JP6945865B2 - Cas protein expression cassette - Google Patents

Description

The present invention relates to a Cas protein expression cassette used in plant genome editing by a CRISPR / Cas system, a plant genome editing method using the expression cassette, and the like.

The combination of guide RNA and Cas protein can cause DNA double-strand breaks at specific sequences on the cell's genome. Since mutations such as random scraping and addition of DNA occur frequently at this DNA cleavage end, gene disruption can be easily performed by combining a guide RNA and a Cas protein. This technology is called the CRISPR / Cas system, and has been rapidly developed and improved in recent years.

The CRISPR / Cas system can be applied to various plants, and examples of its application to various plants in terms of classification such as Arabidopsis thaliana, liverwort, rice, and tomato have been reported (Non-Patent Documents 1 to 4). However, in plant genome editing by the CRISPR / Cas system, there is a problem that the genome editing efficiency in inflorescences including germ cells is low. For this reason, the efficiency of transmitting the mutation to the next generation is inevitably reduced.

Fauser, F., Schiml, S. and Puchta, H. (2014) Both CRISPR / Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J.79: 348-359. Sugano, SS, Shirakawa, M., Takagi, J., Matsuda, Y., Shimada, T., Hara-Nishimura, I. and Kohchi, T. (2014) CRISPR / Cas9-mediated targeted mutagenesis in the liverwort Marchantia polymorpha L. Plant Cell Physiol. 55: 475-481. Endo, M., Mikami, M. and Toki, S. (2015) Multigene knockout utilizing off-target mutations of the CRISPR / Cas9 system in rice. Plant Cell Physiol. 56: 41-47. Brooks, C., Nekrasov, V., Lippman, ZB and Van Eck, J. (2014) Efficient gene editing in tomato in the first generation using the clustered regularly interspaced short palindromic repeats / CRISPR-associated9 system. Plant Physiol. 166: 1292-1297.

An object of the present invention is to provide a plant genome editing technique having higher genome editing efficiency, particularly genome editing efficiency after the T1 generation.

As a result of diligent research in view of the above problems, the present inventor has found that the above problems can be solved by expressing the Cas protein under the control of the RPS5A promoter in the CRISPR / Cas system. As a result of further research based on this finding, the present invention has been completed.

That is, the present invention includes the following aspects:
Item 1. A polynucleotide comprising the RPS5A promoter and a Cas protein coding sequence located under the control of the promoter.
Item 2. Item 2. The polynucleotide according to Item 1, wherein the Cas protein is a Cas9 protein.
Item 3. Item 2. The polynucleotide according to Item 1 or 2, further comprising a reporter protein expression cassette.
Item 4. Item 3. The polynucleotide according to Item 3, wherein the reporter protein expression cassette is a seed-specific promoter and a polynucleotide containing a reporter protein coding sequence arranged under the control of the promoter.
Item 5. Item 6. The polynucleotide according to any one of Items 1 to 4, which comprises a signal for terminating transcription from the Cas protein coding sequence downstream of the Cas protein coding sequence. Item 5. The polynucleotide according to Item 5, wherein the termination signal is a heat shock protein termination signal.
Item 7. The polynucleotide according to any one of Items 1 to 6, further comprising a guide RNA expression cassette.
Item 8. Item 2. The polynucleotide according to Item 7, wherein the guide RNA expression cassette is a site for inserting a crRNA coding sequence and a polynucleotide containing a tracrRNA coding sequence located downstream of the site.
Item 9. A vector comprising the polynucleotide according to any one of Items 1 to 8.
Item 10. A composition for editing a plant genome, which comprises at least one selected from the group consisting of the polynucleotide according to any one of Items 1 to 8 and the vector according to claim 9.
Item 11. A kit for editing a plant genome, which comprises at least one selected from the group consisting of the polynucleotide according to any one of Items 1 to 8 and the vector according to claim 9.
Item 12. A genome-edited plant body comprising the step of introducing into a plant body or a plant cell at least one selected from the group consisting of the polynucleotide according to any one of Items 1 to 8 and the vector according to claim 9. Or a method for producing plant cells.
Item 13. A method for editing a plant genome, comprising a step of introducing at least one selected from the group consisting of the polynucleotide according to any one of Items 1 to 8 and the vector according to claim 9 into a plant body or a plant cell.

According to the present invention, by using a Cas protein expression cassette controlled by the RPS5A promoter, it is possible to provide a plant genome editing technique having higher genome editing efficiency, particularly genome editing efficiency after the T1 generation. According to this technique, higher genome editing efficiency can be obtained even in germ cells, so that mutations can be transmitted more efficiently to the next generation.

In addition, since a plant body in which all cells have been genome-edited can be obtained from a germ cell in which genome editing has already occurred, the foreign DNA introduced for the CRISPR / Cas system is not required in the germ cell. Also, if this foreign DNA remains, the risk of off-target effects increases. Therefore, after genome editing, it is important to select plants and their seeds that do not contain this foreign DNA. Conventionally, this selection has been performed by examining the presence or absence of foreign DNA by PCR or the like, so that it is complicated and low efficiency.

According to a preferred embodiment of the present invention, by incorporating a reporter gene into a foreign DNA, a plant or a seed thereof that does not contain the foreign DNA can be more easily and more easily obtained based on the presence or absence of a signal derived from the reporter. It is possible to select efficiently.

A schematic diagram of the structure of the p35S-Cas9 vector (Comparative Example 1), the pX2-Cas9 vector (Comparative Example 2), and the p5A-Cas9 (pKIR1.0) vector (Example 1) is shown. LB indicates the left border sequence used for DNA recombination by Agrobacterium, RB indicates the right border sequence used for DNA recombination by Agrobacterium, and Basta ^R indicates the Basta resistance gene expression cassette, which is a herbicide. , Hyg ^R indicates the antibiotic hyglomycin resistance gene expression cassette, 35S promoter indicates the promoter of the 35S gene, WOX2 promoter indicates the promoter of the WOX2 gene, Cas9 has the FLAG tag added to the N-terminal, and N The coding sequence of the S. pyogenes-derived Cas9 protein (FLAG-NLS-Cas9) with nuclear translocation signals added to the ends and C ends is shown, 35sT shows the 35s termination signal, hspT shows the heat shock protein termination signal, and OLE. -TagRFP indicates the coding sequence of the OLE promoter and the fusion protein of OLE and RFP placed under its control, HindIII indicates the HindIII recognition sequence which is a restriction enzyme, and SbfI indicates the SbfI recognition sequence which is a restriction enzyme. It is an observation image which shows three patterns of the plant body obtained in Test Example 1. The upper photo shows a bright-field image, and the lower photo shows an autofluorescent image. The photo on the left shows the case where almost all are green, the photo in the center shows the case where only a part is green, and the photo on the right shows the case where all are white. The bars in each photo represent a length of 2 mm. Regarding the plant body obtained in Test Example 1, a plant body in which the entire pair of two leaves in each of the cotyledon, the first leaf (1st leaf), and the second leaf (2nd leaf) is white. It is a graph which shows the ratio (vertical axis). It is a graph which shows the amount (vertical axis) of 3 kinds of pigments (chlorophyll a, chlorophyll b, carotenoid) contained in 1 mg of the inflorescence of the plant body obtained in Test Example 1. The tip of the whiskers extending upward from the column shows the maximum percentile value excluding outliers, the top edge of the column shows the 75th percentile value, the horizontal line in the column shows the 50th percentile value (median), and the bottom edge of the column. Shows the 25th percentile value, and the tip of the whiskers extending downward from the column shows the minimum percentile value excluding outliers. It is a photograph of the plant body obtained in Test Example 2. A is a photograph of the entire plant, B is an enlarged photograph of the area surrounded by the square in A's photograph, and C is a photograph of one double flower transferred. The bar in A represents a length of 5 cm, the bar in B represents a length of 1 cm, and the bar in C represents a length of 1 mm. It is a DAPI-stained image of four pollen molecules of a plant body obtained in Test Example 3. The number on the upper right of each photograph indicates the number of mature pollens (na) in which two sperm cells are observed on the left side, and the number of pollen (nb) in which only one sperm cell-like cell is observed on the right side. The bars in each photo represent a length of 10 μm. In FIG. 4C, the white-painted arrowheads indicate the nuclei of normal sperm cells, and the white arrowheads indicate the nuclei of undivided sperm cell-like cells. The ratio of each pattern of the four pollen molecules of the plant obtained in Test Example 3 is shown. In the pattern notation ([na, nb]) shown at the bottom of the figure, na indicates the number of mature pollens in which two sperm cells are observed, and nb indicates the number of pollen in which only one sperm cell-like cell is observed. # 1 to 12 on the left side of the figure indicate different plants, and 1 to 3 in each # indicate different flowers. The% at the top of the figure indicates the ratio of each pattern. The fertilization rate when the plant # 7 or # 10 obtained in Test Example 3 and the wild strain are crossed in the forward and reverse directions is shown. The sequence of the guide RNA target site in the DUO1 gene of the plant # 10 obtained in Test Example 3 (lower row) is shown. The upper row shows the corresponding sequences in the wild strain. The underline shows the PAM sequence. White arrowheads indicate cleavage sites by Cas protein. The survival rate (vertical axis) of the T2 generation seeds obtained in Test Example 4 after allyl alcohol treatment is shown. The tip of the whiskers extending upward from the column shows the maximum percentile value excluding outliers, the top edge of the column shows the 75th percentile value, the horizontal line in the column shows the 50th percentile value (median), and the bottom edge of the column. Shows the 25th percentile value, and the tip of the whiskers extending downward from the column shows the minimum percentile value excluding outliers. A schematic diagram of the structure of the pKIR1.1 vector (Example 3) is shown. The meaning of each term in the figure is the same as that in FIG. A schematic diagram of the structure of the pKI1.1R vector (Example 4) is shown. The meaning of each term in the figure is the same as that in FIG. The survival rate (vertical axis) of the T2 generation seeds obtained in Test Example 5 after allyl alcohol treatment is shown. The tip of the whiskers extending upward from the column shows the maximum percentile value excluding outliers, the top edge of the column shows the 75th percentile value, the horizontal line in the column shows the 50th percentile value (median), and the bottom edge of the column. Shows the 25th percentile value, and the tip of the whiskers extending downward from the column shows the minimum percentile value excluding outliers. The results of nucleotide sequence analysis of tomato shoots obtained when the pKI1.1R GCS1-1755 vector (Example 4B) was used in Test Example 6 are shown. The target sequence shows the target sequence (SEQ ID NO: 47) of the guide RNA expressed by the pKI1.1R GCS1-1755 vector.

