JP7044399B2 - Tau immunotherapy - Google Patents

Description

Cross-references to related applications This application is non-provisional application Nos. 61 / 780,624 filed on March 13, 2013 and No. 61 / 800,382 filed on March 15, 2013, all of which. The whole is incorporated by reference for the purpose of.

Tau is a well-known human protein that can be present in phosphorylated form (eg, Goedert, Proc. Natl. Acad. Sci. USA 85: 4051-4055 (1988); Goedert, EMBO J.8). : 393-399 (1989); Lee, Neuron 2: 1615-1624 (1989); Goedert, Neuron 3: 519-526 (1989); Andreadis, Biochemistry 31: 10626-10633 (1992)). Tau has been reported to be involved in the stabilization of microtubules, especially in the central nervous system. Total tau (t-tau, ie phosphorylated and non-phosphorylated) and phosphorylated tau (phospho-tau) (p-tau, ie phosphorylated tau) respond to neurological damage and degeneration. It has been reported that it is released by the brain and has increased levels in CSF of patients with Alzheimer's disease compared to the general population (Jack et al., Lancet Neurol 9: 119-28 (2010)).

Tau is a major component of neurofibrillary tangles and, along with plaque, is a hallmark of Alzheimer's disease. Aggregates are composed of abnormal fibers with a diameter of 10 nm that occur in spirally wound pairs with a periodic cycle of 80 nm. Tau in neurofibrillary tangles is abnormally phosphorylated (highly phosphorylated) by phosphate groups attached to specific sites on the molecule. Serious involvement of neurofibrillary tangles in Alzheimer's disease is found in the entorhinal cortex layer II neurons, hippocampal CA1 and hippocampal formation, the amygdala, and the deeper layers of the neocortex (Layer III, V, and surface VI). Be done. Highly phosphorylated tau has also been reported to interfere with microtubule assembly, which can promote disruption of the neural network.

Tau inclusion bodies are part of the definitive neuropathology of several neurodegenerative diseases, including Alzheimer's disease, frontotemporal lobar degeneration, progressive supranuclear palsy and Pick disease.

The present invention provides a monoclonal antibody that competes with the monoclonal antibody 16B5 for binding to tau. Some antibodies are humanized antibodies, chimeric antibodies, veneered antibodies or human antibodies. Some antibodies are antibodies of human IgG isotype (eg, IgG1, IgG2, or IgG4). Some such antibodies have a human IgG1 constant region having the sequence of SEQ ID NO: 29. Some antibodies have a human kappa constant region with the sequence of SEQ ID NO: 32. Some antibodies have at least one mutation in the constant region.

Some of the antibodies are humanized, chimeric or veneered forms of the monoclonal antibody 16B5. Some antibodies have three light chain CDRs as defined by Kabat and three heavy chain CDRs as defined by Kabat of monoclonal antibody 16B5. Some antibodies bind to tau in phosphorylated and non-phosphorylated forms.

The invention further provides a monoclonal antibody that specifically binds to an epitope within residues 24-46 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8). Some such antibodies are human antibodies, humanized antibodies, chimeric antibodies, or veneer antibodies. Some antibodies specifically bind to the epitope within residues 25-44 of SEQ ID NO: 1. Some antibodies specifically bind to the epitope within residues 30-39 of SEQ ID NO: 1. Some antibodies bind to tau in phosphorylated and non-phosphorylated forms.

The invention further comprises a mature heavy chain variable region having an amino acid sequence that is at least 90% (eg, at least 95%, at least 98%, at least 99%) identical to SEQ ID NO: 15 and at least 90% (eg, at least 90%) of SEQ ID NO: 22. Provided is a monoclonal antibody comprising a mature light chain variable region that is at least 95%, at least 98%, at least 99%) identical. In certain embodiments, the monoclonal antibody comprises three Kabat CDRs of SEQ ID NO: 15 and three Kabat CDRs of SEQ ID NO: 22. In some antibodies, the mature heavy chain variable region has an amino acid sequence named SEQ ID NO: 15, and the mature light chain variable region has an amino acid sequence named SEQ ID NO: 21, 22, or 23.

In some antibodies, at least one of positions H13, H48 and H91 is occupied by K, M and F, respectively, and at least one of positions L1, L4, L36 and L43 is N, L, F and respectively. Occupied by S. In some antibodies, positions H13, H48 and H91 are occupied by K, M and F, respectively, and at least two of positions L1, L4, L36 and L43 are occupied by N, L, F and S, respectively. ing. In some antibodies, positions H13, H48 and H91 are occupied by K, M and F, respectively, and at least three of positions L1, L4, L36 and L43 are occupied by N, L, F and S, respectively. ing. In some antibodies, positions H13, H48 and H91 are occupied by K, M and F, respectively, and positions L1, L4, L36 and L43 are occupied by N, L, F and S, respectively.

In some antibodies, the mature heavy chain variable region is fused to the heavy chain constant region and the mature light chain variable region is fused to the light chain constant region. In some antibodies, the heavy chain constant region is a variant of the natural human constant region with reduced binding to the Fcγ receptor compared to the natural human constant region. For some antibodies, the heavy chain constant region is of the IgG1 isotype.

For some antibodies, differences within the CDRs of the mature heavy chain variable region and the mature light chain variable region from SEQ ID NOs: 15 and 22, respectively, are present within positions H60-H65.

The antibody can be an intact antibody or fragment, such as a Fab fragment.

Either the monoclonal antibody or a fragment thereof can be conjugated to a cytotoxic agent or a cell proliferation inhibitor.

The present invention further provides a method of humanizing an antibody. Several methods include sequence of variable regions of heavy and light chains of mouse antibodies and nucleic acids encoding humanized heavy chains, including CDRs of mouse antibody heavy chains, and CDRs of mouse antibody light chains. It comprises synthesizing a nucleic acid encoding a humanized light chain and expressing the nucleic acid in a host cell to produce a humanized antibody, wherein the mouse antibody is 16B5.

The present invention further provides a method of producing a humanized antibody, a chimeric antibody or a veneer antibody. Some methods include culturing cells transformed with nucleic acids encoding the heavy and light chains of the antibody so that the cells secrete the antibody, and purifying the antibody from the cell medium. The antibody is 16B5 humanized, chimeric or veneered.

The invention further provides a method of producing a cell line that produces a humanized antibody, a chimeric antibody or a veneer antibody. Several methods include introducing into cells the heavy and light chains of the antibody as well as the vector encoding the selection marker, and growing the cells under the conditions of choice for cells with the vector with increased copy count. It involves isolating single cells from selected cells and storing cells cloned from selected single cells based on antibody yield, wherein the antibody is a humanized, chimeric form of 16B5. Or it is a veneer type.

The invention further provides a pharmaceutical composition comprising all the antibodies disclosed herein and a pharmaceutically acceptable carrier.

The invention further provides a nucleic acid comprising a segment encoding a heavy chain variable region having the sequence of SEQ ID NO: 10.

The invention further provides a nucleic acid comprising a segment encoding a heavy chain variable region having the sequence of SEQ ID NO: 15. In some nucleic acids, the segment has the nucleotide sequence of SEQ ID NO: 25. Some nucleic acids further include, for example, an IgG1 constant region having the sequence of SEQ ID NO: 29, and optionally a segment encoding a human IgG1 constant region, provided that the C-terminal lysine can be omitted. In some nucleic acids, the segment encoding the IgG1 constant region has the nucleotide sequence of SEQ ID NO: 30. Some such nucleic acids further include introns that link the segments encoding the heavy chain variable region and the IgG1 constant region. For example, the intron may have the sequence of the intron found in SEQ ID NO: 31. Thus, the segment encoding the intron and the IgG1 constant region may have the nucleotide sequence of SEQ ID NO: 31.

The invention further provides nucleic acids comprising a segment encoding a light chain variable region having the sequence of SEQ ID NO: 16.

The invention further provides nucleic acids comprising a segment encoding a light chain variable region having the sequence of SEQ ID NO: 21, 22, or 23. In some nucleic acids, the segment encoding the light chain variable region has the sequence of SEQ ID NO: 26, 27 or 28. Some such nucleic acids further contain segments encoding the κ constant region. The κ constant region can be a human κ constant region and may have the sequence of SEQ ID NO: 32. Optionally, the nucleic acid encoding the κ constant region has the sequence of SEQ ID NO: 33. Some such nucleic acids further include introns that link the segment encoding the light chain variable region to the segment encoding the κ constant region. For example, the intron may have the sequence of the intron found in SEQ ID NO: 34. Thus, the segment encoding the intron and the κ constant region may have the nucleotide sequence of SEQ ID NO: 34.

Any of the above antibodies can include a light chain comprising a human IgG1 constant region having the sequence of SEQ ID NO: 29 and / or a human κ constant region having the sequence of SEQ ID NO: 32.

The invention further provides an isolated fragment of tau containing 3-10 contiguous residues of tau within residues 24-46 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8). Some fragments contain 3-10 contiguous residues of tau within residues 30-39 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8). Some fragments contain residues 33-37 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8). Some fragments are optionally linked via spacers to carrier molecules that help generate antibodies against this fragment. Some fragments are part of a pharmaceutical composition containing an adjuvant that is acceptable for administration to humans.

The present invention further provides a cure or effective prophylaxis for Alzheimer's disease. Some methods are effective dosing regimens with antibodies that specifically bind to epitopes within residues 24-46 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8), or agents that induce such antibodies. It involves administration to patients with or at risk of Alzheimer's disease, thereby treating or effectively preventing the disease. Preferably, this antibody is the antibody described herein. In some methods, the antibody-inducing agent is a tau fragment containing 3-10 contiguous residues of tau within residues 24-46 of SEQ ID NO: 1. In some methods, the patient is an ApoE4 carrier.

The present invention further provides a cure or effective prophylaxis for diseases associated with tau. Some methods are effective dosing regimens with antibodies that specifically bind to epitopes within residues 24-46 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8), or agents that induce such antibodies. Includes administration to a patient with or at risk of the disease, thereby treating or effectively preventing the disease. Preferably, the antibody is an antibody described herein (eg, a humanized 16B5 antibody). In some methods, the antibody-inducing agent is a tau fragment containing 3-10 contiguous residues of tau within residues 24-46 of SEQ ID NO: 1. In some ways, the disease is a neurological disorder.

The present invention further provides a method of reducing the aberrant transmission of tau. Some methods are effective dosing regimens with antibodies that specifically bind to epitopes within residues 24-46 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8), or agents that induce such antibodies. Includes administration to a patient who has or is at risk for a disease associated with abnormal transmission of tau, thereby treating or effectively preventing the disease. Preferably, the antibody is an antibody described herein (eg, a humanized 16B5 antibody). In some methods, the antibody-inducing agent is a tau fragment containing 3-10 contiguous residues of tau within residues 24-46 of SEQ ID NO: 1.

The present invention further provides a method of inducing phagocytosis of tau. Some methods are effective dosing regimens with antibodies that specifically bind to epitopes within residues 24-46 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8), or agents that induce such antibodies. Includes administration to patients with or at risk for a disease associated with tau accumulation. Preferably, the antibody is an antibody described herein (eg, a humanized 16B5 antibody). In some methods, the antibody-inducing agent is a tau fragment containing 3-10 contiguous residues of tau within residues 24-46 of SEQ ID NO: 1. In some ways, the disease is a neurological disorder.

The present invention further provides a method of suppressing tau aggregation or deposition. In certain embodiments, the method comprises an antibody that specifically binds to an epitope within residues 24-46 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8), or an agent that induces such an antibody. Dosage regimens include administration to patients with or at risk of a disease associated with tau aggregation or deposition. Preferably, the antibody is an antibody described herein (eg, a humanized 16B5 antibody). In some methods, the antibody-inducing agent is a tau fragment containing 3-10 contiguous residues of tau within residues 24-46 of SEQ ID NO: 1. In some ways, the disease is a neurological disorder.

The present invention further provides a method of suppressing the formation of tau aggregates. Some methods are effective dosing regimens with antibodies that specifically bind to epitopes within residues 24-46 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8), or agents that induce such antibodies. Includes administration to patients with or at risk of the disease associated with the formation of tau aggregates. Preferably, the antibody is an antibody described herein (eg, a humanized 16B5 antibody). In some methods, the antibody-inducing agent is a tau fragment containing 3-10 contiguous residues of tau within residues 24-46 of SEQ ID NO: 1. In some ways, the disease is a neurological disorder.

The present invention further provides a method of screening for an active agent against Alzheimer's disease. Several methods include administering the drug to a transgenic animal expressing the tau transgene and determining whether the drug suppresses or delays at least one sign or symptom of Alzheimer's disease. At that time, the drug is an antibody that specifically binds to an epitope in residues 24-46 of SEQ ID NO: 1 (Swiss-Prot No. P10636-8), or a drug that induces such an antibody.

The results of an experiment designed to map the epitope (s) to which the 16B5 monoclonal antibody binds are shown. Western blots containing a full-length tau or a deletion variant of tau (Δ5-24 or Δ25-44) were stained with 16B5 antibody (left panel) or tau 46 antibody (right panel). The tau 46 antibody binds to the C-terminal epitope of tau. The results of an experiment designed to map the epitope (s) to which the 16B5 monoclonal antibody binds are shown. Western blots containing full-length tau or tau deletion variants were stained with 16B5 antibody (left panel) or tau 46 antibody (right panel). The longer exposure of the blot stained with 16B5 antibody is shown in the lower left panel. Deletion variants of tau analyzed in this experiment include Δ25-44, Δ5-24, Δ23-32, Δ30-39, and Δ37-46. The results of an alanine scanning experiment designed to map the epitope (s) to which the 16B5 monoclonal antibody binds are shown. Western blots containing wild-type tau (WT) or tau alanine point mutants were stained with 16B5 antibody (left panel) or tau 46 antibody (right panel). Tau alanine variants analyzed in this experiment include T30A, M31A, H32A, Q33A, D34A, Q35A, E36A, G37A, D38A, T39A, D40A, A41L, and G42A. Hittau. The relative amount of tau protein detected in the sarcosyl-insoluble fraction of the brain stem of transgenic mice expressing P301L protein is shown. Mice were passively immunized with either a 16B5 antibody or a non-immune IgG1 isotype-controlled 6F10 antibody. Samples were analyzed by Western blotting, antibody staining, and quantification of the resulting signal. Antibodies used to detect tau include anti-phosphorylated tau-specific antibodies (AT8, upper left panel; AT100, lower left panel; or 1F5, upper right panel), and pantau antibodies (HT7, lower right panel). ) Was included. Hittau. The ratio of phosphorylated tau to total tau protein detected in the whole brainstem homogenate of transgenic mice expressing P301L protein (left panel) and the normalized amount of total tau (right panel) are shown. Mice were passively immunized with either a 16B5 antibody or a non-immune IgG1 isotype-controlled 6F10 antibody. Samples were analyzed by Western blotting, antibody staining, and quantification of the resulting signal. Phosphorylated tau was detected using AT8 antibody and total tau was detected using HT7 antibody. The anti-GAPDH antibody was used to normalize the amount of tau detected in mice treated with 16B5 antibody relative to the amount of tau detected in mice treated with control 6F10 antibody. Hittau. Sections of cerebellar nuclei of transgenic mice expressing P301L protein, immunohistochemically stained with AT8 anti-phosphorylated tau antibody are shown. Mice were passively immunized with either a 16B5 antibody (left panel) or a non-immune IgG1 isotype-controlled 6F10 antibody (right panel). Insertion nucleus, anterior and posterior part of the cerebellum of mice passively immunized with 16B5 or 6F10 antibody, annex lateral cerebellar nucleus (IntA / P / LAT) and subthalamic nucleus zona incerta The quantification of the amount of tau staining detected with the AT8 antibody in incerta (STH / ZI)) is shown in the upper bar graph panel. Quantification of the amount of phosphorylated tau staining detected with AT100 anti-phosphorylated tau antibody on IntA / P / LAT and STH / ZI sections of mice passively immunized with 16B5 or 6F10 antibody is shown in the bar graph panel below. .. Statistical significance was assessed using Student's t-test, p <0.05. The results of tau immunoprecipitation obtained with the chimeric 16B5 antibody and the humanized 16B5 antibody (H1L2 and H1L3 versions) are shown. Tau was immunoprecipitated from both the soluble and insoluble fractions of postmortem frontal cortex samples from patients with Alzheimer's disease. The presence of tau in the blotted immunoprecipitate was detected using a polyclonal anti-tau antibody (tau pAb).

