JP7039897B2 - How to measure histidine - Google Patents

Description

The present invention relates to a method for measuring histidine.

Amino acids are very important as components of living organisms, and it is known that some amino acids can be indicators of health status. For example, histidine is known to be a biomarker for inflammatory bowel diseases such as Crohn's disease and ulcerative colitis, histidineemia, cardiac deficiency, cancer, and lifestyle-related diseases (for example, Patent Document 1). , Non-Patent Documents 1-5). As a method for measuring amino acids, a method using an amino acid analyzer, a method using equipment such as high performance liquid chromatography (HPLC) or LC-MS, a fluorescence analysis method (for example, Patent Document 2), and a method using galactose oxidase (for example, non-patent). Document 6) and the like are known.

International Publication No. 2016/056631 Japanese Unexamined Patent Publication No. 2001-242174

Levy H (2004) "Histidinemia" Orphanet Kawai Y, et al. "Molecular characterization of histidinemia: identification of for missense mutations in the histidase gene" Hum Genet. 116,340-346,2005 Ikunosuke Sakurabayashi, supervised by Kazunari Kumasaka (2008) Latest Clinical Examination Item Dictionary Ishiyaku Publications, Inc., pp. 205 Hisamatus T, et al. PLoS One. 2012; 7 (1) Miyagi Y, et al. PLoS One. 2011; 6 (9): e24143 Hasebe Y, et al. Sensors and Actuators B 66 (2000) 12-15

However, conventional methods require the use of large and expensive equipment, and also require specialized knowledge and proficiency in the maintenance and operation of the equipment, resulting in high costs for installation, maintenance and use. Further, in principle, it is necessary to analyze each sample sequentially, so that it takes a long time to analyze a large number of samples. According to the method using galactose oxidase (Non-Patent Document 6), histidine can be easily measured, but since it is affected by galactose in the biological sample and shows a reaction to histamine, it is contained in the biological sample. It is not suitable for the specific measurement of histidine.

An object of the present invention is to provide a method for measuring histidine suitable for practical use.

The present invention provides the following inventions.
[1] A method for measuring histidine in a test sample using histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme.
[2] The method according to [1], wherein histidine decarboxylase is allowed to act on the test sample, and then 4-imidazolyl acetaldehyde-producing enzyme is allowed to act on the test sample.
[3] The method according to [1] or [2], wherein the 4-imidazolyl acetaldehyde-producing enzyme is at least one selected from the group consisting of histamine dehydrogenase and histamine oxidase.
[4] In any one of [1] to [3], the histidine decarboxylase is one or more proteins selected from the group consisting of the following (A), (B) and (C). The method described.
(A) A protein containing the amino acid sequence represented by SEQ ID NO: 3;
(B) A protein containing an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 3 and having histidine decarboxylase activity;
(C) A protein containing an amino acid sequence in which one or several amino acids are deleted, substituted, added or inserted in the amino acid sequence represented by SEQ ID NO: 3 and having histidine decarboxylase activity.
[5] The method according to any one of [1] to [4], wherein the histidine decarboxylase is derived from a bacterium belonging to the genus Photobacterium.
[6] The method according to [5], wherein the bacterium belonging to the genus Photobacterium is Photobacterium phosphorium.
[7] The method according to any one of [1] to [6], which uses a transformant that produces histidine decarboxylase.
[8] The transformant is a host cell containing an expression unit containing one or more polynucleotides selected from the group consisting of the following (a), (b), (c) and (d). 7] The method described in.
(A) A polynucleotide containing the base sequence represented by SEQ ID NO: 1;
(B) A polynucleotide containing a degenerate variant of the base sequence represented by SEQ ID NO: 1;
(C) A polynucleotide comprising a base sequence having 90% or more identity with the base sequence represented by SEQ ID NO: 1 or a degenerate variant thereof, and encoding a protein having histidine decarboxylase activity; and (d). ) A poly that encodes a protein that hybridizes under stringent conditions with a polynucleotide consisting of the base sequence represented by SEQ ID NO: 1 or a base sequence complementary to the degenerate variant thereof, and has histidine decarboxylase activity. nucleotide.
[9] The method according to [8], wherein the host is a bacterium belonging to the genus Escherichia.
[10] The method according to [8] or [9], wherein the host is Escherichia coli.
[11] The item according to any one of [3] to [10], wherein the histamine oxidase is one or more proteins selected from the group consisting of the following (D), (E) and (F). the method of.
(D) A protein containing the amino acid sequence represented by SEQ ID NO: 8;
(E) A protein containing an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 8 and having histamine oxidase activity;
(F) A protein containing an amino acid sequence in which one or several amino acids are deleted, substituted, added or inserted in the amino acid sequence represented by SEQ ID NO: 8 and having histamine oxidase activity.
[12] The method according to any one of [3] to [10], wherein the histamine oxidase is derived from a bacterium belonging to the genus Arthrobacter.
[13] The method according to [12], wherein the bacterium belonging to the genus Arthrobacter is Arthrobacter crystallopoetes.
[14] The method according to any one of [3] to [10], wherein the histamine oxidase is produced by the transformant.
[15] The transformant is a host cell containing an expression unit containing one or more polynucleotides selected from the group consisting of the following (e), (f), (g) and (h). 14].
(E) A polynucleotide containing the base sequence represented by SEQ ID NO: 6;
(F) A polynucleotide containing a degenerate variant of the base sequence represented by SEQ ID NO: 6;
(G) A polynucleotide comprising a base sequence having 90% or more identity with the base sequence represented by SEQ ID NO: 6 or a degenerate variant thereof, and encoding a protein having histamine oxidase activity; and (h). A polynucleotide encoding a protein that hybridizes under stringent conditions with a nucleotide having a base sequence represented by SEQ ID NO: 6 or a base sequence complementary to a degenerate variant thereof, and has histamine oxidase activity.
[16] The method according to [15], wherein the host is a bacterium belonging to the genus Escherichia.
[17] The method according to [15] or [16], wherein the host is Escherichia coli.
[18] At least one selected from the group consisting of 4-imidazolyl acetaldehyde, a reduced electron donor, ammonia and hydrogen peroxide in a test sample after the action of histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme. The method according to any one of [1] to [17], wherein the method is measured.
[19] A kit for measuring histidine, which comprises histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme.
[20] The kit according to [19], further comprising at least one of a reaction buffer or buffer, a 4-imidazolyl acetaldehyde detection reagent, a hydrogen hydrogen detection reagent, an ammonia detection reagent and a reduced electron donor reagent.
[21] A detection system for measuring histidine, which comprises a device, histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme.
[22] The device further comprises at least one of a reaction buffer or buffer, 4-imidazolyl acetaldehyde detection reagent, hydrogen peroxide detection reagent, ammonia detection reagent and reduced electron donor detection reagent, and the device is a microchannel chip. The detection system according to [21].
[23] An enzyme sensor for measuring histamine, which comprises a detection electrode and a histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme fixed or placed on the detection electrode.
[24] If the amount of histamine in the test sample measured by the method according to any one of [1] to [17] is lower than the reference amount, the subject has ulcerative colitis or cardiac illness. Ulcerative colitis, which is determined to have a lifestyle-related disease or cancer, and if the amount of histamine in the test sample is higher than the standard amount, the subject is determined to have histamineemia. , Cardiovascular disease, lifestyle-related disease, cancer or histidineemia.
[25] The amount of histamine in the test sample of the subject in remission of ulcerative colitis measured by the method according to any one of [1] to [17] is lower than the standard amount. For example, the subject is judged to have a high risk of relapse of inflammatory bowel disease, and if the amount of histamine in the test sample is higher than the standard amount, the subject is judged to have a low risk of relapse. ..

According to the present invention, histidine can be measured accurately, in a short time, easily and inexpensively.

FIG. 1 is a calibration curve for each concentration of histidine when histidine oxidase (HOX) is added after reacting histidine decarboxylase (HisDC) with histidine. FIG. 2 is a calibration curve for each concentration of histidine when HisDC and histidine and histamine dehydrogenase are added at the same time. FIG. 3 is a graph showing the specific activity for each amino acid when the absorbance value at the time of measuring histidine is 100. FIG. 4 is a graph showing the quantified values of histidine in human plasma obtained using HisDC and HOX and the quantified values of other devices, respectively. FIG. 5 is a calibration curve for each concentration of histidine when HOX is added after reacting HisDC with histidine. FIG. 6 is a graph showing the quantified values of histidine in human plasma obtained using HisDC and HOX and the quantified values of other devices, respectively.

