. 10, pp. 896-908, 2013). The mechanism of this rRNA methylation modification reaction is as follows. That is, snoRNA having a consensus sequence called Box C/D forms a base pair with rRNA, and four proteins (main component is fibrillarin) of fibrillarin, Nop58p, Nop56p, and Snu13p (15.5 k in humans) are formed. Forming a bound Box C/D snoRNP complex, it serves as a guide for determining the methylation site of the target rRNA and the methylation modification of the rRNA. The donor of the introduced methyl group is S-adenosylmethionine (SAM), and methylation modification is performed by the action of methyltransferase.
Therefore, an agent that suppresses or inhibits the function of fibrillarin refers to an agent that suppresses or inhibits the above mechanism of methylation modification. Examples include nucleic acid compounds such as aptamers or peptides.

A drug that suppresses or inhibits the activity of fibrillarin means a molecule that suppresses or inhibits the activity of fibrillarin because it binds to the target of fibrillarin but has no activity, or a molecule that binds to or interacts with fibrillarin and suppresses the activity of fibrillarin. or a drug that inhibits For example, the fibrillarin-derived peptide fragment described in Patent Document 1 binds to the target of fibrillarin but does not have fibrillarin activity, so it competes with fibrillarin to inhibit its activity. In addition, Yamamarin described in Non-Patent Document 1 and Patent Document 2 (C-terminal amidated peptide (Asp-Ile-Leu-Arg-Gly)-NH ₂ ) and its N-terminal acylation (especially C6- 28-acylated) derivatives bind to fibrillarin and inhibit its activity. Antibodies against fibrillarin also bind to fibrillarin and inhibit its activity.

The "cancer cell" of the present invention refers to a cancer cell with high expression of fibrillarin. Depending on the type of cancer cell, the expression level of fibrillarin varies depending on the type of cancer cell, as shown in FIG. called cancer cells. The median fibrillarin expression level of various cancer cells refers to the median fibrillarin expression level of cancer tissues of at least 50, especially 50 to 150 cancer patients. It can be calculated from the data collected by the Cancer Genome Atlas Project by the Human Genome Research Institute.

Among cancer cells, as shown in FIGS. 2 to 7, for example, colon cancer, ovarian cancer, breast cancer, lung cancer (especially lung adenocarcinoma), glial cancer, and renal cancer, When the expression level of fibrillarin in cancer tissues is high, cancer cells tend to metastasize, resulting in cancer diseases with poor postoperative prognosis and low survival rates.

Therefore, cancer cells with high fibrillarin expression can also be regarded as cancer cells of cancer patients exhibiting a survival rate lower than the median survival rate of various cancer patients. The median survival rate of various cancer patients refers to the median survival rate of at least 50, especially 50 to 150 cancer patients. It can be determined from the data collected by the Genome Atlas Project.
Survival rate, for example, 50 to 3000 days after the start of cancer treatment (including surgical treatment including surgery such as cancer resection, radiotherapy, chemotherapy, etc.) Survival rate after 300 to 1500 days can be The survival rate is 50 to 150 days (especially 50 days) after the start of cancer treatment for colorectal cancer, 50 to 150 days (especially 50 days) for ovarian cancer, and 50 to 150 days (especially 50 days) for breast cancer from the day cancer treatment is started. 100 days later), 1000-3000 days (especially 1500 days) for lung cancer (especially lung adenocarcinoma), and 300-1000 days (especially 500 days) for glial adenocarcinoma. can.
The inhibitor of fibrillarin expression or activity of the present invention is more effective against cancer cells with poor prognosis and high expression of fibrillarin.