In the present specification, the expressions "contains" and "contains" include the concepts of "contains", "contains", "substantially consists" and "consists of only".

As used herein, the term "identity" of an amino acid sequence refers to the degree of coincidence of two or more contrastable amino acid sequences with respect to each other. Therefore, the higher the match between two amino acid sequences, the higher the identity or similarity of those sequences. The level of amino acid sequence identity is determined, for example, using FASTA, a sequence analysis tool, using default parameters. Alternatively, the algorithm BLAST by Karlin and Altschul (KarlinS, Altschul SF. “Methods for assessing the statistical significance of molecular sequence features by using general scoringschemes” Proc Natl Acad Sci USA. 87: 2264-2268 (1990), KarlinS, Altschul SF. It can be determined using “Applications and statistics for multiple high−scoring segments in molecular sequences.” Proc Natl Acad Sci USA. 90: 5873-7 (1993). A program called blastp and a program called tblastn based on such a BLAST algorithm have been developed. Specific methods for these analysis methods are known, and the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/) can be referred to. In addition, the "identity" of the base sequence is also defined according to the above.

As used herein, "conservative substitution" means that an amino acid residue is replaced with an amino acid residue having a similar side chain. For example, substitution between amino acid residues having a basic side chain such as lysine, arginine, and histidine is a conservative substitution. Other amino acid residues with acidic side chains such as aspartic acid and glutamic acid; amino acid residues with non-charged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine and cysteine; alanine, valine, leucine, isoleucine, Amino acid residues with non-polar side chains such as proline, phenylalanine, methionine and tryptophan; amino acid residues with β-branched side chains such as threonine, valine and isoleucine; with aromatic side chains such as tyrosine, phenylalanine, tryptophan and histidine Substitution between amino acid residues is also a conservative substitution.

The "plant" that is the subject of the genome editing technique of the present invention is not particularly limited as long as it is a plant that can edit the genome by the CRISPR / Cas system. Plants include, for example, moss plants, ferns, angiosperms, angiosperms, monocotyledons, and eudicots (roses I, roses II, asterids I, asterids II and their outer groups). A wide range of plants can be mentioned. More specific examples of plants include legumes such as tomatoes, peppers, capsicums, eggplants and tobacco; melons such as cucumbers, pumpkins, melons and watermelons; vegetables such as cabbage, broccoli and hakusai; Raw vegetables and spicy vegetables such as lettuce; Negi such as green onions, onions and garlic; Beans such as soybeans, rapeseed, green beans, pea and azuki; Other fruit vegetables such as strawberries and melons; Straight roots; potatoes, potatoes, potatoes, sweet potatoes, rapeseed, etc .; rice, corn, wheat, sorghum, barley, lime tree, minatokamojigusa, buckwheat, etc. Beans such as lacquer, pea, and soybean; soft vegetables such as asparagus, spinach, and honey; flowers such as Turkish ginkgo, stock, carnation, and kiku; turf such as bentgrass and sardine; rapeseed, rapeseed, oilseed rape, rapeseed Oil crops such as oilseed rape; Textile crops such as cotton and igusa; Forage crops such as clover, dent corn and tarumago palm; deciduous fruit trees such as apples, pears, grapes and peaches; Citrus fruits such as grapefruit; woody beans such as satsuki, tsutsuji, sugi, poplar, and rapeseed.

1. 1. Polynucleotide The present invention, in one aspect, also comprises a polynucleotide comprising the RPS5A promoter and a Cas protein coding sequence placed under the control of the promoter (also referred to herein as the "polynucleotide of the invention". There is.) This will be described below.

The RPS5A promoter is not particularly limited as long as it is a promoter of the RPS5A (Ribosomal Protein S5 A) gene.

The RPS5A gene is not particularly limited as long as it is a plant-derived RPS5A gene that is the subject of the genome editing technology of the present invention. The RPS5A gene derived from various plants is known, and examples of the gene include the RPS5A gene derived from rice (Oryza sativa) (NCBI Accession Number: XP_015617601) and the RPS5A gene derived from Brachypodium distachyon (NCBI Accession Number: XM_003578781). , Sorghum bicolor-derived RPS5A gene (NCBI Accession Number: KXG32157), corn (Zea mays) -derived RPS5A gene (NCBI Accession Number: NP_001131862), potato (Solanum tuberosum) -derived RPS5A gene (NCBI Accession Number: XP_006363855), tomato (Solanum lycopersicum) -derived RPS5A gene (NCBI Accession Number: XP_004250715), grape (Vitis vinifera) -derived RPS5A gene (NCBI Accession Number: CBI29956), cotton (Gossypium raimondii) -derived RPS5A gene (NCBI Accession Number: XP_012466959), soybean (Glycine) max) -derived RPS5A gene (NCBI Accession Number: XP_003533901), Cassaba (Manihot esculenta) -derived RPS5A gene (NCBI Accession Number: OAY40679), Populus (Populus trichocarpa) -derived RPS5A gene (NCBI Accession Number: XP_002309278), Ingenmame (Phaseolus vul) Derived RPS5A gene (NCBI Accession Number: XP_007149885), apple (Malus domestica) -derived RPS5A gene (NCBI Accession Number: XP_008359524), Tarumago palm (Medicago truncatula) -derived RPS5A gene (NCBI Accession Number: XP_013450311), orange (C) RPS5A gene derived from itrus sinensis (NCBI Accession Number: XP_006481676), RPS5A gene derived from Brassica napus (NCBI Accession Number: XP_013689010), RPS5A gene derived from melon (Cucumis melo) (NCBI Accession Number: XP_008463640), tobacco (Nicotiana) Examples include the RPS5A gene (NCBI Accession Number: XP_016481473) derived from tabacum, the RPS5A gene (NCBI Accession Number: ADR71286) derived from Hevea brasiliensis, and the RPS5A gene (NCBI Accession Number: XP_012090867) derived from Jatropha curcas.

The promoter usually comprises a transcription initiation site, its upstream (5'side) sequence, and optionally its downstream (3'side) sequence. As the RPS5A promoter, when the base of the transcription start site of the RPS5A gene is +1 and its downstream (3'side) is a positive value and its upstream (5'side) is 0 or a negative value, for example, -10000 to +500. , Preferably any DNA region within the DNA region of −5000 to +200, more preferably −2000 to +150, including the transcription start site. When there are a plurality of transcription start points, the transfer start point having the largest transfer amount can be selected. The length (base pair number: bp) of the RPS5A promoter includes, for example, a length in the range of 500 to 10000 bp, preferably 1000 to 5000 bp, and more preferably 1500 to 3000 bp.