In the present invention, histidine decarboxylase and 4-imidazole acetaldehyde-producing enzyme are used for the measurement of histidine in the test sample. Usually, the test sample is allowed to act on histidine decarboxylase, followed by 4-imidazolyl acetaldehyde-producing enzyme.

Histidine decarboxylase (HisDC; EC 4.1.1.22) is an enzyme that converts histidine to histamine. The histidine decarboxylase preferably acts specifically on histidine and preferably exhibits activity near neutrality. Moreover, it preferably does not require an auxiliary protein.

The 4-imidazolyl acetaldehyde-producing enzyme is an enzyme that produces 4-imidazolyl acetaldehyde from histamine, and examples thereof include histamine dehydrogenase and histamine oxidase. Histamine dehydrogenase (HisDH; EC 1.4.99) is an enzyme that produces 4-imidazolyl acetaldehyde from histamine, preferably 4-imidazolyl by oxidative deaminolysis of histamine in the presence of a receptor. It is an enzyme that converts to acetaldehyde. Histamine oxidase (EC 1.4.3.22) is an enzyme that produces 4-imidazolyl acetaldehyde from histamine, water and oxygen. As the histamine dehydrogenase, a histamine dehydrogenase that specifically acts on histamine (for example, substantially does not act on other amines such as cadaverine and putrescine) is preferable. The histamine oxidase is preferably a histamine oxidase that acts specifically on histamine (eg, it does not substantially act on other amino acids such as tryptophan, arginine, proline).

Each enzyme is not particularly limited as long as it is an enzyme capable of exerting the above activity. Examples of histidine decarboxylase include Photobacterium genus bacteria (for example, Photobacterium phosphorium, Photobacterium damsela), Morganella genus bacteria (for example, Morganella morgani). Bacteria of the genus (eg, Klebsiella oxytoca), Bacteria of the genus Streptococcus (eg, Streptococcus thermophiles), Bacteria of the genus Lactobacillus (eg, Lactobacillus 30a (Lactobacillus) lactobacillus 30a, Lactobacillus sac Lactobacillus hilgadii, Lactobacillus buchneri, Bacteria of the genus Oenococcus (eg, Oenococcus oeni), bacteria of the genus Tetragenoccus ), Tetragenococcus halophilus, etc.), Clostridium sp. , Staphylococcus spp. (For example, Staphylococcus capitis, etc.), Laoultera spp. (For example, Laoultella planticola, etc.), Enterobactor spp. (Interobacter aerogenes)) and the like (Molecular Microbiology (2011) 79 (4), 861-871, J Apple Microbiol. 2008 104 (1): 194-203) can be mentioned. Among the above-mentioned bacteria, a bacterium belonging to the genus Photobacterium is preferable, and Photobacterium phosphorium is more preferable.

Examples of the histamine dehydrogenase include the histamine dehydrogenase described in Japanese Patent No. 3782621; the clinical diagnostic medicinal enzyme “histamine dehydrogenase” manufactured by Kikkoman Biochemifa Co., Ltd .; (Nocardioides simplex), etc.), Arthrobacter bacterium (eg, Arthrobacter globiformis, etc.) and other bacterial histamine dehydrogenase (FEMS Microbiology Letters 189 (2000) 183-18) Among EC 1.4.2), those that act on histamine can be mentioned. Examples of the amine dehydrogenase include Pseudomonas sp. Freundii), Alcaligenes spp. (For example, Alcaligenes faecalis).

Examples of the histamine oxidase include Arthrobacter bacterium (eg, Arthrobacter crystallopoiets: Talanta 77 (2009) 1185-1190), Arthrobacter globiformis. 97 (2004): 104-10), etc.), Bacteria of the genus Aspergillus (eg, Aspergillius niger: J Biosci Bioeng. 97 (2004): 104-10), etc.), Alcaligenes xylosoxins: Bacterial-derived histamine oxidases such as JP-A-2003-61650) can be mentioned.

Each enzyme may be a protein having each enzyme activity. Hereinafter, the protein of histidine decarboxylase and the histamine oxidase will be described in order by taking as an example.

[Histidine decarboxylase protein]
Examples of the protein of histidine decarboxylase include the following protein (A): (A) a protein containing the amino acid sequence represented by SEQ ID NO: 3. The protein (A) is a histidine decarboxylase derived from Photobacterium phosphorium.

Other examples of the histidine decarboxylase protein include proteins homologous to the protein of (A), with the following protein of (B) being preferred:
(B) A protein containing an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 3 and having histidine decarboxylase activity.

The% identity with the amino acid sequence may be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more.

The homology (ie, identity or similarity) between the amino acid sequence described above and the base sequence described below is, for example, the algorithm BLAST (Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)) by Karlin and Altschul, Pearson. It can be determined using FASTA (Idents Enzymol., 183, 63 (1990)) according to the above. Since programs called BLASTP and BLASTN have been developed based on this algorithm BLAST (see http://www.ncbi.nlm.nih.gov/), these programs are used in the default settings and are homologous. May be calculated. For homology, for example, using the software GENETYX Ver 7.0.9 of Genetics Co., Ltd., which employs the Lipman-Pearson method, and using the total length of the polypeptide portion encoded by the ORF, Unit Size to Compare You may use the numerical value at the time of performing percentage calculation of Similarity with the setting of = 2. Alternatively, homology was obtained in the NEEDLE program (J Mol Biol 1970; 48: 443-453) search using the parameters of the default settings (Gap penalty = 10, Extension penalty = 0.5, Matrix = EBLOSUM62). It may be a value (Identity). As the homology, the lowest value among the values derived from these calculations may be adopted.

Yet another example of the histidine decarboxylase protein is a modified protein of the protein of (A), with the following protein of (C) being preferred:
(C) A protein containing an amino acid sequence in which one or several amino acids are deleted, substituted, added or inserted in the amino acid sequence represented by SEQ ID NO: 3 and having histidine decarboxylase activity.

In the above protein, one or several amino acid residues can be modified by 1, 2, 3 or 4 mutations selected from the group consisting of deletion, substitution, addition and insertion of amino acid residues. Mutations in amino acid residues may be introduced into one region of the amino acid sequence, or may be introduced into a plurality of different regions. The term "one or several" indicates a number that does not significantly impair the activity of the protein. The number indicated by the term "1 or several" is, for example, 1 to 100, preferably 1 to 80, more preferably 1 to 50, 1 to 30, 1 to 20, 1 to 10 or 1 to 5 (eg, 1, 2, 3, 4, or 5).

Amino acid residues that are the subject of mutations such as substitutions, deletions, insertions, additions, etc. are usually the naturally occurring L-α-amino acids, L-alanine (A), L-aspartin (N), L-cysteine ( C), L-glutamine (Q), L-isoleucine (I), L-leucine (L), L-methionine (M), L-phenylalanine (F), L-proline (P), L-serine (S) ), L-threonine (T), L-tryptophane (W), L-tyrosine (Y), L-valine (V), L-aspartic acid (D), L-glutamic acid (E), L-arginine (R) ), L-histidine (H), or L-lysine (K), or glycine (G). If the mutation is a substitution, addition or insertion, the amino acid residue substituted, added or inserted is similar to the mutated amino acid residue described above. Hereinafter, in the notation of amino acids, L and α may be omitted.

In the amino acid sequence of SEQ ID NO: 3, 90% or more identity with respect to the amino acid sequence containing substitution, deletion, insertion, or addition of one or several amino acid residues, and the amino acid sequence represented by SEQ ID NO: 3. The position of the amino acid residue into which a mutation can be introduced into the amino acid sequence represented by SEQ ID NO: 3 for the preparation of the amino acid sequence having is clear to those skilled in the art, for example, with reference to the alignment of the amino acid sequence. Mutations can be introduced. Specifically, those skilled in the art will 1) compare the amino acid sequences of multiple homologs (eg, the amino acid sequence represented by SEQ ID NO: 3 and the amino acid sequences of other homologs) and 2) be relatively conserved. Areas that are and are relatively unconserved, and then 3) areas that can play an important role in function from relatively conserved and relatively unconserved areas, respectively. And since it is possible to predict areas that cannot play an important role in function, it is possible to recognize the correlation between structure and function. Therefore, those skilled in the art determine an amino acid sequence into which a mutation of one or more amino acid residues is introduced so as to improve the histidine decarboxylase activity of the amino acid sequence after introduction of the mutation in the amino acid sequence of SEQ ID NO: 3. be able to.

