JP7178122B2 - A method for protein introduction into the nucleus of plant cells - Google Patents

Description

TECHNICAL FIELD The present invention relates to a method for introducing protein into the nucleus of plant cells, a method for genome modification using the method, and the like.

Genomic DNA is also called the blueprint of life, and techniques for breeding various organisms by modifying the genomic DNA sequence are known. As a classical method, a genome modification method using a recombination enzyme called phage-derived Cre recombinase is known. By transiently expressing the Cre recombinase, it is possible to recognize loxP sequences located on two different DNA sequences and recombine the sequences. The Cre/loxP system is used in various organisms such as fly, mouse, and human cells, and is used for regulation of gene expression inserted on the genome sequence. Although plants are also used in the field of gene expression analysis, reports of Cre have been limited because it is difficult to transiently express genes in plants (Non-Patent Document 1, etc.). In recent years, genome editing enzymes (ZFN, TALEN, CRISPR/Cas9) have also been reported to modify genomes by transient introduction (Non-Patent Document 2, etc.), and genetic analysis and breeding of plants have been reported. Techniques for introducing such materials are considered important in the field. In addition, in genome editing technology, side effects caused by long-term expression of an artificial nuclease by introduction of an expression vector are regarded as a problem, and it is desirable to stop the expression of the artificial nuclease after a certain period of time.

Several methods have been developed for introducing substances (especially proteins) into plants. The first is an introduction method using Agrobacterium (genus Rhizobium) as a biological method, which is most widely used. Utilizing the property that Agrobacterium infects plants and integrates the Ti plasmid present in Agrobacterium into the plant genome, the modified gene will be introduced into the plant by genetically modifying the Ti plasmid. and Efficient introduction is possible depending on the combination of specific Agrobacterium and plant species. As the second method, there is a physical introduction method, and the particle bombardment method in which gene-attached microparticles are shot at high speed and the whisker method in which the gene is introduced by rubbing glass fibers have been reported. A third technique is the protoplast-PEG method, in which protoplasts are prepared by removing plant cell walls using enzymes such as cellulase and pectinase, and cell membrane fusion is induced using PEG. As a fourth method, a case has been reported in which a protein to be introduced is tagged with CPP or the like and introduced into an individual plant (Non-Patent Document 3, etc.).

In animal cells, techniques for transient introduction of protein enzymes have been developed in anticipation of the application of genome modification technology. Although there are not so many reported examples, methods of introducing genome-editing enzymes such as Cre proteins, or genome-editing enzymes such as ZFN proteins, TALEN proteins, and Cas9 proteins into the nucleus have been reported (Non-Patent Document 4, etc. ).

Gilbertson L. Trends Biotechnol. 21, 550-555 (2003) Gaj T. et al., Trends Biotechnol. 31, 397-405 (2013) Chang M. et al., Plant Cell Physiol. 46(3), 482-488 (2005) Liu J. et al., Nat. Protoc. 10, 1842-1859 (2015)

However, since plant cells have a cell wall, methods for introducing substances into plants have been limited to several methods, unlike methods for introducing substances into animal cells.

All of the above methods of introducing substances into plants have drawbacks. For example, in the method using Agrobacterium, there are no strains with high introduction efficiency depending on the plant species. In addition, the particle bombardment method requires high equipment costs and running costs. In these methods, introduction of only the target protein into plants has not been reported. In addition, in the protoplast-PEG method, the efficiency of regeneration into a plant body is extremely low due to the removal of the plant cell wall. Furthermore, in the method of attaching a tag such as CPP and introducing it into a plant individual, when CPP is fused with a marker protein such as a fluorescent protein or a drug resistance protein, a part of the fusion protein migrates to the intercellular space etc. However, there is a drawback that the activity of the marker protein may be detected even if it has not been introduced into the plant cell (cytosol and nucleus).

At present, a method using Agrobacterium, which is about 30 years old technology, is still widely used in the introduction of substances into plants. Under these circumstances, no cases have demonstrated that proteins can be introduced into the nucleus of plant cells with cell walls. Therefore, the problem to be solved by the present invention is to efficiently introduce a protein of interest into the nucleus of a plant cell having a cell wall, and to regenerate the plant cell into which the protein of interest has been introduced into a plant body. It is to develop a method.

As a result of intensive studies to solve the above problems, the present inventors have found that by using two approaches, electroporation and protein transduction (direct introduction), The present inventors have found that a target protein can be efficiently introduced into the nucleus of a plant cell, and that the plant cell into which the target protein has been introduced can be regenerated into a plant body, leading to the completion of the present invention.

Accordingly, the present invention provides:
(1) A method of introducing a protein into the nucleus of a plant cell having a cell wall, characterized by using electroporation.

(2) under the following conditions:
a poring voltage of about 120 V/cm to about 1200 V/cm;
Pouring time is about 1 ms to about 100 ms,
the buffer has a conductivity of about 0.1 S/m to about 4.0 S/m;
an osmotic pressure of the buffer from about 50 mOsm/kg to about 1000 mOsm/kg, and a concentration of the protein from about 0.1 μM to about 100 μM
(1) The method according to (1), wherein the electroporation is performed in

(3) a poring voltage of about 300 V/cm to about 750 V/cm;
Pouring time is about 2ms to about 75ms
The method according to (2).

(4) The method according to (2) or (3), wherein the protein concentration is about 0.5 μM to about 100 μM.

(5) The method according to any one of (2) to (4), wherein Eagle's minimum essential medium or its modified medium is used as the buffer.

(6) The method according to (5), wherein Opti-MEM (registered trademark) I is used as a buffer.

(7) A genome modification method, which comprises introducing a genome modification enzyme into the nucleus of a plant cell having a cell wall using the method according to any one of (1) to (6).

(8) A genome editing method, which comprises introducing a genome editing enzyme into the nucleus of a plant cell having a cell wall using the method according to any one of (1) to (6).

(9) A method of introducing a protein into the nucleus of a plant cell having a cell wall, characterized by using protein transduction.

(10) under the following conditions: Protein transduction is
an osmotic pressure of the buffer from about 50 mOsm/kg to about 1000 mOsm/kg, and a concentration of the protein from about 0.2 μM to about 200 μM
(9) The method according to (9), wherein the protein transduction is performed in

(11) The method according to (10), wherein the protein concentration is about 0.5 μM to about 100 μM.

(12) A genome modification method, which comprises introducing a genome modification enzyme into the nucleus of a plant cell having a cell wall using the method according to any one of (9) to (11).

(13) A genome editing method, which comprises introducing a genome editing enzyme into the nucleus of a plant cell having a cell wall using the method according to (9) or (11).

