JP6936626B2 - Half-body wilt resistance marker of tomato plant, half-body wilt-resistant tomato plant, and method for producing half-body wilt-resistant tomato plant using the same. - Google Patents

Description

The present invention relates to a half-body wilt resistance marker of a tomato plant, a half-body wilt-resistant tomato plant, and a method for producing a half-body wilt-resistant tomato plant using the same.

In the cultivation of tomato plants, the disease caused by half-body wilt disease has become a serious problem worldwide. In plants infected with the pathogen of half-body wilt disease, the leaflets of the lower leaves are partially wilted, and a yellowish-white wedge-shaped discolored part is formed in that part. After that, the entire leaf slowly yellows, and eventually the plant turns brown and dies (Non-Patent Document 1). As a result, the yield of fruits is reduced by up to 67% (Non-Patent Document 2).

Therefore, resistance to half-body wilt disease (for example, Ve1 gene (verticillium wilt disease resistance gene Ve1), Ve2 gene (verticillium wilt disease resistance gene Ve2)) is used to show resistance to the pathogen of half-body wilt disease. Attempts have been made to grow varieties. However, a pathogen of half-body wilt disease (race 3) capable of infecting tomato plants containing these resistance genes has emerged and has become a problem (Non-Patent Documents 3 and 4).

Source of energy in Kochi Kochi Agricultural Net, "Tomato Half-Body Wilt", [online], [Searched May 17, 2016], Internet <http://www.nogyo.tosa.pref.kochi.lg.jp /info/dtl.php?ID=3253> L. J. Ashworth, Jr. et. Al., “Verticillium Wilt Disease of Tomato: Influence of Inoculum Density and Root Extension Upon Disease Severity”, Phytopathology, 1979, vol.69, pages 490-492 R. G. Grogan et. Al., “Verticillium Wilt on Resistant Tomato Cultivars in California: Virulence of Isolates from Plants and Soil and Relationship of Inoculum Density to Disease Incidence”, Phytopathology, vol.69, pages 1176-1180 Kohei Yoshino, "About the New Race of Tomato Half-Body Wilt Disease (Race 3)", Journal of the Japanese Society of Plant Pathology, November 2014, Vol. 80, No. 4, p. 252 (66)

Therefore, an object of the present invention is to provide a new marker for half-body wilt resistance, a half-body wilt-resistant tomato plant, and a method for producing a half-body wilt-resistant tomato plant using the same.

In order to achieve the above object, the half-body wilt disease resistance marker (hereinafter, also referred to as “resistance marker”) of the tomato plant of the present invention is a half-body wilt disease resistance locus on chromosome 7 (hereinafter, “resistance”). It is characterized by containing (also referred to as "sex locus").

The half-body wilt-resistant tomato plant of the present invention (hereinafter, also referred to as “resistant tomato plant”) is characterized by containing a half-body wilt resistance locus on chromosome 7.

The method for producing a half-body wilt-resistant tomato plant (hereinafter, also referred to as "production method") of the present invention is characterized by including the following steps (a) and (b).
(A) Step of crossing the half-body wilt-resistant tomato plant of the present invention with another tomato plant (b) Half-body wilt resistance from the tomato plant or its progeny line obtained from the above-mentioned step (a). Process of selecting tomato plants

As a result of diligent research, the present inventors have found a novel half-body wilt resistance locus in tomato plants as a half-body wilt resistance marker showing resistance to half-body wilt disease. In addition, the tomato plant containing the resistance marker exhibits resistance to half-body wilt disease. Therefore, according to the half-body wilt resistance marker of the tomato plant of the present invention, for example, a half-body wilt resistant tomato plant can be easily screened. Further, since the tomato plant resistant to half-body wilt disease of the present invention contains, for example, the resistance locus, it is possible to exhibit resistance to half-body wilt disease, for example. Further, the tomato plant containing the resistance marker is resistant to, for example, a pathogen of half-body wilt disease (for example, race 3) capable of infecting the tomato plant containing the resistance gene of the prior art document. show. Therefore, since the half-body wilt-resistant tomato plant of the present invention does not need to be controlled by a pesticide as in the conventional case, for example, the problem of labor and cost of spraying the pesticide can be avoided.

FIG. 1 is a schematic diagram showing relative locus positions of SNPs (single nucleotide polymorphisms) and the like on chromosome 7. FIG. 2 is a photograph showing the evaluation criteria of the disease index of tomato plants in Example 1. FIG. 3 is a graph showing the relationship between the position on chromosome 7 and the rod score in Example 3. FIG. 4 is a graph showing the relationship between the position on chromosome 7 and the rod score in Example 5.

1. 1. Half-Body Wilt Disease Resistance Marker of Tomato Plant The half-body wilt disease resistance marker of the tomato plant of the present invention is characterized by including the half-body wilt disease resistance gene locus on chromosome 7 as described above. The resistance marker of the present invention is characterized by including the half-body wilt disease resistance locus on the 7th chromosome, and other configurations and conditions are not particularly limited.

In the present invention, the "tomato plant" is a plant classified into the Section Lycoperson in the Subgenus Solanum Sensu strike of the Solanam genus Solanum , and as a specific example, S. cerevisiae S. lycopersicum, S. peruvianum, S. arcanum Peralta, S. children , S. corneliomulelli , S. huaylasense Peralta, S. cheesmaniae (L.Riley) Fosberg, S. chmielewskii, S. galapagense S. C. Darwin & Peralta, S. habrochaites, S. neorickii , S. pennelli , S. Pimpinellifolium and the like can be mentioned, and preferably, S. cerevisiae, which is easy to cross. It is a lycopersicum.