In the amino acid sequence represented by SEQ ID NO: 3, 90% or more of the amino acid sequence containing substitution, deletion, insertion, or addition of one or several amino acid residues, and the amino acid sequence represented by SEQ ID NO: 3 In order to prepare an amino acid sequence having the same identity as above, when a mutation of an amino acid residue is introduced into the amino acid sequence represented by SEQ ID NO: 3 and the mutation of the amino acid residue is a substitution, the amino acid residue of the amino acid residue is introduced. Such substitutions may be conservative substitutions. As used herein, the term "conservative substitution" means replacing a given amino acid residue with an amino acid residue having a similar side chain. A family of amino acid residues with similar side chains is well known in the art. For example, such families include amino acids with basic side chains (eg, lysine, arginine, histidine), amino acids with acidic side chains (eg, aspartic acid, glutamate), amino acids with uncharged polar side chains. (Eg, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (eg, glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chain Amino acids with (eg, threonine, valine, isoleucine), amino acids with aromatic side chains (eg, tyrosine, phenylalanine, tryptophan, histidine), amino acids with hydroxyl groups (eg, alcoholic, phenolic) (eg, alcoholic, phenolic) Examples include amino acids with serine, threonine, tyrosine), and sulfur-containing side chains (eg, cysteine, methionine). Amino acids having uncharged polar side chains and amino acids having non-polar side chains are collectively referred to as neutral amino acids. Preferably, the conservative substitution of amino acids is between aspartic acid and glutamic acid, between arginine and lysine and histidine, between tryptophan and phenylalanine, between phenylalanine and valine. , Substitution between leucine and isoleucine and alanine, and substitution between glycine and alanine.

When the proteins (B) and (C) are measured under the same conditions, 50% or more, 60% or more, 70% or more, 80% or more, 90% of the histidine decarboxylase activity of the protein of the above (A). It is preferable to have the above or 95% or more activity.

The protein of histidine decarboxylase may be a fusion protein linked to a heterologous moiety via a peptide bond. Such heterologous moieties include, for example, peptide components that facilitate purification of the protein of interest (eg, tag moieties such as histidine tag, Strep-tag II; purification of the protein of interest such as glutathione-S-transferase, maltose binding protein, etc. (E.g., protein used in), peptide component (eg, Nus-tag) that improves the solubility of the target protein, peptide component that acts as a chapelon (eg, trigger factor), peptide component with other functions (eg, full-length protein or its). Some), as well as linkers.

The histidine decarboxylase protein can also be a post-translational modified (eg, glycosylation) protein or a post-translational unmodified (eg, non-glycosylated) protein, depending on the type of host cell in which the protein is desired to be produced. There may be. In prokaryotes, proteins are not post-translated, and in animal cells, plant cells, insect cells (eg, Sf9 cells), and lower eukaryotes (eg, yeast), post-translational modifications of proteins differ significantly. Is generally known [eg, Bretthauer et al. , Biotechnol. Apple. Biochem. (1999), 30 (19), 3-200]. Therefore, it is believed that when naturally derived plant cell-derived proteins are produced in such heterologous host cells, post-translational unmodified proteins or proteins with different post-translational modifications that cannot occur in nature can be obtained. Be done.

Examples of the histidine decarboxylase protein as described above include proteins derived from Photobacterium phosphorium, naturally occurring homologues thereof, or artificially produced mutant proteins. The mutant protein can be obtained, for example, by introducing a mutation into the DNA encoding the target protein and producing the mutant protein using the obtained mutant DNA. Mutagenesis methods include, for example, site-specific mutagenesis and random mutagenesis treatments (eg, treatment with mutagens, and UV irradiation).

[Histamine oxidase protein]
Examples of the histamine oxidase protein include the following protein (D): (D) a protein comprising the amino acid sequence represented by SEQ ID NO: 8. The protein (D) is a histamine oxidase derived from Arthrobacter crystallopoides.

Other examples of histamine oxidase proteins include proteins homologous to protein (D), with the following protein (E) being preferred:
(E) A protein containing an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 8 and having histamine oxidase activity.
The% identity with the amino acid sequence, each example of the method for determining the homology of the sequence, and preferable examples are the same as those already described for the protein of histidine decarboxylase.

Yet another example of the histamine oxidase protein is a modified protein of the protein (D), with the following protein (F) being preferred:
(F) A protein containing an amino acid sequence in which one or several amino acids are deleted, substituted, added or inserted in the amino acid sequence represented by SEQ ID NO: 8 and having histamine oxidase activity.
Examples of the number of mutations (deletion, substitution, addition and insertion), introduction site, type of amino acid residue to be mutated, selection of introduction position, and preferable examples are about the description of the protein of histidine decarboxylase. It is the same as the one already mentioned.

When the proteins (E) and (F) are measured under the same conditions, the histamine oxidase activity of the protein (D) is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more. Alternatively, it preferably has an activity of 95% or more.

The protein of histamine oxidase may be a fusion protein linked to a heterologous moiety via a peptide bond, or may be a post-translational modification (eg, glycosyl) depending on the type of host cell in which the protein is desired to be produced. It may be a protein (eg, non-glycosylated) protein after translation. Examples of heterologous moieties are similar to those already described for the description of the protein of histidine decarboxylase.

Examples of the histamine oxidase protein as described above include proteins derived from Arthrobacter crystallopoides, naturally occurring homologues thereof, or artificially produced mutant proteins. The mutant protein can be obtained, for example, by introducing a mutation into the DNA encoding the target protein and producing the mutant protein using the obtained mutant DNA. Mutagenesis methods include, for example, site-specific mutagenesis and random mutagenesis treatments (eg, treatment with mutagens, and UV irradiation).

In the present invention, a natural protein or a recombinant protein can be used as the histidine decarboxylase and the 4-imidazolyl acetaldehyde-producing enzyme, respectively. Recombinant proteins can be obtained, for example, using cell-free vectors or from transformants that produce each enzyme. Further, in the present invention, each enzyme itself may be used, but a transformant producing histidine decarboxylase or a transformant producing 4-imidazolyl acetaldehyde-producing enzyme may be used.

A transformant that produces histidine decarboxylase is a host cell capable of producing histidine decarboxylase or expressing a polynucleotide encoding histidine decarboxylase to produce histidine decarboxylase, eg, histidine decarboxylase. A host cell containing an expression unit containing a polynucleotide encoding a carbonate enzyme. A transformant producing a 4-imidazolyl acetaldehyde-producing enzyme is a host cell capable of producing such an enzyme, or expressing a polynucleotide encoding such an enzyme and producing such an enzyme, for example, 4-imidazolyl. A host cell containing an expression unit containing a polynucleotide encoding an acetaldehyde-producing enzyme. Hereinafter, the transformants will be described in order by taking histidine decarboxylase and histamine oxidase as examples.

[Polynucleotide encoding histidine decarboxylase]
Examples of the polynucleotide encoding histidine decarboxylase include the polynucleotides encoding the proteins (A) to (C) described above, and the polynucleotides described below are preferable.

Examples of the polynucleotide encoding histidine decarboxylase include (a) a polynucleotide containing the base sequence of SEQ ID NO: 1. The base sequence of SEQ ID NO: 1 encodes the amino acid sequence of SEQ ID NO: 3. The base sequence of SEQ ID NO: 1 corresponds to cDNA. This is because the polynucleotide (a) is derived from the prokaryote Photobacterium phosphorium. Therefore, the polynucleotide (a) and the polynucleotides (b) to (d) described later are not naturally occurring polynucleotides.

As used herein, the term "start codon" refers to a codon that specifies the initiation of protein synthesis. Starting codons include, for example, a codon encoding a methionine residue (eg, AUG), a codon encoding a valine residue (eg, GUG), a codon encoding an isoleucine residue (eg, AUA), and a leucine residue. The codon encoding the methionine residue (eg, UUG) is mentioned, but the codon encoding the methionine residue (eg, AUG) is preferable. When the polynucleotide of the present invention is RNA, the nucleotide residue "U" should be utilized as described above, but when the polynucleotide of the present invention is DNA, "T" is used instead of the nucleotide residue "U". Should be used.