INDUSTRIAL APPLICABILITY According to the present invention, a protein can be directly introduced into the nucleus of a plant cell having a cell wall easily and inexpensively. According to the present invention, genome modification can be performed by introducing a genome-modifying enzyme such as Cre protein as a protein into the nucleus of a plant cell having a cell wall. By introducing Cre protein into plant cells using such a genome modification method, it is also possible to remove artificial nucleases and/or drug resistance genes located between loxPs. Furthermore, according to the present invention, genome editing can be performed by introducing genome-editing enzymes such as ZFN protein, TALEN protein, and Cas9 protein into the nucleus of plant cells having cell walls as proteins. Unlike genome editing methods that introduce genes into cells, genome editing methods that introduce such proteins into cells do not have the problems of long-term expression of artificial nucleases and side effects due to integration of genes into the genome.

FIG. 1 is a schematic diagram of a reporter gene for confirming protein introduction into the cell nucleus. Figure 2 shows the effect of buffer (GUS staining) on the introduction of protein by electroporation (Figure 2a) and the difference in cytotoxicity depending on the buffer (Figure 2b). FIG. 3 shows the effects of pouring voltage (FIG. 3a), poring time (FIG. 3b), and number of pulses (FIG. 3c) on protein introduction by electroporation. A pulse voltage is a voltage applied to electrodes spaced 4 mm apart. FIG. 4 shows the relationship between protein concentration and transfection efficiency by GUS staining (upper and lower diagrams on the left side of FIG. 4) and GUS activity (diagrams on the right side of FIG. 4). FIG. 5 shows a schematic representation of the reporter gene (FIG. 5a) and detection of homologous recombination products (FIG. 5b) for measuring the homologous recombination efficiency of Cre recombinase using the electroporation method. An open triangle indicates a band before Cre introduction (before recombination), and a black triangle indicates a band after Cre introduction (after recombination). Figure 6 shows a scheme for confirming genome editing (Fig. 6a) and confirmation of deletions (Fig. 6b) when using the electroporation method. Open triangles indicate bands before introduction of guide RNA and Cas9 protein (genome editing), and black triangles indicate bands after introduction of guide RNA and Cas9 protein (genome editing). FIG. 7 shows the results of examining the effects of protein concentration and protein action time on protein transduction into the nucleus by direct transduction (protein transduction method). FIG. 8 shows the results of comparing protein nuclear introduction by the method of the present invention and the conventional method. In the figure, DIVE indicates protein transduction, Elec. indicates electroporation and Agrobacterium infection indicates infection with Agrobacterium (2 days and 5 days later). B1 indicates that protein transfer was performed in Opti-MEM medium and B2 in NT-1 medium. GV indicates infection with Agrobacterium GV3101 strain, and LBA indicates infection with Agrobacterium LBA4404 strain. An open triangle indicates a band before Cre introduction (before recombination), and a black triangle indicates a band after Cre introduction (after recombination). The results of detection by SSA reporter assay of the nuclease activities of ZF-ND1 and ZF-FokI introduced into plant cells by electroporation are shown. The results of detection by SSA reporter assay of the nuclease activities of ZF-ND1 and ZF-FokI introduced into plant cells by the protein transduction method are shown. The results of GUS staining detection of the recombinase activity of the Cre protein introduced into the plant individual by the protein transduction method are shown.

In one aspect, the present invention provides a method of introducing a protein into the nucleus of a plant cell having a cell wall, characterized by using electroporation.

Cell walls of plant cells are known. Its main skeleton is cellulose fibrils. In the present invention, a plant cell having a cell wall is a plant cell that is entirely covered with a cell wall, and excludes a plant cell that partially has a cell wall. In this aspect of the invention, the protein is introduced into the nucleus of the cell-walled plant cell by electroporation.

The introduced protein can be any protein. There are no restrictions on the type, size, etc. of the protein.

Electroporation is a well-known technique for introducing substances by opening holes in cell membranes with electric pulses. The present inventors have now demonstrated for the first time that proteins can be introduced into the nucleus of plant cells having a cell wall by electroporation under certain fixed conditions.

Various electroporation devices are known and commercially available. A person skilled in the art can select a suitable one from these devices and use it in the present invention. A person skilled in the art can also make his own apparatus for electroporation.

Conditions for electroporation in the present invention are described below. A low poring voltage results in insufficient perforation, which reduces the efficiency of protein transduction. Higher poring voltages result in greater damage to cells. In the present invention, the pouring voltage is usually about 120 V/cm to about 1200 V/cm, preferably about 300 V/cm to about 750 V/cm, more preferably about 400 V, although it depends on conditions such as the type of plant and buffer. /cm to about 650 V/cm.

If the pouring time is too short, the perforation will be insufficient and the efficiency of protein introduction will decrease. The longer the poling time, the greater the damage to the cells. In the present invention, the pouring time is usually about 1 ms to about 100 ms, preferably about 2 ms to about 75 ms, more preferably about 10 ms to about 50 ms, although it depends on the type of plant and conditions such as buffers.

In general, protein introduction efficiency can be increased by shortening the poling time when the pouring voltage is high and lengthening the pouring time when the pouring voltage is low. A person skilled in the art can determine the appropriate pouring voltage and pouring time by simple experimentation.

Pouring pulse may be performed once or multiple times. Preferably, 2 to 9 or more electrical pulses are applied.

If desired, the transfer pulse may be applied after applying the pouring pulse to the plant cells. The voltage of the transfer pulse is usually about 20 V/cm to about 100 V/cm, preferably about 30 V/cm to about 70 V/cm. The pulse width of the transfer pulse is usually about 1 ms to about 100 ms, preferably about 20 ms to about 80 ms. The pulse interval of transfer pulses is usually about 1 ms to about 100 ms, preferably about 20 ms to about 80 ms. The number of pulses is usually 1 to 30, preferably 10 to 30. These transfer pulse conditions can be appropriately selected and changed by those skilled in the art according to conditions such as cell type, buffer type, and electroporation apparatus.

The shape of the electric pulse for electroporation is not particularly limited, but exponential pulse and square pulse are exemplified. The pouring time is the time required for the voltage to decrease to 37% of the set voltage (initial voltage) in the case of the exponential pulse, and the set pulse length is the pouring time in the case of the square pulse.

There are no particular restrictions on the buffer used for electroporation in the present invention, and various types of buffers can be used. Examples of buffers include, but are not limited to, aqueous solutions containing salts, such as PBS (phosphate buffered saline), aqueous solutions containing sugars, and cell culture media. A commercially available buffer for electroporation may be used. Buffers of the present invention preferably include, but are not limited to, PBS, more preferably Eagle's minimum essential medium or its modified medium, and even more preferably Opti-MEM®I. Media such as Opti-MEM (registered trademark) I contain not only inorganic salts but also many organic substances present in cells such as amino acids and vitamins, and these components reduce cytotoxicity and electroporation efficiency. It is thought that it will contribute to the improvement of

Buffer conductivity and osmotic pressure affect the efficiency of material introduction into cells by electroporation. In the electroporation of the present invention, the conductivity of the buffer is usually about 0.1 S/m to about 4.0 S/m, preferably about 0, although it depends on conditions such as cell type and buffer composition. .3 S/m to about 3.0 S/m, more preferably about 0.6 S/m to about 2.0 S/m. In the present invention, the osmotic pressure of the buffer is usually about 50 mOsm/kg to about 1000 mOsm/kg, preferably about 100 mOsm/kg to about 500 mOsm/kg, although it depends on conditions such as cell type and buffer composition. , more preferably from about 250 mOsm/kg to about 350 mOsm/kg. The conductivity of the buffer can be adjusted by varying the concentration of electrolytes in the buffer. For example, the conductivity of the buffer can be adjusted by diluting or concentrating the cell culture medium as needed. The osmotic pressure of the buffer can be adjusted by changing the concentration of salts and sugars in the buffer. These techniques are known.