Definition Monoclonal antibodies and other therapeutic agents are typically provided in isolated form. This means that the drug is usually at least 50% w / w pure with respect to the interfering protein and other contaminants resulting from its production or purification, but the drug is excessively pharmaceutically acceptable. Does not preclude the possibility of being combined with a carrier (s) or other vehicle intended to facilitate its use. Occasionally, monoclonal antibodies (or other therapeutic agents) are at least 60%, 70%, 80%, 90%, 95% or 99% w / w against interfering proteins and other contaminants resulting from production or purification. Purity.

Antibodies of the invention typically bind to their designated target with an association constant of at least ¹⁰⁶ , 10 ⁷ , 10 ⁸ 10, ⁹ or 10 ¹⁰ M ^-1 . Such a bond is specific in that it is detectable high in size and can be distinguished from non-specific bonds that occur in at least one unrelated target. Specific bonds can be the result of the formation of bonds with specific functional groups or specific spatial fits (eg, lock and key types), while non-specific bonds are usually of van der Waals forces. The result. However, specific binding does not necessarily mean that the monoclonal antibody binds to a single target.

The basic antibody structural unit is the subunit tetramer. Each tetramer contains two identical pairs of polypeptide chains, each pair having one "light" chain (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The amino-terminal portion of each chain contains variable regions of about 100-110 or more amino acids primarily involved in antigen recognition. This variable region linked to the cleavable signal peptide is first expressed. Variable regions that do not contain a signal peptide are often referred to as mature variable regions. Thus, for example, the mature variable region of a light chain means a light chain variable region that does not contain a light chain signal peptide. The carboxy-terminal portion of each chain defines a constant region primarily involved in effector function. The constant region may include any or all of the CH1 region, the hinge region, the CH2 region and the CH3 region.

Light chains are classified as either κ or λ. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, defining antibody isotypes as IgG, IgM, IgA, IgD, and IgE, respectively. Within the light and heavy chains, the variable and constant regions are linked by the "J" region of about 12 or more amino acids, and the heavy chain also contains the "D" region of about 10 or more amino acids. (In general, see Chapter 7 of Basic Immunology (Paul, W. (eds.), 2nd Edition, Raven Press, New York, 1989) (the whole of which is incorporated by reference for all purposes)).

The mature variable region of each light chain / heavy chain pair forms an antibody binding site. Therefore, intact antibodies have two binding sites. Except for bifunctional or bispecific antibodies, the two binding sites are identical. All of the chains show the same general structure of relatively conserved framework regions (FRs) linked by three hypervariable regions, also called complementarity determining regions or CDRs. The CDRs of the two strands of each pair are aligned by the framework region, allowing binding to specific epitopes. From the N-terminus to the C-terminus, both the light and heavy chains contain domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. Amino acid assignments to each domain are Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Maryland, 1987 and 1991), or Chothia. & Lesk, J.M. Mol. Biol. 196: 901-917 (1987); Chothia et al. , Nature 342: 878-883 (1989). Kabat also provides a widely used numbering rule (Kabat numbering) in which the same number is assigned to the corresponding residues between different heavy chains or between different light chains.

The term "antibody" includes intact antibodies and binding fragments thereof. Typically, the fragment competes with the intact antibody induced for specific binding to the target. Fragments include separate heavy chains, light chains Fab, Fab', F (ab') ₂ , F (ab) c, Fv and single domain antibodies. For single (variable) domain antibodies, the VH region (or vice versa) isolated from the VL partner of the conventional antibody (Ward et al., 1989, Nature 341: 544-546) as well as the VH region binds to the VL region. Includes VH regions (sometimes known as VHH) of species such as Camelids or Cartilaginous fish (eg, Carpet Shark) that are not (see, eg, WO9404678). Single-domain antibodies from which one strand is isolated from its natural partner are sometimes known as Dab, and single-domain antibodies from Camelids or cartilaginous fish are sometimes known as Nanobodies. The constant region or portion of the constant region may or may not be present in the single domain antibody. For example, a native single variable region antibody from Camelidaceae comprises a VHH variable region, as well as CH2 and CH3 constant regions. Single domain antibodies can be targeted for humanization by methods similar to conventional antibodies. Dab type antibodies are usually obtained from human-derived antibodies. Nanobody type antibodies are of camelid or shark origin and can be the target of humanization. Fragments can be produced by recombinant DNA technology or by enzymatic or chemical separation of intact immunoglobulins. The term "antibody" also includes bispecific antibodies. Bispecific or bifunctional antibodies are artificial hybrid antibodies with two different heavy / light chain pairs and two different binding sites (eg, Songsivilai and Lachmann, Clin. Exp. Immunol., 79: 315). -321 (1990); see Kostelny et al., J. Immunol., 148: 1547-53 (1992)).

The term "epitope" refers to a site on an antigen to which an antibody binds. Epitopes can be formed from continuous amino acids or discontinuous amino acids that are closely aligned by tertiary folding of one or more proteins. Epitopes formed from continuous amino acids are typically retained upon exposure to a denaturing solvent, whereas epitopes formed by tertiary folding are typically lost upon treatment with a denaturing solvent. Epitopes typically contain at least 3 or more, usually at least 5 or 8-10 amino acids in a unique spatial conformation. When an epitope is said to be within a range of amino acid residues in a protein (eg, within tau residues 25-44), that range includes the residues that define its boundaries. Certain residues within the range may contribute to the epitope, others may not. The residues forming the epitope may or may not be continuous with each other. Similarly, if an antibody binds to an epitope found within a particular range of amino acids, the antibody does not need to contact all amino acid residues within the range, and the epitope residues that contact the antibody are adjacent to each other. It may or may not be. Methods for determining the spatially higher order structure of an epitope include, for example, x-ray crystallography and two-dimensional nuclear magnetic resonance. For example, Glenn E. See Epitope Mapping Protocols in Volume 66 of Methods in Molecular Biology, Morris (eds.) (1996).

Antibodies that recognize the same or overlapping epitopes can be identified by a simple immunoassay showing the ability of one antibody to compete with the binding of the other antibody to the target antigen. The epitope of an antibody can also be defined by X-ray crystallography of the antibody bound to that antigen to identify contact residues. Alternatively, if all amino acid mutations in the antigen that reduce or eliminate the binding of one antibody reduce or eliminate the binding of the other, then the two antibodies have the same epitope. If some amino acid mutations that reduce or eliminate the binding of one antibody reduce or eliminate the binding of the other antibody, the two antibodies have overlapping epitopes. The invention comprises an antibody that competes with 16B5 and / or binds to an epitope on the same tau as 16B5.

Competition between antibodies is determined by an assay in which the test antibody suppresses specific binding of a reference antibody (eg, 16B5) to a common antigen (eg, Junghans et al., Cancer Res. 50: 1495, 1990). When measured in a competitive binding assay, an excess (eg, at least 2-fold, 5-fold, 10-fold, 20-fold or 100-fold) of test antibody binds the reference antibody by at least 50%, preferably 75%, 90% or 99. % When inhibited, the test antibody competes with the reference antibody. Antibodies identified by competitive assays (competitive antibodies) include antibodies that bind to the same epitope as the reference antibody and antibodies that bind to adjacent epitopes sufficiently proximal to the epitope to which the reference antibody binds due to steric damage. included.

The term "patient" includes human and other mammalian subjects receiving either prophylactic or therapeutic treatment.

For the purpose of classifying amino acid substitutions as conservative or non-conservative amino acid substitutions, the amino acids are grouped as follows: Group I (hydrophilic side chain): met, ala, val, leu, ile; group. II (neutral hydrophilic side chain): cys, ser, thr; group III (acidic side chain): asp, gl; group IV (basic side chain): asn, gln, his, lys, arg; group V ( Residues that affect chain orientation): gly, pro; Group VI (aromatic side chains): trp, tyr, phe. Conservative substitutions include substitutions between amino acids of the same class. Non-conservative permutation is the exchange of a member of one of these classes with a member of another class.

Percentage sequence identity is determined using antibody sequences that are maximally sorted by Kabat numbering convention. After alignment, when comparing the target antibody region (eg, the entire mature variable region of the heavy or light chain) to the same region of the reference antibody, the percent sequence identity between the target antibody region and the reference antibody region is the target antibody. The number of positions occupied by the same amino acid in both the region and the reference antibody region is divided by the total number of positions in the two aligned regions (gap is not counted) and multiplied by 100 to convert to a percentage.

The term "assistant" refers to a compound that, when administered with an antigen, increases and / or redirects an immune response to the antigen, but when administered alone, does not produce an immune response to the antigen. The adjuvant can enhance the immune response by several mechanisms, including lymphocyte recruitment, stimulation of B and / or T cells, and stimulation of macrophages.

Increased levels of tau in the brain of a population of patients with the disease, increased tau deposition or inclusion bodies, presence of tau aggregates in the brain, or phosphorylation of tau in the brain (tau 1 molecule) Disease is associated with tau when intercellular or intracellular transmission of tau is abnormal compared to a population of subjects whose average number of phosphate groups per) is increased or which is not known to have neurological disease. Related. Disease is tau when patients with a variant of the tau gene have an increased risk of developing the disease compared to patients with the wild-type (the most frequently occurring type in the human population) tau gene. Also related.

A subject has at least one known risk factor (eg, genetic, biochemical, family history) that places an individual with a risk factor at a statistically significantly higher risk of developing the disease than an individual without a risk factor. Individuals are at increased risk of illness if they have (situational exposure).

The term "symptom" refers to subjective evidence of a disease, such as a change in pace that the patient notices. "Signs" refers to objective evidence of a disease as recognized by a physician.

Statistical significance means p <0.05.

Detailed explanation I. Overview The present invention provides an antibody that binds to tau. Some antibodies specifically bind to epitopes within residues 23-46 of SEQ ID NO: 1. Some antibodies bind to tau regardless of phosphorylation status. Some antibodies of the invention help suppress or delay the exacerbation of tau-related medical conditions and tau-related signs. Understanding the mechanism is not necessary for the practice of the invention, but among other mechanisms, stabilizing non-toxic higher-order structures or suppressing intercellular or intracellular transmission of pathogenic tau forms. Thus, a reduction in toxicity occurs as a result of tau's antibody-induced phagocytosis, which may prevent tau from intermolecular or intramolecular aggregation or to bind to other molecules. The antibodies or agents of the invention that induce such antibodies can be used in the treatment or effective prophylaxis of Alzheimer's disease and other diseases associated with tau.

II. Unless otherwise apparent from the tau context, references to tau are human tau containing all isoforms, with or without post-translational modifications (eg, phosphorylation, glycation, or acetylation). Means the natural form of. The human brain produces six major isoforms of tau (splicing variants). The longest of these variants has 441 amino acids with the first methionine residue cleaved. The residues are numbered according to the 441 isoform. Thus, for example, reference to phosphorylation at position 404 means position 404 of the 441 isoform, or the corresponding position of any other isoform when maximally aligned with the 441 isoform. The amino acid sequence of the isoform and the Swiss plot number are shown below.
P10636-8 (SEQ ID NO: 1)

References to tau include about 30 known natural changes listed in the Swiss-Pro database and its sequence, as well as mutations associated with tau pathology such as dementia, Pick disease, and supranuclear palsy ( See, for example, the Swiss-Pro database and Poorkaj, et al. Ann Neurol. 43: 815-825 (1998)). Some examples of tau mutations numbered by the 441 isoform are the lysine to threonine mutation at amino acid residue 257 (K257T), the isoleucine to valine mutation at amino acid position 260 (I260V), and amino acid position 272. Glycin to valine mutation (G272V), asparagine to lysine mutation at amino acid position 279 (N279K), asparagine to histidine mutation at amino acid position 296 (N296H), proline to serine mutation at amino acid position 301 (N279K) P301S), glycine to valine mutation at amino acid position 303 (G303V), serine to asparagine mutation at position 305 (S305N), glycine to serine mutation at amino acid position 335 (G335S), valine to methionine at position 337. (V337M), glutamate to valine mutation at position 342 (E342V), lysine to isoleucine mutation at amino acid position 369 (K369I), glycine to arginine mutation at amino acid position 389 (G389R), position 406 The mutation from arginine to tryptophan (R406W) in.

Tau is tyrosine at amino acid positions 18, 29, 97, 310, and 394, amino acid positions 184, 185, 198, 199, 202, 208, 214, 235, 237, 238, 262, 293, 324, 356, 396, It can be phosphorylated at one or more amino acid residues, including serine at 400, 404, 409, 412, 413, and 422, and threonine at amino acid positions 175, 181, 205, 212, 217, 231, and 403.