Yet another example of the polynucleotide encoding histidine decarboxylase is decarboxylated polynucleotide, the polynucleotide of (b) below being preferred:
(B) A polynucleotide containing a degenerate variant of the polynucleotide of (a).

As used herein, the term "degenerate variant" means that at least one codon encoding a given amino acid residue in a pre-mutated polynucleotide is another codon encoding the same amino acid residue. A polynucleotide variant modified to. Since such a degenerate variant is a variant based on a silent mutation, the protein encoded by the degenerate variant is the same as the protein encoded by the polynucleotide before the mutation.

Preferably, the degenerate variant is a polynucleotide variant whose codons have been modified to match the codon usage frequency of the host cell into which it should be introduced. When a gene is expressed in a heterologous host cell (eg, microorganism), different codon usage causes insufficient supply of the corresponding tRNA molecular species, resulting in reduced translation efficiency and / or inaccurate translation (eg, translation). Stop) may occur. For example, in Escherichia coli, the low frequency codons shown in Table 1 are known.

Therefore, in the present invention, degenerate mutants suitable for the codon usage frequency of host cells (eg, microorganisms) as described later can be utilized. For example, a degenerate variant has a modified codon that encodes one or more amino acid residues selected from the group consisting of arginine residues, glycine residues, isoleucine residues, leucine residues, and proline residues. May be. More specifically, the degenerate variant of the invention comprises one or more codons selected from the group consisting of low frequency codons (eg, AGG, AGA, CGG, CGA, GGA, AUA, CUA, and CCC). It may be modified. Preferably, the degenerate variant may include changes in the codons of one or more (eg, 1, 2, 3, 4, or 5) selected from the group consisting of:
i) Change of at least one codon selected from the group consisting of four codons encoding Arg (AGG, AGA, CGG, and CGA) to another codon (CGU, or CGC) encoding Arg;
ii) Change of one codon (GGA) encoding Gly to another codon (GGG, GGU, or GGC);
iii) Change of one codon (AUA) encoding Ile to another codon (AUU, or AUC);
iv) Change of one codon (CUA) encoding Leu to another codon (UUG, UUA, CUG, CUU, or CUC); and v) of one codon (CCC) encoding Pro. Change to another codon (CCG, CCA, or CCU).

If the degenerate mutant is RNA, the nucleotide residue "U" should be used as described above, but if the degenerate mutant is DNA, "T" is used instead of the nucleotide residue "U". It should be. The number of nucleotide residue mutations to be adapted to the codon usage frequency of the host cell is not particularly limited as long as it encodes the same protein before and after the mutation, but is, for example, 1 to 500, 1 to 400, 1 to 300. 1 to 200 pieces, or 1 to 100 pieces.

Identification of low-frequency codons can be easily performed based on any host cell type and genomic sequence information by utilizing techniques known in the art. Thus, degenerate variants may include changes of low frequency codons to non-low frequency codons (eg, high frequency codons). In addition, since a method for designing a mutant in consideration of factors such as compatibility with the genomic GC content of the producing strain as well as low-frequency codons is known (Alan Vilalobos et al., Gene Designer: a syndrome). Biology tool for codontactic artificial DNA genes, BMC Bioinformatics. 2006 Jun 6; 7: 285.), Such a method may be utilized. As described above, the above-mentioned mutant can be appropriately produced depending on the type of any host cell (eg, a microorganism described later) into which the above-mentioned mutant can be introduced, and for example, a host commonly used for fermentative production of heterologous proteins. It may be made to suit the type of cell. Host cells commonly used for fermentative production of heterologous proteins include, for example, any microorganism described below, but bacteria and yeast are preferred. Examples of such bacteria and yeast include bacteria belonging to the genus Bacillus such as Bacillus subtilis, bacteria belonging to the genus Corynebacterium such as Corynebacterium glutamicum, and Escherichia corynebacterium. Bacteria of the genus Escherichia such as Eschericia coryne, Bacteria of the genus Pantoea such as Pantoea ananatis, Enterobacter aerogenes, Enterobacter aerogenes, Enterobacter aerogenes, etc. (Saccharomyces cerevisiae) and the like (Saccharomyces), and Schizosaccharomyces pombe (Schizosaccharomyces pombe) and the like. Therefore, it is preferable to consider factors such as change of low frequency codons to non-low frequency codons in such microorganisms (eg, bacteria, yeast) and genomic GC content compatibility.
Examples of the polynucleotide (b) include a polynucleotide containing the base sequence represented by SEQ ID NO: 2. The base sequence represented by SEQ ID NO: 2 is a degenerate variant of the base sequence represented by SEQ ID NO: 1, and the codon in SEQ ID NO: 1 is a base sequence modified in consideration of expression in Escherichia coli.

Other examples of the polynucleotide encoding histidine decarboxylase include the polynucleotide represented by SEQ ID NO: 1 or the homologous polynucleotide of its degenerate variant thereof, and the polynucleotide of (c) below is preferred:
(C) A nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 1 or a degenerate variant thereof (preferably the nucleotide sequence represented by SEQ ID NO: 2), and histidine decarboxylase. A polynucleotide encoding an active protein.

The% identity with the base sequence may be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more.

Still other examples of the polynucleotide encoding histidine decarboxylase include the polynucleotide represented by SEQ ID NO: 1 or an analog polynucleotide of a demultiplexed variant thereof, and the polynucleotide of (d) below is preferable. :
(D) Hybridization under stringent conditions with a polynucleotide having a base sequence complementary to the base sequence represented by SEQ ID NO: 1 or a degenerate variant thereof (preferably the base sequence represented by SEQ ID NO: 2). And a polynucleotide encoding a protein with histidine decarboxylase activity.

As used herein, the term "stringent condition" refers to a condition in which a so-called specific hybrid is formed and no non-specific hybrid is formed. For example, stringent conditions include hybridization in 6 x SSC (sodium chloride / sodium citrate) at about 45 ° C, followed by 0.2 x SSC in 0.1% SDS at 50-65 ° C. 1 or 2 or more washes of.

An expression unit containing a polynucleotide encoding a histidine decarboxylase is an expression of a protein encoded by the polynucleotide, including the polynucleotide and a promoter operably linked to it (eg, homologous promoter, heterologous promoter). A unit that enables. Examples of the host cell containing an expression unit containing a polynucleotide encoding histidine decarboxylase include a host cell containing an expression vector containing a polynucleotide encoding histidine decarboxylase.

The expression vector may contain a polynucleotide encoding histidine decarboxylase, and examples thereof include a cell-based vector that expresses a protein in a host and a cell-free vector that utilizes a protein translation system. The expression vector may also be a plasmid, viral vector, phage, integrated vector, or artificial chromosome. The integrated vector may be a type of vector that is entirely integrated into the genome of the host cell. Alternatively, only a portion of the integrated vector (eg, an expression unit comprising the polynucleotide of the invention encoding the histidine decarboxylase of the invention and a promoter operably linked to it) is in the genome of the host cell. It may be a vector of the type to be incorporated. The expression vector may further be a DNA vector or an RNA vector.

In addition to the polynucleotide encoding histidine decarboxylase, the expression vector further extends to regions such as regions encoding promoter, terminator and drug (eg, tetracycline, ampicillin, kanamycin, hyglomycin, phosphinoslicin) resistance genes. It may be included. The expression vector may be a plasmid or an integrated vector. The expression vector may be a viral vector or a cell-free vector. The expression vector may contain a polynucleotide encoding another peptide component that can be added to histidine decarboxylase at the 3'or 5'end side with respect to the polynucleotide encoding histidine decarboxylase. Examples of the polypeptide encoding other peptide components include a polypeptide encoding a peptide component that facilitates purification of the target protein as described above, and a peptide component that improves the solubility of the target protein as described above. Examples thereof include a polypeptide, a polypeptide encoding a peptide component acting as a chapelon, a protein having another function, a domain of a protein, or a polynucleotide encoding a peptide component as a linker connecting them. Various expression vectors are available, including polynucleotides encoding other peptide components. Therefore, such an expression vector may be used to prepare an expression vector containing a polynucleotide encoding a histidine decarboxylation enzyme. For example, an expression vector containing a polynucleotide encoding a peptide component that facilitates purification of the target protein (eg, pET-15b, pET-51b, pET-41a, pMAL-p5G), a peptide component that improves the solubility of the target protein. Expression vectors containing polynucleotides encoding (eg, pET-50b), expression vectors containing polynucleotides encoding peptide components acting as chaperones (eg, pCold TF), proteins with other functions or domains of proteins or theirs. An expression vector containing a polynucleotide encoding a peptide component as a linker to connect with can be used. The expression vector may include a region encoding a cleavage site by a protease between a polynucleotide encoding a histidine decarboxylation enzyme and a polynucleotide encoding another peptide component. This allows cleavage of histidine decarboxylase with other peptide components added to it after protein expression.