In the present invention, examples of the pathogenic bacterium of the half-body wilt disease (hereinafter, also referred to as "half-body wilt disease bacterium") include filamentous fungi. Examples of the filamentous fungus include Verticillium dahliae .

In the present invention, "half-body wilt resistance" is also referred to as, for example, "half-body wilt resistance". The resistance means, for example, the ability to inhibit or suppress the onset and progression of a disease caused by infection with a half-body wilt disease bacterium, and specifically, for example, the non-occurrence of the disease, the cessation of the progression of the disease that has occurred, and the occurrence of the disease. Any of these may be used, such as suppressing the progression of the disease (also referred to as "inhibition").

The resistance markers of the present invention include the resistance loci on the 7th chromosome, but the tomato plant having the resistance loci is, for example, on any chromosome other than the 7th chromosome instead of the 7th chromosome. May have the resistance locus on the 7th chromosome. That is, the tomato plant having the resistance locus includes the first chromosome, the second chromosome, the third chromosome, the fourth chromosome, the fifth chromosome, the sixth chromosome, the eighth chromosome, the ninth chromosome, the tenth chromosome, and the tenth chromosome. The resistance locus on the 7th chromosome may be present on either the 11th chromosome or the 12th chromosome.

The resistance marker of the present invention may contain, for example, the resistance locus on chromosome 7 in a heterozygous manner or in a homozygous manner. In the latter case, the resistant tomato plant may contain at least one resistance marker on a chromosome other than chromosome 7, for example, one resistance locus on a chromosome other than chromosome 7. However, the two resistance loci may be included on chromosomes other than chromosome 7. When two resistance loci are contained on a chromosome other than chromosome 7, the resistant tomato plant may contain, for example, the two resistance loci on the same chromosome or on different chromosomes. good.

A half-body wilt resistance locus means a quantitative trait locus or gene region that provides half-body wilt resistance. The Quantitative Traits Loci (QTL) generally refers to a chromosomal region involved in the expression of a quantitative trait. QTLs can be defined using molecular markers that indicate specific loci on the chromosome. Techniques for defining QTLs using the molecular markers are well known in the art.

In the present invention, the molecular marker used to define the resistance locus is not particularly limited. The molecular markers include, for example, SNP markers, AFLP (amplified fragment length polymorphism) markers, RFLP (restriction fragment length polymorphism) markers, microsatellite markers, SCAR (sequence-characterized amplified region) markers and CAPS. (Cleaved amplified polymorphic sequence) Markers and the like can be mentioned. In the present invention, for the SNP marker, for example, one SNP may be used as the SNP marker, or a combination of two or more SNPs may be used as the SNP marker.

In the present invention, the half-body wilt resistance locus may be, for example, (1) defined by the SNP marker (hereinafter, also referred to as “specification”), or (2) by a base sequence containing the SNP marker. It may be defined by (3) the base sequence of the region between the sites of the two SNP markers, or by a combination thereof. When specified by the combination, the combination is not particularly limited, and for example, the following combinations can be exemplified.
Combination of (1) and (2) Combination of (1) and (3) Combination of (2) and (3) Combination of (1), (2) and (3)

(1) Identification by SNP Marker The resistance locus may be defined by, for example, the SNP marker as shown in (1) above. The SNP markers is not particularly limited, for example, solcap_snp_sl_14174 ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_37097', solcap_snp_sl_12147 ', solcap_snp_sl_12152' and the like. The resistance locus is identified by, for example, at least one SNP marker selected from the group consisting of solcap_snp_sl_100293', solcap_snp_sl_55399, and solcap_snp_sl_37097'. The notation of the SNP marker represented by "solcap_snp_sl_number" can be understood by those skilled in the art from the common general knowledge at the time of filing the application of the present application, and can be understood from the website of the International Consortium for Solanaceae Plant Genome Research (Solanaceae Plant Genome Research International Consortium). It can be viewed at http://solgenomics.net/). For these SNP analyzes, for example, the following documents can be referred to. Also, 'SNP markers other than Solcap_snp_sl_14174 in, solcap_snp_sl_7034' solcap_snp_sl_14174 SNP markers other than Solcap_snp_sl_7034 in, in 'SNP markers other than Solcap_snp_sl_24321 in, solcap_snp_sl_100293' solcap_snp_sl_24321 SNP markers other than Solcap_snp_sl_100293 in, 'SNP markers other than Solcap_snp_sl_100761 in, solcap_snp_sl_55410' solcap_snp_sl_100761 SNP markers other than Solcap_snp_sl_55410, 'SNP markers other than solcap_snp_sl_71138 in, solcap_snp_sl_37097' solcap_snp_sl_71138 SNP markers other than solcap_snp_sl_12152 in 'SNP markers other than Solcap_snp_sl_12147, and solcap_snp_sl_12152 in' SNP markers Solcap_snp_sl_12147 non solcap_snp_sl_37097 in the present inventors have newly The identified SNP marker, and a person skilled in the art can specify the seating position of the SNP marker based on the base sequence containing these SNP markers, which will be described later.
Reference 1: Hamilton JP, Sim SC, Stoffel K, Van Deynze A, Buell CR, et al. (2012) “Single Nucleotide Polymorphism Discovery in Cultivated Tomato via Sequencing by Synthesis.”, The Plant Genome 5.
Reference 2: Sim SC, Durstewitz G, Plieske J, Wieseke R, Ganal MW, et al., (2012) “Development of a Large SNP Genotyping Array and Generation of High-Density.”, Genetic Maps in Tomato. PLoS ONE 7 (7)
Reference 3: Blanca J, Can izares J, Cordero L, Pascual L, Diez MJ, et al., (2012) “Variation Revealed by SNP Genotyping and Morphology Provides Insight into the Origin of the Tomato.”, PLoS ONE 7 ( Ten)