III. Antibody A. Binding specificity and functional properties
The present invention provides an antibody that binds to tau. Some antibodies specifically bind to epitopes within residues 23-46 of SEQ ID NO: 1. Some antibodies specifically bind to the epitope within residues 25-44 of SEQ ID NO: 1. Some antibodies specifically bind to epitopes within 28-41 of SEQ ID NO: 1. Some antibodies specifically bind to epitopes within residues 30-39 of SEQ ID NO: 1. Some antibodies specifically bind to the epitope within residues 30-36 of SEQ ID NO: 1. Some antibodies specifically bind to the epitope within residues 33-39 of SEQ ID NO: 1. Some antibodies specifically bind to the epitope within residues 33-36 of SEQ ID NO: 1. Some antibodies have residues 28-30, 28-31, 28-32, 28-33, 28-34, 28-35, 28-36, 28-37, 28-38, 28- of SEQ ID NO: 1. 39, 28-40, 28-41, 29-31, 29-32, 29-33, 29-34, 29-35, 29-36, 29-37, 29-38, 29-39, 29-40, 29-41, 30-32, 30-33, 30-34, 30-35, 30-36, 30-37, 30-38, 30-39, 30-40, 30-41, 31-33, 31- 34, 31-35, 31-36, 31-37, 31-38, 31-39, 31-40, 31-41, 32-34, 32-35, 32-36, 32-37, 32-38, 32 to 39, 32 to 40, 32 to 41, 33 to 35, 33 to 36, 33 to 37, 33 to 38, 33 to 39, 33 to 40, 33 to 41, 34 to 36, 34 to 37, 34 to 38, 34-39, 34-40, 34-41, 35-37, 35-38, 35-39, 35-40, 35-41, 36-38, 36-39, 36-40, 36-41 It specifically binds to the inclusion epitope. Some antibodies bind to tau regardless of phosphorylation status. Some antibodies bind to epitopes that are free of phosphorylation-sensitive residues. These antibodies can be obtained by immunization with a taupolypeptide purified from natural sources or recombinantly expressed. Antibodies can be screened for binding to non-phosphorylated tau and to tau in the form of phosphorylated form of one or more phosphorylated residues. Such antibodies preferably bind with indistinguishable affinity or bind to phosphorylated tau within a coefficient of at least 1.5-fold, 2-fold or 3-fold compared to non-phosphorylated tau. (Ie, "pan-specific"). 16B5 is an example of a panspecific monoclonal antibody. The invention also binds to the same epitope as any of the above antibodies, for example, the epitope of 16B5. Also included are antibodies that compete for binding to tau with any of the above antibodies, such as those that compete with 16B5.

The above antibodies are residues 23-46, 25-44, 28-30, 28-31, 28-32, 28-33, 28-34, 28-35, 28-36, 28-37 of SEQ ID NO: 1. , 28-38, 28-39, 28-40, 28-41, 29-31, 29-32, 29-33, 29-34, 29-35, 29-36, 29-37, 29-38, 29 ~ 39, 29-40, 29-41, 30-32, 30-33, 30-34, 30-35, 30-36, 30-37, 30-38, 30-39, 30-40, 30-41 , 31-33, 31-34, 31-35, 31-36, 31-37, 31-38, 31-39, 31-40, 31-41, 32-34, 32-35, 32-36, 32 ~ 37, 32 ~ 38, 32 ~ 39, 32 ~ 40, 32 ~ 41, 33 ~ 35, 33 ~ 36, 33 ~ 37, 33 ~ 38, 33 ~ 39, 33 ~ 40, 33 ~ 41, 34 ~ 36 , 34-37, 34-38, 34-39, 34-40, 34-41, 35-37, 35-38, 35-39, 35-40, 35-41, 36-38, 36-39, 36 Immunize with a peptide containing -40, 36-41, or with a full-length tau polypeptide or fragment thereof containing such residues and screen for specific binding to peptides containing such residues. Can be newly produced by. Such peptides are preferably attached to a heterologous conjugate molecule that facilitates the induction of an antibody response to the peptide. Binding can be done directly or via spacer peptides or spacer amino acids. Cysteine is used as a spacer amino acid because the free SH group promotes the binding of carrier molecules. Polyglycine linkers (eg, 2-6 glycine) can also be used with or without cysteine residues between glycine and the peptide. The carrier molecule serves to provide a T cell epitope that facilitates the induction of an antibody response to the peptide. Some carriers are, among other things, the commonly used keyhole limpet hemocyanin (KLH), ovalbumin and bovine serum albumin (BSA). Peptide spacers can be added to peptide immunogens as part of solid phase peptide synthesis. The carrier is typically added by chemical cross-linking. Some examples of chemical cross-linking agents that can be used include cross-N-maleimide-6-aminocaproyl ester or m-maleimidebenzoyl-N-hydroxysuccinimide ester (MBS) (eg, Harlow, E. et al.). Antibodies: Laboratory Manual (A Laboratory Male), Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, New York, 1988; Singigaglia et al., Nature, 336: 778-780 (1988). ); Chizz et al., J. Exp. Med., 178: 27-47 (1993); Hammer et al., Cell 74: 197-203 (1993); Falk K. et al., Immunogenetics, 39: 230. -242 (1994); WO98 / 23635; and Southwood et al. J. Immunologic, 160: 3363-3373 (1998). Carriers and spacers, if present, can be attached to any end of the immunogen. ..

Peptides with optional spacers and carriers can be used to immunize laboratory animals or B cells as described in more detail below. The hybridoma supernatant is composed of residues 24-46, 25-44, 28-30, 28-31, 28-32, 28-33, 28-34, 28-35, 28-36, 28-37 of SEQ ID NO: 1. , 28-38, 28-39, 28-40, 28-41, 29-31, 29-32, 29-33, 29-34, 29-35, 29-36, 29-37, 29-38, 29 ~ 39, 29-40, 29-41, 30-32, 30-33, 30-34, 30-35, 30-36, 30-37, 30-38, 30-39, 30-40, 30-41 , 31-33, 31-34, 31-35, 31-36, 31-37, 31-38, 31-39, 31-40, 31-41, 32-34, 32-35, 32-36, 32 ~ 37, 32 to 38, 32 to 39, 32 to 40, 32 to 41, 33 to 35, 33 to 36, 33 to 37, 33 to 38, 33 to 39, 33 to 40, 33 to 41, 34 to 36 , 34-37, 34-38, 34-39, 34-40, 34-41, 35-37, 35-38, 35-39, 35-40, 35-41, 36-38, 36-39, 36 For the ability to bind to phosphorylated and non-phosphorylated forms of tau, such as one or more peptides including -40, 36-41 and / or, for example, a full-length isoform of tau having a position 404 in the phosphorylated form. Can be tested. The peptide can be attached to a carrier or other tag to facilitate the screening assay. In this case, the carrier or tag is preferentially different than the combination of spacers and carrier molecules used for immunization in order to remove the spacer or carrier-specific antibody rather than the tau peptide. All tau isoforms can be used.

Antibodies with binding specificity for selected mouse antibodies (eg, 16B5) can also be produced using variants of the phage display method. See Winter WO 92/20791. This method is particularly suitable for producing human antibodies. In this method, either the heavy or light chain variable region of the selected mouse antibody is used as a starting material. For example, when the light chain variable region is selected as the starting material, the phage library is configured so that the members present the same light chain variable region (ie, mouse starting material) and different heavy chain variable regions. Heavy chain variable regions can be obtained, for example, from a library of rearranged human heavy chain variable regions. Phages (eg, at least ¹⁰⁸ and preferably at least 10 ⁹ M ^-1 ) that exhibit strong specific binding to the desired target (eg, taupeptide) are selected. This phage-derived heavy chain variable region then serves as a starting material for constructing further phage libraries. In this library, each phage presents the same heavy chain variable region (ie, the region identified from the first display library) and different light chain variable regions. The light chain variable region can be obtained, for example, from a library of rearranged human variable light chain regions. Again, phages that exhibit strong specific binding to the desired target are selected. The resulting antibody usually has the same or similar epitope specificity as the mouse starting material.

Other antibodies can be obtained by mutagenesis of the cDNA encoding the heavy and light chains of a representative antibody such as 16B5. Monoclonal antibodies that are at least 90%, 95% or 99% identical to 16B5 in the amino acid sequence of the mature heavy chain and / or light chain variable region and retain their functional properties, and / or a few non-functionally significant amino acid substitutions. Also included in the invention are monoclonal antibodies that differ from their respective antibodies due to (eg, conservative substitution), deletion, or insertion. Also included are monoclonal antibodies having at least one, preferably all six CDRs (s) that are 90%, 95%, 99% or 100% identical to the corresponding CDRs of 16B5, as defined by Kabat.

B. Non-human antibody
Production of other non-human monoclonal antibodies to the immunogen, such as mice, guinea pigs, primates, rabbits or rats, can be carried out, for example, by immunizing the animal with the immunogen as described above. See Harlow & Line, Antibodies, Laboratory Manual (CSHP NY, 1988) (incorporated by reference for all purposes). Such immunogens can be obtained from natural sources by peptide synthesis or recombinant expression.

If desired, the immunogen can be administered with an adjuvant. Several types of adjuvants can be used as described below. An incomplete adjuvant following a complete Freund's adjuvant is preferred for immunization of laboratory animals. Rabbits or guinea pigs are typically used to make polyclonal antibodies. Mice are typically used to make monoclonal antibodies. Antibodies are screened for specific binding and, if necessary, antibodies are further screened for binding to specific regions of tau. Such screening can be accomplished by determining the binding of the antibody to the collection of Tau deletion variants and which deletion variants bind to the antibody. Binding can be evaluated, for example, by Western blot, FACS ™ or ELISA.

C. Humanized antibody
A humanized antibody is a genetically engineered antibody in which the CDR of a non-human "donor" antibody (eg, 16B5) is conjugated to a human "acceptor" antibody sequence (eg, Queen US Pat. No. 5,530,101). No. 5,585,089; Winter's US Patent No. 5,225,539, Carter's US Patent No. 6,407,213, Adair's US Patent No. 5,859,205, No. 6 , 881,557, please refer to Foote's US Pat. No. 6,881,557). The sequence of the acceptor antibody can be, for example, a mature human antibody sequence, a complex of such sequences, a consensus sequence of human antibody sequences, or a sequence of a germline region. Thus, a humanized antibody may contain some or all CDRs, if any, completely or substantially derived from the donor antibody, variable region framework sequences and constant regions derived entirely or substantially from the human antibody sequence. It is an antibody that has. Similarly, humanized heavy chains are at least one, two, usually all three CDRs, completely or substantially derived from the donor antibody heavy chain, substantially the human heavy chain variable region frame, if present. It has a heavy chain variable region framework sequence and a heavy chain constant region derived from the work and constant region sequences. Similarly, the humanized light chain is a substantially human light chain variable region frame, if any, at least one, two, usually all three CDRs, completely or substantially derived from the donor antibody light chain. It has a light chain variable region framework sequence and a light chain constant region derived from the work and constant region sequences. In addition to Nanobodies and dAbs, humanized antibodies include humanized heavy chains and humanized light chains. CDRs in humanized antibodies are substantially non-human antibodies if at least 85%, 90%, 95%, or 100% of the corresponding residues (by Kabat's definition) are identical between the respective CDRs. Derived from the corresponding CDR in. Variable region framework sequence of antibody chain or constant region of antibody chain is substantially human variable region frame, respectively, when at least 85, 90, 95 or 100% of the corresponding residues defined by Kabat are identical. Derived from the work sequence or human constant region.

Humanized antibodies often include all 6 CDRs derived from mouse antibodies (preferably as defined by Kabat), but less than all CDRs derived from mouse antibodies (eg, at least 3, 4, or 5). (Eg, Pascalis et al., J. Immunol. 169: 3076, 2002; Vajdos et al., Journal of Molecular Biology, 320: 415-428, 2002; Iwahashi et al. Immunol. 36: 1079-1091, 1999; Tamura et al, Journal of Immunology, 164: 1432-1441, 2000).

In some antibodies, only a portion of the CDR, a subset of the CDR residues required for binding, called SDR, is required to retain binding in the humanized antibody. CDR residues that are not in contact with the antigen and are not present in the SDR are based on previous studies (eg, residues H60-H65 in CDR H2 are often not required), and the Cothia hypervariable loop (Chothia, From the region of Kabat CDR outside J. Mol. Biol. 196: 901, 1987), molecular modeling and / or empirically, or Gonzales et al. , Mol. Immunol. It can be identified as described in 41: 863, 2004. In such humanized antibodies, where one or more donor CDR residues are absent or the entire donor CDR has been removed, the amino acid occupying that position is in the acceptor antibody sequence (Kabat number). It can be an amino acid that occupies the corresponding position (according to the attachment). The number of such substitutions of acceptors for donor amino acids in the included CDRs reflects a balance of competing considerations. Such substitutions are advantageous in that they potentially reduce the number of mouse amino acids in humanized antibodies and, as a result, their potential immunogenicity. However, substitutions can also cause changes in affinity, preferably avoiding a significant decrease in affinity. The position of the substitution in the CDR and the amino acid to be substituted can also be empirically selected.

The human acceptor antibody sequence provides a high degree of sequence identity (eg, 65-85% identity) between the variable region framework of the human acceptor sequence and the corresponding variable region framework of the donor antibody chain. Therefore, it can be selected from many known human antibody sequences, if desired.

Specific amino acids of human variable region framework residues can be selected for substitutions based on their potential effects on CDR conformation and / or binding to antigen. Studies of these possible effects are based on modeling, testing of amino acid characteristics at specific positions, or empirical observation of the effects of specific amino acid substitutions or mutagenesis.

For example, if the amino acid differs between the mouse variable region framework residue and the selected human variable region framework residue, the human framework amino acid can be replaced by the equivalent framework amino acid of the mouse antibody, in which case the amino acid. but,
(1) Non-covalently binds directly to the antigen,
(2) Adjacent to the CDR regions,
(3) Model light or heavy chains on the analyzed structure of homologous known immunoglobulin chains that otherwise interact with the CDR regions (eg, within about 6 Å of the CDR regions). (Identified by) and (4) residues involved in the VL-VH interface.
That is reasonably expected.

As defined by Queen US Pat. No. 5,530,101, framework residues of classes (1)-(3) may also be alternately referred to as canonical and vernier residues. Framework residues that define the canonical class of donor CDR loops that determine the conformation of the CDR loops are sometimes referred to as canonical residues (Chothia and Lesk, J. Mol. Biol. 196, 901-917 (1987). , Toronto & Martin J. Mol. Biol., 263,800-815, 1996). The layer of framework residues that support the conformation of the antigen-binding loop, which serves to fine-tune the suitability of the antibody to the antigen, is sometimes referred to as vernier residues (Fooote & Winter, 1992, J Mol Bio. 224,). 487-499). Other candidates for substitution are residues that create potential glycosylation sites. Another candidate for substitution is the acceptor human framework amino acid, which is rare at its location for human immunoglobulins. These amino acids can be replaced with amino acids at equivalent positions in mouse donor antibodies or at equivalent positions in more typical human immunoglobulins. Another candidate for substitution is the acceptor human framework amino acid, which is rare at its location for human immunoglobulins.