The host cell containing an expression unit containing a polynucleotide encoding histidine decarboxylase is not particularly limited as long as it can express histidine decarboxylase. The host cell may be homologous or heterologous to the histidine decarboxylase and the polynucleotide encoding it, but is preferably heterologous. The host cell may also be homologous or heterologous to the promoter, but is preferably heterologous. Host cells include, for example, animal cells, plant cells, insect cells, and microorganisms, with microorganisms being preferred. Examples of the microorganisms include Escherichia bacteria such as Escherichia coli, Corynebacterium bacteria [eg, Corynebacterium glutamicum], and Bacillus bacteria [eg, Bacillus subtilis. )] And other prokaryotic cells, Saccharomyces cerevisiae [eg, Saccharomyces cerevisiae], Pichia bacterium [eg, Pichia stippitis], Aspergillus bacterium [eg, Aspergillus (Aspirillus oryzae)] and various other eukaryotic cells can be used. As the host, a strain lacking a predetermined gene may be used. Examples of the transformant include a transformant having an expression vector in the cytoplasm and a transformant having a target gene introduced into the genome.

The introduction (transformation) of the expression vector into which the gene is incorporated into the host can be performed by using a conventionally known method. For example, a competent cell method using calcium-treated cells, an electroporation method, and the like can be mentioned. In addition to the plasmid vector, a phage vector may be used to infect and introduce the cells into the cells.

[Polynucleotide encoding histamine oxidase]
Examples of the polynucleotide encoding histamine oxidase include the polynucleotides encoding the proteins (D) to (F) described above, and the polynucleotides described below are preferable.

Examples of the polynucleotide encoding histamine oxidase include (e) a polynucleotide containing the base sequence represented by SEQ ID NO: 6. The base sequence of SEQ ID NO: 6 encodes the amino acid sequence of SEQ ID NO: 8. The base sequence of SEQ ID NO: 6 corresponds to cDNA. This is because the polynucleotide (e) is derived from the prokaryote Arthrobacter crystallopoetes. Therefore, the polynucleotide (e) and the polynucleotides (f) to (h) described later are not naturally occurring polynucleotides.

Yet another example of the polynucleotide encoding histamine oxidase is degenerate polynucleotide, the polynucleotide of (f) below being preferred:
(F) A polynucleotide containing a degenerate variant of the polynucleotide of (e).
Examples of the polynucleotide (f) include a polynucleotide containing the base sequence represented by SEQ ID NO: 7. The base sequence represented by SEQ ID NO: 7 is a degenerate variant of the base sequence represented by SEQ ID NO: 6, and the codon in SEQ ID NO: 6 is a base sequence modified in consideration of expression in Escherichia coli.

Other examples of the polynucleotide encoding histamine oxidase include the polynucleotide represented by SEQ ID NO: 6 or the homologous polynucleotide of a degenerate variant thereof, and the polynucleotide of (g) below is preferable:
(G) A nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 6 or a degenerate variant thereof (preferably the nucleotide sequence represented by SEQ ID NO: 7), and histidine decarboxylase. A polynucleotide encoding an active protein.
Examples of% identity with the base sequence and preferred examples are the same as those already described for histidine decarboxylase.

Still other examples of the polynucleotide encoding histamine oxidase include the polynucleotide represented by SEQ ID NO: 6 or the analog polynucleotide of a degenerate variant thereof, and the polynucleotide of (h) below is preferable:
(H) Hybridization under stringent conditions with a polynucleotide having a base sequence complementary to the base sequence represented by SEQ ID NO: 6 or a degenerate variant thereof (preferably the base sequence represented by SEQ ID NO: 7). And a polynucleotide encoding a protein with histamine oxidase activity.

An expression unit containing a polynucleotide encoding a histamine oxidase is an expression of a protein encoded by the polynucleotide, including the polynucleotide and a promoter operably linked to it (eg, homologous promoter, heterologous promoter). A unit that enables. Examples of the host cell containing an expression unit containing a polynucleotide encoding a histamine oxidase include a host cell containing an expression vector containing a polynucleotide encoding a histamine oxidase.

The expression vector may contain a polynucleotide encoding a histamine oxidase, and examples thereof include a cell-based vector that expresses a protein in a host and a cell-free vector that utilizes a protein translation system. Examples of expression vectors and preferred examples are similar to those already described for histidine decarboxylase.

The host cell containing an expression unit containing a polynucleotide encoding histamine oxidase is not particularly limited as long as it can express histamine oxidase. The host cell may be homologous or heterologous to the histamine oxidase and the polynucleotide encoding it, but is preferably heterologous. The host cell may also be homologous or heterologous to the promoter, but is preferably heterologous. Examples and preferred examples of introduction (transformation) of host cells, transformants, expression vectors into the host are similar to those already described for the description of histidine decarboxylase.

In the present invention, the test sample is not particularly limited as long as it is a sample suspected to contain histidine, for example, a biological sample (eg, blood, urine, saliva, tears, etc.), a food (eg, nutritional drink, amino acid, etc.). Beverages, etc.). The histidine in the test sample may be low concentration (eg, concentration less than 1 mM such as 1 μM or more and less than 1 mM) or high concentration (eg, concentration 1 mM or more such as 1 mM or more and less than 1 M). ..

When the test sample is a bio-derived sample, the subject from which the test sample is collected is not particularly limited, but Crohn's disease, inflammatory bowel disease such as ulcerative colitis, histidineemia, and cardiac cachexia are present. It is preferable that the subject requests confirmation of whether or not histidine such as ulcer is suffering from a disease that can be a biomarker. This makes it possible to accurately analyze the risk of morbidity, whether or not it is morbid, in a short time, easily and inexpensively. If the disease is ulcerative colitis, the subject is preferably in remission of ulcerative colitis. This makes it possible to evaluate the risk of relapse of ulcerative colitis.

The detection target in the measurement of histidine is not particularly limited as long as the histidine in the test sample can be measured, and may be any of 4-imidazolyl acetaldehyde produced, a reduced electron donor, and by-products such as ammonia and hydrogen peroxide. .. Alternatively, it may be conjugated with another reaction to detect the product of the conjugate reaction.

When the 4-imidazolyl acetaldehyde-producing enzyme is a histamine dehydrogenase, examples of the reaction and the conjugated reaction in the measurement of histidine include the following reactions.

Reaction catalyzed by histidine decarboxylase Histidine → histamine + CO ₂

Reaction catalyzed by histamine dehydrogenase Histamine + oxidized electron donor → 4-imidazolyl acetaldehyde + NH ₂ + reduced electron donor 1-PMSH ₂

Conjugated reaction Reduced electron donor + tetrazolium salt (WST-8) → oxidized electron donor + WST-8 (red)

Examples of the electron donor include 1-methoxyphenazinemethsulfate (1-methoxyPMS) [oxidized form] / 1-PMSH ₂ [reduced form].

When utilizing the above-mentioned conjugated reaction, the measurement of histidine can be carried out using an electron donor and a tetrazolium salt in addition to histidine decarboxylase and histamine dehydrogenase. Specifically, the test sample is subjected to an enzymatic reaction with histidine decarboxylase in an aqueous solution (eg, buffer), and then an electron donor, a tetrazolium salt, and a histamine dehydrogenase are mixed to form an enzyme. Histidine is measured by subjecting to the reaction and finally detecting the absorbance (about 470 nm) of the produced WST-8 (red). The measurements can be made qualitatively or quantitatively. The measurement may be performed, for example, based on the endpoint method in which the measurement is performed until all the substrates have reacted, or may be performed based on the rate method (initial velocity method). Since the amount of oxygen required in the oxidation reaction is very small, the required amount of oxygen can be covered by the dissolved oxygen in the reaction system. Therefore, normally, oxygen or a gas containing oxygen is forcibly supplied into the reaction system. do not have to.

When the 4-imidazolyl acetaldehyde-producing enzyme is a histamine oxidase, examples of the reaction and the conjugated reaction at the time of measuring histidine include the following reactions.