The concentration of protein introduced into the cells in the buffer is typically about 0.01 μM to about 100 μM, preferably about 0.1 μM to about 100 μM, more preferably about 0.5 μM to about 100 μM. The protein concentration may be 100 μM or higher. The higher the protein concentration, the more protein is introduced into the nucleus. A person skilled in the art can select an appropriate protein concentration according to the protein, plant cells, buffer, etc. used.

Accordingly, in one embodiment of the above aspect of the invention,
a poring voltage of about 120 V/cm to about 1200 V/cm;
Pouring time is about 1 ms to about 100 ms,
the buffer has a conductivity of about 0.1 S/m to about 4.0 S/m;
an osmotic pressure of the buffer from about 50 mOsm/kg to about 1000 mOsm/kg, and a concentration of the protein from about 0.1 μM to about 100 μM
electroporation is performed in Under such conditions, proteins can be efficiently introduced into the nuclei of plant cells having cell walls.

In a preferred embodiment of the above aspect of the invention, under the following conditions:
a poring voltage of about 300 V/cm to about 750 V/cm;
Pouring time is about 2ms to about 75ms,
the buffer has a conductivity of about 0.3 S/m to about 3.0 S/m;
an osmotic pressure of the buffer from about 100 mOsm/kg to about 500 mOsm/kg, and a concentration of the protein from about 0.5 μM to about 100 μM
electroporation is performed in

Pouring voltage and pouring time are correlated with respect to the efficiency of substance introduction into cells by electroporation, and the product of the two is preferably about 2500 ms·V to about 25000 ms·V.

In a particularly preferred embodiment of the above aspect of the invention, under the following conditions:
The product of the poring voltage and the poring time is about 2500 ms V to about 25000 ms V,
the buffer has a conductivity of about 0.6 S/m to about 2.0 S/m;
an osmotic pressure of the buffer from about 250 mOsm/kg to about 350 mOsm/kg, and a concentration of the protein from about 1 μM to about 100 μM
electroporation is performed in

Under such conditions, proteins can be more efficiently introduced into the nucleus of plant cells having cell walls.

Genome-modifying enzymes may be introduced into the nucleus of cell-walled plant cells using the above method using electroporation of the present invention. Therefore, in a further aspect of the present invention, there is provided a method for genome modification, which comprises introducing a genome-modifying enzyme into the nucleus of a plant cell having a cell wall using the method described above. For example, using the above method, genome modification can be performed by introducing a genome modification enzyme such as Cre protein into the nucleus of a plant cell having a cell wall as a protein. Such genome modification methods may be used to remove sites located between loxPs by introducing the Cre protein into plant cells.

Genome-editing enzymes may be introduced into the nucleus of a plant cell having a cell wall using the method described above using electroporation of the present invention. Therefore, in a further aspect of the present invention, there is provided a genome editing method, characterized by introducing a genome editing enzyme into the nucleus of a plant cell having a cell wall using the above method. Genome editing is a technique that utilizes site-specific nucleases to modify desired target genes. ZFN, TALEN, CRISPR/Cas9 and the like are often used as genome editing enzymes (nucleases). According to the present invention, since a genome editing enzyme can be introduced into the nucleus of a plant cell as a protein, there is no problem of side effects due to long-term expression of an artificial nuclease.

In another aspect, the present invention provides a method of introducing a protein into the nucleus of a plant cell having a cell wall, characterized by using protein transduction.

Protein transduction utilizes a phenomenon in which proteins are spontaneously taken up into cells without using special equipment or reagents. Protein transduction has several reports in mammalian cells. The present inventors have now demonstrated for the first time that proteins can be introduced into the nucleus of plant cells having a cell wall by performing protein transduction under specific fixed conditions.

In the present invention, introduction of a protein into the nucleus of a plant cell having a cell wall by protein transduction can be carried out by removing and culturing the cells after a certain period of time after adding the protein to be introduced to the buffer containing the cells. can. For example, protein can be introduced by adding a certain concentration of protein to a culture of plant cells, leaving the cells to stand for a certain period of time, washing the cells, and culturing them again.

The protein introduced by the method of this aspect of the invention can be any protein. There are no restrictions on the type, size, etc. of the protein.

Conditions for protein transduction in the present invention are described below. There are no particular restrictions on the buffer used for protein transduction, and various types of buffers can be used. Examples of buffers include, but are not limited to, aqueous solutions containing salts, such as PBS (phosphate buffered saline), aqueous solutions containing sugars, and cell culture media.

The osmotic pressure of the buffer affects the efficiency of substance introduction into cells by protein transduction. In the protein transduction of the present invention, the osmotic pressure of the buffer is usually about 50 mOsm/kg to about 1000 mOsm/kg, preferably about 100 mOsm/kg to about 600 mOsm, although it depends on conditions such as cell type and buffer composition. /kg, more preferably from about 150 mOsm/kg to about 400 mOsm/kg. The conductivity of the buffer can be adjusted by varying the concentration of electrolytes in the buffer. For example, the conductivity of the buffer can be adjusted by diluting or concentrating the cell culture medium as needed. The osmotic pressure of the buffer can be adjusted by changing the concentration of salts and sugars in the buffer. These techniques are known.

In the protein transduction of the present invention, the protein concentration is generally about 0.1 μM to about 500 μM, preferably about 0.2 μM to about 200 μM, more preferably about 0.5 μM to about 100 μM. The higher the protein concentration, the more protein is introduced into the nucleus, but it is necessary to consider the type and solubility of the protein, and the osmotic pressure and viscosity of the buffer in which the protein is dissolved. A person skilled in the art can select an appropriate protein concentration according to the protein, plant cells, buffer, etc. used.

Thus, in one embodiment of the above aspect of the invention, under the following conditions:
an osmotic pressure of the buffer from about 50 mOsm/kg to about 1000 mOsm/kg, and a concentration of the protein from about 0.2 μM to about 200 μM
in which protein transduction takes place. Under such conditions, proteins can be efficiently introduced into the nuclei of plant cells having cell walls.

In a preferred embodiment of the above aspect of the invention, under the following conditions:
an osmotic pressure of the buffer from about 100 mOsm/kg to about 600 mOsm/kg, and a concentration of the protein from about 0.2 μM to about 200 μM
in which protein transduction takes place.