The present invention provides a humanized version of a mouse 16B5 antibody. Mouse antibodies include variable regions of mature heavy and light chains having amino acid sequences containing SEQ ID NOs: 10 and 16, respectively. The present invention provides one representative humanized mature heavy chain variable region (H1) and three representative humanized mature light chain variable regions (L1, L2 and L3). The H1L2 variant has the same or better affinity as chimera 16B5 and 7 reversion mutations. H1L1 and H1L3 have similar affinities to chimera 16B5 and 6 reversion mutations.

In the present invention, the humanized mature heavy chain variable region exhibits at least 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO: 15, and the humanized mature light chain mature variable region is sequenced. Provided are variants of the H1L2 humanized 16B5 antibody that exhibit at least 90%, 95%, 96%, 97%, 98% or 99% sequence identity with number 22. Preferably, in such antibodies, some or all of the return mutations within H1L2 are retained. That is, at at least one, two, or three positions, position H13 is occupied by K, position H48 is occupied by M, and position H91 is occupied by F. Preferably, at at least 1, 2, 3 or all four positions, position L1 is occupied by N, position L4 is occupied by L, position L36 is occupied by F, and position L43 is occupied by S. ing. The CDR regions of such a humanized antibody are preferably identical or substantially identical to those of the H1L2, and are the same as those of the mouse donor antibody. The CDR regions can be defined by any conventional definition (eg, Cotia), but preferably as defined by Kabat.

One possibility of additional changes in the 16B5 variant is an additional return mutation in the variable region framework. Many of the framework residues that do not contact CDRs in humanized mAbs can adapt to amino acid substitutions at the corresponding positions of donor mouse mAbs or other mouse or human antibodies, and even more potential CDR contact residues. Also susceptible to substitutions, or even amino acids within the CDRs may be altered, for example, with residues found at the corresponding positions in the human acceptor sequence used to provide the variable region framework. good. Further, for example, for heavy and / or light chains, another human acceptor sequence can be used. If different acceptor sequences are used, the corresponding donor and acceptor residues are already the same without the return mutation, so one or more of the return mutations recommended above may not be performed. good. For example, if a heavy chain acceptor sequence in which position H13 is already occupied by K is used, no return mutation is required.

Also in the present invention, the mature light chain and heavy chain variable regions are the mature light chain and heavy chain variable regions of the humanized 16B5 H1L1 antibody (SEQ ID NOs: 21 and 15 respectively) or the humanized 16B5 H1L3 antibody (SEQ ID NOs: 23 and 15 respectively). ) And humanized antibodies exhibiting at least 90, 95, 96, 97, 98 or 99% sequence identity.

D. Chimeric antibody and veneer antibody
The invention further provides chimeric and veneer types of non-human antibodies, in particular 16B5 antibodies.

Chimeric antibodies are antibodies that combine the mature variable regions of the light and heavy chains of a non-human antibody (eg, mouse) with the human light and heavy chain constant regions. Such antibodies substantially or completely retain the binding specificity of mouse antibodies and are about two-thirds of the human sequence.

Veneer antibodies carry some and usually all of the CDRs as well as some of the non-human variable region framework residues of non-human antibodies, but B-cell epitopes or T-cell epitopes, eg, exposed residues. A type of humanized antibody in which other variable region framework residues that may contribute to the group (Padlan, Mol. Immunol. 28: 489, 1991) are replaced with residues at the corresponding positions in the human antibody sequence. The result is an antibody in which the CDR is completely or substantially derived from a non-human antibody and the variable region framework of the non-human antibody is replaced to make it more human-like. Any veneer type of 16B5 antibody is included in the present invention.

E. Human antibody
Human antibodies against tau are provided by the various techniques described below. Methods for producing human antibodies include Oestberg et al. , Hybridoma 2: 361-376 (1983); Trioma method of Oestberg US Pat. No. 4,634,664, and Engleman et al., US Pat. No. 4,634,666, transgenic mice containing human immunoglobulin genes. Use (eg, WO93 / 12227 (1993) by Lomberg et al.; US Pat. Nos. 5,877,397, 5,874,299, 5,814,318, 5,789,650. , No. 5,770,429, No. 5,661,016, No. 5,633,425, No. 5,625,126, No. 5,569,825, No. 5, See 545,806, Nature 148, 1547-1553 (1994), Nature Biotechnology 14,826 (1996), Kucherlapati, WO91 / 10741 (1991)) and phage display methods (eg, WO91 / 17271 by Dower et al.). And McCafferty et al. WO 92/01047, US Pat. No. 5,877,218, No. 5,871,907, No. 5,858,657, No. 5,837,242, No. 5,733. , 743 and 5,565,332).

F. Selection of constant region
Chimeric antibodies, humanized antibodies (including veneer antibodies), or variable regions of the heavy and light chains of human antibodies can be linked to at least a portion of the human constant region. The choice of constant region depends to some extent on whether antibody-dependent complement and / or cell-mediated cytotoxicity is desired. For example, human isotypes IgG1 and IgG3 have complement-mediated cytotoxicity, whereas human isotypes IgG2 and IgG4 have little or no complement-mediated cytotoxicity. The light chain constant region can be a lambda or a kappa. Antibodies are as tetramers containing two light chains and two heavy chains, as separate heavy chains, as light chains, as Fab, Fab', F (ab') 2, and Fv, or as heavy chains and light chains. Can be expressed as a single-chain antibody in which the variable regions of are linked via spacers.

The human constant region exhibits allotype and isoallotype mutations between different individuals. That is, the constant regions can differ in different individuals at one or more polymorphic locations. Isotypes differ from allotypes in that the serum that recognizes the isotype binds to the non-polymorphic region of one or more other isotypes. References to human constant regions are up to 3, 5 or any sequence of residues occupying any natural allotype or polymorphic position in the natural allotype or to reduce or increase effector function as described below. Includes a constant region with 10 substitutions.

One or several amino acids at the amino or carboxy terminus of the light chain and / or heavy chain, such as the C-terminal lysine of the heavy chain, may be missing or derivatized in part or all of the molecule. May be good. Substitution is to reduce or increase effector function such as complement-mediated cytotoxicity or ADCC (eg, Winter et al. US Pat. No. 5,624,821, Tso et al. US Pat. No. 5,834,597). , And Lazar et al., Proc. Natl. Acad. Sci. USA 103: 4005, 2006), or can be performed in the constant region to extend the half-life in humans (eg, Hinton et al. , J. Biol. Chem. 279: 6213, 2004). Representative substitutions for increasing the half-life of an antibody include Gln at position 250 and / or Leu at position 428 (EU numbering of constant regions is used in this paragraph). Substitution of any or all of positions 234, 235, 236 and / or 237 reduces the affinity for Fcγ receptors, in particular FcγRI receptors (see, eg, US Pat. No. 6,624,821). ). Alanine substitutions at positions 234, 235 and 237 of human IgG1 are preferred to reduce effector function. If necessary, 234, 236 and / or 237 in human IgG2 have been replaced with alanine and position 235 has been replaced with glutamine (see, eg, US Pat. No. 5,624,821).

G. Expression of recombinant antibody
Chimeric antibodies, humanized antibodies (including veneers) and human antibodies are typically produced by recombinant expression. The nucleic acid encoding the antibody can be codon-optimized for expression in the desired cell type (eg, CHO or Sp2 / 0). The nucleic acids encoding the variable regions of the humanized 16B5 heavy and light chains disclosed herein are, for example, SEQ ID NO: 25 (encoding Hu16B5 H1), SEQ ID NO: 26 (encoding Hu16B5 L1), (Hu16B5). It has a sequence comprising or consisting of SEQ ID NO: 27 (encoding L2) or SEQ ID NO: 28 (encoding Hu16B5 L3). For variable regions containing signal peptides such as SEQ ID NOs: 10 and 16, the nucleic acid can encode the variable region with or without the signal peptide. Nucleic acid segments encoding heavy and light chains can be on the same contiguous nucleic acid molecule or on separate molecules. Heavy and light chains can be expressed from the same vector or different vectors. Nucleic acids are typically provided in isolated form.

The nucleic acid encoding the humanized 16B5 heavy chain variable region can be linked, for example, to the nucleic acid segment encoding the human IgG1 constant region having the sequence of SEQ ID NO: 30. Such nucleic acids can also include introns located between the segment encoding the heavy chain variable region and the segment encoding the IgG1 constant region, i.e., on the 5'side of the segment encoding the constant region. A representative nucleic acid sequence encoding a human IgG1 constant region with a mouse intron at its 5'end is shown in SEQ ID NO: 31.

The nucleic acid encoding the humanized 16B5 light chain variable region can be linked, for example, to the nucleic acid segment encoding the human kappa constant region having the sequence of SEQ ID NO: 33. Such nucleic acids can also contain introns between the segment encoding the light chain variable region and the segment encoding the κ constant region (ie, the 5'side of the κ constant region). A representative nucleic acid sequence encoding a human kappa constant region with a human intron at its 5'end is shown in SEQ ID NO: 34.

Recombinant polynucleotide constructs typically comprise an expression control sequence operably linked to the coding sequence of an antibody chain containing a naturally related or heterologous promoter region. Preferably, the expression control sequence is a eukaryotic promoter system in a vector capable of transforming or transfecting a eukaryotic host cell. After the vector is integrated into the appropriate host, the host is maintained under conditions suitable for high levels of nucleotide sequence expression and collection and purification of cross-reactive antibodies. The vector encoding the antibody strand (s) can also include selectable genes such as dihydrofolate reductase or glutamine synthetase to allow amplification of the copy number of the nucleic acid encoding the antibody strand. ..

E. coli is a prokaryotic host that is particularly useful for expressing antibodies, especially antibody fragments. Microorganisms such as yeast are also useful for expression. The genus Saccharomyces is a preferred yeast host with suitable vectors having expression control sequences, origins of replication, termination sequences, etc., as appropriate. Representative promoters include 3-phosphoglycerate kinase and other glycolytic enzymes. Inducible yeast promoters include, among other things, alcohol dehydrogenase, isotitochrome C, and promoters of enzymes involved in maltose and galactose utilization.

Mammalian cells are the preferred host for expressing nucleotide segments encoding immunoglobulins or fragments thereof. See Winnacker, Genes to Clone (From Genes to Clones (VCH Publishing, New York, 1987)). Several suitable host cell lines capable of secreting intact heterologous proteins have been developed in the art and are CHO cell lines, various COS cell lines, HeLa cells, HEK293 cells, L cells, and SP2. Includes non-antibody-producing myeloma including / 0 and NS0. Preferably, the cells are non-human. Expression vectors for these cells include expression control sequences such as replication origins, promoters, enhancers (Queen et al., Immunol. Rev. 89: 49 (1986)), as well as ribosome binding sites, RNA splice sites, and polyadenylation sites. , And the required information processing sites such as transcription termination sequences. Preferred expression control sequences are promoters derived from endogenous genes, cytomegalovirus, SV40, adenovirus, bovine papillomavirus and the like. Co et al. , J. Immunol. 148: 1149 (1992).

Vectors encoding the heavy and light chains of the antibody (s) can be introduced into the cell culture and the cell pool can be screened for growth productivity and product quality in serum-free medium. The top production cell pool can then be subjected to FACS-based single cell cloning to generate monoclonal strains. Specific productivity of more than 50 pg or 100 pg per cell per day, which corresponds to the product titer of cultures above 7.5 g / L, is preferred. Antibodies produced by single cell clones can also be tested for turbidity, filtration properties, PAGE, IEF, UV scan, HP-SEC, carbohydrate-oligosaccharide mapping, mass spectrometry, and binding assays such as ELISA or Biacore. .. The selected clones can then be placed in multiple vials and cryopreserved for later use.

Upon expression, the antibody is purified according to standard procedures in the art, including protein A capture, column chromatography (eg, hydrophobic interaction or ion exchange), and low pH for virus inactivation. Yes (generally see Scopes, Protein PurificaTion (Springer-Verlag, NY, 1982)).

Codon optimization, promoter selection, transcriptional elements, and terminators, serum-free single-cell cloning, cell banks, use of selection markers for copy count amplification, CHO terminators, serum-free single-cell cloning, protein titers Methods for commercial production of antibodies can be used, including improvements in (eg, US Pat. Nos. 5,786,464, 6,114,148, 6,063,598, No. See 7,569,339, WO2004 / 050884, WO2008 / 012142, WO2008 / 012414, WO2005 / 019442, WO2008 / 107388, and WO2009 / 027471, and US Pat. No. 5,888,809).

IV. Active Immunization Drugs used for active immunization help induce the same type of antibody described above in relation to passive immunization in a patient. Agents used for active immunization are immunogens of the same type used to generate monoclonal antibodies in laboratory animals, such as residues 23-46, 25-44, 28-41 or 30 of SEQ ID NO: 1. Peptides of 3-15 or 3-12 or 5-12 or 5-8 contiguous amino acids from the region of tau corresponding to ~ 39, eg, residues 28-30, 28-31, 28 of SEQ ID NO: 1. -32, 28-33, 28-34, 28-35, 28-36, 28-37, 28-38, 28-39, 28-40, 28-41, 29-31, 29-32, 29-33 , 29-34, 29-35, 29-36, 29-37, 29-38, 29-39, 29-40, 29-41, 30-32, 30-33, 30-34, 30-35, 30 ~ 36, 30 ~ 37, 30 ~ 38, 30 ~ 39, 30 ~ 40, 30 ~ 41, 31 ~ 33, 31 ~ 34, 31 ~ 35, 31 ~ 36, 31 ~ 37, 31 ~ 38, 31 ~ 39 , 31-40, 31-41, 32-34, 32-35, 32-36, 32-37, 32-38, 32-39, 32-40, 32-41, 33-35, 33-36, 33 To 37, 33 to 38, 33 to 39, 33 to 40, 33 to 41, 34 to 36, 34 to 37, 34 to 38, 34 to 39, 34 to 40, 34 to 41, 35 to 37, 35 to 38. , 35-39, 35-40, 35-41, 36-38, 36-39, 36-40, 36-41. In order to induce antibodies that bind to the same or overlapping epitopes as 16B5, the epitope specificity of these antibodies can be mapped (eg, by testing binding to a series of overlapping peptides across tau). Fragments of tau consisting of, containing or overlapping epitopes can then be used as immunogens. Such fragments are typically used in non-phosphorylated form.