Reaction catalyzed by histidine decarboxylase Histidine → histamine + CO ₂

Reaction catalyzed by histamine oxidase Histamine + H ₂ O + O ₂ → 4-imidazolyl acetaldehyde + NH ₃ + H ₂ O ₂

Conjugated reaction (reaction catalyzed by peroxidase)
2H ₂ O ₂ + 4-aminoantipyrine + phenol → quinoneimine dye + 4H ₂ O

When utilizing the above-mentioned conjugated reaction, the measurement of histidine can be performed using 4-aminoantipyrine and phenol, and peroxidase in addition to histidine decarboxylase and histamine oxidase. Specifically, the test sample is subjected to an enzymatic reaction with histidine decarboxylase in an aqueous solution (eg, buffer), and subsequently mixed with 4-aminoantipyrine, phenol, and peroxidase. Histidine is measured by subjecting the resulting mixed sample to an enzymatic reaction and finally detecting the absorbance (about 500 nm) of the produced quinoneimine dye. The measurements can be made qualitatively or quantitatively. The measurement may be performed, for example, based on the endpoint method in which the measurement is performed until all the substrates have reacted, or may be performed based on the rate method (initial velocity method). Since the amount of oxygen required in the oxidation reaction is very small, the required amount of oxygen can be covered by the dissolved oxygen in the reaction system. Therefore, normally, oxygen or a gas containing oxygen is forcibly supplied into the reaction system. do not have to.

In addition, histamine oxidase can be used for a hydrogen peroxide electrode. By using such a hydrogen peroxide electrode, the amount of histamine in the test sample can be specifically evaluated.

Histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme can be included in the kit for measuring histamine. The histamine measurement kit can further include at least one of other reagents such as reaction buffer, buffer salt, hydrogen peroxide detection reagent, ammonia detection reagent and 4-imidazolyl acetaldehyde detection reagent.

The reaction buffer or buffer salt can be used to maintain the pH in the reaction solution at a value suitable for the desired enzymatic reaction.

When the 4-imidazolyl acetaldehyde-producing enzyme is a histamine oxidase, the hydrogen peroxide detection reagent can be used when hydrogen peroxide is detected, for example, by color development or fluorescence. Examples of such a reagent include a combination of peroxidase and a color-developing agent that can be a substrate thereof, and specific examples thereof include, but are not limited to, a combination of horseradish peroxidase and 4-aminoantipyrine and phenol. ..

Examples of the ammonia detection reagent include the indophenol method in which phenol and hypochlorous acid are combined.

Examples of the 4-imidazolyl acetaldehyde detection reagent include electron donors such as 1-methoxy PMS.

Histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme, together with the device, can be components of the detection system for histidine measurement. Each enzyme may exist as a unit independent of the microdevice that may be supplied into the device during use, but may be pre-injected, immobilized or placed in the device. Preferably, each enzyme is provided in a pre-injected, immobilized or placed form into the device. Immobilization or placement of each enzyme on the device is done directly or indirectly. As the device, for example, a microdevice such as a microchannel chip provided with a channel can be preferably used.

The histidine measurement detection system may include other components. Other components include, for example, at least one of a reaction buffer or buffer, a hydrogen peroxide detection reagent, an ammonia detection reagent and a 4-imidazolyl acetaldehyde detection reagent. In the histidine measurement detection system, all of the above other components may be provided in the form of being housed in the device. Alternatively, some of the other components may be provided in a form housed in the device and the rest may be provided in a form not housed in the device (eg, in a form housed in a different container). In this case, the elements not contained in the device may be used by being injected into the device during the measurement of the target substance.

The device includes, for example, 1) a first area for mixing a sample and a component of (c) to prepare a mixed solution, and the prepared mixed solution using histidine decarboxylase and 4-imidazolyl acetaldehyde production. A device provided with a second area for detecting histidine in contact with an enzyme (device in which each step of mixing and detection is performed in different areas); 2) a sample and a component of (c) and histidine decarboxylase. And a device comprising a zone for detecting histidine by both enzymes by mixing with 4-imidazolyl acetaldehyde-producing enzyme (device in which each step of mixing and detection is performed in the same zone); and 3) sample and (c). A device with a flow path that allows mixing of the components of) and (and optionally both enzymes), and an area for detecting histidine by the amphoteric enzyme (when the sample is injected into the device inlet), A device in which a sample or the like is automatically mixed by being sent through a flow path and histidine in the obtained mixed solution is automatically detected in the detection area). From the viewpoint of automation, the device of 3), particularly the device of 3) in the form of a microchannel device is preferable. In the device of 3), the histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme may be provided in the liquid feed flowing through the flow path, or may be provided in a fixed or placed form in the detection area, which is preferable. Is provided in a fixed or placed form in the detection area.

Histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme can also be used as an enzyme sensor for measuring histidine. Enzyme sensors for measuring histidine include, for example, a detection electrode, and histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme immobilized or placed on the detection electrode. Both enzymes are fixed or placed directly or indirectly on the electrodes.

Examples of the detection electrode in the case of histamine oxidase include a hydrogen peroxide detection electrode, and more specifically, for example, an enzymatic hydrogen peroxide detection electrode and a diaphragm type hydrogen peroxide detection electrode. .. This makes it possible to measure histidine in a test substance by detecting hydrogen peroxide generated when histamine is oxidized by histamine oxidase activity. For other configurations, the configurations adopted by known sensors can be used as they are or modified as appropriate.

INDUSTRIAL APPLICABILITY The present invention can be used for predicting and diagnosing a subject's disease such as Crohn's disease, inflammatory bowel disease such as ulcerative colitis, histidineemia, cardiac cachexia, and cancer. Histidine levels are reduced in patients with inflammatory bowel disease, cardiac cachexia, lifestyle-related diseases, and cancer, and increased in patients with histidineemia. Therefore, for example, the amount of histidine in the test sample measured by the above measurement method is compared with the reference amount (reference amount of a healthy person, etc.), and if the amount of histidine in the test sample is lower than the reference amount, The subject can be determined to have inflammatory bowel disease or cardiac malaise. The amount of histidine in the test sample measured by the above measurement method is compared with the standard amount (standard amount of a healthy person, etc.), and if the amount of histidine in the test sample is higher than the standard amount, the subject It can be determined that the patient has histidineemia.

In addition, when the subject is in remission of ulcerative colitis, it can be used to evaluate the risk of relapse of ulcerative colitis. For example, if it is clear that the subject is in remission of ulcerative colitis, the amount of histidine in the test sample measured by the above measurement method is used as a reference amount (relapse in remission of ulcerative colitis). When the amount of histidine in the test sample is less than the standard amount, the risk of relapse to ulcerative colitis is high compared to the standard amount based on the subject who did not develop ulcerative colitis, the standard amount of healthy subjects, etc.). The risk of relapse of ulcerative colitis in a subject can be determined by comparing it with the criterion that the risk is low when the number is high.

The present invention will be described in detail with reference to the following examples, but the present invention is not limited to the following examples.

[Example 1] Expression and purification of HisDC A recombinant expression system of HisDC using Escherichia coli was constructed as follows. First, a plasmid for recombinant expression was constructed. Codon optimization based on general codon frequency using GEMETXY from the amino acid sequence of HisDC (SEQ ID NO: 3) to efficiently express histidine decarboxylase (HisDC) derived from photobacterium phosphorium in Escherichia coli. HisDC (SEQ ID NO: 2) was obtained. Codon-optimized HisDC (SEQ ID NO: 2) is amplified with DNA primer 1 (SEQ ID NO: 4: 5'TATCGAAGGTCGTCATATGACCACCC3') and DNA primer (SEQ ID NO: 5: 5'TTTGTTAGCAGCCGGATCCTTAGGC3') according to standard PCR methods. did. Subsequently, pET16b (Merck Co., Ltd.) was digested with restriction enzymes using NDEI (Takara Bio Inc.) and HindIII (Takara Bio Inc.), and deproteinized and deproteinized using FastGene Plasmamid Mini Kit (Nippon Genetics Co., Ltd.). Unwanted DNA fragments were removed. From the obtained product, a ligation product was obtained according to a standard method, and a transformant of Escherichia coli XL-10 gold was obtained. A plasmid was extracted from a transformant of Escherichia coli XL-10-gold, and the insertion of the target gene into the plasmid was confirmed using a standard DNA sequence analysis method. Hereinafter, the plasmid into which the target gene is inserted is referred to as pET16b-HisDC, and the transformant of BL21 (DE3) by pET16b-HisDC is referred to as pET16b-HisDC-BL21 (DE3), respectively.