In a particularly preferred embodiment of the above aspect of the invention, under the following conditions:
an osmotic pressure of the buffer from about 150 mOsm/kg to about 400 mOsm/kg, and a concentration of the protein from about 0.5 μM to about 100 μM
in which protein transduction takes place.

Under such conditions, proteins can be more efficiently introduced into the nucleus of plant cells having cell walls.

Genome-modifying enzymes may be introduced into the nucleus of cell-walled plant cells using the methods described above using the protein transduction of the present invention. Therefore, in a further aspect of the present invention, there is provided a method for genome modification, which comprises introducing a genome-modifying enzyme into the nucleus of a plant cell having a cell wall using the method described above. For example, using the above method, genome modification can be performed by introducing a genome modification enzyme such as Cre protein into the nucleus of a plant cell having a cell wall as a protein. Such genome modification methods may be used to remove sites located between loxPs by introducing the Cre protein into plant cells.

Genome-editing enzymes may be introduced into the nucleus of cell-walled plant cells using the methods described above using the protein transduction of the present invention. Therefore, in a further aspect of the present invention, there is provided a genome editing method, characterized by introducing a genome editing enzyme into the nucleus of a plant cell having a cell wall using the above method. Genome editing is a technique that utilizes site-specific nucleases to modify desired target genes. ZFN, TALEN, CRISPR/Cas9 and the like are often used as genome editing enzymes (nucleases). According to the present invention, a genome-editing enzyme can be directly introduced into the nucleus of a plant cell as a protein, so there is no problem of side effects due to long-term expression of an artificial nuclease.

In order to investigate protein introduction into the nucleus of plant cells having a cell wall in the present invention, the present inventors introduce a protein having enzymatic activity into the plant cell, and observe the enzymatic activity exhibited only in the nucleus. developed. Specifically, Cre recombinase was selected as the enzymatic protein, and the DNA recombination reaction was used as the enzymatic activity exhibited only in the nucleus. A plant cell line was established in which two loxP sequences were inserted into the nuclear genomic DNA of a plant, and a reporter gene was expressed upon recombination with Cre recombinase. Using this cell line, the transfection efficiency was verified by the expression level of the reporter gene when the protein was transfected by various methods. In the above method, Cre recombinase was used for verification, but the protein is not limited to this protein, and a genome editing enzyme, for example, may be used.

Techniques for proving the introduction of proteins into the nucleus include (1) introducing a fluorescently labeled protein into plant cells using some technique and observing the fluorescence with a microscope, etc., and (2) examining proteins with enzymatic activity. A method of directly observing the enzymatic activity by introducing it into plant cells by some method is also conceivable. However, both are considered insufficient. The reason why the above method (1) is insufficient is that (i) plant cells contain organelles such as chloroplasts and fluorescent biomolecules, so they cannot be distinguished from background fluorescence; and (ii) due to the presence of proteases in plant cells, the fluorescence signal does not necessarily indicate the localization of the protein of interest as a result of the separation of the protein of interest from the fluorescent label. is. The reason why the above method (2) is inadequate is that plant cells have various organelles, cell membranes, or intercellular spaces, so that the introduced enzyme protein exerts enzymatic reactions at locations other than the nucleus. This is because the introduction into the nucleus cannot be proven in such cases. The method developed by the present inventors does not have the drawbacks of methods (1) and (2).

Therefore, in a further aspect, the present invention provides a method for examining nuclear introduction of an externally introduced protein using a plant cell line having a site in the nuclear genomic DNA that specifically reacts with the protein introduced from the outside. offer. A mechanism may be provided in the nuclear genomic DNA that allows expression of a specific protein when the above-mentioned specific reaction occurs and allows detection of the expression from the outside. In the above method, examples of externally introduced proteins include, but are not limited to, genome-modifying enzymes such as Cre recombinase, genome-editing enzymes such as ZFNs, TALENs, and CRISPR/Cas9. The protein introduced from the outside may be a fusion protein, for example, a fusion protein of a genome-modifying enzyme such as Cre recombinase and another protein, a genome-editing enzyme such as ZFN, TALEN, CRISPR / Cas9 and another protein It may be a fusion protein or the like.

As a specific example of the above aspect, a fusion protein of Cre recombinase and a test protein is introduced into the above plant cell line, and expression of a reporter gene is examined, and the test protein enters the nucleus of a plant cell having a cell wall. There is a way to check the introduction of

Also provided by the present invention are plant cell lines for use in the above methods. One specific example is a plant cell line having a cell wall in which a loxP sequence is inserted into the nuclear genomic DNA and a reporter gene is expressed when a recombination reaction occurs in the nucleus by Cre recombinase.

Unless otherwise specified, the terms used herein have the meanings commonly understood in the fields of biochemistry, biology, botany, and the like. EXAMPLES The present invention will be described in more detail and specifically below by way of examples, but the examples are not intended to limit the present invention.

[Example 1]
A. Experimental methods and materials (1) Preparation of Cre protein Unless otherwise specified, reagents used in experiments were purchased from Fujifilm Wako Pure Chemical Industries (Osaka, Japan). The Cre protein used for electroporation was obtained by transfecting Escherichia coli BL21 (DE3) strain with plasmid pET-HNCre encoding the Cre gene with a 6-amino acid histidine tag and a nuclear localization signal derived from simian virus 40 added to the N-terminus. It was made by transforming and expressing. Detailed procedures for expression using E. coli and protein purification are shown below. After shaking culture of the transformed E. coli at 37° C. for 3 hours, isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 mM to induce protein expression. After culturing with shaking for an additional 2.5 hours, E. coli was lysed with a lysis buffer (20 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 10 mM imidazole, 1 mM benzylsulfonyl fluoride, 1 mM dithiothreitol, pH 8.0). did. Cre protein was then adsorbed onto a nickel NTA column, and contaminants were removed using a washing buffer (20 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 20 mM imidazole, pH 8.0). Elution of Cre protein was performed using an elution buffer (20 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 500 mM imidazole, pH 8.0). The eluted Cre protein was purified by gel filtration chromatography HiPrep 16/60 Sephacryl S-200 HR (GE healthcare, Illinois, USA) and buffer A (20 mM HEPES, 150 mM NaCl, 10% glycerol, 1 mM dithiothreitol, pH 7.4). and stored at -80°C after flash freezing in liquid nitrogen. It was dialyzed against HBS (20 mM HEPES, 150 mM NaCl, 5 mM KCl, 25 mM glucose) when used for electroporation.