The "cancer therapeutic agent" of the present invention may contain additives and carriers as long as an effective amount of the inhibitor of fibrillarin expression or activity is present in a manner that exhibits its function. For example, depending on the administration route, drug release mode, etc., it may be coated with a time-disintegrating material, or incorporated into an appropriate drug release system. It may be formulated with a targeting agent for delivery to target cancer tissue.
The cancer therapeutic agent of the present invention can be administered by various routes including both oral and parenteral routes, for example, without limitation, oral, intravenous, intramuscular, subcutaneous, topical (especially intratumoral), lymphatic or It can be administered by routes such as intralymphatic, intrathecal, intrarectal, intraarterial, intraportal, intraventricular, transmucosal, transdermal, intranasal, intraperitoneal, intrapulmonary and intrauterine. It can be formulated in dosage forms suitable for the route. Any known dosage form and formulation method can be appropriately employed (see, for example, Standard Pharmacology, Yoshiteru Watanabe et al., Nankodo, 2003).
An effective amount of an inhibitor of fibrillarin expression or activity is, for example, an amount that suppresses cancer growth, alleviates symptoms, or delays or stops progression, preferably inhibits progression of cancer. , or a cancer-curing amount. Also, an amount that does not cause adverse effects that exceed the benefits of administration is preferred. Such amount can be appropriately determined by in vitro tests using cultured cells or the like, or tests in model animals such as mice, rats, dogs or pigs, and such test methods are well known to those skilled in the art. . In addition, dosages of additives and carriers are known to those skilled in the art, or can be appropriately determined by the above tests.

The present invention provides a method for inhibiting cancer cell proliferation, comprising administering to a cancer patient an inhibitor of fibrillarin expression or activity in an amount effective for inhibiting cancer cell proliferation. Suppression of cancer cell proliferation refers to reducing the degree of proliferation compared to cancer cells when no drug is administered.
The present invention also provides a cancer treatment method comprising administering to a cancer patient a therapeutically effective amount of an inhibitor of fibrillarin expression or activity. Cancer treatments include curing, remission, amelioration, alleviation, slowing progression, halting progression, etc. of cancer.
As described above, the "cancer cells" of the present invention refer to fibrillarin-highly expressed cancer cells. A poor cancer patient.
The inhibitor of fibrillarin expression or activity may be formulated together with additives and carriers and then administered. The route of administration varies depending on the dosage form, and is oral, intravenous, intramuscular, subcutaneous, local (especially intratumoral), intralymphatic or intralymphatic, intrathecal, intrarectal, intraarterial, intraportal, intraventricular. , transmucosal, transdermal, intranasal, intraperitoneal, intrapulmonary, intrauterine, and the like.

The amount of fibrillarin expression or activity inhibitor effective for cancer cell growth inhibition or cancer treatment depends on various conditions, such as cancer type, severity of symptoms, general health condition, age, body weight. , sex, diet, timing and frequency of administration, concomitant drugs, response to treatment, compliance to treatment, dosage form, route of administration, etc., can be determined by those skilled in the art.
The amount of fibrillarin expression or activity inhibitor effective for cancer cell proliferation suppression or cancer treatment varies depending on the above-mentioned various conditions, but for example, 0.00001 mg to 100 g, especially 0.0001 mg per day. ~10 g, especially 0.001 mg to 1 g, 0.01 mg to 100 mg, especially 0.1 mg to 10 mg. When the agent for suppressing the expression or activity of Brillarin is a modified nucleic acid compound, this dose is the amount converted to the nucleic acid compound. In addition, when not administered every day or when the administration frequency changes over time, it is the dose per day calculated from the total dose.

The frequency or schedule of administration will vary depending on the various conditions described above, but may be, for example, multiple times a day (ie 2, 3, 4, or 5 or more times a day), once a day, every few days (ie 2, 3 , every 4, 5, 6, 7 days, etc.); several times a week (e.g., 2, 3, 4 times a week, etc.); can be In addition, the frequency of administration may be changed over time depending on the symptoms.
The administration period can be until the cancer is cured or in remission.

The present invention comprises the steps of measuring the fibrillarin expression level in cancer tissues of cancer patients, comparing the measured value with the median value of the fibrillarin expression level determined in advance for each type of cancer, and the measured value determining that the prognosis is poor when the measured value is the median value or higher, and determining that the prognosis is good when the measured value is lower than the median value.

The fibrillarin expression level, that is, the expression level of the fibrillarin gene, can be quantified by extracting RNA from cancer tissues collected from cancer patients according to a conventional method, and performing RT-qPCR, for example.