The HisDC was prepared as follows. First, the glycerol stock of pET16b-HisDC-BL21 (DE3) was inoculated into an LB plate containing 100 μg / ml ampicillin and statically cultured at 37 ° C. overnight. 50 ml of LB liquid medium containing 100 μg / ml ampicillin was placed in a 250 ml volume flask, single colonies on the LB plate were inoculated and cultured at 37 ° C. overnight. 20 ml of the preculture solution was added to 2 L of LB liquid medium containing 100 μg / ml ampicillin, and the cells were cultured by shaking at 37 ° C. until the value of OD600 became about 0.6. The cells were allowed to stand at 25 ° C. for 30 minutes, IPTG was added to a final concentration of 0.1 mM, and the cells were cultured overnight at 25 ° C. with swirling and shaking, and then collected in a 50 ml tube.

The cells were suspended in a crushing buffer (50 mM Tris-HCl, 500 mM NaCl, 75 mM imidazole, 0.2 μM PLP pH 8.0) and crushed using an ultrasonic crusher (INSONATOR, Kubota Shoji Co., Ltd.). This crushed solution was centrifuged at 15,000 × g for 30 minutes to collect the supernatant, and then purified using Ni Sepharose 6 Fast Flow (GE Healthcare Japan Co., Ltd.). The wash buffer is (50 mM Tris-HCl, 500 mM NaCl, 75 mM imidazole, 0.2 μM PLP, pH 8.0) and the elution buffer is (50 mM Tris-HCl, 500 mM NaCl, 500 mM imidazole, 0.2 μM PLP, pH 8.0). I used each. The elution fraction was collected and the solution was exchanged with 50 mM Tris-HCl, pH 8.0 using AKTA Explorer 10S and Hi prep 26/10 desalting. Purification with an anion exchange column was performed at 4 ° C. using AKTA Explorer 10S and 6 mL of Resource Q. 50 mM Tris-HCl, pH 8.0 was used for equilibration, and 50 mM Tris-HCl, 1M NaCl, pH 8.0 was used for elution, and elution was performed with a NaCl concentration gradient.

[Example 2] Activity confirmation The activity of HisDC prepared in Example 1 was evaluated by the following procedure. HisDC was adjusted to 0.2 mg / ml, and 0.2 M sodium phosphate buffer, pH 6.5 was added to 25 μL, ultrapure water was added to 10 μL, and each concentration of histidine solution was added to 10 μL to 5 μL of HisDC. Was incubated at 25 ° C. for 60 minutes. A solution containing 50 μL of histamine dehydrogenase (Checkcolor histamine, Kikkoman Biochemifa) and 50 μL of the detection solution was placed in a 96-well microplate with 50 μL of this solution, and the change in absorbance at a wavelength of 470 nm over time was measured by a microplate reader (microplate reader). Measured with SpectraMax M2e, MOLECULAR DEVICES). FIG. 1 shows a calibration curve for each concentration of histidine solution.

Further, to 5 μL of HisDC, 0.2 M sodium phosphate buffer, pH 6.5 of 75 μL, ultrapure water of 15 μL, each concentration histide solution 5 μL, histamine dehydrogenase 25 μL, and detection solution 25 μL were added and mixed. It was placed in a 96-well microplate and the change over time in absorbance at a wavelength of 470 nm was measured with a microplate reader. FIG. 2 shows a calibration curve for each concentration of histidine solution.

[Example 3] Expression and purification of histamine oxidase A recombinant expression system of histamine oxidase using Escherichia coli was constructed as follows. First, a plasmid for recombinant expression was constructed. In order to efficiently express histamine oxidase (HOX) derived from Arthrobacter crystallopoies in Escherichia coli, the amino acid sequence of HOX (SEQ ID NO: 8) is based on the general codon frequency using GEMETXY. A codon-optimized HOX (SEQ ID NO: 7) was obtained. Codon-optimized HOX (SEQ ID NO: 7) using DNA primer 3 (SEQ ID NO: 9: 5'ATCGAGGGAAGGATTTCACATATGGCAGAATATCTGCTGCCTGGCAC3') and DNA primer 4 (SEQ ID NO: 10: 5'ATTACCTGCAGGGAATTCGGATCCTTAATTCGGACAACGGC3') according to standard PCR methods. Amplified. Subsequently, pMAL-c5X (NEW ENGLAND BioLabs Co., Ltd.) was digested with restriction enzymes using DNAI (Takara Bio Co., Ltd.) and HindIII (Takara Bio Co., Ltd.), and FastGene Plasmamid Mini Kit (Japan Genetics Co., Ltd.) was used. The protein was removed and unnecessary DNA fragments were removed. From the obtained product, a ligation product was obtained according to a standard method, and a transformant of Escherichia coli XL-10 gold was obtained. A plasmid was extracted from a transformant of Escherichia coli XL-10-gold, and the insertion of the target gene into the plasmid was confirmed using a standard DNA sequence analysis method. Hereinafter, the plasmid into which the target gene is inserted is referred to as pMAL-c5X-HOX, and the transformant of BL21 (DE3) by pMAL-c5X-HOX is referred to as pMAL-c5X-HOX-BL21 (DE3), respectively.

The histamine oxidase was prepared as follows. First, the glycerol stock of pMAL-c5X-HOX-BL21 (DE3) was inoculated into an LB plate containing 100 μg / ml ampicillin, and cultured at 37 ° C. overnight. 50 ml of LB liquid medium containing 100 μg / ml ampicillin was placed in a 250 ml volume flask, single colonies on the LB plate were inoculated and cultured at 37 ° C. overnight. 20 ml of the preculture solution was added to 2 L of LB liquid medium containing 100 μg / ml ampicillin, and the cells were cultured by shaking at 37 ° C. until the value of OD600 became about 0.6. The cells were allowed to stand at 16 ° C. for 30 minutes, IPTG was added to a final concentration of 0.5 mM, and the cells were cultured overnight at 16 ° C. with swirling and shaking, and then collected in a 50 ml tube.

The cells were suspended in a crushing buffer (50 mM sodium phosphate, 500 mM NaCl pH 7.0) and crushed using an ultrasonic crusher (INSONATOR, Kubota Shoji Co., Ltd.). This crushed solution was centrifuged at 15,000 × g for 30 minutes to collect the supernatant, and then purified using Ni Sepharose 6 Fast Flow (GE Healthcare Japan Co., Ltd.). The wash buffer was (50 mM sodium phosphate, 500 mM NaCl pH 7.0) and the elution buffer was (50 mM sodium phosphate, 500 mM NaCl, 10 mM maltoth pH 7.0). The eluted fraction was collected, copper sulfate was added to a final concentration of 0.1 mM, and the mixture was incubated at 4 ° C. for 30 minutes. The solution was changed to 50 mM sodium phosphate and 500 mM NaCl pH 7.0 using AKTA Explorer 10S and Hi prep 26/10 desalting.

[Example 4] Substrate specificity The substrate specificity of HisDC prepared in Example 1 was carried out by the following procedure. HisDC was adjusted to 0.2 mg / ml, and 0.2 M sodium phosphate buffer, pH 6.5 was added to 25 μL, ultrapure water was added to 10 μL, and 10 μL of each concentration histidine solution was added to 5 μL of HisDC and mixed. Was incubated at 25 ° C. for 60 minutes. A solution containing 50 μL of histamine dehydrogenase (Checkcolor histamine, Kikkoman Biochemifa) and 50 μL of the detection solution was placed in a 96-well microplate with 50 μL of this solution, and the change over time in absorbance at wavelengths of 470 nm and 800 nm was measured on the microplate. It was measured with a reader (SpectraMax M2e, MOLECULAR DEVICES). FIG. 3 shows the specific activity for each amino acid solution.

[Example 5] Quantitative measurement of plasma His (1)
Quantitative measurement of His in human plasma was performed using the HisDC prepared in Example 1. HisDC was prepared to be 0.6 mg / ml, 0.2 M sodium phosphate buffer, pH 6.5 was 25 μL, 7.5% Tween20 5 μL, ultrapure water 5 μL, and each concentration histidine was adjusted to 5 μL of HisDC. 10 μL of the solution or human plasma was added and the mixed solution was incubated at 25 ° C. for 15 minutes. To a 96-well microplate, 50 μL of histamine dehydrogenase (Checkcolor histamine, Kikkoman Biochemifa) and 50 μL of the detection solution were added to 50 μL of this solution. Microplate reader (Abs 470 nm (before), Abs 470 nm (after), Abs 800 nm (before), Abs 800 nm (after)) at 470 nm and 800 nm before and after mixing with histamine dehydrogenase. It was measured by SpectraMax M2e, MOLECULAR DEVICES).