Specific examples of the RPS5A promoter include a promoter containing the base sequence shown in SEQ ID NO: 1 as an example of a promoter of the RPS5A gene derived from Arabidopsis thaliana, and a promoter of the RPS5A gene (NCBI Accession Number: XP_015617601) derived from rice (Oryza sativa). As an example, a promoter containing the base sequence shown in SEQ ID NO: 2, a promoter containing the base sequence shown in SEQ ID NO: 3 as an example of a promoter of the RPS5A gene (NCBI Accession Number: XM_003578781) derived from Brachypodium distachyon, Sorgham ( As an example of the promoter of the RPS5A gene (NCBI Accession Number: KXG32157) derived from Sorghum bicolor, as an example of the promoter containing the base sequence shown in SEQ ID NO: 4, and as an example of the promoter of the RPS5A gene (NCBI Accession Number: NP_001131862) derived from corn (Zea mays). Derived from potato (Solanum tuberosum), a promoter containing the base sequence shown in SEQ ID NO: 5 As an example of the promoter of the RPS5A gene (NCBI Accession Number: XP_006363855), the promoter containing the base sequence shown in SEQ ID NO: 6 is derived from tomato (Solanum lycopersicum). As an example of the promoter of the RPS5A gene (NCBI Accession Number: XP_004250715), the promoter containing the base sequence shown in SEQ ID NO: 7, and as an example of the promoter of the RPS5A gene (NCBI Accession Number: CBI29956) derived from grape (Vitis vinifera), in SEQ ID NO: 8. As an example of the promoter of the RPS5A gene (NCBI Accession Number: XP_012466959) derived from cotton (Gossypium raimondii), which contains the base sequence shown, the promoter containing the base sequence shown by SEQ ID NO: 9, the RPS5A gene (NCBI) derived from soybean (Glycine max) Accession Number: XP_003533901) One of the promoters Populus trichocarpa, a promoter containing the base sequence shown in SEQ ID NO: 10, as an example of the promoter of the RPS5A gene (NCBI Accession Number: OAY40679) derived from Cassaba (Manihot esculenta), which contains the base sequence shown in SEQ ID NO: 10. ) Derived RPS5A gene (NCBI Accession Number: XP_002309278) as an example of the promoter containing the base sequence shown in SEQ ID NO: 12, Phaseolus vulgaris (NCBI Accession Number: XP_007149885) as an example of the promoter As an example of the promoter of the apple (Malus domestica) -derived RPS5A gene (NCBI Accession Number: XP_008359524), the promoter containing the base sequence shown in 13 is the promoter containing the base sequence shown in SEQ ID NO: 14, RPS5A derived from Medicago truncatula. An example of a promoter of a gene (NCBI Accession Number: XP_013450311) is a promoter containing the base sequence shown in SEQ ID NO: 15.

The RPS5A promoter has mutations in the base sequence (eg, substitution, deletion, insertion, addition, etc.) as long as it has the same level of expression control ability as the promoter that controls the expression of the endogenous RPS5A gene in the cell. You may be doing it. In this case, the base sequence of the promoter having the mutation is, for example, 70% or more, preferably 80% or more, more preferably 90% or more with the corresponding base sequence of the promoter that controls the expression of the endogenous RPS5A gene in the cell. , More preferably 95% or more, even more preferably 97% or more, and particularly preferably 99% or more identity. It is desirable that the mutation site is a site other than, for example, a known expression control element (for example, a basal transcription factor binding region, various activator binding regions, etc.). The consensus sequence of the expression control element is already known and can be easily searched on various databases. Examples of such a database include plantpromoterdb (http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/index.cgi).

The Cas protein coding sequence is not particularly limited as long as it is a base sequence encoding the amino acid sequence of the Cas protein.

The Cas protein is not particularly limited as long as it is used in the CRISPR / Cas system, and for example, various proteins capable of binding to a target site of genomic DNA in a complex form with a guide RNA and cleaving the target site are used. can do. As Cas protein, those derived from various organisms are known, for example, Cas9 protein derived from S. pyogenes (type II), Cas9 protein derived from S. solfataricus (type I-A1), Cas9 protein derived from S. solfataricus. (I-A2 type), H. walsbyl-derived Cas9 protein (IB type), E. coli-derived Cas9 protein (IE type), E. coli-derived Cas9 protein (IF type), P. aeruginosa-derived Cas9 protein (IF type), S. Thermophilus-derived Cas9 protein (II-A type), S. agalactiae-derived Cas9 protein (II-A type), S. aureus-derived Cas9 protein, N. meningitidis-derived Cas9 protein, T Examples include Cas9 protein derived from denticola and Cpf1 protein (V type) derived from F. novicida. Among these, Cas9 protein is preferably mentioned, and more preferably Cas9 protein inherently possessed by a bacterium belonging to the genus Streptococcus is mentioned. Information on the amino acid sequences of various Cas proteins and their coding sequences can be easily obtained on various databases such as NCBI.

The Cas protein may be a wild-type double-stranded Cas protein or a nickase-type Cas protein. Double-strand break Cas proteins typically include a domain involved in the cleavage of the target strand (RuvC domain) and a domain involved in the cleavage of the non-target strand (HNH domain). As the nickase-type Cas protein, for example, in any of these two domains of the double-stranded cleaved Cas protein, its cleaving activity is impaired (for example, its cleaving activity is reduced to 1/2, 1/5, Proteins with mutations (to 1/10, 1/100, 1/1000 or less) can be mentioned. Such mutations include, for example, if the double-stranded Cas protein is a Cas9 protein derived from S. pyogenes (amino acid sequence is SEQ ID NO: 16), for example, the 10th amino acid from the N-terminal (aspalanoic acid). Alanine (D10A: mutation in RuvC domain), amino acid 840th from N-terminal (histidine) to alanine (H840A: mutation in HNH domain), amino acid 863th from N-terminal (asparagin) Alanine mutation (N863A: mutation in HNH domain), N-terminal 762th amino acid (glutamic acid) alanine mutation (E762A: RuvCII domain mutation), N-terminal 986th amino acid (aspartic acid) ) To alanine (D986A: mutation in the RuvCIII domain) and the like.

The Cas protein may have a mutation in the amino acid sequence (eg, substitution, deletion, insertion, addition, etc.) as long as its activity is not impaired. From this point of view, the Cas protein is, for example, 85% or more, preferably 90% or more, with the amino acid sequence of the wild-type double-stranded Cas protein or the nickase-type Cas protein based on the wild-type double-stranded Cas protein. , More preferably 95% or more, still more preferably 98% or more identity, and its activity (binding to a target site of genomic DNA in a complex with a guide RNA, said target site It may be a protein having an activity of cleaving). Alternatively, from the same viewpoint, the Cas protein may be one or more (for example, one or more) with respect to the amino acid sequence of the wild-type double-stranded Cas protein or the nickase-type Cas protein based on the wild-type double-stranded Cas protein. Substitutions or deletions of 2 to 100, preferably 2 to 50, more preferably 2 to 20, even more preferably 2 to 10, even more preferably 2 to 5, particularly preferably 2) amino acids , Addition or insertion (preferably conservative substitution), and its activity (activity to bind to a target site of genomic DNA in a complex with a guide RNA and cleave the target site) It may be a protein having. The above "activity" can be evaluated in vitro or in vivo according to or according to a known method.

The Cas protein may be a protein to which a protein such as a known protein tag, signal sequence, or enzyme protein is added, as long as it has the above-mentioned "activity". Examples of protein tags include biotin, His tag, FLAG tag, Halo tag, MBP tag, HA tag, Myc tag, V5 tag, PA tag and the like. Examples of the signal sequence include a nuclear localization signal and the like. Examples of the enzyme protein include various histone-modifying enzymes and deamination enzymes.

In the polynucleotide of the invention, the Cas protein coding sequence is located under the control of the RPS5A promoter. In other words, the Cas protein coding sequence is arranged such that transcription of the sequence is regulated by the RPS5A promoter. As a specific arrangement mode, for example, the Cas protein coding sequence is arranged immediately below the 3'side of the RPS5A promoter (for example, from the base at the 3'end of the RPS5A promoter to the base at the 5'end of the Cas protein coding sequence. The number of base pairs (bp) between them is, for example, 100 bp or less, preferably 50 bp or less).

The polynucleotide of the present invention preferably further comprises a reporter protein expression cassette. When the polynucleotide of the present invention contains a reporter protein expression cassette, plants and seeds that do not contain the polynucleotide can be easily and efficiently selected based on the presence or absence of a signal derived from the reporter.

The reporter protein expression cassette is not particularly limited as long as it is a polynucleotide capable of expressing the reporter protein in a plant that is the subject of the genome editing technique of the present invention. Typical examples of the expression cassette include a promoter and a polynucleotide containing a reporter protein coding sequence arranged under the control of the promoter.

The promoter of the reporter protein expression cassette is not particularly limited, and examples thereof include organ-nonspecific constitutive promoters such as CaMV35S promoter, UBQ (ubiquitin) promoter, and NOS promoter; and organ-specific promoters such as OLE1 promoter. Among these, a seed-specific promoter such as the OLE1 promoter is preferably mentioned, and a seed-specific promoter such as the OLE1 promoter is more preferable.

The reporter protein coding sequence is not particularly limited as long as it is a base sequence encoding the amino acid sequence of the reporter protein.

The reporter protein is not particularly limited, and examples thereof include a luminescent (color-developing) protein that reacts with a specific substrate to emit light (color-developing), a fluorescent protein that emits fluorescence by excitation light, and the like. Examples of luminescent (color-developing) proteins include luciferase, β-galactosidase, chloramphenicol acetyltransferase, β-glucuronidase, etc., and examples of fluorescent proteins include GFP, Azami-Green, ZsGreen, GFP2, HyPer, Sirius, BFP, etc. Examples include CFP, Turquoise, Cyan, TFP1, YFP, Venus, ZsYellow, Banana, KusabiraOrange, RFP, DsRed, AsRed, Strawberry, Jred, KillerRed, Cherry, HcRed, mPlum and the like. The reporter protein includes a fusion protein of a luminescent (color-developing) protein or a fluorescent protein and another protein (for example, a seed-specific protein), a protein tag known for the luminescent (color-developing) protein or the fluorescent protein, and a known signal. Proteins to which sequences and the like are added are also included.

As an embodiment of the "reporter protein coding sequence arranged under the control of the promoter", for example, the reporter protein coding sequence is arranged immediately below the 3'side of the promoter (for example, the reporter protein code from the base at the 3'end of the promoter). The number of base pairs (bp) between the bases at the 5'end of the sequence is, for example, 100 bp or less, preferably 50 bp or less).