(2) Preparation of plasmid The NOS promoter was amplified from pRI201 (Takara Bio Inc., Shiga, Japan) using primers (ACGGCCAGTGCCAAGCTTGATCATGAGCGGAGAATTAAG (SEQ ID NO: 1) and TCTGCGAAGCTCGACCTAGGAAACGATCCAGATCCGGTGCA (SEQ ID NO: 2)) and PCR method to generate The DNA fragment was cloned into pCambia-1305.2 (Marker Gene Technologies, Oregon, USA) partially cleaved with HindIII and XhoI using InFusion (Takara Bio) to form pCambiaN-GUS.さらにｐｃＤＮＡＦＲＴｘＥ２ＣｘｍＥｍをテンプレートとし、プライマー（ＧＧＡＣＴＣＴＴＧＡＣＣＡＴＧＴＡＡＴＡＡＣＴＴＣＧＴＡＴＡＧＣＡＴＡＣＡＴＴＡＴＡＣＧＡＡＧＴＴＡＴＧＴＴＡＡＣＴＡＣＡＴＣＡＣＡＡＴＣＡＣＡＣＡＡＡＡＣ（配列番号：３）及びＴＴＡＧＴＡＧＴＡＧＣＣＡＴＧＧＴＣＴＡＧＡＴＡＡＣＴＴＣＧＴＡＴＡＡＴＧＴＡＴＧＣＴＡＴＡＣＧＡＡＧＴＴＡＴＧＧＧＣＣＣＣＴＴＡＴＣＴＴＴＡＡＴＣＡＴＡＴＴＣＣＡ（配列番号：４））を用いてＰＣＲ法で２つのｌｏｘＰ配列に挟まれたＧＦＰ断片を増幅し、ＮｃｏＩで切断処理をしたIt was cloned into pCambiaN-GUS using InFusion (Takara Bio) to obtain pCambiaN-xGxGUS.

(3) Cell culture Arabidopsis thaliana T87 cell line transferred from RIKEN BioResource Center (Ibaraki, Japan) was cultured in NT1 medium (30 g/L sucrose, 0.1 mM KH ₂ PO ₄ , 1× Murashige Skoog Salt Mixture and Vitamins, 2 μM 2, 4-dichlorophenylacetic acid (adjusted to pH 5.8 using KOH) was cultured with shaking at 22° C. under light irradiation. To maintain the cells, they were passaged once a week at a 15-fold dilution. Agrobacterium tumefaciens (Rhizobium radiobacter) strain GV3101 was cultured with shaking at 28° C. in LB medium (Merck, Darmstadt, Germany) supplemented with 50 μg/mL rifampicin and 30 μg/mL gentamicin. Transformations were made by electroporating T-DNA in LB medium (Merck) containing 50 μg/mL rifampicin, 30 μg/mL gentamycin and 50 μg/mL kanamycin. For infection experiments on T87 cells, transformed GV3101 cells were cultured overnight in LB medium (Merck) containing 50 μg/mL rifampicin, 30 μg/mL gentamycin and 50 μg/mL kanamycin with shaking, followed by B5 medium (30 g/L sucrose , 0.5 g/L MES, 1x Gamborg's B5 Salt Mixture and Vitamins, 1 μM 1-naphthaleneacetic acid), washed three times, and suspended in B5 medium so that the OD600 value was 0.6. .

(4) Transformation of T87 Cells Using Agrobacterium Two days before transformation, T87 cells were cultured with shaking in B5 medium. T87 cells with a packed cell volume of 30 μL were infected with a suspension of GV3101 transformants with an OD ₆₀₀ value of 0.6 with a final concentration of 200 μM acetosyringone. After two days of shaking culture, the T87 cells were washed three times with B5 medium containing 200 μg/mL cefotaxime to remove GV3101, and continued shaking culture in the same medium for three days.

(5) Construction of T87 reporter cells After transformation by the method described above, T87 cells were transferred to CIM agar medium containing 200 μg/mL cefotaxime and 20 μg/mL hygromycin (0.6% agar, 30 g/mL). L sucrose, 0.5 g/L MES, 1× Gamborg's B5 Salt Mixture and Vitamins, 1 μM 1-naphthaleneacetic acid, pH adjusted to 5.7 using KOH) and cultured for 2 weeks. A single colony exhibiting strong green fluorescence was selected, transferred to NT1 medium containing hygromycin at a final concentration of 10 µg/mL, and cultured with shaking under the same conditions as for T87 cells. This cell line was designated as T87-xGxGUS cells.

(6) Electroporation T87-xGxGUS cells subcultured in NT1 medium 1-5 days before were collected in an Eppendorf tube and added with a buffer for electroporation (Opti-MEM I (Thermo Fisher Scientific, Massachusetts, USA), PBS (Phosphate buffered saline, Thermo Fisher Scientific), NT1 medium, or B5 medium). T87-xGxGUS cells with a packed cell volume of 20 μL were suspended on ice in 200 μL of electroporation buffer containing Cre protein at the concentration shown in each figure, and cuvette electrodes with an electrode interval of 4 mm (Neppagene, Chiba, Japan) were used. I put it in Unless otherwise specified, 5 pouring pulses with a voltage of 150 V (375 V/cm), a pulse width of 10 ms, and a pulse interval of 50 ms, and 20 transfer pulses with a voltage of 20 V (50 V/cm), a pulse width of 50 ms, and a pulse interval of 50 ms. Electroporation was performed under the conditions of NEPA21 Type II (Neppagene) was used as an electroporation device. Immediately after electroporation, the cells were collected and washed with 2 mL of NT1 medium, resuspended in NT1 medium, and subjected to shaking culture.

(7) Preparation of protoplasts T87-xGxGUS cells were washed with 400 mM mannitol, protoplasted enzyme solution (20 mM MES, 400 mM mannitol, 20 mM KCl, 10 mM CaCl ₂ , 1.5% (w/v) Onozuka RS (Serva Electrophoresis, Heidelberg, Germany), 0.25% (w/v) Macerozyme R-10 (Yakult Pharmaceutical Co., Ltd.) pH adjusted to 5.7 with NaOH). After culturing the cell suspension with shaking at 22° C. in the dark for 4 hours, a half volume of 200 mM CaCl ₂ was added to stop the enzymatic reaction, and protoplasts were recovered.

(8) Evans Blue Staining Cytotoxicity was evaluated 1 hour after electroporation using Evans blue, which has the property of not permeating the cell membrane of live cells but permeating only the membrane of dead cells. Cells were washed once with water and then stained with 0.05% (w/v) Evans blue stain for 15 minutes at room temperature. After staining, the cells were washed with water one or more times, and Evans blue was extracted using 50% (v/v) methanol and 1% (w/v) SDS. Cytotoxicity was quantified by measuring the absorbance of this extract at 595 nm using NanoDrop ONE (Thermo Fisher Scientific).

(9) GUS Staining To visualize GUS protein expression, cells were stained with 0.5 mg/mL X-glucuronide (X-Gluc, Carbosynth, Berkshire, UK) in staining buffer (20% (w/v)). ) methanol, 50 mM NaH ₂ PO ₄ , pH 7.0) and stained at 37° C. for 30 minutes. After staining, the reaction was stopped by replacing the supernatant with 70% (w/v) ethanol, and stained images were acquired using a phase-contrast microscope (Nikon, Tokyo, Japan).