Using the absorbance values at each measurement point before and after the reaction, the amount of change in absorbance (ΔAbs) before and after the addition of the enzyme solution was (Abs 470 nm (after) -Abs 800 nm (after))-(Abs 470 nm (before)-). Abs 800 nm (front)) × 100/150. After subtracting the absorbance of the unreacted solution from each value as a blank, a calibration curve was created from the relationship between ΔAbs and His concentration when the His aqueous solution was used as the sample, and from ΔAbs when human plasma was used as the sample. , His concentration in human plasma was determined. A calibration curve was prepared using the average value obtained from three experiments at each His concentration, and human plasma of the same lot was measured three times and compared with the analysis value (73.5 μM) by LC-MS. .. The results are shown in FIG.

[Example 6] Quantitative measurement of plasma His (2)
Quantitative measurement of His in human plasma was performed using HisDC prepared in Example 1 and HOX prepared in Example 3. Prepare HisDC to 0.6 mg / ml, add 0.2 M sodium phosphate buffer, pH 6.5 to 75 μL, ultrapure water 10 μL, each concentration histidine solution 50 μL or human plasma to 15 μL of HisDC. The mixed solution was incubated at 25 ° C. for 60 minutes. 20 μL of HOX prepared to be 4.0 mg / ml, 20 μL of 1M HEPES pH 7.5, 2 μL of 100 mM TOOS, and 2 μL of 0.1M 4-aminoantipyrine in a 96-well microplate with respect to 40 μL of this solution. 2 μL of 1500 U / ml peroxidase and 114 μL of ultrapure water were added. Microplate reader (SpectraMax M2e, Abs 555 nm (before), Abs 555 nm (after), Abs 800 nm (before), Abs 800 nm (after)) at 555 nm and 800 nm before and after mixing by adding HOX. It was measured by MOLECULAR DEVICES).

Using the absorbance values at each measurement point before and after the reaction, the amount of change in absorbance (ΔAbs) before and after the addition of the enzyme solution was (Abs 555 nm (after) -Abs 800 nm (after))-(Abs 555 nm (before)-). It was determined as Abs 800 nm (front). After subtracting the absorbance of the unreacted solution from each value as a blank, a calibration curve was created from the relationship between ΔAbs and His concentration when the His aqueous solution was used as the sample, and from ΔAbs when human plasma was used as the sample. , His concentration in human plasma was determined. A calibration curve was prepared using the average value obtained from three experiments at each His concentration, and human plasma of the same lot was measured three times and compared with the analysis value (74.9 μM) by LC-MS. .. The calibration curve is shown in FIG. 5, and the quantitative result is shown in FIG.

The present invention is useful for rapid and sensitive measurement of histidine, and is also useful for specific measurement of histidine. The present invention is useful in a wide range of fields such as biological research, health nutrition, medical care, and food manufacturing.

Claims (18)

Using histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme,
Histidine decarboxylase is one or more proteins selected from the group consisting of (A), (B) and (C) below:
(A) A protein containing the amino acid sequence represented by SEQ ID NO: 3;
(B) A protein containing an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 3 and having histidine decarboxylase activity;
(C) A protein containing an amino acid sequence in which one or several amino acids are deleted, substituted, added or inserted in the amino acid sequence represented by SEQ ID NO: 3 and having histidine decarboxylase activity.
4-imidazolyl acetaldehyde-producing enzyme is at least one selected from the group consisting of histamine dehydrogenase and histamine oxidase.
Histidine decarboxylase is allowed to act on the test sample, and 4-imidazolyl acetaldehyde-producing enzyme is subsequently allowed to act on the test sample without inactivating the histidine decarboxylase.
A method for measuring histidine in a test sample. The method according to claim 1 , wherein the histidine decarboxylase is derived from a bacterium belonging to the genus Photobacterium. The method according to claim 2 , wherein the bacterium belonging to the genus Photobacterium is Photobacterium phosphorium. The method according to any one of claims 1 to 3 , wherein the histidine decarboxylase is produced by the transformant. The fourth aspect of claim 4 , wherein the transformant is a host cell containing an expression unit containing one or more polynucleotides selected from the group consisting of the following (a), (b), and (c ) ). Method.
(A) A polynucleotide containing the base sequence represented by SEQ ID NO: 1;
(B) A polynucleotide containing a degenerate variant of the base sequence represented by SEQ ID NO: 1; and
(C) A polynucleotide comprising a base sequence having 90% or more identity with the base sequence represented by SEQ ID NO: 1 or a demultiplexed variant thereof, and encoding a protein having histidine decarboxylase activity . The method according to any one of claims 1 to 5 , wherein the histamine oxidase is one or more proteins selected from the group consisting of the following (D), (E) and (F).
(D) A protein containing the amino acid sequence represented by SEQ ID NO: 8;
(E) A protein containing an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 8 and having histamine oxidase activity;
(F) A protein containing an amino acid sequence in which one or several amino acids are deleted, substituted, added or inserted in the amino acid sequence represented by SEQ ID NO: 8 and having histamine oxidase activity. The method according to any one of claims 1 to 6 , wherein the histamine oxidase is derived from a bacterium belonging to the genus Arthrobacter. The method of claim 7 , wherein the Arthrobacter bacterium is Arthrobacter crystallopoetes. The method according to any one of claims 1 to 8 , wherein the histamine oxidase is produced by the transformant. The method of claim 9 , wherein the transformant is a host cell comprising an expression unit comprising one or more polynucleotides selected from the group consisting of (e), (f), and (g ) below. ..
(E) A polynucleotide containing the base sequence represented by SEQ ID NO: 6;
(F) A polynucleotide containing a degenerate variant of the base sequence represented by SEQ ID NO: 6; and
(G) A polynucleotide comprising a base sequence having 90% or more identity with the base sequence represented by SEQ ID NO: 6 or a degenerate variant thereof, and encoding a protein having histamine oxidase activity . At least one selected from the group consisting of 4-imidazolyl acetaldehyde, reduced electron donor, ammonia and hydrogen peroxide in the test sample after the action of histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme is measured. , The method according to any one of claims 1 to 10 . A kit for measuring histidine for carrying out the method according to any one of claims 1 to 10 , which comprises a histidine decarboxylase and a 4-imidazolyl acetaldehyde-producing enzyme. The kit according to claim 12 , further comprising at least one of a reaction buffer or buffer, a 4-imidazolyl acetaldehyde detection reagent, a hydrogen hydrogen detection reagent, an ammonia detection reagent and a reduced electron donor reagent. The detection system for measuring histidine by the method according to any one of claims 1 to 10 , which comprises a device, a histidine decarboxylase and a 4-imidazolyl acetaldehyde-producing enzyme. Further comprising at least one of a reaction buffer or buffer, 4-imidazolyl acetaldehyde detection reagent, hydrogen hydrogen detection reagent, ammonia detection reagent and reduced electron donor detection reagent, and the device is a microchannel chip. The detection system according to claim 14 . The method according to any one of claims 1 to 10, comprising a detection electrode and a histidine decarboxylase and 4-imidazolyl acetaldehyde-producing enzyme immobilized or placed on the detection electrode. Enzyme sensor for measurement. The amount of histidine in the test sample is measured by the method according to any one of claims 1 to 11 , and if the amount of histidine is lower than the reference amount, the subject is ulcerative colitis or cardiac illness. Predicting a high risk of developing a lifestyle-related disease or cancer , and predicting that a subject is at a high risk of developing histidineemia if the amount of histidine in the test sample is higher than the standard amount, ulcerative colitis , How to predict the risk of developing heart disease, lifestyle-related diseases, cancer or histidineemia. The amount of histidine in the test sample of the subject in the remission stage of ulcerative colitis is measured by the method according to any one of claims 1 to 11 , and the amount of histidine is lower than the reference amount. For example, the subject predicts that the risk of relapse of inflammatory bowel disease is high, and if the amount of histidine in the test sample is higher than the reference amount, the subject predicts that the risk of relapse is low. Prediction method.

Images