The solcap_snp_sl_14174'(hereinafter, also referred to as "SNP (a)") is an SNP marker set including two SNPs in the solcap_snp_sl_14174 and its vicinity. Further, in the base sequence of SEQ ID NO: 1 below, the base in the underlined portion surrounded by the second parenthesis (the 51st base of SEQ ID NO: 1) is the SNP corresponding to solcap_snp_sl_14174. Hereinafter, the bases underlined in the 1st to 3rd parentheses in the base sequence of SEQ ID NO: 1 below are also referred to as _{SNP (a 1} ), SNP (a ₂ ), and SNP (a _{3), respectively.} The SNP (a) shows, for example, a polymorphism in which the bases 1 to 3 of the underlined bases enclosed in parentheses in SEQ ID NO: 1 are G, G, and G, respectively. That is, for example, when the SNP (a ₁ ), SNP (a ₂ ), and SNP (a ₃ ) in the SNP (a) are G, G, and G, respectively, the tomato plant is resistant to half-body wilt disease. In the case of a combination of bases other than the above combination of bases (for example, in the case of C, A, and A), it indicates that the tomato plant is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 1 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 1
5'-CACCACCA [ G ] TACCTGACCCACTCCCTACTCCAACACCTTTGCCAGCTCCA [ G ] CACCAACACCAACTCCAATACCAATTCCAATTCCAACTCCGAT [ G ] CCTCCA-3'

The SNP (a) can also be identified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 12 is, for example, the base sequence of Heinz (variety name, Heinz 1706) except for the SNP (a), and the base in the underlined portion enclosed in parentheses corresponds to the SNP (a). It is polymorphic. In addition, the bases in the underlined parts in the 1st to 3rd parentheses in SEQ ID NO: 12 below are the bases corresponding to SNP (a ₁ ), SNP (a ₂ ), and SNP (a ₃ ), respectively. That is, for example, when the SNP (a ₁ ), SNP (a ₂ ), and SNP (a ₃ ) in the SNP (a) are G, G, and G, respectively, the tomato plant is resistant to half-body wilt disease. In the case of a combination of bases other than the above combination of bases (for example, in the case of C, A, and A), it indicates that the tomato plant is susceptible to half-body wilt disease. In this way, the position of the SNP (a) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 12
5'-CACCACCA [ G ] TACCTGACCCACTCCCTACTCCAACACCTTTGCCAGCTCCA [ G ] CACCAACACCAACTCCAATACCAATTCCAATTCCAACTCCGAT [ G ] CCTCCA-3'

The solcap_snp_sl_7034'(hereinafter, also referred to as "SNP (b)") is an SNP marker set including four SNPs in the solcap_snp_sl_7034 and its vicinity. Further, in the base sequence of SEQ ID NO: 2 below, the base underlined in parentheses at the 5th position (the 51st base of SEQ ID NO: 2) is the SNP corresponding to solcap_snp_sl_14174. Hereinafter, the bases underlined in the 1st to 5th parentheses in the base sequence of SEQ ID NO: 2 below are also referred to as _{SNP (b 1} ) to _{SNP (b 4} ) and SNP (b _{5), respectively.} The SNP (b) shows, for example, polymorphisms in which the bases 1 to 5 of the underlined bases enclosed in parentheses in SEQ ID NO: 2 are G, G, A, C, and T, respectively. That is, for example, when SNPs (b ₁ ) to SNPs (b ₄ ) and SNPs (b ₅ ) in the SNP (b) are G, G, A, C, and T, respectively, the tomato plant is half-body. In the case of a combination of bases other than the above-mentioned combination of bases (for example, T, A, A, T, and G), the tomato plant is resistant to wilt disease, indicating that the tomato plant is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 2 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 2
5'-T [ G ] AGATC [ G ] AT [ A ] ATCAATGGAAGTTTCTATGATCTCCGATACG [ C ] TAACGGC [ T ] GTGGTAACCACTCAAGGCTTAGGTGTTTCAAAGTTTCTGCTGAATCGCAA-3'

The SNP (b) can also be identified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 13 is, for example, the base sequence of Heinz except for the SNP (b), and the base underlined in parentheses is a polymorphism corresponding to the SNP (b). In addition, the bases in the underlined portions enclosed in parentheses in the 1st to 5th brackets in SEQ ID NO: 13 below are the bases corresponding to SNP (b ₁ ) to _{SNP (b 4} ) and SNP (b ₅ ), respectively. That is, for example, when SNPs (b ₁ ) to SNPs (b ₄ ) and SNPs (b ₅ ) in the SNP (b) are G, G, A, C, and T, respectively, the tomato plant is half-body wilted. In the case of disease resistance and base combinations other than the above base combinations (eg, T, A, A, T, and G), the tomato plant indicates that it is susceptible to half-body wilt disease. In this way, the position of the SNP (b) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 13
5'-T [ G ] AGATC [ G ] AT [ A ] ATCAATGGAAGTTTCTATGATCTCCGATACG [ C ] TAACGGC [ T ] GTGGTAACCACTCAAGGCTTAGGTGTTTCAAAGTTTCTGCTGAATCGCAA-3'

The solcap_snp_sl_24321'(hereinafter, also referred to as "SNP (c)") is an SNP marker set including one SNP in the solcap_snp_sl_24321 and its vicinity. Further, in the base sequence of SEQ ID NO: 3 below, the base in the underlined portion surrounded by the second parenthesis (the 51st base of SEQ ID NO: 3) is the SNP corresponding to solcap_snp_sl_24321. Hereinafter, the bases underlined in the first and second parentheses in the base sequence of SEQ ID NO: 3 below are also referred to as _{SNP (c 1} ) and SNP (c _{2), respectively.} The SNP (c) shows, for example, a polymorphism in which the first and second bases of the underlined bases enclosed in parentheses in SEQ ID NO: 3 are C and A, respectively. That is, for example, when SNP (c ₁ ) and SNP (c ₂ ) in the SNP (c) are C and A, respectively, the tomato plant is resistant to half-body wilt disease, and bases other than the combination of the bases are used. In the case of the combination of (for example, in the case of T and G), the tomato plant indicates that it is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 3 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 3
5'-TGACTTGTCCTATTCCATCAAGGCATTTCACTGCAATCTTTGTGCCATC [ C ] [ A ] CTAAGCACCCTTCAAAAACTGA-3'