The median fibrillarin expression level of various cancer cells refers to the median fibrillarin expression level of cancer tissues of at least 50, especially 50 to 150 cancer patients. It can be determined from data collected by the Cancer Genome Atlas Project of the Human Genome Research Institute.

Poor prognosis refers to a low survival rate after the start of cancer treatment (including surgical treatment including surgery such as cancer resection, radiotherapy, chemotherapy, etc.), and good prognosis refers to It refers to a high survival rate after the first day of such cancer treatment.
The survival rate can be, for example, the survival rate 50 to 3000 days, especially 300 to 1500 days from the date of initiation of cancer treatment. In particular, 50 to 150 days (especially 50 days) after the start of cancer treatment for colorectal cancer, 50 to 150 days (especially 50 days) after the start of cancer treatment for ovarian cancer, and the start of cancer treatment for breast cancer 50 to 150 days (especially 100 days) from day 1, 1000 to 3000 days (especially 1500 days) from the start of cancer treatment for lung adenocarcinoma, 300 to 1000 days after the start of cancer treatment for glial cancer It can be the survival rate after days (especially 500 days).

In the cancer prognosis examination method of the present invention, the fibrillarin expression level may be measured before or after the cancer treatment start date. Among them, it is preferable to measure the fibrillarin expression level before starting cancer treatment, and in the case of cancer treatment by suppressing fibrillarin expression, the fibrillarin expression level may be measured before starting cancer treatment.

EXAMPLES The present invention will be described in more detail below based on examples and test examples, but the present invention is not limited by these.

(Example 1) Expression level of fibrillarin gene in various cancer-bearing patients a) Materials and reagents:
Public data such as cancer genomes, epigenomes, transcriptomes, mutation information, etc. in various tissues collected by the Cancer Genome Atlas Project of the National Cancer Institute, US National Human Genome Research Institute b) Method:
Acquire the RNA expression data (RPKM value: Reads per kilobase of exon per million mapped reads) of the fibrillarin gene analyzed by RNA-seq in the public data, and use the expression level of all genes to obtain the relative value of the fibrillarin RNA expression level (AU) was calculated by the normalization method, and the relative value of the fibrillarin gene expression level for each patient was displayed as log2.
c) Results:
As shown in FIG. 1, it was revealed that the fibrillarin gene is highly expressed in many cancers.

(Example 2) Correlation between expression level of fibrillarin gene in various cancer-bearing patients and survival rate of cancer-bearing patients a) Materials and reagents:
Public data such as cancer genomes, epigenomes, transcriptomes, mutation information, etc. in various tissues collected by the Cancer Genome Atlas Project of the National Cancer Institute, US National Human Genome Research Institute b) Method:
We collected the expression level of the fibrillarin gene in cancer tissues and the number of survival days after the start of treatment in cancer-bearing patients within public data.
For each cancer tissue of patients with colorectal cancer, ovarian cancer, breast cancer, lung adenocarcinoma, and glioma, the median value of the fibrillarin RNA expression level was calculated, and values above the median value were indicated as high, and lower values. was classified as low. Each cancer patient was classified into a high group and a low group, and the postoperative survival rate of each group patient was calculated over time and graphed by the Kaplan-Meier method. Statistical analysis was performed with the Cox proportional hazards model.
c) Results:
As shown in Figures 2 to 6, among cancer-bearing patients with colorectal cancer, ovarian cancer, breast cancer, lung adenocarcinoma, and glial adenocarcinoma, the amount of fibrillarin expressed (produced) is high. showed a poor survival rate. 2 to 6, the solid line indicates the median value, and the two dashed lines indicate the highest and lowest values, respectively.

(Example 3) Suppressing effect of fibrillarin expression (production) by fibrillarin siRNA in renal cell carcinoma line a) Materials and reagents:
Renal cell carcinoma: 7860 strain fibrillarin siRNA: Uses an RNA nucleotide sequence (SEQ ID NO: 1: ggucgaggcggagggcuua) corresponding to positions 103 to 121 in the nucleotide sequence of the human fibrillarin gene.
b) Method:
After culturing the 7860 strain in a 24-well plate, 5 μM of fibrillarin siRNA was introduced into the cells using 5 μL of Dharmafect reagent (GE-healthcare). After culturing for 72 hours, RNA was extracted and fibrillarin expression level was analyzed by RT-qPCR. The fibrillarin expression level was expressed as a relative value to the fibrillarin expression level of control cells into which no siRNA was introduced.
c) Results:
As shown in FIG. 7, the use of fibrillarin siRNA reduced the fibrillarin expression level (production level) of the renal cell carcinoma line to about one-tenth.