The heterologous carrier and adjuvant, when used, may be the same as those used to produce the monoclonal antibody, but may be selected for better pharmaceutical compatibility for use in humans. Suitable carriers include serum albumin, keyhole limpet hemocianine, immunoglobulin molecules, thyroglobulin, ovalbumin, tetanus toxoid, or diphtheria (eg, CRM197), E. coli, cholera, or H.I. Includes toxoids from other pathogenic bacteria such as Helicobacter, or attenuated toxin derivatives. T cell epitopes are also suitable carrier molecules. Some conjugates are immunostimulatory polymer molecules (eg, trypalmitoyle-S-glycerin cysteine (Pam ₃ Cys), mannan (mannose polymer), or glucan (aβ1 → 2 polymer)), cytokines (eg, IL- 1. IL-1α and IL-1β peptides, IL-2, γ-INF, IL-10, GM-CSF), and chemokines (eg, MIP1-α and MIP1-β, and RANTES) with the agents of the invention. It can be formed by connecting them. The immunogen may be linked to the carrier with or without the spacer amino acid (eg, gly-gly). Additional carriers include virus-like particles. Virus-like particles (VLPs), also called pseudovirions or virus-like particles, exhibit subunit structures composed of multiple copies of virus capsids and / or enveloped proteins that can self-assemble in vivo within defined spherically symmetric VLPs. (Powerleit, et al., (2007) PLoS ONE 2 (5): e415.). Alternatively, the peptide immunogen can be linked to at least one artificial T cell epitope capable of binding to the majority of MHC class II molecules such as pan DR epitope (“PADRE”). PADRE is described in US Pat. No. 5,736,142, WO95 / 07707, and Alexander Jet al, Immunoty, 1: 751-761 (1994). The active immunogen can exist in a multimeric form in which multiple copies of the immunogen and / or its carrier are presented as a single covalently bound molecule.

Fragments are often administered with a pharmaceutically acceptable adjuvant. The adjuvant increases the titer of the induced antibody and / or the binding affinity of the induced antibody as compared to the situation when the peptide is used alone. Various adjuvants can be used in combination with an immunogenic fragment of tau to elicit an immune response. Preferred adjuvants increase the inherent response to the immunogen without causing conformational changes in the immunogen that affect the qualitative morphology of the response. Preferred adjuvants include aluminum salts such as aluminum hydroxide and aluminum phosphate, 3De-O-acylated monophosphoryl lipid A (MPL ™) (GB2220211 (RIBI ImmunoChem Research, Hamilton, Montana, now Corixa). Includes. Simulon ™ QS-21 is a triterpene glycoside or saponin isolated from the bark of Kiraya saponaria molina found in South America (Kensil et al., Vaccine Design). : Subunit and Adjuvant Approach (Power & Newman (eds.), Plenum Press, New York, 1995); US Pat. No. 5,057,540), (Alumina BioPharma Cematics, Inc.). See Antikines, New York, New York). Other adjuvants may optionally be immunostimulants such as monophosphoryllipid A (Stoute et al., N. Engl. J. Med. 336, 86-91). (1997)) in water oil emulsions (such as squalane or peanut oil), pluronic polymers, and killed mycobacteria. The Livi adjuvant is an oil in water emulsion. Livi is a physiology comprising Tween80. Includes a salivable oil (squalene) emulsified in saline. Livi also contains purified mycobacterial products and bacterial monophosphoryllipid A that act as immunostimulators. Another adjuvant is CpG (WO98 / 40100). ). The adjuvant can be administered as a component of the therapeutic composition together with the active agent, or separately before, simultaneously with, or after the administration of the therapeutic agent.

Analogs of natural fragments of tau that induce antibodies against tau can also be used. For example, one or more or all L-amino acids can be replaced with D-amino acids in such peptides. Also, the order of amino acids can be reversed (retropeptides). If desired, the peptide contains all D-amino acids in reverse order (retroinversopeptide). Peptides and other compounds do not necessarily have significant amino acid sequence similarity to taupeptides, but nevertheless function as mimetics of taupeptides and elicit similar immune responses. Anti-idiotype antibodies against Tau's monoclonal antibodies as described above can also be used. Such anti-Id antibodies mimic the antigen and provide an immune response to it (Essential Immunology, ed., Blackwell Scientific Publishing, Palo Alto, Calif., 6th Edition, p. 181). Please refer to).

The peptide (and optionally the carrier fused to the peptide) can also be administered in the form of a nucleic acid encoding the peptide and expressed in the patient's body. Nucleic acid segments encoding immunogens are typically linked to regulatory elements such as promoters and enhancers that allow expression of the DNA segment within the patient's intended target cell. For expression in blood cells, such as desirable for inducing an immune response, promoters and enhancer elements of light or heavy chain immunoglobulin genes or CMV major earliest promoters and enhancers are suitable to direct expression. Concatenated regulatory elements and coding sequences are often cloned into vectors. The antibody can also be administered in the form of a nucleic acid encoding the heavy and / or light chain of the antibody. When both heavy and light chains are present, the chains are preferably linked as single chain antibodies. Antibodies for passive administration can also be prepared, for example, by affinity chromatography from the sera of patients treated with peptide immunogens.

DNA can be delivered in naked form (ie, colloidal or without encapsulating material). Alternatively, a retrovirus system (see, eg, Lawrie and Tumin, Cur.Opin.Genet.Develop. 3,102-109 (1993)); adenovirus vector (eg, Bett et al, J. Virus. 67, 5911 (1993)). ); Adeno-associated virus vector (see, eg, Zhou et al., J. Exp. Med. 179, 1867 (1994)); Pox family virus vectors, including vaccinia virus and avian pox virus, Sindbis and Semuliki forest. Alpha virus genus virus vectors such as those derived from viruses (see, eg, Dubensky et al., J. Virol. 70, 508-519 (1996)), Venezuelan encephalitis virus (see US Pat. No. 5,643,576). ) And Labdviruses such as vesicular stomatitis virus (see WO96 / 34625) and papillomaviruses (Ohe et al., Human Gene Therapy 6,325-333 (1995); Woo et al. Several viral vector systems are available, including Acids. Res. 24, 2630-2622 (1996).

The DNA encoding the immunogen, or the vector containing it, can be packaged in liposomes. Suitable lipids and related analogs are described in US Pat. Nos. 5,208,036, 5,264,618, 5,279,833 and 5,283,185. .. Vectors and DNAs encoding immunogens can also be adsorbed or bound to particulate carriers, such as polymethylmethacrylate polymers and polylactides and polys (lactide-co-glycolide) (eg, McGee et al). ., J. Micro Encap. 1996).

V. Screening Method As mentioned above, the antibody can be screened for the originally intended binding specificity. Active immunogens can also be screened for their ability to induce antibodies with such binding specificity. In this case, the active immunogen is used to immunize the experimental animal and the resulting serum is tested for appropriate binding specificity.

Antibodies with the desired binding specificity can then be tested in cell and animal models. The cells used for such screening are preferentially nerve cells. Cell models of tau pathology in which neuroblastoma cells were optionally transfected with tau's four-repeat domain with mutations associated with tau pathology have been reported (eg, Delta K280), Khristunova, Current Alzheimer Research. 4,544-546 (2007). In another model, tau is induced in neuroblastoma N2a cell lines by the addition of doxycycline. This cell model shows tau toxicity to cells in a soluble or aggregated state, appearance of tau aggregates after switching on tau gene expression, lysis of tau aggregates after switching off gene expression again, It is also possible to study the efficiency of antibodies in suppressing the formation of tau aggregates or deaggregating them.

Antibodies or active immunogens can also be screened in transgenic animal models of diseases associated with tau. Such transgenic animals carry the tau transgene (eg, one of the human isoforms) and, optionally, the human APP transgene, such as a kinase that phosphorylates tau, apoE, presenilin or α-synuclein. Can include. Such transgenic animals have been treated to develop at least one sign or symptom of a disease associated with tau.

A representative transgenic animal is the mouse K3 strain (Itner et al., Proc. Natl. Acad. Sci. USA 105 (41): 15997-6002 (2008)). These mice carry the K369I mutation (which is associated with Pick disease) and the human tau transgene with the Thy 1.2 promoter. This model shows the rapid course of neurodegenerative, motor disorders and degeneration of afferent fibers and cerebellar granule cells. Another representative animal is the mouse pR5 strain. These mice carry the human tau transgene with the P301L mutation (this mutation is associated with frontotemporal dementia) and the Thy 1.2 promoter (Taconic, German, NY, Lewis, et al. , Nat Genet. 25: 402-405 (2000)). These mice have a more gradual course of neurodegeneration. This mouse develops neurofibrillary tangles in several brain regions and spinal cord, which are incorporated herein by reference in their entirety. This is an excellent model for studying the consequences of the development of aggregates and for screening therapies that can suppress the formation of these aggregates. Another advantage of these animals is the relatively early onset of lesions. In homozygous strains, behavioral abnormalities associated with tau pathology can be observed at least as early as 3 months, but these animals remain relatively healthy until at least 8 months of age. That is, at 8 months, these animals can roam, feed on themselves, and perform behavioral tasks sufficient to allow monitoring of therapeutic effects. Active immunization of these mice with AI wI KLH-PHF-1 for 6 to 13 months yielded a titer of approximately 1,000, with little neurofibrillary tangle compared to untreated control mice. Both pSer422 and weight loss decreased.

The activity of an antibody or activator can be assessed by a variety of criteria including reduction in total tau or phosphorylated tau, reduction in other pathological features such as amyloid deposits of Αβ, and suppression or delay or behavioral deficits. .. Active immunogens can also be tested for the induction of antibodies in serum. Both passive and active immunogens can be tested for the passage of antibodies from the blood-brain barrier into the brain of transgenic animals. Antibodies or antibody-inducing fragments can also be tested in non-human primates that develop symptoms of a disease characterized by tau, either naturally or via induction. Testing for antibodies or activators is usually performed simultaneously with controlled experiments performed in parallel except that the antibody or activator is absent (eg, replaced by vehicle). Subsequent reduction, delay or suppression of signs or symptoms of the disease due to the antibody or activator under study can be assessed compared to the control.

VI. Patients eligible for treatment The presence of neurofibrillary tangles includes Alzheimer's disease, Down's syndrome, mild cognitive impairment, post-encephalitis parkinsonism, post-traumatic dementia or punched ranker, C-type Niemann-Pick disease, supranuclear palsy, frontotemporal dementia. It has been found in several diseases including head dementia, frontotemporal degeneration, muscle atrophic lateral sclerosis / Parkinson's dementia syndrome in Guam, and PSP progressive supranuclear palsy. The dosing regimen can also be used to treat or prevent any of these disorders. Due to the widespread relationship between neurological disorders and pathologies and tau, this dosing regimen is for levels of tau or phosphorylated tau (eg, within CSF) compared to the mean for individuals without neurological disorders. It can be used to treat or prevent any subject showing elevation. The dosing regimen can also be used to treat or prevent neurological disorders in individuals with tau mutations associated with neurological disorders. This method is particularly suitable for the treatment or prevention of Alzheimer's disease, and especially in patients.

Patients eligible for treatment include individuals at risk of the disease but asymptomatic and those who are currently symptomatic. Patients at risk for disease include those with a known genetic risk of disease. Such individuals include patients with relatives who are experiencing the disease, and patients whose risk is determined by analysis of genetic or biochemical markers. Genetic markers of risk include mutations in tau, such as those mentioned above, as well as mutations in other genes associated with neurological disorders. For example, homozygous as well as heterozygous ApoE4 alleles are associated with the risk of Alzheimer's disease. Other markers of risk for Alzheimer's disease include mutations in the APP gene, especially mutations at position 717, mutations at positions 670 and 671, called Hardy mutations and Swedish mutations, respectively, and mutations in the presenilin genes PS1 and PS2. Is associated with a family history of AD, hypercholesterolemia or atherosclerosis. Individuals currently suffering from Alzheimer's disease can be recognized by PET imaging due to their characteristic dementia and the presence of the risk factors described above. In addition, several diagnostic tests are available to identify individuals with AD. These include measurements of CSF tau or phosphorylated tau and Αβ42 levels. Elevated levels of tau or phosphorylated tau and decreased levels of Αβ42 imply the presence of AD. Some mutations are associated with Parkinson's disease. Mutations in other genes, such as Ala30Pro or Ala53, or the leucine-rich repeat kinase PARK8, are associated with Parkinson's disease. Individuals can also be diagnosed using any of the neurological disorders described above, according to the criteria of DSM IV TR.

In asymptomatic patients, treatment can be initiated at all ages (eg, 10, 20, 30). However, it is usually not necessary to start treatment until the patient is 40, 50, 60 or 70 years old. Treatment typically requires multiple doses over a period of time. Treatment can be monitored by assaying antibody levels over time. If the response is diminished, an additional immune dose is indicated. For patients with potential Down's syndrome, treatment can be initiated prenatally or shortly after birth by administering a therapeutic agent to the mother.

VII. Pharmaceutical Compositions and Therapeutics In prophylactic applications, the antibody or drug for inducing the antibody or the pharmaceutical composition thereof is a disease-sensitive patient (eg, Alzheimer's disease), or otherwise at risk of the disease. Administered to a patient with a dosing regimen (dose, frequency and route) that is effective in reducing the risk of the disease, reducing the severity of the disease, or delaying the onset of at least one sign or symptom of the disease. Will be done. In particular, the dosing regimen preferably suppresses or delays tau or phosphorylated tau and the pair of filaments formed from it in the brain and / or suppresses or delays its toxic effects and / or behavioral disorders. It is effective in suppressing or delaying the onset. In therapeutic applications, an antibody or antibody-inducing agent is effective in controlling the improvement or at least further exacerbation of at least one sign or symptom of the disease in a disease (eg, dose, frequency and route of administration). , Alzheimer's disease), or to patients who are already suffering from the disease. In particular, this dosing regimen is preferably effective in reducing or at least suppressing further elevated levels of tau, phosphorylated tau, or paired filaments formed from it, associated toxicity and / or behavioral deficits. ..

If individual treated patients achieve better outcomes than average outcomes in a control population of comparable patients not treated by the methods of the invention, or in comparative clinical trials (eg, Phase II, Phase II). If, in a / III or Phase III study), better outcomes of the treated patient for the control patient are shown at the level of p <0.05 or 0.01, or even 0.001, the dosing regimen is therapeutic. Or it is considered to be prophylactically effective.

Many different factors such as means of administration, target site, patient's physiological condition, whether the patient is an ApoE carrier, whether the patient is human or animal, whether other drugs are administered, Effective doses vary depending on whether the treatment is prophylactic or therapeutic.

A typical dose range for an antibody is about 0.01-5 mg / kg per kg body weight of a patient, more generally 0.1-3 mg / kg or 0.15-2 mg / kg or 0. It is 15 to 1.5 mg / kg. Antibodies can be administered at such doses daily, on alternate days, weekly, biweekly, monthly, quarterly, or according to any other schedule determined by empirical analysis. Typical treatments require multiple doses over a long period of time, eg, at least 6 months. A more representative dosing regimen requires dosing once every two weeks, once a month, or once every 3-6 months.