(10) Measurement of GUS Activity Using Fluorescent Substrate Cells cultured with shaking for 2 days after electroporation were washed once with NT1 medium adjusted to pH 7.0 with KOH. A 5 μL packed cell volume of cells was suspended in 100 μL of NT1 medium (pH 7.0) containing 6-chloro-4-methylumbelliferyl β-D-curcuronide (CMUG, Glycosynth, Cheshire, UK) at a final concentration of 10 μM. It was clouded and transferred to a 96-well black plate (Thermo Fisher Scientific). Fluorescence intensity was measured using Wallac 1420 ARVOsx (PerkinElmer, Massachusetts, USA) at 460 nm when excited with light at 355 nm. In addition, quantification of the amount of chlorophyll in the same amount of cells used for electroporation was performed to standardize GUS activity. Chlorophyll was extracted by soaking a packed cell volume of 5 μL of cells in 50 μL of N,N-dimethylformamide for 6 hours at 4° C. in the dark. The absorbance of this extract at 646 nm and 664 nm was measured using NanoDrop ONE (Thermo Fisher Scientific), and the previous research (Porra, RJ et al., Biochim. Biophys. Acta-Bioenerg. 975, 384-394 (1989)). The amount of chlorophyll was calculated by the same method as described above. Furthermore, standard GUS activity was calculated by dividing the amount of increase in fluorescence intensity per minute by the weight (μg) of chlorophyll a and b.

(11) Genomic PCR
The cells cultured with shaking for 2 days after electroporation were immersed in a genomic DNA extraction solution (250 mM NaOH, 0.1% Tween 20) and treated at 98° C. for 10 minutes to extract genomic DNA. Further, half of 1M Tris-HCl (pH 6.5) was added to this solution, and after centrifugation, the supernatant was collected and used as a genomic DNA solution. Using this DNA as a template, primers targeting a reporter cassette (TCCTTCGCAAGACCCTTCCTC (SEQ ID NO: 5) and GGATGGCAAGAGCCCAAATGCTTAG (SEQ ID NO: 6)) and MightyAmp DNA Polymerase Ver. 3 (Takara Bio) was used to perform PCR. PCR products were subjected to agarose gel electrophoresis. The gel was further stained with GelGreen (Biotium, CA, USA) and photographed using the ChemiDoc XRS+ system (Bio-Rad, CA, USA). The efficiency of homologous recombination by Cre protein was calculated using the following formula.

Homologous recombination efficiency (%) = 100 x (a/(a+b))
a and b represent the band intensity of the homologously-recombined DNA amplification product and the band intensity of the non-homologously-recombined DNA amplification product, respectively.

(12) Statistical Analysis All measured values represent mean values with standard errors.

B. Results (1) Production of T87 Reporter Cells In order to verify whether Cre recombinase was introduced into cells, reporter cells, T87-xGxGUS cells, were established. In order to produce this cell, a promoter, loxP sequence, GFP gene, transcription termination signal, loxP sequence, and Agrobacterium were transformed with pCambiaN-xGxGUS encoding the GUS gene in order, and T87 cells were infected with the above-mentioned Agrobacterium. A reporter cassette was integrated into the genomic DNA. When Cre recombinase is introduced into the nucleus of this cell line and homologous recombination occurs between the two loxP sequences, the expressed protein switches from GFP to GUS (Fig. 1). GUS expression can be easily visualized and detected using the blue staining reagent X-Gluc and the fluorescent substrate CMUG. Recombination activity can be assessed.

(2) Introduction of Cre Recombinase into T87 Cells Using Electroporation Using the established T87-xGxGUS cells, an attempt was made to introduce Cre recombinase into T87 cells having cell walls by electroporation. NEPA21 Type II marketed by Nepagene was used for electroporation. Electroporation was performed using various buffers such as PBS, NT1 medium, B5 medium and Opti-MEMI, and cytotoxicity was evaluated after 1 hour, and GUS activity was evaluated after 2 days. As a result, as shown in FIG. 2, expression of GUS was not observed in most of the cells after electroporation using NT1 medium or B5 medium. When electroporation was performed using PBS, more cells expressed GUS than when using NT1 medium or B5 medium, but very high cytotoxicity was observed. On the other hand, surprisingly, when electroporated with Opti-MEMI, a large number of cells expressed GUS, although little cytotoxicity was observed. From this experiment, electroporation using Opti-MEMI achieved introduction of Cre recombinase into T87 cells with cell walls. Opti-MEM I contains not only inorganic salts but also many organic substances present in cells such as amino acids and vitamins, and these components contribute to the reduction of cytotoxicity and the improvement of electroporation efficiency Conceivable.

The electrical conductivity (S/m) and osmotic pressure (mOsm/kg) of each medium are as follows.

[Conductivity (S/m)]
Opti-MEM I: 1.11
PBS: 1.18
NT1: 0.54
B5: 0.34
[Osmotic pressure (mOsm/kg)]
Opti-MEM I: 285
PBS: 281
NT1:203
B5: 168
(3) Influence of Pouring Pulse Conditions on Electroporation Efficiency It is known that the efficiency of introduction of a foreign substance by electroporation greatly depends on the electrical conditions of the pouring pulse. Therefore, using NEPA21 Type II, the electroporation efficiency was evaluated when each condition (voltage, pulse width, number of pulses) of the pouring pulse was changed. The voltage of 100 V in this experiment corresponds to 250 V/cm, 150 V corresponds to 375 V/cm, 200 V corresponds to 500 V/cm, and 250 V corresponds to 625 V/cm. In this experiment, the electroporation efficiency was indirectly evaluated by evaluating the GUS activity using CMUG. As a result, it was observed that the GUS activity increased depending on the voltage increase of the pouring pulse (Fig. 3a). In addition, the GUS activity also increased in a pulse width-dependent manner (Fig. 3b). On the other hand, when the pulse number was changed, almost no pulse-number-dependent change in GUS activity was observed (Fig. 3c). These experimental results indicate that the voltage and pulse width of the pouring pulse are important when electroporating proteins into cell wall-bearing plant cells, and that increasing the voltage or pulse width, or both, yields more of protein can be introduced.

(4) Effect of Protein Concentration on Electroporation Efficiency When exogenous biomaterials such as DNA, RNA, and proteins are introduced into cells, the concentrations of these materials are very important. Therefore, we evaluated the effect of protein concentration on electroporation efficiency in a protein electroporation system for plant cells. Electroporation was carried out by varying the concentration of Cre recombinase from 0.01 μM to 5 μM, and after 2 days the percentage of cells expressing GUS was evaluated. As shown in FIG. An increase in cells was observed. When GUS activity was evaluated using fluorescence measurement, similar to the results of GUS staining, it was observed that GUS activity increased in a Cre recombinase concentration-dependent manner (Fig. 4). Also, when the Cre recombinase concentration was increased from 0.2 μM to 0.5 μM, GUS expression was significantly increased (FIG. 4). These experimental results indicate that the protein concentration is a very important factor in a protein electroporation system for plant cells, and the protein concentration must be 0.5 μM or higher for efficient protein introduction. One thing became clear. Also, in HNCre, a nuclear localization signal is fused to the Cre protein, and it was found that the protein was introduced under similar conditions even in HCre without a nuclear localization signal (Fig. 4, bottom). Therefore, this method was found to be effective as a method for introducing proteins into the nucleus of plant cells.