The polynucleotide of the present invention preferably contains a transcription termination signal from the Cas protein coding sequence downstream. This makes it possible to express the Cas protein more efficiently, which in turn makes it possible to further increase the efficiency of genome editing.

The termination signal is not particularly limited as long as it is a base sequence capable of terminating transcription from the Cas protein coding sequence (preferably, a polyA sequence can be added to the mRNA transcribed from the Cas protein coding sequence). Examples of the termination signal include heat shock protein terminator (HspT), NosT (Noparin synthase Terminator), 35sT (CaMV35S Terminator) and the like. Among these, heat shock protein termination signals are preferably mentioned from the viewpoint of genome editing efficiency.

"Downstream of the Cas protein coding sequence" is not particularly limited, but for example, the base pair number (bp) between the 3'end base of the Cas protein coding sequence and the 5'end base of the termination signal is, for example, 500. An embodiment of bp or less, preferably 200 bp or less can be mentioned.

The polynucleotide of the present invention preferably further comprises a guide RNA expression cassette. Since the Cas protein expression cassette and the guide RNA expression cassette are present in the same molecule (polynucleotide), the efficiency of introduction into cells can be further increased, and thus the efficiency of genome editing can be further enhanced. Is.

The guide RNA expression cassette is not particularly limited as long as it is a polynucleotide used for the purpose of expressing guide RNA in a plant that is the subject of the genome editing technique of the present invention. Typical examples of the expression cassette include a promoter and a polynucleotide containing a coding sequence of all or part of a guide RNA arranged under the control of the promoter.

The promoter of the guide RNA expression cassette is not particularly limited, and a pol II promoter can be used, but a pol III promoter is preferable from the viewpoint of more accurately transcribing a relatively short RNA. Examples of the pol II promoter include the CaMV35S promoter, RPS5A promoter, UBQ promoter, NOS promoter and the like. Examples of the pol III promoter include a U6-snRNA (for example, U6.1-snRNA, U6.26-snRNA, etc.) promoter, a U3-snRNA promoter, and the like.

The guide RNA coding sequence is not particularly limited as long as it is a base sequence encoding the guide RNA.

The guide RNA is not particularly limited as long as it is used in the CRISPR / Cas system, and for example, the Cas protein can be induced to the target site of the genomic DNA by binding to the target site of the genomic DNA and binding to the Cas protein. Various things can be used.

In the present specification, the target site is a PAM (Proto-spacer Adjacent Motif) sequence and a 17 to 30 base length (preferably 18 to 25 base length, more preferably 19 to 22 base length) adjacent to the 5'side thereof. Particularly preferably, it is a site on genomic DNA consisting of a DNA strand (target strand) consisting of a sequence having a length of about 20 bases) and its complementary DNA strand (non-target strand).

The PAM sequence depends on the type of Cas protein used. For example, the PAM sequence corresponding to the Cas9 protein (type II) derived from S. pyogenes is 5'-NGG, and the PAM sequence corresponding to the Cas9 protein (type I-A1) derived from S. solfataricus is 5'-CCN. Yes, the PAM sequence corresponding to the Cas9 protein (I-A2 type) derived from S. solfataricus is 5'-TCN, and the PAM sequence corresponding to the Cas9 protein (IB type) derived from H. walsbyl is 5'-TTC. Yes, the PAM sequence corresponding to the E. coli-derived Cas9 protein (IE type) is 5'-AWG, and the PAM sequence corresponding to the E. coli-derived Cas9 protein (IF type) is 5'-CC. The PAM sequence corresponding to the Cas9 protein (IF type) derived from P. aeruginosa is 5'-CC, and the PAM sequence corresponding to the Cas9 protein (II-A type) derived from S. Thermophilus is 5'-NNAGAA. The PAM sequence corresponding to the Cas9 protein derived from S. agalactiae (type II-A) is 5'-NGG, and the PAM sequence corresponding to the Cas9 protein derived from S. aureus is 5'-NGRRT or 5'-NGRRN. The PAM sequence corresponding to the Cas9 protein derived from N. meningitidis is 5'-NNNNGATT, and the PAM sequence corresponding to the Cas9 protein derived from T. denticola is 5'-NAAAAC.

The guide RNA has a sequence (sometimes called a crRNA (CRISPR RNA) sequence) involved in the binding of genomic DNA to the target site, and this crRNA sequence excludes the PAM sequence complementary sequence of the non-target strand. By binding complementaryly (preferably complementaryly and specifically) to the sequence, the guide RNA can bind to the target site of genomic DNA.

It should be noted that "complementary" binding is not limited to the case of binding based on a complete complementary relationship (A and T, and G and C), but also a complementary relationship to the extent that hybridization can be performed under stringent conditions. The case of combining based on is also included. Stringent conditions are the melting temperature of the nucleic acid that binds the complex or probe, as taught by Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego CA). It can be determined based on (Tm). For example, as cleaning conditions after hybridization, conditions of about "1 x SSC, 0.1% SDS, 37 ° C." can be mentioned. It is preferable that the hybrid state is maintained even after washing under such conditions. Although not particularly limited, cleaning conditions of "0.5 x SSC, 0.1% SDS, 42 ° C" are listed as stricter hybridization conditions, and "0.1 x SSC, 0.1% SDS, 65 ° C" are listed as stricter hybridization conditions. Can be done.

Specifically, among the crRNA sequences, the sequence that binds to the target sequence is, for example, 90% or more, preferably 95% or more, more preferably 98% or more, still more preferably 99% or more, and particularly preferably 100% or more of the target chain. Has% identity. It is said that 12 bases on the 3'side of the sequence that binds to the target sequence are important for the binding of the guide RNA to the target site. Therefore, if the sequence that binds to the target sequence in the crRNA sequence is not exactly the same as the target strand, the base different from the target strand is 12 bases on the 3'side of the sequence that binds to the target sequence in the crRNA sequence. It is preferable that it exists in other than.

The guide RNA has a sequence involved in binding to the Cas protein (sometimes referred to as a tracrRNA (trans-activating crRNA) sequence), and this tracrRNA sequence binds to the Cas protein to bind the Cas protein. It can be directed to a target site of genomic DNA.

The tracrRNA sequence is not particularly limited. The tracrRNA sequence is typically an RNA consisting of a sequence having a length of about 50 to 100 bases capable of forming a plurality of (usually three) stem loops, and the sequence varies depending on the type of Cas protein used. .. As the tracrRNA sequence, various known sequences can be adopted depending on the type of Cas protein to be used.

The guide RNA usually includes the crRNA sequence and the tracr RNA sequence described above. The mode of the guide RNA may be a single-strand RNA (sgRNA) containing a crRNA sequence and a tracr RNA sequence, or an RNA complex in which an RNA containing a crRNA sequence and an RNA containing a tracrRNA sequence are complementarily linked. It may be a body.

As an embodiment of "the coding sequence of the whole or a part of the guide RNA arranged under the control of the promoter", for example, the coding sequence of the whole or a part of the guide RNA is arranged just below the 3'side of the promoter (for example, The number of base pairs (bp) between the base at the 3'end of the promoter and the base at the 5'end of the reporter protein coding sequence is, for example, 100 bp or less, preferably 50 bp or less).

As a specific example of the expression cassette of the guide RNA, for example, when the guide RNA is a single-stranded RNA (sgRNA) containing a crRNA sequence and a tracr RNA sequence, the promoter and the crRNA coding sequence arranged under the control of the promoter are used. Examples thereof include a polynucleotide containing a tracrRNA coding sequence arranged at the insertion site and downstream of the site, a promoter, and a polynucleotide containing an sgRNA coding sequence arranged under the control of the promoter. As another example, when the guide RNA is an RNA complex in which an RNA containing a crRNA sequence and an RNA containing a tracrRNA sequence are complementarily bound, a promoter and a typical example of an expression cassette of the guide RNA are used. An expression cassette (crRNA expression cassette) containing an "RNA containing a crRNA sequence" coding sequence (or a site for inserting a crRNA coding sequence) placed under the control of the promoter, a promoter, and a promoter, and a promoter placed under the control of the promoter. In addition, a combination with an expression cassette (tracrRNA expression cassette) containing an "RNA containing a tracrRNA sequence" coding sequence can be mentioned.

The site for inserting a crRNA coding sequence is not particularly limited as long as it has a sequence suitable for inserting a polynucleotide containing an arbitrary crRNA coding sequence. Examples of the site include a sequence containing one or more restriction enzyme sites.

In addition to the above, the polynucleotide of the present invention may contain other sequences as long as it does not significantly interfere with the expression of Cas protein under the control of the RPS5A promoter. The other sequence is not particularly limited, and various known sequences that can be contained in the expression vector can be adopted. Examples of such a sequence include an origin of replication, a drug resistance gene, and the like.

Examples of the drug resistance gene include a chloramphenicol resistance gene, a tetracycline resistance gene, a neomycin resistance gene, an erythromycin resistance gene, a spectinomycin resistance gene, a canamycin resistance gene, a hyglomycin resistance gene, a puromycin resistance gene and the like.