The SNP (c) can also be identified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 14 is, for example, the Heinz base sequence except for the SNP (c), and the underlined base enclosed in parentheses is a polymorphism corresponding to the SNP (c). In addition, the bases in the underlined portions enclosed in parentheses in the following SEQ ID NO: 14 are the bases _{corresponding to SNP (c 1} ) and SNP (c ₂ ), respectively. That is, for example, when SNP (c ₁ ) and SNP (c ₂ ) in the SNP (c) are C and A, respectively, the tomato plant is resistant to half-body wilt disease, and bases other than the combination of the bases are used. In the case of the combination of (for example, in the case of T and G), the tomato plant indicates that it is susceptible to half-body wilt disease. In this way, the position of the SNP (c) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 14
5'-TGACTTGTCCTATTCCATCAAGGCATTTCACTGCAATCTTTGTGCCATC [ C ] [ A ] CTAAGCACCCTTCAAAAACTGA-3'

The solcap_snp_sl_100293'(hereinafter, also referred to as "SNP (d)") is an SNP marker set including three SNPs of solcap_snp_sl_100293 and its vicinity. Further, in the base sequence of SEQ ID NO: 4 below, the base underlined in the first parenthesis (the 101st base of SEQ ID NO: 4) is the SNP corresponding to solcap_snp_sl_100293. Hereinafter, the bases underlined in the 1st to 4th parentheses in the base sequence of SEQ ID NO: 4 below are also referred to as _{SNP (d 1} ) to _{SNP (d 3} ) and SNP (d _{4), respectively.} The SNP (d) shows, for example, a polymorphism in which the bases 1 to 4 of the bases in the underlined portion enclosed in parentheses in SEQ ID NO: 4 are G, C, G, and A, respectively. That is, for example, when SNPs (d ₁ ) to SNPs (d ₃ ) and SNPs (d ₄ ) in the SNP (d) are G, C, G, and A, respectively, the tomato plant has resistance to half-body wilt disease. In the case of a base combination other than the above-mentioned base combination (for example, in the case of A, A, A, and T), the tomato plant indicates that it is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 4 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 4
5'-GATTCCTGGTCTTGATCTAGCTACCTCTGTGAAGTTGTATAGTCTGTTCCAGGAAAAGGATTTTGTTGATACAAAAGGTTTCATGAGAAATGACGGGCGT [ G ] CAATACAATGGAAGG [ C ] AGCTCTCAA [ G ] GAGAGAGAGATTATTCTCCC [ A ]

The SNP (d) can also be specified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 15 is, for example, the base sequence of Heinz except for the SNP (d), and the base underlined in parentheses is a polymorphism corresponding to the SNP (d). In addition, the bases in the underlined parts in the 1st to 4th brackets in SEQ ID NO: 15 below are the bases corresponding to SNP (d ₁ ) to _{SNP (d 3} ) and SNP (d ₄ ), respectively. That is, for example, when SNPs (d ₁ ) to SNPs (d ₃ ) and SNPs (d ₄ ) in the SNP (d) are G, C, G, and A, respectively, the tomato plant has resistance to half-body wilt disease. In the case of a base combination other than the above-mentioned base combination (for example, in the case of A, A, A, and T), the tomato plant indicates that it is susceptible to half-body wilt disease. In this way, the position of the SNP (d) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 15
5'-GATTCCTGGTCTTGATCTAGCTACCTCTGTGAAGTTGTATAGTCTGTTCCAGGAAAAGGATTTTGTTGATACAAAAGGTTTCATGAGAAATGACGGGCGT [ G ] CAATACAATGGAAGG [ C ] AGCTCTCAA [ G ] GAGAGAGAGATTATTCTCCC [ A ]

The solcap_snp_sl_100371'(hereinafter, also referred to as "SNP (e)") is an SNP marker set including two SNPs in the solcap_snp_sl_100877 and its vicinity. Further, in the base sequence of SEQ ID NO: 5 below, the underlined base (the 50th base of SEQ ID NO: 5) surrounded by the first parenthesis is the SNP corresponding to solcap_snp_sl_100371. Hereinafter, the bases underlined in the 1st to 3rd parentheses in the base sequence of SEQ ID NO: 5 below are also referred to as _{SNP (e 1} ), SNP (e ₂ ), and SNP (e _{3), respectively.} The SNP (e) represents, for example, a polymorphism in which the bases 1 to 3 of the underlined bases enclosed in parentheses in SEQ ID NO: 5 are A, G, and G, respectively. That is, for example, when the SNP (e ₁ ), SNP (e ₂ ), and SNP (e ₃ ) in the SNP (e) are A, G, and G, respectively, the tomato plant is resistant to half-body wilt disease. In the case of a combination of bases other than the above combination of bases (for example, in the case of C, T, and C), it indicates that the tomato plant is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 5 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 5
5'-TCTCTCTTTTCAGCTCTGTTCCTTCAAAACAGAGTTTTTAAGCATTAGC [ A ] ATATAGGA [ G ] TGAGTAGTAGCAACATGATACAGAAGGTGATTCTTCATGT [ G ] -3'