(5) Evaluation of homologous recombination efficiency using genomic PCR As shown in Fig. 5, the homologous recombination efficiency of Cre recombinase was calculated by amplifying the region containing two loxP sequences in the reporter cassette by PCR. did. As a result, it was revealed that 79.4% of all reporter cassettes undergo homologous recombination by introducing 5 μM Cre recombinase using the electroporation method. From the results of this experiment, Cre recombinase was introduced into at least 79.4% of the cells, indicating that this method is a very efficient technique for introducing proteins into plant cells with cell walls. rice field.

(6) Verification of genome editing Furthermore, Cas9 protein is delivered into the nucleus and verified whether genome editing can be performed. After mixing two types of guide RNA and Cas9 protein for the Arabidopsis thaliana endogenous ADH1 gene, electroporation was performed in the same manner as described above. Simultaneous cleavage of genomic DNA by the two guide RNAs and the Cas9 protein results in a deletion of 194 bp. Genomic DNA after electroporation was collected and PCR was performed, and it was confirmed that the expected deletion had occurred (Fig. 6).

[Example 2]
In the above examples, introduction was attempted by physically opening pores in the cell membrane or cell wall by electroporation. This example describes an experiment in which a protein was directly introduced into the nucleus by protein transduction without using special equipment or reagents.

In order to directly introduce the protein, the protein was added to the culture medium containing the cells (Opti-MEM (registered trademark) I) at a specific concentration (0.1 to 10 μM), and the cells were washed after standing for a certain period of time, and then washed again. Culture was started (2 days). The results are shown in FIG. A particularly remarkable protein transfer was observed at a protein concentration of 0.2 μM or higher. The time for the protein to act should be 5 minutes or more, and there was no problem even if it was about 2 hours. This is the world's first example of direct protein introduction into the plant nucleus.

[Example 3]
Methods of the invention (electroporation, protein transduction) and conventional methods (infection with Agrobacterium) were compared. Electroporation was performed according to the method described in Example 1. Protein transduction was performed according to the method described in Example 2. Infection with Agrobacterium was performed by a conventional method.

The results are shown in FIG. In the method of the present invention (electroporation (indicated as Elec. in the figure) and protein transduction (indicated as DIVE in the figure)), there were many products after recombination, but the conventional method (infection with Agrobacterium) (indicated as Agrobacterium infection in the figure)), the product after recombination was small, and the level was almost the same as that of the negative control (NC). These results demonstrate that the method of the present invention can efficiently introduce proteins into the nucleus of plant cells in a short period of time.

[Example 4]
(1) Construction of ZF-ND1 and ZF-FokI Expression Vectors A pET-MCS plasmid containing a His tag at the N-terminus was cleaved at the XhoI site and the SalI site, and the ZF-ND1 fragment was inserted. The ZF-ND1 fragment contains each localization signal NLS, Zinc-Finger (hereinafter abbreviated as ZF), and the nuclease domain ND1. Domains recognizing two types of sequences were used as ZFs. One is ZFA36, which recognizes the 12 base pair DNA sequence GAAGCTGGT. The other is ZFL1, which recognizes the 12 base pair DNA sequence CAAGGAGAC. Therefore, pET-ZF(ZFA36A)ND1 and pET-ZF(ZFL1)ND1 were constructed as plasmids expressing ZF(ZFA36A)-ND1 and ZF(ZFL1)-ND1, respectively.

Based on the above plasmid, pET-ZF(ZFA36A)-FokI and pET-ZF(ZFL1)-FokI, which are plasmids in which the nuclease domain of the restriction enzyme FokI (hereinafter abbreviated as FokI) is inserted instead of ND1, were created. . The amino acid sequences of ZF(ZFA36A)-ND1, ZF(ZFL1)-ND1, ZF(ZFA36A)-FokI, and ZF(ZFL1)-FokI are shown in SEQ ID NOS:7-10.

(2) Expression and Purification of ZF-ND1 Protein in E. coli The pET plasmids expressing ZF-ND1 or ZF-FokI and pRARE2 (Stratagene) were transformed into E. coli strain BL21 (DE3), kanamycin and chloramphenic acid were added. The cells were cultured in LB medium containing chol. The transformed E. coli was cultured at 37°C until the OD (absorbance at 600 nm) reached 0.6, and then cultured at 18°C for 1 hour. Isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 mM to induce protein expression. After culturing with shaking at 18° C. for 17 hours, E. coli was lysed with a lysis buffer (20 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 10 mM imidazole, 1 mM benzylsulfonyl fluoride, 1 mM dithiothreitol, pH 8.0). dissolved. Proteins were then adsorbed onto a nickel NTA column and contaminants were removed using a wash buffer (20 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 20 mM imidazole, pH 8.0). Protein elution was performed using an elution buffer (20 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 500 mM imidazole, pH 8.0). A portion of the eluted protein was dissolved in SDS sample buffer for protein yield analysis. The eluted protein was purified using gel filtration chromatography HiPrep 16/60 Sephacryl S-200 HR (GE healthcare, Illinois, USA) and buffer A (20 mM HEPES, 150 mM NaCl, 10% glycerol, pH 7.4), After flash freezing using liquid nitrogen, it was stored at -80°C. For protein yield analysis, the imidazole-eluted protein fraction and the final purified protein were dissolved in SDS sample buffer and electrophoresed by SDS-PAGE. During electrophoresis, a known concentration of BSA protein is run in another lane, the gel after PAGE is Coomassie-stained, the target protein molecular weight band is quantified by ChemiDoc XRS+, and the protein yield is analyzed from the molecular weight of the protein. did.

[Example 5]
(1) Construction of reporter cells In order to evaluate the activity of ZF-ND1 or ZF-FokI, when SSA (single-strand annealing) after DNA cleavage is induced, a full-length 2.1 kb A reporter cell expressing the GUS (β-glucuronidase) gene was constructed. Specifically, 1.8 kb from the upstream of the GUS gene, a ZFA36 recognition sequence (GAAGCTGGT), and 0.8 kb from the downstream of the GUS gene were introduced into pCAMBIA1305.2 (Marker Gene). 1.8 kb from the upstream of the GUS gene and 0.8 kb from the downstream of the GUS gene have 500 bp as a common sequence (overlap region). Arabidopsis thaliana T87 cultured cell line (RIKEN) was transformed with this vector via Agrobacterium, and the established cell line was designated as T87-GUUS (ZFA36). Since the expression of GUS can be easily visualized and detected using X-Gluc, a blue staining reagent, the detection of GUS protein confirms introduction of ZF-ND1 or ZF-FokI into the nucleus and SSA induction. Activity can be assessed.