When the polynucleotide of the present invention is introduced into a plant body or a plant cell by the agrobacterium method, the polynucleotide of the present invention usually contains the above-mentioned sequences (RPS5A promoter and Cas protein code arranged under the control of the promoter). In addition to sequence A containing the sequence and optionally the reporter protein expression cassette, transcription termination signal, guide RNA expression cassette, other sequences, etc.), the left and right border regions are included. The left bounding region is located to the left of array A and the right bounded region is located to the right of array A.

From the viewpoint of genome editing efficiency and the like, it is desirable that the guide RNA expression cassette is not located in the immediate vicinity of the right boundary region. Specifically, the base length from the base at the 3'end of the guide RNA expression cassette to the base at the 5'end of the right boundary region is, for example, 50 bp, preferably 100 bp, more preferably 200 bp, and even more preferably 500 bp. ..

The polynucleotide of the present invention can be easily prepared according to a known genetic engineering technique. For example, it can be prepared by utilizing PCR, restriction enzyme cleavage, DNA ligation technique, in vitro transcription technique and the like.

The polynucleotide of the present invention may constitute a vector. The type of vector is not particularly limited, for example, agrobacterium vector; tobacco mosaic virus, cucumber mosaic virus, African cassaba mosaic virus, apple small spherical latent virus, barley spotted leaf mosaic virus, Bean pod mottle virus, Beet curly top. virus, Brome mosaic virus, Cabbage leaf curl virus, Cotton leaf crumple virus, Symbidium mosaic virus, Grape A virus, Pea early browning virus, Poplar mosaic virus, Potato X virus, Rice tungro bacilliform virus, Satellite tobacco mosaic virus, Tobacco curly shoot Examples thereof include plant virus vectors such as virus and tobacco stem virus. In addition to vectors suitable for introduction into plants or plant cells, such as the above-mentioned vectors, vectors for transferring the polynucleotide of the present invention to such vectors (for example, gateway (registered trademark)). Entry clone vector, etc.) can also be mentioned as an example.

2. Plant Genome Editing Method, Genome-Edited Plant Body or Plant Cell Production Method These plants or plants by a method comprising the step of introducing the polynucleotide of the present invention or a vector containing the polynucleotide into a plant body or plant cell. The genome of the cell can be edited. If the polynucleotide of the present invention does not contain a guide RNA expression cassette, the method may include a step of introducing a polynucleotide containing a guide RNA expression cassette or a vector containing the polynucleotide. If necessary, a step of introducing a donor polynucleotide used in the CRISPR / Cas system or a vector containing the polynucleotide may be included.

The target of introduction is a plant body or a plant cell. Examples of the introduction site in the plant include flowers (particularly, egg cells, pollen, etc. in flowers), leaves, roots, and the like. From the viewpoint of more efficiently performing genome editing in germ cells in order to transmit mutations due to genome editing to the next generation, flowers are preferably introduced.

The introduction method is not particularly limited, and can be appropriately selected according to the type of the object to be introduced and the introduction target. Examples of the introduction method include an Agrobacterium method such as a floral dip method and a floral spray method; a particle gun method; and a virus-mediated nucleic acid delivery. Among these, the Agrobacterium method is preferably mentioned from the viewpoint of convenience and safety.

When the introduction target is a plant, seeds are obtained from the plant (T0 generation) obtained in the above introduction step, and seeds in which the polynucleotide of the present invention has been successfully introduced are selected from the seeds. By cultivating selected seeds (T1 generation), genome-edited plants can be obtained with higher efficiency (in more cells and tissues). Seeds in which the polynucleotide of the present invention has been successfully introduced can be selected by the corresponding drug if the polynucleotide of the present invention contains a drug resistance gene, or the polynucleotide of the present invention can be used. If it contains a reporter gene, it can be selected based on the presence or absence of a reporter signal.

According to the genome editing technology of the present invention, it is possible to obtain a genome-edited plant with higher efficiency (in more cells and tissues) in this T1 generation, and higher genome editing efficiency is also obtained in germ cells. Since it is obtained, the mutation due to genome editing can be transmitted to the next generation with higher efficiency.

Therefore, for example, seeds are obtained from a T1 generation plant, and seeds containing no polynucleotide of the present invention are selected from the seeds based on the presence or absence of a reporter signal, and the selected seeds (T2 generation). By cultivating the seeds and confirming that the desired genome editing has occurred as necessary, the genome has already been edited and the polynucleotide of the present invention is not contained (that is, the CRISPR / Cas system is not functioning). As a result, it is possible to easily and efficiently obtain a plant (in a state where the off-target effect is suppressed).

3. 3. Composition for editing plant genome, kit for editing plant genome The polynucleotide of the present invention and a vector containing the polynucleotide can be used as a composition for editing plant genome, or as a kit for editing plant genome. You can also.

The composition for editing the plant genome is not particularly limited as long as it contains the polynucleotide of the present invention, and may further contain other components if necessary. The other components are not particularly limited as long as they are pharmaceutically acceptable components, but are, for example, bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, and binders. , Disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents and the like. If the polynucleotide of the present invention does not contain a guide RNA expression cassette, the composition for editing the plant genome may contain a polynucleotide containing a guide RNA expression cassette, if necessary. It may also contain donor polynucleotides, if desired. Donor polynucleotides allow knock-in with the CRISPR / Cas system.

The genome editing kit is not particularly limited as long as it contains the polynucleotide of the present invention, and if necessary, other materials necessary for carrying out the genome editing method of the present invention, such as nucleic acid transfer reagents and buffers, Reagents, instruments and the like may be appropriately contained. Other materials necessary for carrying out the genome editing method of the present invention include, if the polynucleotide of the present invention does not contain a guide RNA expression cassette, a polynucleotide containing a guide RNA expression cassette, and if necessary. Donor polynucleotides may be mentioned accordingly. Donor polynucleotides allow knock-in with the CRISPR / Cas system.

Hereinafter, the present invention will be described in detail based on examples, but the present invention is not limited to these examples.

Comparative Example 1: Preparation of p35S-Cas9 vector
A vector in which the FLAG-NLS-Cas9 coding sequence was arranged under the control of the 35S promoter (p35S-Cas9 vector: a schematic diagram of the structure is shown in FIG. 1) was prepared as follows.

Contains the coding sequence (SEQ ID NO: 18) of S. pyogenes-derived Cas9 protein (FLAG-NLS-Cas9: SEQ ID NO: 17) with a FLAG tag added to the N-terminal and a nuclear translocation signal added to the N-terminal and C-terminal. Using DNA as a primer, a primer (Cas9_F (cacc) (SEQ ID NO: 19) and Cas9_R (+ stop) (SEQ ID NO: 20)) to which a TOPO site insertion sequence was added was used, and pX330-U6-Chimeric_BB- was used as a template DNA. It was amplified by PCR using the CBh-hSpCas9 vector (Addgene plasmid # 42230). The obtained DNA fragment was inserted into the TOPO site of pENTR / D-TOPO (manufactured by Thermo Fisher Scientific). From the obtained vector (pENTR / D-TOPO Cas9 vector), a DNA fragment containing the FLAG-NLS-Cas9 coding sequence was transferred to the pFAST-R02 vector (International Publication No. 2009/145180) by the LR reaction of the gateway system. Transferred to obtain the p35S-Cas9 vector.

Comparative Example 1A: Preparation of p35S-Cas9 PDS3 vector
A vector (p35S-Cas9 PDS3 vector) in which a guide RNA expression cassette targeting the PHYTOENE DESATURASE 3 (PDS3) gene was incorporated into the p35S-Cas9 vector was prepared as follows.

A forward primer (U6.26p_F + Hind3 + linkr (SEQ ID NO: 21)) to which a HindIII recognition sequence has been added as a primer using DNA containing the U6.26 promoter (DNA fragment 1), and a reverse primer to which the sequence A has been added (SEQ ID NO: 21). It was amplified by PCR using PDS3sgRNA_R (SEQ ID NO: 22)) and a vector containing the U6.26 promoter as template DNA.

Separately, a DNA containing a guide RNA coding sequence targeting the PDS3 gene (DNA fragment 2) is added with a forward primer (PDS3sgRNA_F (SEQ ID NO: 23)) to which sequence B is added as a primer, and a HindIII recognition sequence is added. It was amplified by PCR using the reverse primer (sgRNA_R + Hind3 + linkr (SEQ ID NO: 24)) and a vector containing an sgRNA coding sequence targeting the PDS gene as a template DNA. In addition, the sequence A and the sequence B are in a complementary sequence relationship with each other.

Using a mixture of DNA fragment 1 and DNA fragment 2 as template DNA, a forward primer (U6.26p_F + Hind3 + linkr (SEQ ID NO: 21)) to which a HindIII recognition sequence has been added as a primer, and a reverse primer to which a HindIII recognition sequence has been added. PCR was performed using (sgRNA_R + Hind3 + linkr (SEQ ID NO: 24)). As a result, the DNA fragment formed by linking the DNA fragment 1 and the DNA fragment 2 is amplified based on the complementarity of the sequences A and B. The obtained DNA fragment (U6.26p :: PDS3sgRNA) was inserted into the HindIII site of the p35S-Cas9 vector to obtain the p35S-Cas9 PDS3 vector.

Comparative Example 2: Preparation of pX2-Cas9 vector
A vector in which the FLAG-NLS-Cas9 coding sequence was arranged under the control of the WOX2 promoter (pX2-Cas9 vector: a schematic diagram of the structure is shown in FIG. 1) was prepared as follows.