The amount of agent for active administration varies from 0.1 to 500 μg per patient, more generally from 1 to 100 or 1 to 10 μg per injection for administration to humans. The timing of injections can vary significantly from once a day to once a year and once every few years. A typical dosing regimen consists of immunization followed by booster injections at time intervals such as 6 weeks or 2 months. Another dosing regimen consists of booster injections 1, 2 and 12 months after immunization. Another dosing regimen involves injections every two months during life. Alternatively, booster injections can be irregular, as indicated by monitoring of the immune response.

Antibodies or agents for inducing antibodies are preferably administered via a peripheral route (ie, the route through which the administered or induced antibody crosses the blood-brain barrier and reaches the intended site in the brain). .. Routes of administration include topical, intravenous, oral, subcutaneous, intraarterial, intracranial, intrathecal, intraperitoneal, intranasal or intramuscular administration. The preferred route of administration of the antibody is the intravenous and subcutaneous routes. Preferred routes for active immunization are subcutaneous and intramuscular routes. This type of injection is most typically given to the arm or leg muscles. In some methods, the drug is injected directly into the specific tissue where the deposits have accumulated, eg, intracranial injection.

Pharmaceutical compositions for parenteral administration are preferably sterile, substantially isotonic, and are produced under GMP conditions. The pharmaceutical composition may be provided in a unit dosage form (ie, a dose for a single dose). The pharmaceutical composition can be formulated with one or more physiologically acceptable carriers, diluents, excipients or auxiliaries. The formulation depends on the route of administration selected. For injection, the antibody is an aqueous solution, preferably a physiologically compatible buffer such as Hanks' solution, Ringer's solution, or saline or acetate buffer (to reduce discomfort at the injection site). Can be formulated with liquid. The solution can contain a pharmaceutical agent such as a suspending agent, a stabilizer and / or a dispersant. Alternatively, the antibody may be in lyophilized form to be composed of a suitable vehicle prior to use, eg, sterile, pyrogen-free water.

The dosing regimen may be administered in combination with another agent effective in treating or preventing the disease to be treated. For example, in the case of Alzheimer's disease, this dosing regimen can be combined with immunotherapy for Αβ (WO / 2000/072880), cholineresterase inhibitor or memantine, or in the case of Parkinson's disease immunotherapy, α-sinucrane ( WO / 2008/103472), can be combined with immunotherapy against levodopa, dopamine agonists, COMT inhibitors, MAO-B inhibitors, amantadine, or anticholinergic agents.

VIII. In vivo Imaging, Diagnostic Methods, and Optimized Immunotherapy The present invention provides methods for in vivo imaging of tau protein deposits (eg, neurofibrillary tangles and tau inclusion bodies) in a patient. The method works by administering to the patient a drug such as an antibody that binds to tau (eg, mouse, humanized, chimeric or veneer 16B5 antibody) and then detecting the drug that binds to tau. Antibodies that bind to tau epitopes within amino acids 24-46 are preferred. In some methods, the antibody binds to an epitope within amino acids 25-44 or 30-39. The elimination reaction of the administered antibody can be avoided or reduced by using an antibody fragment lacking a full-length constant region, such as Fab. In some methods, the same antibody can serve as both a therapeutic and diagnostic reagent.

Diagnostic reagents can be administered directly to the brain by intravenous injection into the patient's body, by intracranial injection, or by piercing the skull. The dosage of the reagent should be within the same range as for the treatment method. Typically, the reagents are labeled, but in some methods, the primary reagents that have an affinity for tau are not labeled and are used to bind the secondary labeling agents to the primary reagents. The choice of label depends on the means of detection. For example, fluorescent labels are suitable for optical detection. The use of paramagnetic labels is suitable for tomographic detection without surgical intervention. Radiolabels can also be detected using PET or SPECT.

Methods of in vivo imaging of tau protein deposits are used to diagnose or diagnose tauopathy such as Alzheimer's disease, frontotemporal lobar degeneration, progressive supranuclear palsy and Pick disease, or susceptibility to such diseases. It is useful to confirm. For example, the method can be used in patients with symptoms of dementia. If a patient has abnormal neurofibrillary tangles, the patient may have Alzheimer's disease. Alternatively, if the patient has an abnormal tau inclusion body, the patient may have frontotemporal lobar degeneration, depending on the location of the inclusion body. The method can also be used in asymptomatic patients. The presence of aberrant tau protein deposits indicates future susceptibility to symptomatic disease. The method is also useful for monitoring disease progression and / or response to treatment in patients previously diagnosed with tau-related disease.

Diagnosis can be made by comparing the number, size, and / or intensity of labeled loci with the corresponding baseline values. Baseline values can represent average levels in a population of non-diseased individuals. Baseline values can also represent previous levels determined in the same patient. For example, a patient's baseline value can be determined prior to starting tau immunotherapy treatment, after which the measured and baseline values are compared. Decreased values relative to baseline indicate a positive response to treatment.

In some patients, the diagnosis of tauopathy can be assisted by performing a PET scan. PET scans can be performed using, for example, conventional PET imaging devices and auxiliary devices. Scans typically serve as one or more areas of the brain that are generally known to be associated with tau protein deposits, and, if any, as controls. Includes one or more regions present in.

The signal detected by the PET scan can be represented as a multidimensional image. A multidimensional image can represent a cross section of the brain in two dimensions, a three-dimensional brain in three dimensions, or a change over time in a three-dimensional brain in four dimensions. The color scale can be done with different colors, showing different labeling amounts and estimated tau protein deposits detected. The results of the scan can also be presented numerically in terms of the amount of label detected and, as a result, the number associated with the amount of tau protein deposits. For a particular tauopathy (eg, Alzheimer's disease), a marker present in a region of the brain known to be associated with deposits is deposited to provide a proportion of the degree of deposit within the former region. It can be compared to signs that exist in areas that are not known to be associated with the object. For the same radiolabeled ligand, such a ratio results in a comparable measure of tau protein deposits and its variation between different patients.

In some methods, PET scans are performed at the same time as the MRI or CAT scan, or at the same patient visit as the MRI or CAT scan. MRI or CAT scans provide more anatomical details of the brain than PET scans. However, images from PET scans can be superimposed on MRI or CAT scan images that more accurately locate PET ligands and putative tau deposits with respect to the anatomy in the brain. Some machines can perform both a patient's PET scan and an MRI or CAT scan without the patient repositioning during the scan, facilitating image superposition.

Suitable PET ligands include radiolabeled antibodies of the antibodies of the invention (eg, mouse, humanized, chimeric or veneer 16B5 antibodies). The radioisotope used can be, for example, C ¹¹ , N ¹³ , O ¹⁵ , F ¹⁸ , or I ¹²³ . The interval at which the PET ligand is administered and the scan is performed may depend on the rate of uptake and removal of the PET ligand, in particular the brain, and the half-life of its radiolabeled material.

PET scans can also be performed as a precautionary measure in asymptomatic patients or patients with symptoms of mild cognitive impairment who have not been diagnosed with tauopathy and are at high risk of developing tauopathy. In asymptomatic patients, scans are particularly useful for individuals who are considered to be at high risk for tauopathy due to family history, genetic or biochemical risk factors or mature age. Prophylactic scans can be initiated, for example, in patients aged 45-75 years. For some patients, the first scan is done at age 50.

Prophylactic scans can be performed, for example, at intervals of 6 months to 10 years, preferably 1 to 5 years. For some patients, prophylactic scans are performed annually. If PET scans performed as a precautionary measure show abnormally high levels of tau protein deposits, immunotherapy may be initiated and then PET scans may be performed similar to patients diagnosed with tauopathy. If a PET scan performed as a precautionary measure indicates the level of tau protein deposits that are within normal levels, then further PET scans, as described above, are performed at intervals of 6 months to 10 years, preferably 1 to 5 years. Or it can be done in response to the appearance of signs and symptoms of tauopathy or mild cognitive impairment. When and when the above normal levels of tau protein deposits are detected, by combining prophylactic scans with administration of tau-oriented immunotherapy, the levels of tau protein deposits are reduced to normal levels or it. It can be prevented from reaching closer levels, or at least further increasing, and patients will have a longer duration (eg, at least 5, 10, 15 or 20) than if they were not receiving prophylactic scans and tau-oriented immunotherapy. It can remain tauopathy-free for years, or for the rest of the patient's life).

Normal levels of tau protein deposits are representative samples of individuals in the general population who have not been diagnosed with a particular tauopathy (eg, Alzheimer's disease) and are not considered at high risk of developing such diseases (eg, Alzheimer's disease). For example, it can be determined by the amount of neurofibrillary tangles or tau inclusions in the brain of a disease-free individual (typical sample) younger than 50 years. Alternatively, in areas of the brain where tau protein deposits are known to occur, PET signals according to the methods of the invention are found in areas of the brain where such deposits are normally known to occur. Normal levels can be perceived by individual patients if they are not different (within the accuracy of the measurement) from the signal from. Elevated levels in an individual are associated with tau protein deposits by comparison to normal levels (eg, variance of external mean and standard deviation) or simply compared to regions not known to be associated with deposits. It can be recognized from signals that rise beyond the experimental error in the region of the brain. For the purpose of comparing the levels of tau protein deposits in individuals and populations, tau protein deposits should preferably be determined in the same region of the brain (s), where these regions are specific tauopathy (s). For example, it comprises at least one region known to form tau protein deposits associated with (Alzheimer's disease). Patients with elevated levels of tau protein deposits are candidates for initiating immunotherapy.

Decreased levels of tau protein deposits after initiating immunotherapy can first be seen as an indication that the treatment has the desired effect. The observed reduction can be, for example, in the range of 1-100%, 1-50%, or 1-25% of the baseline value. Such effects can be measured in one or more regions of the brain known to form deposits, or can be measured from the mean of such regions. The overall effect of treatment can be estimated by adding the rate of decrease to baseline to the increase in tau protein deposits that would otherwise occur in untreated patients.

Maintaining a nearly constant level of tau protein deposits or even a slight increase in tau protein deposits is a suboptimal response, but can be an indicator of response to treatment. Such a response is to determine if immunotherapy has the effect of suppressing the further increase in tau protein deposits, tau in patients with certain untreated tauopathy (eg, Alzheimer's disease). It can be compared with the passage of time at the level of protein deposits.

Monitoring changes in tau protein deposits allows the coordination of dosing regimens for immunotherapy or other therapies in response to treatment. PET monitoring provides an indicator of the nature and degree of response to treatment. It can then be determined whether or not treatment adjustments should be made, and if necessary, treatments can be adjusted according to PET monitoring. Therefore, PET monitoring allows adjustment of dosing regimens for tau-oriented immunotherapy or other therapies before other biomarkers, MRI or cognitive measurements are detectably responsive. Significant changes mean that comparing the values of the post-treatment parameters to the base provides evidence that the treatment has or does not have a beneficial effect. In some cases, changes in the values of the parameters in the patient himself provide evidence that the treatment has or has not had a beneficial effect. In another example, changes in values in patients, if any, are compared to changes in values in a representative control population of patients who are not receiving immunotherapy, if any. The difference between the response of a particular patient and the normal response of a control patient (eg, mean plus standard deviation variance) also indicates whether the immunotherapy dosing regimen has achieved or does not have a beneficial effect in the patient. Evidence can be provided.

In some patients, monitoring shows a detectable reduction in tau protein deposits, but levels of tau protein deposits remain above normal. In such patients, continue the treatment regimen with the same frequency and / or dose if there are no unacceptable side effects, or with an increased frequency and / or dose if it is not the maximum recommended dose. Can be done.

If monitoring indicates that the level of tau protein deposits in the patient has dropped to normal or near normal, then the immunotherapy dosing regimen is the inducing dosing regimen (ie, the plan to reduce the levels of tau protein deposits). ) Can be adjusted to a maintenance dosing regimen (ie, a regimen to maintain tau protein deposits at near constant levels). Such dosing regimens can be influenced by reducing the dose and / or frequency of administration of immunotherapy.

In other patients, surveillance may indicate that immunotherapy has some beneficial but suboptimal effects. Optimal effects are experienced by a representative sample of tauopathy patients receiving immunotherapy at a given point in time after the start of treatment (its whole brain or representative known to form tau protein deposits). It can be defined as the rate of decrease in the level of tau protein deposits within the upper half or quadrant of changes in tau protein deposits (measured or calculated over multiple regions). Inferred from controls in patients with slightly reduced tau protein deposits, or patients with constant or increased tau protein deposits, but in the absence of immunotherapy (eg, not receiving immunotherapy) Patients who have an increase to a degree lower than expected (when they do) can be classified as patients who experience a positive but suboptimal response. Such patients may be subjected to dosing regimen adjustments to increase the dose and / or frequency of dosing of the agent, as needed.

In some patients, tau protein deposits can increase as well as or better than tau deposits in patients not receiving immunotherapy. If such an increase persists for a period of time, such as 18 months or 2 years, then immunotherapy is discontinued, prioritizing other treatments, as needed, even after increasing the frequency or dose of the drug. Can be done.

The aforementioned discussion of tauopathy diagnosis, monitoring, and coordination of treatment has primarily focused on the use of PET scans. However, any other technique for visualizing and / or measuring tau protein deposits susceptible to the use of the tau antibody of the invention (eg, mouse, humanized, chimeric or veneer 16B5 antibody) is such. Can be used in place of PET scans to perform various methods.

Example Example 1. Preparation of Antibody 16B5 Pan antibody 16B5 that recognizes phosphorylated or non-phosphorylated tau was prepared for purified tau and selected based on its high affinity capture properties in the ELISA assay.

Example 2. Cloning and Sequencing RNA of Antibody 16B5 RNA was extracted from pelleted cells expressing the 16B5 antibody using Trizol LS (Invitrogen). RNA concentration was measured using a Quant-IT kit (Invitrogen).

5'-RACE was used to amplify the 5'end of IgG mRNA using the Smart RACE kit (Clontech). Approximately 1 μg of RNA was used in the RT reaction and the cDNA pool was further amplified using Universal Primers from the Smart RACE Kit and Gene Specific Primers (GSPs) designed with ExonBIO.

Primer sequence:
Universal Primer: CTAATACGACTCACTATAGGGC (SEQ ID NO: 7)
GSP:
IgG1 and IgG2a: CTC AAT TTT CTT GTC CAC CTT GGT GC (SEQ ID NO: 8)
IgG2b: CTC AAG TTT TTT GTC CAC CGT GGT GC (SEQ ID NO: 9)

The PCR product was gelled and cloned into a pSUPER-blunt vector (Adexon, www.adexonbiotech.com). For heavy chains, 15 colonies were miniprepped and sequenced. For light chains, colony PCR was performed to distinguish endogenous aberrant light chains and sequence the only clone that was not amplified from colony PCR. The results of the sequencing were analyzed on the NTI vector. Primer sequences for adapters and GSPs were marked on the map. The region between the adapter and the GSP sequence is an IgG heavy chain sequence containing a leader, a signal peptide and a V-region, and a portion of the constant region. Marked the ORF on the map.