(Example 4) Growth inhibition test of xenograft renal cell carcinoma by suppression of fibrillarin expression level (production level) a) Materials and reagents:
・Human renal cancer cell line for xenotransplantation: 786O mock
-Fibrillarin siRNA: Uses the nucleotide sequence of the human fibrillarin gene (nucleotide sequence corresponding to the nucleotide sequence of positions 103-121 (SEQ ID NO: 1: ggucgaggcggagggcuuua)).
- EGFP siRNA: MISSION siRNA (SIGMA) is used.
b) Method:
Nude mice (male, 4 weeks old) were subcutaneously injected with 5×10 ⁶ human renal cancer cell lines (786O mock). Fibrillarin siRNA (1 nM) mixed with atelocollagen was injected into the human renal cancer cell line injection site according to the schedule shown in FIG. As a control, a human renal cancer cell line was similarly injected into the opposite side of the body, and EGFP siRNA (1 nM) mixed with atelocollagen was injected into the human renal cancer cell line injection site on the same schedule.
The diameter of the transplanted kidney cells was measured on the day of the start of administration of fibrillarin siRNA and on the 5th, 10th, 17th, 25th and 32nd days thereafter.
c) Results:
As shown in FIG. 9, renal carcinogenesis was suppressed at sites where fibrillarin siRNA was administered. Moreover, the diameter of the transplanted renal cancer was clearly reduced until 17 days after the start of administration of siRNA, suggesting that the cancer died. On the other hand, as a control, the diameter of the transplanted renal cancer was increased at the site where EGFP siRNA was administered.

As described above, in human renal cancer cell lines, engraftment and proliferation of cancer cells in nude mice could be significantly suppressed by administering fibrillarin siRNA to suppress the expression of fibrillarin. This indicates that suppression of fibrillarin expression or action of fibrillarin can suppress proliferation of cancer cells, particularly cancer cells that highly express fibrillarin. In other words, it indicates that cancer can be treated by suppressing the expression of fibrillarin or suppressing the action of fibrillarin.

The inhibitor of fibrillarin expression or action of the present invention effectively suppresses the growth of cancer cells, particularly cancer cells that highly express fibrillarin, and treats cancer with a new mechanism of action. can do The inhibitor of fibrillarin expression or action of the present invention can be used as a single agent, or can be used in combination with other cancer therapeutic agents.

Claims (6)

An siRNA having a base sequence of SEQ ID NO: 1: ggucgaggcggaggcuuua, an antisense RNA having a base sequence of SEQ ID NO: 1: ggucgaggcggaggcuuua, or an antisense DNA having a base sequence of SEQ ID NO: 2: ggtcgaggcggaggcttta, which targets fibrillarin, as an active ingredient. cancer cell growth inhibitor. The agent for suppressing cancer cell proliferation according to claim 1, wherein the cancer cells are cancer cells that highly express fibrillarin. 3. The cancer cell according to claim 2, wherein the cancer cell with high fibrillarin expression is a cancer cell with a fibrillarin RNA expression level equal to or higher than the median fibrillarin RNA expression level determined from a patient database for each cancer type. growth inhibitor. 3. The cancer cells according to claim 1 or 2, wherein the cancer cells are colon cancer cells, ovarian cancer cells, breast cancer cells, lung adenocarcinoma cells, glial adenocarcinoma cells, or renal cancer cells. cancer cell growth inhibitor. 5. The cancer cell proliferation inhibitor according to claim 4, wherein the cancer cells are renal cancer cells. A cancer therapeutic agent comprising the cancer cell growth inhibitor according to any one of claims 1 to 5 as an active ingredient.

Images