The SNP (e) can also be identified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 16 is, for example, the base sequence of Heinz except for the SNP (e), and the base underlined in parentheses is a polymorphism corresponding to the SNP (e). In the base sequence of SEQ ID NO: 16 below, for example, between the 10th base (T) and the 11th base (C) in the base sequence of SEQ ID NO: 5, or between the 11th base (C) and the 12th base. The base (C) is inserted between the base (A) and the base (A). In addition, the bases in the underlined parts in the 1st to 3rd parentheses in SEQ ID NO: 16 below are the bases corresponding to SNP (e ₁ ), SNP (e ₂ ), and SNP (e ₃ ), respectively. That is, for example, when the SNP (e ₁ ), SNP (e ₂ ), and SNP (e ₃ ) in the SNP (e) are A, G, and G, respectively, the tomato plant is resistant to half-body wilt disease. In the case of a combination of bases other than the above combination of bases (for example, in the case of C, T, and C), it indicates that the tomato plant is susceptible to half-body wilt disease. In this way, the position of the SNP (e) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 16
5'-TCTCTCTTTTCCAGCTCTGTTCCTTCAAAACAGAGTTTTTAAGCATTAGC [ A ] ATATAGGA [ G ] TGAGTAGTAGCAACATGATACAGAAGGTGATTCTTCATGT [ G ] -3'

The solcap_snp_sl_55410'(hereinafter, also referred to as "SNP (f)") is an SNP marker set including one SNP of solcap_snp_sl_55410 and its vicinity. Further, in the base sequence of SEQ ID NO: 6 below, the base underlined in the first parenthesis (the 51st base of SEQ ID NO: 6) is the SNP corresponding to solcap_snp_sl_55410. Hereinafter, the bases underlined in the first and second parentheses in the base sequence of SEQ ID NO: 6 are also referred to as _{SNP (f 1} ) and SNP (f _{2), respectively.} The SNP (f) shows, for example, a polymorphism in which the first and second bases of the bases in the underlined portion enclosed in parentheses in SEQ ID NO: 6 are G and T, respectively. That is, for example, when SNP (f ₁ ) and SNP (f ₂ ) in the SNP (f) are G and T, respectively, the tomato plant is resistant to half-body wilt disease, and bases other than the combination of the bases are used. In the case of the combination of (eg, in the case of T and C), the tomato plant indicates that it is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 6 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 6
5'-AGCATTAGCTGCTCGAGGGACTTGCAAGTCTTTAGGCCATAAGGGATATT [ G ] CC [ T ] GACAACTTGTTAGACCCGAGGCTCAGGAATGTTAACTTCTGAAACTG-3'

The SNP (f) can also be identified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 17 is, for example, the base sequence of Heinz except for the SNP (f), and the base underlined in parentheses is a polymorphism corresponding to the SNP (f). In addition, the bases in the underlined portions enclosed in parentheses in the following SEQ ID NO: 17 are the bases _{corresponding to SNP (f 1} ) and SNP (f ₂ ), respectively. That is, for example, when SNP (f ₁ ) and SNP (f ₂ ) in the SNP (f) are G and T, respectively, the tomato plant is resistant to half-body wilt disease, and bases other than the combination of the bases are used. In the case of the combination of (eg, in the case of T and C), the tomato plant indicates that it is susceptible to half-body wilt disease. In this way, the position of the SNP (f) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 17
5'-AGCATTAGCTGCTCGAGGGACTTGCAAGTCTTTAGGCCATAAGGGATATT [ T ] CC [ C ] GACAACTTGTTAGACCCGAGGCTCAGGAATGTTAACTTCTGAAACTG-3'

The solcap_snp_sl_55399 (hereinafter, also referred to as “SNP (g)”) indicates, for example, a polymorphism in which the base in the underlined portion enclosed in parentheses in SEQ ID NO: 7 is T. That is, for example, when the base in the underlined portion is T, the tomato plant is resistant to half-body wilt disease, and when the base other than T (for example, C), the tomato plant is susceptible to half-body wilt disease. Show that. In addition, the nucleotide sequence of SEQ ID NO: 7 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 7
5'-TCTCATAAGCATAAAACCAGCTATAGTACCCAATCAACGCAATATCCACA [ T ] AACCAAAAATTATCTCCTCCAAAGTAAGGCTTCTCTCCAAGTGCTCCCTCT-3'

The SNP (g) can also be specified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 18 is, for example, the Heinz base sequence except for the SNP (g), and the underlined base enclosed in parentheses is a polymorphism corresponding to the SNP (g). That is, for example, when the base in the underlined portion is T, the tomato plant is resistant to half-body wilt disease, and when the base other than T (for example, C), the tomato plant is susceptible to half-body wilt disease. Show that. In this way, the position of the SNP (g) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 18
5'-TCTCATAAGCATAAAACCAGCTATAGTACCCAATCAACGCAATATCCACA [ T ] AACCAAAAATTATCTCCTCCAAAGTAAGGCTTCTCTCCAAGTGCTCCCTCT-3'

The solcap_snp_sl_71138'(hereinafter, also referred to as "SNP (h)") is an SNP marker set including two SNPs in the solcap_snp_sl_71138 and its vicinity. Further, in the base sequence of SEQ ID NO: 8 below, the underlined base (the 51st base of SEQ ID NO: 8) surrounded by the first parenthesis is the SNP corresponding to solcap_snp_sl_711138. Hereinafter, the bases underlined in the 1st to 3rd parentheses in the base sequence of SEQ ID NO: 8 below are also referred to as _{SNP (h 1} ), SNP (h ₂ ), and SNP (h _{3), respectively.} The SNP (h) represents, for example, a polymorphism in which the bases 1 to 3 of the bases in the underlined portion enclosed in parentheses in SEQ ID NO: 8 are T, A, and A, respectively. That is, for example, when the SNP (h ₁ ), SNP (h ₂ ), and SNP (h ₃ ) in the SNP (h) are T, A, and A, respectively, the tomato plant is resistant to half-body wilt disease. In the case of a combination of bases other than the above combination of bases (for example, in the case of C, G, and G), it indicates that the tomato plant is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 8 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 8
5'-CCATCAGAGTGGCTAGTCCAAAATCAGATACTCGAGCCTCCATGTTATGA [ T ] CCAACAAGATATT [ A ] CTTGACTTTATATCTCTGTGGATGAT [ A ] TGAGGGATG-3'