A primer (WOX2p_FWD (SEQ ID NO: 26) and WOX2p_RVS) to which a restriction enzyme (NotI, NcoI) recognition sequence has been added using DNA containing the WOX2 promoter (SEQ ID NO: 25: Dev. Cell, 2010, 20: 264-270.) As a primer (SEQ ID NO: 27)) was used, and a vector containing the WOX2 promoter (MU14) was used as the template DNA for amplification by PCR. The obtained DNA fragment was transferred to the pENTR / D-TOPO Cas9 vector, which is an intermediate product of Comparative Example 1, at the NotI site and the NcoI site (both (existing adjacent to the 5'side of the FLAG-NLS-Cas9 coding sequence)). The heat shock protein 18.2 termination signal (Plant Cell Physiol. 2010. 51: 328) was added to the AscI site of the obtained vector (adjacent to the 3'side of the FLAG-NLS-Cas9 coding sequence). -332.) Was inserted by Gibson assembly. From the obtained vector, a DNA fragment containing the WOX2 promoter, FLAG-NLS-Cas9 coding sequence, and heat shock protein 18.2 termination signal was pFAST by LR reaction of the gateway system. -Transferred to the R01 vector (International Publication No. 2009/145180) to obtain the pX2-Cas9 vector.

Comparative Example 2A: Preparation of pX2-Cas9 PDS3 vector
A vector (pX2-Cas9 PDS3 vector) in which a guide RNA expression cassette targeting the PHYTOENE DESATURASE 3 (PDS3) gene was incorporated into the pX2-Cas9 vector was prepared as follows.

A DNA fragment (U6.26p :: PDS3sgRNA), which is an intermediate product of Comparative Example 1A, was inserted into the HindIII site of the pUC19 vector. Using this DNA fragment as a template DNA, and adding a Gibson assembly sequence as a primer (U6.26p_F_GbAs (Sbf1) (SEQ ID NO: 28) and sgRNA_R_GbAs (Sbf1) (SEQ ID NO: 29)) ) Was amplified by PCR. The obtained DNA fragment was inserted into the SbfI site of the pX2-Cas9 vector by a Gibson assembly to obtain a pX2-Cas9 PDS3 vector.

Example 1: Preparation of p5A-Cas9 (pKIR1.0) vector
A vector in which the FLAG-NLS-Cas9 coding sequence is arranged under the control of the RPS5A promoter (p5A-Cas9 (pKIR1.0) vector: a schematic diagram of the structure is shown in FIG. 1) was prepared as follows. ..

A primer (RPS5Ap_FWD (SEQ ID NO: 31) and RPS5Ap_RVS) to which a restriction enzyme (NotI, NcoI) recognition sequence has been added using DNA containing the RPS5A promoter (SEQ ID NO: 30: Dev. Cell, 2013, 25: 317-323.) As a primer. (SEQ ID NO: 32)) and a vector containing the RPS5A promoter (DKv39) as a template DNA was used for amplification by PCR. The obtained DNA fragment was transferred to the pENTR / D-TOPO Cas9 vector, which is an intermediate product of Comparative Example 1, at the Not I site and the Nco I site (both exist adjacent to the 5'side of the FLAG-NLS-Cas9 coding sequence). Used and incorporated. Gibson assembly of heat shock protein 18.2 termination signal (Plant Cell Physiol. 2010. 51: 328-332.) To the AscI site of the obtained vector (located adjacent to the 3'side of the FLAG-NLS-Cas9 coding sequence). Inserted by Lee. From the obtained vector (pENTR / D-TOPO RPS5Ap-Cas9-hspT vector), a DNA fragment containing the RPS5A promoter, FLAG-NLS-Cas9 coding sequence, and heat shock protein 18.2 termination signal was obtained by the LR reaction of the gateway system. The pFAST-R01 vector (International Publication No. 2009/145180) was transferred to obtain a p5A-Cas9 (pKIR1.0) vector.

Example 1A: Preparation of pKIR1.0 PDS3 vector
A vector (pKIR1.0 PDS3 vector) in which a guide RNA expression cassette targeting the PHYTOENE DESATURASE 3 (PDS3) gene was incorporated into the pKIR1.0 vector was prepared as follows.

A DNA fragment (U6.26p :: PDS3sgRNA), which is an intermediate product of Comparative Example 1A, was inserted into the HindIII site of the pUC19 vector. Using this DNA fragment as a template DNA, and adding a Gibson assembly sequence as a primer (U6.26p_F_GbAs (Sbf1) (SEQ ID NO: 28) and sgRNA_R_GbAs (Sbf1) (SEQ ID NO: 29)) ) Was amplified by PCR. The obtained DNA fragment was inserted into the SbfI site of the pKIR1.0 vector by Gibson assembly to obtain the pKIR1.0 PDS3 vector.

Example 1B: Preparation of pKIR1.0 AG vector
A vector (pKIR1.0 AG vector) in which a guide RNA expression cassette targeting the AGAMOUS (AG) gene was further incorporated into the pKIR1.0 vector was prepared in the same manner as in Example 1A. In this example, AG_sgRNA_R (SEQ ID NO: 33) is used as a reverse primer for amplifying the DNA fragment corresponding to DNA fragment 1 (Comparative Example 1A), and the DNA fragment corresponding to DNA fragment 2 (Comparative Example 1A) is amplified. AG_sgRNA_F (SEQ ID NO: 34) was used as the forward primer.

Example 1C: Preparation of pKIR1.0 DUO1 vector
A vector (pKIR1.0 DUO1 vector) in which a guide RNA expression cassette targeting the DUO POLLEN 1 (DUO1) gene was further incorporated into the pKIR1.0 vector was prepared in the same manner as in Example 1A. In this example, DUO1sgRNA_RVS (SEQ ID NO: 35) is used as a reverse primer for amplifying the DNA fragment corresponding to DNA fragment 1 (Comparative Example 1A), and the DNA fragment corresponding to DNA fragment 2 (Comparative Example 1A) is amplified. DUO1sgRNA_FWD (SEQ ID NO: 36) was used as the forward primer.

Example 1D: Preparation of pKIR1.0 ADH1-1 vector
A vector (pKIR1.0 ADH1-1 vector) in which a guide RNA (ADH1-1) expression cassette targeting the ALCOHOL DEHYDROGENASE 1 (ADH1) gene is further incorporated into the pKIR1.0 vector is the same as in Example 1A. Made. In this example, ADH1sgRNA1_RVS (SEQ ID NO: 37) is used as a reverse primer for amplifying the DNA fragment corresponding to DNA fragment 1 (Comparative Example 1A), and the DNA fragment corresponding to DNA fragment 2 (Comparative Example 1A) is amplified. ADH1sgRNA1_FWD (SEQ ID NO: 38) was used as the forward primer.

Example 1E: Preparation of pKIR1.0 ADH1-2 vector
A guide RNA (ADH1-2: a guide RNA targeting a site different from ADH1-1 in Example 1D) expression cassette targeting the ALCOHOL DEHYDROGENASE 1 (ADH1) gene is further incorporated into the pKIR1.0 vector. A vector (pKIR1.0 ADH1-2 vector) was prepared in the same manner as in Example 1A. In this example, ADH1sgRNA2_RVS (SEQ ID NO: 39) is used as a reverse primer for amplifying the DNA fragment corresponding to DNA fragment 1 (Comparative Example 1A), and the DNA fragment corresponding to DNA fragment 2 (Comparative Example 1A) is amplified. ADH1sgRNA2_FWD (SEQ ID NO: 40) was used as a forward primer.

Example 2: Preparation of pKI1.0 vector
A site for inserting a crRNA coding sequence (a site containing two AarI recognition sequences) and a guide RNA expression cassette containing a tracrRNA coding sequence located downstream of the site are pENTR / D-TOPO, which are intermediate products of Example 1. A vector (pKI1.0 vector) incorporated into the RPS5Ap-Cas9-hspT vector was prepared as follows.

A forward primer (U6.26p_FWD + NotI (SEQ ID NO: 41)) to which a NotI recognition sequence has been added as a primer using DNA containing the U6.26 promoter (DNA fragment 3), and a reverse primer to which the sequence C has been added (U6. 26p_R_ (Aar1) (SEQ ID NO: 42)) was used, and a vector containing the U6.26 promoter was used as the template DNA for amplification by PCR.

Separately from this, a forward primer (sgRNA_F_ (Aar1)) to which sequence D is added using a crRNA coding sequence insertion site and DNA (DNA fragment 4) containing a tracrRNA coding sequence located downstream of the site as a primer. It was amplified by PCR using SEQ ID NO: 43)) and a reverse primer (sgRNA + polyT + NotI_RVS (SEQ ID NO: 44)) to which a NotI recognition sequence and a polyT signal were added. In addition, the sequence C and the sequence D are in a complementary sequence relationship with each other.