(2) Introduction by electroporation The protein prepared in Example 4 was introduced by electroporation. Using the established T87-GUUS (ZFA36) cells, an attempt was made to introduce ZF-ND1 and ZF-FokI at a final concentration of 0.1-2 μM into T87 cells with cell walls by electroporation. . NEPA21 Type II marketed by Nepagene was used for electroporation. A. It was carried out under the conditions of (6). Electroporation was performed using Opti-MEMI buffer, and GUS activity was evaluated 2 days later. As a result, as shown in FIG. 9, a large number of cells expressed GUS when electroporated using Opti-MEMI.

(3) Introduction by protein transduction method Using the protein prepared in Example 4, introduction by protein transduction method was attempted. That is, ZF(ZFA36A)-ND1 protein or ZF(ZFA36A)-FokI at a final concentration of 0.1-2 μM in culture medium (Opti-MEM® I) containing T87-GUUS(ZFA36) with a cell wall. One hour after adding protein, the cells were washed with culture medium and cultured for 3 days. When the protein was added, no biochemical treatment such as protease treatment or physicochemical treatment such as electroporation was performed. Therefore, spontaneous uptake of proteins is expected. As a result, as shown in FIG. 10, ZF(ZFA36A)-ND1 protein and ZF(ZFA36A)-FokI protein were taken up by the protein transduction method, albeit at a lower rate than the electroporation method, and the genome It turned out to be editable. When the protein transduction method was used, the activity of ZF(ZFA36A)-ND1 was equal to or higher than that of ZF(ZFA36A)-FokI.

[Example 6]
(1) Construction of Individual Reporter Plant Wild-type Arabidopsis thaliana was cultivated to flowering state, and transformation was performed by the floral dip method using a culture solution of Agrobacterium GV3101 strain harboring pCambiaN-xGxGUS. The transformed plants were cultivated in a medium containing hygromycin, and individuals showing green fluorescence of GFP were selected. This plant individual was named At-xGxGUS.

(2) Introduction of Cre Protein by Protein Transduction Method Protein transduction was performed according to the method described in Example 2. Arabidopsis thaliana At-xGxGUS strain seeds were germinated on MS agarose medium (1x MS salts, 1x MS vitamins, 1% sucrose, 0.5% agar) and after 1 week, 2 μM Cre protein was added to some individuals. After being immersed in the solution for 1 hour, the cells were cultured for 2 days and subjected to GUS staining (experiment a). Furthermore, for some plants, the root portion was excised to form a root piece, which was immersed in a 2 μM Cre protein solution for 1 hour and then subjected to callus induction in CIM medium (experiment b). One week later, shoots (stems and their upper tissues) were induced on SIM medium. After an additional two weeks, shoot pieces were transferred to RIM medium to induce roots. Some plant tissues were subjected to GUS staining at this time (experiment b). The rest of the plant tissue was grown to flowering and seeding and seeds were obtained. The seeds were germinated on B5 agarose medium and GUS stained one week later (experiment c).

(3) Results The results are shown in FIG.

Experiment a: When a plant individual was immersed in a Cre protein solution, it was confirmed that part of the plant tissue was stained with GUS, revealing that the Cre protein could be introduced into the nucleus. .

Experiment b: When the root piece was immersed in a solution of Cre protein to form callus and then regenerated into a plant, it was confirmed that the leaf tissue in the regenerated plant was stained with GUS. Therefore, it was clarified that the Cre protein could be introduced into the nuclei of regenerative cells.

Experiment c: Root discs were immersed in a solution of Cre protein, the root discs were converted to callus, then regenerated into plant bodies, and seeds were obtained. Therefore, it was clarified that the Cre protein could be introduced into the nuclei of cells that can be regenerated as individual plants.

According to the present invention, proteins can be introduced directly into the nucleus of plant cells that have a cell wall. Therefore, the present invention can be used in plant breeding, breed improvement, plant genetics research, and the like.

SEQ ID NO: 1 is the nucleotide sequence of a primer for NOS promoter amplification.

SEQ ID NO: 2 is the nucleotide sequence of a primer for NOS promoter amplification.

SEQ ID NO: 3 is the nucleotide sequence of the primer for amplifying the GFP fragment.

SEQ ID NO: 4 is the base sequence of the primer for GFP fragment amplification.

SEQ ID NO: 5 is the nucleotide sequence of a primer for obtaining a genomic DNA amplification product.

SEQ ID NO: 6 is the nucleotide sequence of a primer for obtaining a genomic DNA amplification product.

SEQ ID NO:7 is the amino acid sequence of ZF(ZFA36A)-ND1.

SEQ ID NO:8 is the amino acid sequence of ZF(ZFL1)-ND1.

SEQ ID NO:9 is the amino acid sequence of ZF(ZFA36A)-FokI.

SEQ ID NO: 10 is the amino acid sequence of ZF(ZFL1)-FokI.

Claims (10)

A method of introducing a protein (excluding a fusion protein with a cell membrane penetrating peptide) into the nucleus of a plant cell entirely covered with a cell wall, characterized by using protein transduction,
Under the following conditions:
the buffer has an osmotic pressure of about 150 to about 400 mOsm/kg, and
protein concentration from about 0.2 μM to about 200 μM
A method wherein protein transduction is performed in . 2. The method of claim 1 , wherein the concentration of protein is from about 0.5 μM to about 100 μM. 3. A genome editing method, wherein the method according to claim 1 or 2 is used to introduce a genome editing enzyme into the nucleus of a plant cell entirely covered with a cell wall. 3. A genome modification method, which comprises introducing a genome modification enzyme into the nucleus of a plant cell entirely covered with a cell wall, using the method according to claim 1 or 2 . 1. A method for introducing a protein into the nucleus of a plant cell entirely covered with a cell wall, characterized by using electroporation, comprising:
Under the following conditions:
a poring voltage of about 400 V/cm to about 650 V/cm;
Pouring time is about 10ms to about 50ms,
The number of boring pulses is 2 or more,
the buffer contains inorganic salts, amino acids and vitamins,
the buffer has a conductivity of about 0.6 S/m to about 2.0 S/m, and
Osmotic pressure of the buffer from about 250 mOsm/kg to about 350 mOsm/kg
The method by which electroporation is performed in 6. The method of claim 5 , wherein the protein concentration is from about 0.5 μM to about 100 μM. 7. The method of claim 5 or 6, wherein Eagle's minimum essential medium or its modification is used as buffer. 8. The method of claim 7, wherein Opti-MEM® I is used as buffer. A genome editing method, which comprises introducing a genome editing enzyme into the nucleus of a plant cell entirely covered with a cell wall, using the method according to any one of claims 5 to 8 . 9. A genome modification method, which comprises introducing a genome modification enzyme into the nucleus of a plant cell entirely covered with a cell wall, using the method according to any one of claims 5 to 8 .

Images