The SNP (h) can also be specified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 19 is, for example, the Heinz base sequence except for the SNP (h), and the underlined base enclosed in parentheses is a polymorphism corresponding to the SNP (h). In addition, the bases in the underlined portions enclosed in parentheses in the 1st to 3rd brackets in SEQ ID NO: 19 below are the bases corresponding to SNP (h ₁ ), SNP (h ₂ ), and SNP (h ₃ ), respectively. That is, for example, when the SNP (h ₁ ), SNP (h ₂ ), and SNP (h ₃ ) in the SNP (h) are T, A, and A, respectively, the tomato plant is resistant to half-body wilt disease. In the case of a combination of bases other than the above combination of bases (for example, in the case of C, G, and G), it indicates that the tomato plant is susceptible to half-body wilt disease. In this way, the position of the SNP (h) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 19
5'-CCATCAGAGTGGCTAGTCCAAAATCAGATACTCGAGCCTCCATGTTATGA [ T ] CCAACAAGATATT [ A ] CTTGACTTTATATCTCTGTGGATGAT [ A ] TGAGGGATG-3'

The solcap_snp_sl_37097'(hereinafter, also referred to as "SNP (i)") is an SNP marker set including one SNP in the solcap_snp_sl_37097 and its vicinity. Further, in the base sequence of SEQ ID NO: 9 below, the base in the underlined portion surrounded by the second parenthesis (the 51st base of SEQ ID NO: 9) is the SNP corresponding to solcap_snp_sl_37097. Hereinafter, the bases underlined in the first and second parentheses in the base sequence of SEQ ID NO: 9 are also referred to as _{SNP (i 1} ) and SNP (i _{2), respectively.} The SNP (i) shows, for example, a polymorphism in which the first and second bases of the bases in the underlined portion enclosed in parentheses in SEQ ID NO: 9 are T and G, respectively. That is, for example, when the SNPs (i ₁ ) and SNPs (i ₂ ) in the SNP (i) are T and G, respectively, the tomato plant is resistant to half-body wilt disease, and bases other than the combination of the bases are used. In the case of the combination of (eg, C and A), the tomato plant indicates that it is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 9 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 9
5'-GTGAGGCTACTGTCGGGTTACCCGGTGGGTGTGACATTGGGGCCCGACC [ T ] [ G ] TTGATTTTTACATTCATGGTCTACGTGCTCTTGGTGCTACGGTTGAGTTG-3'

The SNP (i) can also be identified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 20 is, for example, the base sequence of Heinz except for the SNP (i), and the base underlined in parentheses is a polymorphism corresponding to the SNP (i). In addition, the bases in the underlined portion enclosed in the first and second parentheses in SEQ ID NO: 20 below are the bases _{corresponding to SNP (i 1} ) and SNP (i ₂ ), respectively. That is, for example, when the SNPs (i ₁ ) and SNPs (i ₂ ) in the SNP (i) are T and G, respectively, the tomato plant is resistant to half-body wilt disease, and bases other than the combination of the bases are used. In the case of the combination of (eg, C and A), the tomato plant indicates that it is susceptible to half-body wilt disease. In this way, the position of the SNP (i) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 20
5'-GTGAGGCTACTGTCGGGTTACCCGGTGGGTGTGACATTGGGGCCCGACC [ T ] [ G ] TTGATTTTTACATTCATGGTCTACGTGCTCTTGGTGCTACGGTTGAGTTG-3'

The solcap_snp_sl_12147'(hereinafter, also referred to as "SNP (j)") is an SNP marker set including three SNPs of solcap_snp_sl_12147 and its vicinity. In addition, the underlined base (51st base of SEQ ID NO: 10) surrounded by the second parenthesis in the base sequence of SEQ ID NO: 10 below is the SNP corresponding to solcap_snp_sl_12147. Hereinafter, the bases underlined in the 1st to 4th parentheses in the base sequence of SEQ ID NO: 10 below are also referred to as _{SNP (j 1} ) to _{SNP (j 3} ) and SNP (j _{4), respectively.} The SNP (j) shows, for example, a polymorphism in which the bases 1 to 4 of the bases in the underlined portion enclosed in parentheses in SEQ ID NO: 10 are A, C, T, and A, respectively. That is, for example, when SNPs (j ₁ ) to SNPs (j ₃ ) and SNPs (j ₄ ) in the SNP (j) are A, C, T, and A, respectively, the tomato plant has resistance to half-body wilt disease. In the case of a base combination other than the above-mentioned base combination (for example, in the case of T, A, C, and T), the tomato plant indicates that it is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 10 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 10
5'-CAATGGACTACAGGAAGCC [ A ] TTGTCTGCTTTCCAAGCGTTTGCAATTTGC [ C ] TGACCAGTTTTGG [ T ] AC [ A ] AAATTGGCCTGTGAATAGATTCTTTAGAACTTG-3'