Using a mixture of DNA fragment 3 and DNA fragment 4 as template DNA, a forward primer (U6.26p_FWD + NotI (SEQ ID NO: 41)) to which a NotI recognition sequence has been added as a primer, and a reverse primer to which a NotI recognition sequence and a polyT signal have been added. PCR was performed using a primer (sgRNA + polyT + NotI_RVS (SEQ ID NO: 44)). As a result, the DNA fragment formed by linking the DNA fragment 3 and the DNA fragment 4 is amplified based on the complementarity of the sequences C and D. Insert the obtained DNA fragment (NotI-U6.26p :: 2 × AarI: sgRNA) into the NotI site of the pENTR / D-TOPO RPS5Ap-Cas9-hspT vector (located adjacent to the 5'side of the RPS5A promoter). Then, the pKI1.0 vector was obtained.

Example 3: Preparation of pKIR1.1 vector
A vector (pKIR1.) In which a site for inserting a crRNA coding sequence (a site containing two AarI recognition sequences) and a guide RNA expression cassette containing a tracrRNA coding sequence located downstream of the site are integrated into the pKIR1.0 vector. 1 vector: A schematic diagram of the structure is shown in FIG. 6A) was prepared as follows.

Using DNA containing the U6.26 promoter (DNA fragment 5) as a primer, a forward primer (U6.26p_F_GbAs (Sbf1) (SEQ ID NO: 45)) to which the Gibson assembly sequence has been added, and a reverse primer to which the sequence C has been added. (U6.26p_R_ (Aar1) (SEQ ID NO: 42)) was used, and a vector containing the U6.26 promoter was used as a template DNA for amplification by PCR.

Separately from this, a forward primer (sgRNA_F_ (Aar1)) to which sequence D is added using a crRNA coding sequence insertion site and DNA (DNA fragment 6) containing a tracrRNA coding sequence located downstream of the site as a primer. It was amplified by PCR using SEQ ID NO: 43)) and a reverse primer (sgRNA_R_GbAs (Sbf1) (SEQ ID NO: 46)) to which the Gibson assembly sequence and polyT signal were added. In addition, the sequence C and the sequence D are in a complementary sequence relationship with each other.

A forward primer (U6.26p_F_GbAs (Sbf1) (SEQ ID NO: 45)) to which a Gibson assembly sequence was added as a primer using a mixture of DNA fragment 5 and DNA fragment 6 as template DNA, and a Gibson assembly sequence and polyT signal. PCR was performed using a reverse primer to which was added (sgRNA_R_GbAs (Sbf1) (SEQ ID NO: 46)). As a result, the DNA fragment formed by linking the DNA fragment 5 and the DNA fragment 6 is amplified based on the complementarity of the sequences C and D. The obtained DNA fragment (GbAs-U6.26p :: 2 × AarI: sgRNA) was inserted into the SbfI site of the pKIR1.0 vector by Gibson assembly to obtain a pKIR1.1 vector.

As shown in FIG. 6B, the pKIR1.1 vector can edit the genome of an arbitrary gene (for example, disrupt the gene) by inserting an arbitrary target sequence into the crRNA coding sequence insertion site (AarI × 2). Can be used for.

Test Example 1: Genome Editing Test 1 (PDS3 gene)
The p35S-Cas9 PDS3 vector (Comparative Example 1A), the pX2-Cas9 PDS3 vector (Comparative Example 2A), or the p5A-Cas (pKIR1.0) PDS3 vector (Example 1A) is subjected to Agrobacterium by electroporation. Introduced in tumefaciens GV3101). The obtained Agrobacterium was used to transform Arabidopsis thaliana accession Columbia (Col-0) by the floral dip method (T0 generation). Seeds (T1 generation) were collected from the T0 generation, and seeds emitting red fluorescence were selected. The selected seeds were germinated and cultivated according to a standard method. If genome editing is successful in a cell and the PDS3 gene is disrupted, the cell cannot synthesize pigment and becomes white.

First, when the bright-field image and the autofluorescent image of the T1 generation plant were observed, almost all of them were green (the photograph on the left side of FIG. 2A), and only some of them were green (the photograph of the center of FIG. 2A). ), And when all are white (photograph on the right side of FIG. 2A).

Next, in each of the cotyledons, the first leaf, and the second leaf, the proportion of plants in which the entire pair of two leaves was white was measured. The results are shown in FIG. 2B.

As shown in FIG. 2B, as compared with the case where the Cas protein was expressed by the 35S promoter or the WOX2 promoter using the vectors of Comparative Examples 1A and 2A (in FIG. 2B, p35S-Cas9 and pX2-Cas9), Examples. When the Cas protein was expressed with the RPS5A promoter using the 1A vector (p5A-Cas9 in FIG. 2B), the proportion of plants in which the entire pair of two leaves was white was higher. The difference was more pronounced at the more developed sites (first and second leaves).

Subsequently, the amounts of the three pigments in the further grown site (inflorescence) were measured. Specifically, it was done as follows. T1 generation plants were transferred to medium containing 1.0 mg / L gibberellin A3 to facilitate extraction. After drawing, the first inflorescence was collected and weighed. The collected inflorescences were dipped in 1 mL of N, N-dimethylformamide (DMF) and left in the dark at 4 ° C. overnight. For the obtained solution, the absorbance at wavelengths (480 nm, 647 nm, 664 nm) for detecting each of the three dyes (chlorophyll a, chlorophyll b, carotenoid) was measured using a spectrophotometer (manufactured by DeNovix). bottom. From the absorbance, the amount of each dye was calculated according to the method described in the literature (J. Plant Physiol. 1994. 144: 307-313.). The results are shown in FIG. 2C.

As shown in FIG. 2C, as compared with the case where the Cas protein was expressed by the 35S promoter or the WOX2 promoter using the vectors of Comparative Examples 1A and 2A (in FIG. 2C, p35S-Cas9 and pX2-Cas9), Examples. When the Cas protein was expressed with the RPS5A promoter using the 1A vector (p5A-Cas9 in FIG. 2C), the amount of pigment in the inflorescence was significantly smaller.

From the above, it was shown that by expressing the Cas protein with the RPS5A promoter, a genome-edited plant can be obtained with higher efficiency (in more cells and tissues) in the T1 generation.

Test Example 2: Genome Editing Test 2 (AG gene)
The pKIR1.0 AG vector (Example 1B) was introduced into Agrobacterium (Agrobacterium tumefaciens GV3101) by the electroporation method. The obtained Agrobacterium was used to transform Arabidopsis thaliana accession Columbia (Col-0) by the floral dip method (T0 generation). Seeds (T1 generation) were collected from the T0 generation, and seeds emitting red fluorescence were selected. The selected seeds were germinated and cultivated according to a standard method. If genome editing is successful in a flower bud meristem and the AG gene is disrupted in both alleles, more flowers will appear in the flower (double flower).

As a result, of the 13 cultivated plants, one stopped growing before flowering, but all 12 flowers were double flowers (Fig. 3). From this, it was shown that by expressing the Cas protein with the RPS5A promoter, in the T1 generation, a genome-edited plant can be obtained with extremely high efficiency even in flowers.

Test Example 3: Genome Editing Test 3 (DUO1 gene)
The pKIR1.0 DUO1 vector (Example 1C) was introduced into Agrobacterium (Agrobacterium tumefaciens GV3101) by the electroporation method. The obtained Agrobacterium was used to transform Arabidopsis thaliana qrt1-2 (ABRC stock name: CS8846) mutant by the floral dip method (T0 generation). Seeds (T1 generation) were collected from the T0 generation, and seeds emitting red fluorescence were selected. The selected seeds were germinated and cultivated according to a standard method.

In angiosperms such as white indigo plants, pollen mother cells meiosis into four pollen molecules, mitosis occurs in each of the four microspores, and pollen with two sperm cells is formed. In the strain (qrt1-2 mutant) that is the source of transformation in this test example, the four pollen molecules do not separate from each other even when they mature. If the genome editing of this test example is successful and the DUO1 gene is disrupted, mitosis from male progenitor cells to two spermatogonia will not occur. Therefore,
Pollen by observing four pollen molecules linked to each other and measuring the number of mature pollen in which two sperm cells are observed (na) and the number of pollen in which only one sperm cell-like cell is observed (nb). Whether DUO1 gene disruption occurs in both alleles in the mother cell (na = 0, nb = 4), in only one allele (na = 2, nb = 2), or in which allele It is possible to check whether the destruction has occurred (na = 4, nb = 0). Specifically, the investigation was conducted as follows.

Three flowers were collected from the first inflorescence for each of the 12 T1 generation plants. 100 μL of each flower 4', 6-diamidino-2-phenylindole (DAPI) staining buffer (1 μg / mL DAPI, 0.1% Triton X-100, 1 mM ethylenediaminetetraacetic acid (EDTA), 0.1 M sodium phosphate (pH 7.0) )) Immersed in. After stirring for a short time, the mixture was centrifuged to transfer 4 precipitated pollen molecules onto a slide glass. Four pollen molecules were observed with a microscope (Olympus, BX51N), and a stained image was acquired with a microscope camera (ZEISS, Axiocam 506 color).

The four patterns of the four pollen molecules observed are shown in FIGS. 4A-E. Odd patterns of na and nb (FIGS. 4B and 4D) are thought to indicate mitosis failure from male progenitor cells to two spermatogonia, independent of disruption of the DUO1 gene. The result of measuring the ratio of each pattern of FIGS. 4A-E is shown in FIG. 4F. As shown in FIG. 4, disruption of the DUO1 gene also occurred in germ cells. In particular, for the # 7 and # 10 plants, the DUO1 gene was disrupted at a very high rate in the pollen 4 molecules of all three flowers collected.