Example 3. Epitope mapping of antibody 16B5
Identification of epitopes by peptide fragment analysis
A human tau sequence containing four microtubule-bound repeats and a P301L mutation (r tau) without the N-terminal insert was expressed and purified in E. coli. This form of tau has the sequence of SEQ ID NO: 3 in which leucine at position 243 is replaced with proline (corresponding to P301L using a numbering rule based on tau's longest isoform). Enzymatic digestion of 200 μg tau was performed using one of four different proteases: trypsin (cleaves at the carboxyl ends of arginine and lysine), mainly cleaves at the carboxyl ends of tyrosine, tryptophan, phenylalanine and leucine. ) Chymotrypsin, LysC (cleaves at the carboxyl end of lysine), or Gluc (cleaves after glutamate residues and rarely asparagine residues). All proteases were obtained from Thermo Scientific and digested at 37 ° C. for 16 hours. The resulting peptide fragment was incubated with 10 μg of 16B5 and precipitated with protein G magnetic beads (NEB). The precipitate was washed completely in PBS containing 300 mM NaCl and 0.5% NP-40 and then eluted with 1 M NaCl (pH 2.8) in 100 mM glycine. The eluate was vacuum dried and resuspended in 0.1% trifluoroacetic acid (TFA). The resuspended eluate was loaded onto a 4.6 × 50 mm C18 column and then fractionated by HPLC (Agient1260 Infinity System) using a linear gradient of 0.075% TFA and acetonitrile. Peak fractions were collected, dried and resuspended in distilled water. Peptide mass and identity were determined by MALDI-TOF / TOF. The peaks corresponding to residues 25-44 of SEQ ID NO: 1 were identified in the LysC MS spectrum. Peaks corresponding to numbers 25-44 and 24-44 of residue sequence 1 were identified in the MS spectrum of trypsin. The lack of signals from chymotrypsin and GluC digests suggests that some epitopes can include residue 29 of SEQ ID NO: 1 and / or residue 37 of SEQ ID NO: 1.

Identification of Epitopes by Mutation Analysis Using the results determined by peptide fragment analysis (described above), mutation mutations in r-tau were induced by amplification of all plasmids using standard molecular biological methods. The protein was expressed in a small amount of bacterial culture, an equal volume of purified bacterial lysate was electrophoresed, blotted and stained with 16B5 antibody. Overlapping blots were stained with Tau 46, an antibody specific for the C-terminal region (C-terminal epitope) of tau, as a control for sample loading. Both antibodies were used at a concentration of 0.2 μg / ml. Images were acquired using a Licor Odyssey fluorescent scanner. The following deletion variants of tau were made and analyzed in this way: Δ5-24, Δ23-32, Δ25-44, Δ30-39, and Δ37-46. As shown in FIGS. 1 and 2, tau Δ25-44 and Δ30-39 deletion mutants were not detected by the 16B5 antibody, providing evidence that the epitope recognized by 16B5 is within those residues. .. The Δ37-46 deletion mutant of tau is very slightly detectable at 16B5, saying that some of the residues within 37-46 (eg, residue 37) may play a role in the binding of 16B5 to tau. Evidence was obtained. The 16B5 antibody stains tau's Δ23-32 deleted mutants to a lesser extent than the Δ5-24 deleted mutants and to a greater extent than the Δ25-44 and Δ30-39 deleted mutants, leaving 16B5 also remaining. Evidence was obtained that it could bind to peptides containing groups 33-36, 30-36, 33-37, 30-37 or 33-39. Overall, the data obtained from the tau-deleted mutants show that the epitope recognized by 16B5 is part or all of residues 23-32 of SEQ ID NO: 1 and part or all of residues 37-46 of SEQ ID NO: 1. Suggests that it can include everything. For example, 16B5 can recognize epitopes within residues 32-38 or 28-41 of SEQ ID NO: 1.

Identification of Epitopes by Alanine Scanning Next, a single residue within the tau region spanning residues 30-42 was alanine-mutated using PCR mutagenesis. The mutated protein was expressed and the lysate was separated by electrophoresis as described above and blotted with either 16B5 antibody or Tau46 antibody. The result of this analysis is shown in FIG. Specific point variants analyzed including T30A, M31A, H32A, Q33A, D34A, Q35A, E36A, G37A, D38A, T39A, D40A, A41L, and G42A are listed on the blot. Residues of particular interest are boxed on each blot. The detectable binding of 16B5 is completely eliminated by the Q33A tau mutation and substantially reduced by the G37A tau mutation, with residue 33 and a lesser degree of residue 37 being an important component of the epitope recognized by 16B5. Evidence was obtained that could be. Other residues may be important components of the epitope recognized by 16B5 in viacore analysis.

Example 4. Tauopathy h tau. Passive immunity in P301L transgenic mouse model
Immunity
FVB / N 3-month-old h-tau with a genetic background. Female mice with P301L-Tg were used in this study. Administration of 10 mg / kg of test antibody and control antibody was performed intraperitoneally once a week. The treatment period was about 5 months. After 23 injections, mice were sacrificed to complete the study. The test and control antibodies administered in this study are listed in Table 1.

Premature death is a phenotype observed in a model of transgenic mouse tauopathy. The specific model used in this study expresses hyperphosphorylated tau at 6 months of age, although onset variability is high. The mice also suffer from motor defects such as clasping in their hind limbs, have reduced general mobility and die prematurely at the age of 8-11 months (reMYND unpublished data, Tervel et al. , 2005). Mice exhibiting end-stage disease symptoms characterized by a clasping phenotype and the presence of weight loss were sacrificed. An unexpectedly high number of mice died prematurely in the absence of these symptoms. The cause of death in such cases is believed to be unrelated to late tauopathy or test antibodies and instead to be associated with inbred FVB / N background.

Table 2 outlines the overall survival of all mice during the course of this study.

After slaughter, mice were dissected and using a potter-type mechanical homogenizer (VOS 14 S40, speed 750 rpm, VWR), 20 mM Tris-hydrochloride (pH 8.1); 150 mM NaCl; 1 mM ethylenediaminetetraacetic acid (EDTA, Merck). ); 1 mM ethylenediaminetetraacetic acid (EGTA, Sigma-Aldrich); 5 mM sodium pyrophosphate (Sigma); 30 mM sodium fluoride (Sigma-Aldrich); 1 mM PMSF (Sigma); 2 mM vanazine. Sodium acid acid (Sigma); 10 mM 1,10-ortho-phenanthroline monohydrate (Sigma-Aldrich); 5 μg / ml soy trypsin inhibitor; 5 μg / ml peptatin; and proteinase inhibitor buffer (CPI, Roche). The brain stem and midbrain were homogenized in 10 weight volumes of ice-cold trisproteinase-phosphatase-inhibitor buffer (TPPI-buffer) containing Diagnostics Sigma (Germany). A fixed volume (about half of the total volume) of 140 μl and 100 μl of brain stem and midbrain homogenate (TotH), respectively, was centrifuged at 136000 × g for 60 minutes at 4 ° C. (TLA-55 rotor, OptimaTMTLX ultracentrifuge, Beckman Coulter). ), Tris soluble fraction (SF) was prepared and the rest of the total homogenate was stored at −80 ° C. Due to the limited number of centrifuge holders (N = 12), samples were randomized to even out the centrifuge and different treatment groups were divided over different centrifuge sessions.

The supernatant (S1, also referred to as "soluble fraction" or "SF") was separated from the pellet (P1), divided equally and stored at −80 ° C. P1 pellets were solubilized in 10 weight volumes of high salt solution (0.85 M NaCl-containing TPPI buffer) and centrifuged at 20000 xg for 30 minutes at 4 ° C. The obtained high salt pellets (P2) were stored at −80 ° C. The supernatant (S2) is placed in 1% sarcosyl, which is one tenth of 10% sarcosyl, and incubated in a top-over-top rotary tumbler for 60 minutes at room temperature, then at 4 ° C. for 60 minutes. Centrifugation was performed at 136000 × g. The sarcosyl soluble supernatant (S3) was stored at −80 ° C. and sarcosyl insoluble pellets (P3, also referred to as “insoluble fraction” or “IF”) were resuspended in 30 μl TPPI buffer and dispensed. The brainstem fractions of total homogenate (TotH), tris-soluble (SF), and sarcosyl-insoluble (IF) prepared by the above fractionation protocol were used for subsequent polyacrylamide gel electrophoresis and Western blotting analysis.

Polyacrylamide Gel Electrophoresis and Western Blotting For the application of conventional SDS-PAGE and Western blotting, samples are denatured and reduced by incubation at 95 ° C. for 10 minutes to a 7.5% Tris-HCl gel (Criterion). Separation was performed on XT precast gel, 26 well combs, 15 μl, 1.0 mm; Biorad). PVDF-Film (iBlot ™ Gel Transfer Stack, PVDF, Regular, Invitrogen) is dry electrophoretically transferred (dry electrotransfer (iBlot ™ Invitrogen)) and then the membrane is 0 for 30 minutes. It was washed with .4% PFA and then with Tris buffered saline. The membrane was then incubated in Tris buffered saline (TBS, pH 7.6) containing 5% (w / v) skim milk powder and 0.1% (v / v) Tween-20 for 1 hour. The blots were incubated overnight with various anti-tau primary antibodies at the working concentrations shown in Table 3. After washing and incubating with an anti-mouse or anti-rabbit HRP-binding secondary antibody (goat anti-mouse or goat anti-rabbit IgG, DAKO), the blot is subjected to the ECL detection system (SuperSignal West Femto Femto Maximum Sensitivity Substrate). ), Product No. 34096, Thermo Scientific). Images were digitally recorded (VisionWorks Analysis, UVP) at different exposure times and dedicated software (VisionWorks Analysis, UVP) was used for blot analysis. For comparison, intergel reference gels were run and 4 fractions of aliquots were moved on each gel for comparison. Anti-tau primary monoclonal antibodies used for detection include AT100 (Phosphorylated Tau, Thermo Scientific, Dilution 1: 250), AT8 (Phosphorylated Tau, Thermo Scientific, Dilution 1: 500), HT7 (Pantau, Pantau, Pierce, dilution 1: 1000), and 1F5 (epitope unknown to the test facility, Neotope, dilution 3: 500) were included. The blot was reprobed with anti-GAPDH as a loading control (Abcam9485; dilution 1: 2500). Pantau antibodies are not specific for phosphorylated tau.

As shown in FIG. 4, a statistically significant reduction in the amount of tau was observed in the sarcosyl-insoluble brainstem fraction from the animals treated with the 16B5 antibody compared to the animals treated with the 6F10 control antibody. Statistical significance was assessed using Student's t-test, p <0.05. This reduction was observed with both phosphorylated tau-specific antibodies (AT8, upper left panel; AT100, lower left panel; 1F5, upper right panel) and pan-tau antibodies (HT7, lower right panel). Western blots of all homogenates also showed a significant reduction in the ratio of phosphorylated tau to total tau in 16B5 treated animals compared to controls treated with 6F10 antibody when detected with phosphate-specific antibody. See the left panel of FIG. 5 (showing the signal detected by the AT8 anti-phosphorylated tau antibody divided by the signal detected by the HT7 pantou antibody). In contrast, there was no significant change in the ratio of total tau to GAPDH levels in all homogenates of animals treated with 16B5 compared to controls treated with 6F10 antibody. (Shows the signal detected by the HT7 Pantau antibody divided by the signal detected by the GAPDH antibody) See the right panel of FIG. These data provide evidence of reduced levels of non-total tau phosphorylated tau in the homogenate.

Histological analysis Immune tissue using anti-phosphorylated tau antibody in the subthalamic nucleus annex uncertain zone (STH / ZI) and cerebellar insertion nucleus, anterior and posterior, annex lateral cerebellar nucleus (IntA / P / LAT) A chemical analysis was performed. Sagittal vibratome sections (40 μm) were stored at 4 ° C. in PBS containing 0.1% sodium azide until use. With the shown bregma, 8 sections per mouse were free-floating stained with mAb AT8, AT100 or 1F5. Sections were selected for staining with the antibodies shown in Table 4 below. All animal sections selected for a particular staining were randomized for staining and randomization.

Free floating sections were incubated in Netwells ™. The sections were then washed twice with PBS and incubated with 1.5% hydrogen peroxide in PBS and methanol (1: 1) for 20 minutes to remove endogenous peroxidase activity. After washing the section 3 times with PBS (PBST) containing 0.1% Triton X100, the section was blocked in 10% fetal bovine serum (FCS) in PBST for 30 minutes and then in PBST with 10% FCS. They were incubated overnight with primary antibodies AT8 and AT100 (Thermo Scientific) using concentrations of 0.4 μg / ml and 0.05 μg / ml, respectively. After washing, sections are incubated with goat anti-mouse peroxidase-labeled (GAMPO) secondary antibody (DAKO, 1/500 in PBST, 10% FCS) and the signal is signaled with 3,3'-diaminobenzidine tetrachloride (DAB, 10 ml). Color was developed with 10 ml of Tris-HCl (1 tablet) with 3 μl of H ₂ O ₂ per tablet. Sections were counterstained with Meyer's hematoxylin, dehydrated in 5 steps (50, 70, 95 and 2 x 100%) in ethanol and xylene (Merck Eurolab), Depex (Depex mounting medium), BDH Laboratory. ) Mounted.

Images were acquired using an Olympus BX41 microscope equipped with a Color View II Olympus camera and analyzed by computer using AnySIS Five-Cell ^ D software. The light intensity and condenser settings for the microscope were kept constant during the image acquisition process. All acquired images were submitted to the same computer subroutine to minimize investigator prejudice. Density slice thresholding was applied uniformly throughout the analysis.

Regions of interest as defined below were selected for automatic quantification of staining signals (s). The subthalamic nucleus and zona incerta were separated ventral by the cerebral peduncle and dorsal by the white matter, respectively, based on differences in cell density (sagittal cerebellar section, bregma 1,32-1,92). The insertion nucleus, anterior and posterior parts of the cerebellum, and the lateral cerebellum nucleus were separated by changes in white matter and cell density and third ventricle (sagittal cerebellar section, bregma 1,92-2,64 and IntA / for LAT). For P, 0,84-1,8). For each staining, 6 brain sections containing STH / ZI and 16 sections containing IntA / P / LAT per mouse were included in the analysis.

As shown in FIG. 6, the amount of phosphorylated tau detected in the cerebellar nucleus and hypothalamus region of animals treated with 16B5 antibody is the amount of phosphorylated tau detected in the same structure of control animals treated with 6F10 antibody. Significantly decreased compared to. Statistical significance was assessed using Student's t-test, p <0.05.