The SNP (j) can also be identified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 21 is, for example, the base sequence of Heinz except for the SNP (j), and the base underlined in parentheses is a polymorphism corresponding to the SNP (j). Further, the bases in the underlined portions enclosed in parentheses in the 1st to 4th brackets in SEQ ID NO: 21 below are the bases corresponding to SNP (j ₁ ) to _{SNP (j 3} ) and SNP (j ₄ ), respectively. That is, for example, when SNPs (j ₁ ) to SNPs (j ₃ ) and SNPs (j ₄ ) in the SNP (j) are A, C, T, and A, respectively, the tomato plant has resistance to half-body wilt disease. In the case of a base combination other than the above-mentioned base combination (for example, in the case of T, A, C, and T), the tomato plant indicates that it is susceptible to half-body wilt disease. In this way, the position of the SNP (j) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 21
5'-CAATGGACTACAGGAAGCC [ A ] TTGTCTGCTTTCCAAGCGTTTGCAATTTGC [ C ] TGACCAGTTTTGG [ T ] AC [ A ] AAATTGGCCTGTGAATAGATTCTTTAGAACTTG-3'

The solcap_snp_sl_12152'(hereinafter, also referred to as "SNP (k)") is an SNP marker set including one SNP in the solcap_snp_sl_12152 and its vicinity. Further, in the base sequence of SEQ ID NO: 11 below, the underlined base (the 51st base of SEQ ID NO: 11) surrounded by the first parenthesis is the SNP corresponding to solcap_snp_sl_12152. Hereinafter, the bases underlined in the first and second parentheses in the base sequence of SEQ ID NO: 11 below are also referred to as _{SNP (k 1} ) and SNP (k _{2), respectively.} The SNP (k) shows, for example, a polymorphism in which the first and second bases of the bases in the underlined portion enclosed in parentheses in SEQ ID NO: 11 are C and A, respectively. That is, for example, when SNP (k ₁ ) and SNP (k ₂ ) in the SNP (k) are C and A, respectively, the tomato plant is resistant to half-body wilt disease, and bases other than the combination of the bases are used. In the case of the combination of (for example, in the case of A and G), the tomato plant indicates that it is susceptible to half-body wilt disease. In addition, the nucleotide sequence of SEQ ID NO: 11 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 11
5'-CTCGGGTACTACTTTATCACCGACAGCTGGGACATGTCTGATCTCGGAAG [ C ] GGGTGGTGGAGCCCTCTGCTTTGACTAATGGG [ A ] GCTCAACTTCATCTT-3'

The SNP (k) can also be specified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 22 is, for example, the base sequence of Heinz except for the SNP (k), and the base underlined in parentheses is a polymorphism corresponding to the SNP (k). In addition, the bases in the underlined portion enclosed in the first and second parentheses in SEQ ID NO: 22 below are the bases _{corresponding to SNP (k 1} ) and SNP (k ₂ ), respectively. That is, for example, when SNP (k ₁ ) and SNP (k ₂ ) in the SNP (k) are C and A, respectively, the tomato plant is resistant to half-body wilt disease, and bases other than the combination of the bases are used. In the case of the combination of (for example, in the case of A and G), the tomato plant indicates that it is susceptible to half-body wilt disease. In this way, the position of the SNP (k) can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 22
5'-CTCGGGTACTACTTTATCACCGACAGCTGGGACATGTCTGATCTCGGAAG [ C ] GGGTGGTGGAGCCCTCTGCTTTGACTAATGGG [ A ] GCTCAACTTCATCTT-3'

The locus position of the SNP marker on the chromosome is not particularly limited. As shown in FIG. 1, the SNP markers are, for example, on chromosome 7 of a tomato plant, from the upstream side (solcap_snp_sl_5840 side) to the downstream side (solcap_snp_sl_70781 side), solcap_snp_sl_14174', solcap_sl_sn_ solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_12147', solcap_snp_sl_12152 ', solcap_snp_sl_12147', and Solcap_snp_sl_37097 'have been Zajo in this order. Incidentally, Solcap_snp_sl_5840 and solcap_snp_sl_70781 is, Solcap_snp_sl_14174 in chromosome 7 tomato plants ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_37097', Zajo position of solcap_snp_sl_12147 ', and Solcap_snp_sl_12152' It is used to indicate. Solcap_snp_sl_5840 and solcap_snp_sl_70781 will be described later.

The number of the SNP markers possessed by the resistance locus is not particularly limited, and for example, any one or two or more of the SNP markers, that is, two, three, four, or five. , 6, 7, 8, 9, 10, or all 11. The relationship between these 11 types of polymorphisms (SNP markers) and half-body wilt resistance has not been reported so far, and the half-body wilt resistance first discovered by the present inventors. A new polymorphism involved.

The combination of the SNP markers is not particularly limited, and for example, the following combinations can be exemplified.
Combination of SNP (a) and SNP (b) Combination of SNP (a) and SNP (c) Combination of SNP (b) and SNP (c) Combination of SNP (d) and SNP (g) SNP (d) and SNP (I) Combination of SNP (g) and SNP (i) Combination of SNP (d), SNP (g), and SNP (i) Combination of SNP (a), SNP (b), and SNP (c) Of the above combinations, the following combinations are preferable because they have a higher correlation with resistance to half-body wilt.
Combination of SNP (a), SNP (b), and SNP (c) Combination of SNP (d), SNP (g), and SNP (i) Combination of SNP (a) to SNP (j) and SNP (k)

In the present invention, SNPs (a) to (f) and (h) to (k) refer to, for example, SNPs (a) of any one or more of the SNPs constituting each SNP marker set. )-(F) and (h)-(k), or any one or more SNPs may be combined with other SNP marker sets or SNPs constituting them. As a specific example, the SNP (d) includes the SNPs (d ₁ ) to SNPs (d ₄ ), but the present invention is not limited thereto, and the SNPs (d ₁ ) to SNPs (d ₄ ). Any one, two, or three may be referred to as the SNP (d). Further, in this case, the SNP (d) is, for example, at least one selected from the group consisting of the SNPs (a) to SNP (c) and the SNPs (e) to SNP (k) as described above. It may be combined with one or at least one of the SNP (g) and SNP (i). Further, in the present invention, the SNP (i) includes the SNP (i ₁ ) and the SNP (i ₂ ), but the present invention is not limited thereto, and the SNP (i ₁ ) and the SNP (i _2). ) May be the SNP (i). Further, in this case, the SNP (i) is, for example, at least selected from the group consisting of the SNPs (a) to SNPs (h), SNPs (j), and SNPs (k) as described above. It may be combined with one or at least one of the SNPs (d) and SNPs (g).