In addition, as a result of forward and reverse crossing of a wild strain (Arabidopsis thaliana accession Columbia (Col-0)) and a plant of # 7 or # 10, the plant of # 10 was 100% sterile (Fig. 4G). ). This means that the # 10 plant is a mutant in which the DUO1 gene is not functioning.

Furthermore, as a result of collecting the first stem fresh leaves of the # 10 plant and examining the sequence of the guide RNA target site in the DUO1 gene, it was clarified that single nucleotide (T) insertion occurred (Fig.). 4H). In addition, no significant difference was detected other than the main peak, indicating that the first stem leaves of the # 10 plant were not mosaic.

From the above, it was shown that by expressing the Cas protein with the RPS5A promoter, a genome-edited plant can be obtained in germ cells in the T1 generation.

Test Example 4: Genome Editing Test 4 (ADH1 gene)
The pKIR1.0 ADH1-1 vector (Example 1D) or the pKIR1.0 ADH1-2 vector (Example 1E) was introduced into Agrobacterium (Agrobacterium tumefaciens GV3101) by the electroporation method. The obtained Agrobacterium was used to transform Arabidopsis thaliana accession Columbia (Col-0) by the floral dip method (T0 generation). Seeds (T1 generation) were collected from the T0 generation, and seeds emitting red fluorescence were selected. The selected seeds were germinated and cultivated according to a standard method to obtain seeds (T2 generation). Seeds were treated with 25 mM allyl alcohol according to the method described in the literature (Biochem. Genet. 1988. 26: 105-122.). After that, seeds were sown and cultivated according to a standard method. Seven days after sowing the seeds, the presence or absence of survival was confirmed and the survival rate was calculated.

The ADH1 protein is an enzyme that converts allyl alcohol into a toxic substance called acrolein. Therefore, if the ADH1 gene is disrupted in both alleles in the T2 generation seeds tested, the seeds can survive after allyl alcohol treatment. On the other hand, if the ADH1 gene remains unbroken in the T2 generation seeds used in the test, the seeds cannot survive due to allyl alcohol treatment.

The results are shown in FIG. As shown in FIG. 5, the T2 generation seeds introduced with the pKIR1.0 ADH1-1 vector had a survival rate of 43%, and the T2 generation seeds introduced with the pKIR1.0 ADH1-2 vector had an 81% survival rate. It showed the survival rate. On the other hand, the survival rate of the seeds of the wild strain was 0%, and the survival rate of the seeds of the adh1 mutant (GABI-Kat line ID: 924D03.3) was 96%. From this result, it was shown that by expressing the Cas protein with the RPS5A promoter, mutations due to genome editing can be transmitted to the next generation (T2 generation) with high efficiency.

Example 4: Preparation of pKI1.1R vector
Based on the pKIR1.1 vector (Fig. 6A), a vector in which a guide RNA expression cassette is placed upstream of the RPS5A promoter (pKI1.1R vector: a schematic diagram of the structure is shown in Fig. 7) is prepared as follows. Made.

Both the expression cassette for expressing the Cas9 protein with the RPS5A promoter (having the FLAG-NLS-Cas9 coding sequence and the heat shock protein 18.2 termination signal under the control of the RPS5A promoter) and the guide RNA expression cassette, pENTR / D- A vector (pKI1.1) having on TOPO was prepared, and it was transferred to the pFAST-R01 vector by the LR reaction of the gateway system to prepare pKI1.1R.

In the preparation of pKI1.1, a vector having a site for inserting a crRNA coding sequence (a site containing two AarI recognition sequences) and a guide RNA expression cassette containing a tracrRNA coding sequence located downstream of the site was used as a template for NotI. Amplification was performed by PCR using a forward primer (U6.26p_FWD + NotI) and a reverse primer (sgRNA + polyT + NotI_RVS) to which a recognition sequence was added. By inserting this PCR product into the Not I site of the vector pENTR / D-TOPO RPS5Ap-Cas9-hspT, the guide RNA expression cassette was inserted upstream of the RPS5A promoter in pENTR / D-TOPO RPS5Ap-Cas9-hspT. The product was pKI1.1.
U6.26p_FWD + NotI: CATCGAGCGGCCGCTCGTTGAACAACGGAAACTCGAC (SEQ ID NO: 49)
sgRNA + polyT + NotI_RVS: CATCGAGCGGCCGCAAAAAAAAAAAGCACCGACTCGGT (SEQ ID NO: 50)

Similar to the pKIR1.1 vector, the pKI1.1R vector is the genome of any gene by inserting an arbitrary target sequence into the crRNA coding sequence insertion site (AarI × 2) as shown in FIG. 6B. It can be used for editing (eg, disruption of the gene).

Example 4A: Preparation of pKI1.1R ADH1-2 vector
Insert the target sequence into the crRNA coding sequence insertion site (AarI × 2) of the pKI1.1R vector so that the guide RNA targeting the ADH1 gene (ADH1-2: Example 1E) is expressed, and pKI1.1R An ADH1-2 vector was obtained.

Example 4B: Preparation of pKI1.1R GCS1-1755 vector The target sequence (target1755:) was placed on the crRNA coding sequence insertion site (AarI × 2) of the pKI1.1R vector so that the guide RNA targeting the tomato GCS1 gene was expressed. gaacatctgcatcagttggg (SEQ ID NO: 47)) was inserted to obtain the pKI1.1R GCS1-1755 vector.

Example 4C: Preparation of pKI1.1R GCS1-1967 vector The target sequence (target1967:) was placed on the crRNA coding sequence insertion site (AarI × 2) of the pKI1.1R vector so that the guide RNA targeting the tomato GCS1 gene was expressed. Gaagtcataagaatgagcca (SEQ ID NO: 48)) was inserted to obtain the pKI1.1R GCS1-1967 vector.

Test Example 5: Genome Editing Test 5 (ADH1 gene)
The test was carried out in the same manner as in Test Example 4 except that the pKI1.1R ADH1-2 vector (Example 4A) was used.

The results are shown in FIG. In addition, FIG. 8 also shows the results (FIG. 5) when the pKIR1.0 ADH1-2 vector (Example 1E) was used as a comparison target. As shown in FIG. 8, the T2 generation seeds into which the pKI1.1R ADH1-2 vector was introduced showed a survival rate of 94%. On the other hand, the T2 generation seeds into which the pKIR1.0 ADH1-2 vector was introduced had an 81% survival rate. This suggests that genome editing efficiency is higher when the guide RNA expression cassette is not adjacent to the border region, as in the pKI1.1R ADH1-2 vector.

Test Example 6: Genome Editing Test 6 (GCS1 Gene)
The pKI1.1R GCS1-1755 vector (Example 4B) or the pKI1.1R GCS1-1967 vector (Example 4C) was introduced into Agrobacterium (Agrobacterium tumefaciens GV3101) by the electroporation method. On the other hand, tomato leaf fragments were collected. After infecting the leaf fragments with the obtained Agrobacterium, the leaf fragments were called and shoots (buds) were generated from the callus. As a result of examining the nucleotide sequences around the target site for multiple individuals (4 individuals when the pKI1.1R GCS1-1755 vector was used and 3 individuals when the pKI1.1R GCS1-1967 vector was used), all the individuals In, a plurality of peaks were observed after the target sequence (an example is shown in FIG. 9). This is because the Cas protein cleaved in the target sequence, and random scraping and addition occurred, so that the base sequence differs depending on the cell after the target sequence, that is, genome editing has occurred. show.

Claims (12)

RPS5A promoter, and viewed including the Cas protein coding sequence placed under the control of the promoter, and the Cas protein is Cas9 protein or Cpf1 protein, polynucleotide. The polynucleotide according to claim 1 , further comprising a reporter protein expression cassette. The polynucleotide according to claim 2 , wherein the reporter protein expression cassette is a seed-specific promoter and a polynucleotide containing a reporter protein coding sequence arranged under the control of the promoter. The polynucleotide according to any one of claims 1 to 3 , which comprises a signal for terminating transcription from the Cas protein coding sequence downstream of the Cas protein coding sequence. The polynucleotide according to claim 4 , wherein the termination signal is a heat shock protein termination signal. The polynucleotide according to any one of claims 1 to 5 , further comprising a guide RNA expression cassette. The polynucleotide according to claim 6 , wherein the guide RNA expression cassette is a site for inserting a crRNA coding sequence and a polynucleotide containing a tracrRNA coding sequence located downstream of the site. A vector comprising the polynucleotide according to any one of claims 1 to 7. A composition for editing a plant genome, which comprises at least one selected from the group consisting of the polynucleotide according to any one of claims 1 to 7 and the vector according to claim 8. A kit for editing a plant genome, which comprises at least one selected from the group consisting of the polynucleotide according to any one of claims 1 to 7 and the vector according to claim 8. A genome-edited plant comprising the step of introducing into a plant or a plant cell at least one selected from the group consisting of the polynucleotide according to any one of claims 1 to 7 and the vector according to claim 8. A method for producing body or plant cells. A method for editing a plant genome, comprising a step of introducing at least one selected from the group consisting of the polynucleotide according to any one of claims 1 to 7 and the vector according to claim 8 into a plant body or a plant cell.

Images