Humanized sequence analysis of Example 5.16B5 shows that the 16B5 antibody has a variable kappa (Vk) domain that belongs to mouse Kabat subgroup 1 and has the sequence of SEQ ID NO: 16 corresponding to human Kabat subgroup 4. Is done. The Kabat CDR is underlined. The variable heavy chain (Vh) domain of the 16B5 antibody belongs to the mouse Kabat subgroup 2b and has the sequence of SEQ ID NO: 10 corresponding to the human Kabat subgroup 1 (Kabat et al. (1991), of immunological interest. Sequence of a protein (Sequences of Proteins of Immunological Interest), 5th Edition, NIH Publication No. 91-3242). The Kabat CDR is underlined.

The 16B5Vk domain consists of a 17-residue CDR-L1 sequence (KSSQSLLNSRTRKNYLA, SEQ ID NO: 17), a 7-residue CDR-L2 sequence (WASTRES, SEQ ID NO: 18), and an 8-residue CDR-L3 (KQSYTLRT, SEQ ID NO: 19). )including. The CDR-L1 sequence belongs to canonical class 3, and the CDR-L2 and CDR-L3 sequences belong to class 1 (Martin & Toronto (1996), J. Mol. Biol. 263: 800-15).

The 16B5 Vh domain is a 5-residue CDR-H1 sequence based on Kabat numbering (YHGMD, SEQ ID NO: 11) or a 10-residue CDR-H1 sequence based on Kabat and Kothia numbering (GYPFTYHGMD, SEQ ID NO: 24). , 17-residue CDR-H2 sequence (WINTYSGVPTYADDFKG, SEQ ID NO: 12), and 8-residue CDR-H3 sequence (RRDFTMDF, SEQ ID NO: 13). The CDR-H1 sequence belongs to canonical class 1 and the CDR-H2 sequence belongs to class 2 (Martin & Toronto (1996), J. Mol. Biol. 263: 800-15). The CDR-H3 sequence does not have a canonical class, but probably has a twisted base according to the rules of Shirai et al. ((1999), FEBS Lett. 455: 188-97).

Residues at the interface between the Vk and Vh domains are normal residues for these positions in the mouse.

To find a structure that provides a rough structural model for the 16B5 antibody, a search was performed on the protein sequences in the PDB database (Deshpanda et al. (2011), J. Virol. 85: 1820-33). The structure of the anti-cholera toxin antibody Fab fragment Te33 (pdb code 1ZEA_H) was used with a resolution of 1.78 A for VL. It retained the same canonical structure as 16B5 for the loop. The Fab crystal structure in the Dsbb-Fab complex (pdb code 2ZUQ_B) was used to model the VH domain of 16B5. It contained the same canonical structure for CDR-H1 and CDR-H2 when analyzed at a resolution of 3.3A, and also contained the same length of CDR-H3 with a twist base. A rough structure of 16B5 Fv was modeled using the BioLuminate program.

Searching NCBI's non-redundant protein sequence database using the CDR "X" ed 16B5 Fv sequence allowed selection of a suitable human framework for transplanting mouse CDRs. For Vk, NCBI accession code ACJ71718. A human κ light chain having pro was selected (SEQ ID NO: 20). This human kappa light chain sequence has the same canonical class for CDR-L2 and L3. For Vh, human Ig heavy chain BAC02002.1 was selected (SEQ ID NO: 14). It shares the canonical form of 16B5 CDR-H1 and H2, where H3 is 8 residues long with a predicted twist base.

The design of humanized heavy and light chains and the return mutations based on these human frameworks are shown in Tables 5 and 6, respectively.

A humanized 16B5 variable heavy chain (H1) having the sequence of SEQ ID NO: 15 was designed. This design includes three return mutations: R13K, V48M, and Y98F. Since it is more frequent than R in humans, K was selected as the 13th place. Since it is more frequent than V in humans, M was selected for position 48. F was chosen for position 98 because it is located at the interface and it is desirable to retain mouse residues.

Three humanized 16B5 variable light chain sequences were designed:
Version 1 (L1) has the sequence of SEQ ID NO: 21 and contains three return mutations DIN, M4L, and Y36F. N was selected as the 1st position to form a potential hydrogen bond with N61 of HCDR2. Since it comes into contact with K96, Q97 and S98 of LCDR3, L was selected as the 4th position. It also contacts the interface residue F104. Although F cannot be formed, F can be hydrogen-bonded to D106 of HCDR3, so F was selected at the 36th position. Hydrogen bonds constitute extra interactions that can affect HCDR3 function and are therefore preferably avoided.

Version 2 (L2) has the sequence of SEQ ID NO: 22 and contains four return mutations D1N, M4L, Y36F, and P43S. The rationale for D1N, M4L, and Y36F is the same as for version 1. Since S forms a hydrogen bond with Q110 in VH and is close to HCDR3, S was selected as the 43rd position.

Version 3 (L3) has the sequence of SEQ ID NO: 23 and contains three return mutations M4L, Y36F, and P43S. The rationale for each of these mutations is similar to versions 1 and 2.

Example 6. Tau affinity for humanized 16B5 antibody Binding data for humanized 16B5 antibody with H1L1 or H1L2 design is shown in Table 7 below. Binding data for chimera 16B5 are also shown for comparison. Data were obtained using the via core device. It was concluded that version H1L2 has the strongest affinity, which is essentially the same as that of chimera 16B5. Humanized 16B5 versions H1L1 and H1L3 also had sufficient affinity.

Surface plasmon resonance measurement was performed using Viacore T200 (GE Lifesciences). All experiments were transferred at 30 μl / min with 10 mM HEPES pH 7.4, 150 mM NaCl, 0.05% Tween-20 on a CM5 sensor chip prepared by amine binding anti-mouse or anti-human capture antibody. This was done using the phase. Recombinant htau at various concentrations purified by binding 16B5 (chimeric or humanized) to immobilized capture antibody. P301L was applied to the antibody complex in sequential iterations. Repeated steps were separated in high salt or low pH regeneration steps. The experiment was repeated with different preparations of antibody and antigen. The analysis was performed using the on-board viacore software.

Example 7. Immunoprecipitation detection of tau with humanized 16B5 antibody Postmortem samples of the frontal cortex of patients with Alzheimer's disease with a Braak score of 6 were continuously extracted with buffers that increase solubilization capacity in the following order: (i). ) High salt buffer (20 mM Tris, 5 mM EDTA, 1 mM DTT, 10% sucrose, 7500 mM NaCl pH 7.4), (ii) Triton buffer (20 mM Tris, 5 mM EDTA, 1 mM DTT, 10). % Sulose, 1% Triton X100, 500 mM NaCl pH 7.4), (iii) Sarcosyl buffer (10 mM Tris, 5 mM EDTA, 1 mM DTT, 10% Scruth, 500 mM NaCl, 1% Sarcosyl, pH 7. 4).

For each sample, 200 micrograms of high salt soluble fraction, or 20 micrograms of sarcosyl insoluble fraction, 400 microliters of immunoprecipitation buffer (10 mM Tris, 150 mM NaCl, 0.5% Triton X 100, 1 mM). It was diluted to EGTA, 1 mM EDTA, pH 7.4). Samples were pre-cleared with Protein G magnetic beads (New England Biolabs) and 5 micrograms of antibody were added to each tube. Antibodies used include: 1) mouse non-immune IgG antibody (mIgG) as a control; 2) human non-immune IgG antibody (hIgG) as a control; 3) chimeric 16B5 antibody (Chi16B5); 4) Humanized 16B5, version H1L2 (h16B6-H1L2); and humanized 16B5, version H1L3 (h16B6-H1L3). The preclear lysate and antibody were incubated at 4 ° C. for 2 hours. The antibody / antigen complex was precipitated with protein G magnetic beads and the precipitate was thoroughly washed with PBS / 350 mM NaCl. After elution with Laemmli buffer, the eluate was separated by SDS-PAGE and blotted with a polyclonal anti-tau antibody (DAKO).

As shown in FIG. 7, chimeric 16B5 and humanized 16B5 H1L2 and H1L3 recognized tau in both soluble and insoluble fractions from Alzheimer's brain.

Example 8. Immunohistochemical Properties of Mouse and Humanized 16B5 Tau Antibodies in Alzheimer's Disease Brains Mouse monoclonal anti-tau antibody 16B5 and its two humanized variants h16B5-H1L2 and h16B5-N1D are donors and non-affected with Alzheimer's disease. Immunohistochemical tests were also performed on fresh frozen sections of human brain cortex from elderly controls.

Method:
The human brain tissue frontal cortex was obtained from the Sun Health Research Institute. Cases included 6 patients (mean age 86.8 ± 0.40 SEM) diagnosed with Alzheimer's disease and confirmed by postmortem neuropathological evaluation, and 3 unaffected elderly controls (mean age 77). ± 9.7 SEM) was included. The demographic data of the cases are listed in Table 8 below. Immunohistochemistry was performed on 10 μm frozen sections mounted on slides and lightly acetone-fixed.

Immunohistochemistry The immunoperoxidase method is a peroxidase-labeled polymer conjugated to goat anti-mouse immunoglobulin (EnVision + system HRP-labeled polymer; Dako K4001) or a vector ABC amplification system for directly biotinylated humanized antibody (ABC Elite Standard; PK). -6100; Vector Laboratories) was the main detection system. Staining was visualized using DAB chromogen (Liquid DAB + Substrate Dyeogen System; Dako K3468) to produce brown deposits.

Negative controls consisted of using IgG isotype control antibodies or omitting the primary antibody and performing a total immunohistochemical procedure on adjacent sections.

Immunofluorescent labeling Double immunofluorescent staining was performed to determine the relationship between mouse and humanized variants of the antibody and other tau antibodies that recognize various phosphorylated epitopes and amyloid beta. Tissue sections were biotinylated or FITC-tagged humanized 16B5 variants (1 μg / mL) and mouse antibodies (monoclonal 16B5 (1 μg / mL), AT8 (1: 1000), AT100 (1: 1000), or 3D6 (μg). It was stained in parallel with an antibody cocktail containing any of / mL)). Mouse antibodies were detected with goat anti-mouse secondary antibodies conjugated to 488 or 635 fluorophores (Invitrogen). Biotinylated humanized antibody was detected with streptavidin 635.

Pre-absorption To assess the specificity of the antibody against the target antigen, 1 μg / mL 16B5 antibody was pre-absorbed at 4 ° C. overnight with 50 μg / mL purified human P301L tau or wild-type synuclein (unrelated protein). These antibodies were then applied to the tissue and the immunohistochemistry procedure was performed as described above.

Image analysis slides were imaged using either an Olympus BX61 microscope, an Olympus Nanozoomer 2.0HT, or a Leica SPE spectral cofocal system. Images were collected as TIFF files.

Results As shown in Table 9 below, the mouse monoclonal antibody 16B5 and both humanized variants were responsive on Alzheimer's disease tissue, with marked neuropil threading and neurofibrillary tangles (mainly spherical). And some tau-positive amyloid plaques were stained to some extent. Most 16B5AD-fibrous lesions were confined to the gray matter, but some responsiveness was also detected in the white matter. In contrast, non-disease control tissue showed diffusion background responsiveness, but was negative for the pathology detected in AD tissue.

Double-labeled experiments were performed with a mouse monoclonal version of 16B5 and (1) both humanized variants, (2) antibodies that recognize tau at various phosphorylated epitopes, and (3) beta-amyloid. The lesions recognized by the variant were further characterized.

Both h16B5-H1L2 and h16B5-N1D co-localized with the monoclonal 16B5 antibody, which has a high degree of congruence in the AD-fibrilological structure. h16B5-H1L2 is also immune responsive to various phosphorylated tau epitopes including serine 202 and threonine 205 (AT8), serine 212 and threonine 214 (AT100), and serine 396 (tissue-specific antibody, 20H1). We also detected the pathology that was shown to be. Finally, double labeling with 16B5 with an amyloid β antibody that recognizes the N-terminal amino acid sequence (3D6; aa1-5) results in little co-localization between the Aβ structure and the 16B5 immune responsive structure on the amyloid plaque. Was shown.

When the immune responsiveness of 16B5 is compared to a well-characterized commercially available monoclonal anti-tau antibody (Dako), both fibril AD pathologies including tau-positive amyloid plaques, neuropil threads, and neurofibrillary tangles. Was stained.

Antibody specificity was assessed by preabsorption with purified recombinant P301L tau. Decreased staining was observed when 16B5 was pre-absorbed with P301L tau, but staining was unaffected when the antibody was pre-absorbed with an unrelated protein (wild-type synuclein) at the same molar concentration.

Both the IgG isotype control antibody and the omitted section of the primary antibody were negative for staining of all tissue tested.

All publications, patents and patent applications cited (including GenBank accession numbers and UniProtKB / Swiss-Prot accession numbers, etc.) are all individual publications, patents and patent applications in their entirety for all purposes. Incorporated herein by reference in its entirety for all purposes, to the same extent that it is specifically and individually indicated to be incorporated by reference. In the event of any differences in the sequences related to GenBank and UniProt KB / Swiss-Prot accession numbers, etc., this application will be accepted after or after the effective filing date of the application, which means the actual filing date. Disclose the number Refers to the sequence associated with the accession number cited earlier than the date of the priority application. Any feature, process, element, embodiment, or embodiment of the invention may be used in combination with any other, unless otherwise specified. Although the present invention has been described in some detail by way of illustration and examples for clarity and understanding purposes, it will be clear that certain changes and modifications may be made within the appended claims. ..

Claims (9)

A monoclonal antibody that specifically binds to human tau, comprising a mature heavy chain variable region having the amino acid sequence encoded by SEQ ID NO: 25 and a mature light chain variable region having the amino acid sequence of SEQ ID NO: 21 or 23. The antibody according to claim 1 , wherein the mature heavy chain variable region is fused to the heavy chain constant region, and the mature light chain variable region is fused to the light chain constant region. The antibody according to claim 2 , wherein the heavy chain constant region is a variant of the natural human constant region in which binding to the Fcγ receptor is reduced as compared with the natural human constant region. The antibody according to claim 2 or 3 , wherein the heavy chain constant region is an IgG1 isotype. The polynucleotide (s) encoding the heavy and light chains of the antibody according to any one of claims 1 to 4 . The polynucleotide (s) according to claim 5, comprising SEQ ID NO: 25, and SEQ ID NO: 26 or 28. A pharmaceutical composition comprising the antibody according to any one of claims 1 to 4 and a pharmaceutically acceptable carrier. The pharmaceutical composition comprising the antibody according to any one of claims 1 to 4 , for use in a therapeutic method or an effective preventive method for a disease associated with tau, optionally Alzheimer's disease. The heavy chain of the antibody comprises a human IgG1 constant domain having the sequence of SEQ ID NO: 29 with or without C-terminal lysine, and the light chain of the antibody comprising the human kappa constant region having the sequence of SEQ ID NO: 32. The antibody according to any one of claims 1 to 4 .

Images