(2) Identification by Base Sequence Containing SNP Marker As shown in (2) above, the resistance locus may be defined by, for example, a base sequence containing the SNP marker. The resistance locus may be composed of, for example, the base sequence, or may include the base sequence.

The base sequence containing the SNP marker is not particularly limited, and examples thereof include polynucleotides (a) to (j) and (k) described later. The resistance locus is identified, for example, by at least one polynucleotide selected from the group consisting of (d), (g) and (i) below. The polynucleotides (a) to (j) and (k) correspond to the nucleotide sequences containing the SNP markers of SNP (a) to SNP (j) and SNP (k), respectively.

The polynucleotide of (a) is a nucleotide sequence containing the SNP (a), that is, solcap_snp_sl_14174', and is, for example, the polynucleotide of (a1), (a2), or (a3) below. The polynucleotides (a2) and (a3) are polynucleotides having the same functions as the polynucleotide of (a1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide of (a2) or (a3) exhibits half-body wilt resistance.
(A) A polynucleotide (a2) consisting of the nucleotide sequence of the following (a1), (a2), or (a3) polynucleotide (a1) SEQ ID NO: 1 The base (G) and the 95th base (G) are conserved, and the base sequence of (a1) consists of a base sequence in which one or several bases are deleted, substituted, inserted and / or added. Polynucleotide (a3) The 9th base (G), 51st base (G), and 95th base (G) of the above (a1) are stored, and 80 with respect to the base sequence of the above (a1). A polynucleotide consisting of a base sequence having% or more identity

In the polynucleotide (a1), the 9th base (G), the 51st base (G), and the 95th base (G) in the parenthesized parts of SEQ ID NO: 1 are the SNPs, respectively. It is a base corresponding to the polymorphisms of SNP (a ₁ ), SNP (a ₂ ), and SNP (a _{3) of (a).} In addition, the polynucleotide of (a1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (a2), the one or several are, for example, 1 to 20, 1 to 15, 1 to 5, 1 to 4, 1 to 3, 1 or 2. .. In the present invention, the numerical range of the number of bases and the like discloses, for example, all positive integers belonging to the range. That is, for example, the description of "1 to 5" means all disclosures of "1, 2, 3, 4, 5" (hereinafter, the same applies).

In the polynucleotide of (a3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all. The identity can be determined by aligning two base sequences (hereinafter, the same applies). Specifically, the identity can be calculated by default parameters using, for example, analysis software such as BLAST or FASTA (hereinafter, the same applies).

The polynucleotide of (b) is a nucleotide sequence containing the SNP (b), that is, solcap_snp_sl_7034', and is, for example, the polynucleotide of (b1), (b2), or (b3) below. The polynucleotides (b2) and (b3) are polynucleotides having the same functions as the polynucleotide of (b1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide of (b2) or (b3) shows half-body wilt resistance.
(B) A polynucleotide (b2) consisting of the nucleotide sequence of the following (b1), (b2), or (b3) polynucleotide (b1) SEQ ID NO: 2, the second base (G), eighth of the above (b1). The base (G), the 11th base (A), the 43rd base (C), and the 51st base (T) are conserved, and one or several bases are contained in the base sequence of (b1). A polynucleotide consisting of a deleted, substituted, inserted and / or added base sequence (b3) The second base (G), the eighth base (G), the eleventh base (A) of the above (b1), A polynucleotide in which the 43rd base (C) and the 51st base (T) are conserved and consist of a base sequence having 80% or more identity with respect to the base sequence of (b1).

In the polynucleotide of (b1), the second base (G), the eighth base (G), the eleventh base (A), and the 43rd base (C) in the underlined portion enclosed in parentheses in SEQ ID NO: 2 ) And the 51st base (T) are the bases corresponding to the polymorphisms _{of SNP (b 1} ) to _{SNP (b 4} ) and SNP (b _{5) of the SNP (b), respectively.} In addition, the polynucleotide of (b1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (b2), the one or several are, for example, 1 to 20, 1 to 15, 1 to 5, 1 to 4, 1 to 3, 1 or 2. ..

In the polynucleotide of (b3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The polynucleotide of (c) is a nucleotide sequence containing the SNP (c), that is, solcap_snp_sl_24321', and is, for example, the polynucleotide of (c1), (c2), or (c3) below. The polynucleotides (c2) and (c3) are polynucleotides having the same functions as the polynucleotide of (c1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide of (c2) or (c3) shows half-body wilt resistance.
(C) A polynucleotide (c2) consisting of the nucleotide sequence of the following (c1), (c2), or (c3) polynucleotide (c1) SEQ ID NO: 3) The 50th base (C) and the 51st base of the above (c1). (A) is preserved, and in the base sequence of (c1), a polynucleotide (c3) consisting of a base sequence in which one or several bases are deleted, substituted, inserted and / or added. 50th base (C) and 51st base (A) are conserved, and a polynucleotide consisting of a base sequence having 80% or more identity with respect to the base sequence of (c1).

In the polynucleotide of (c1), the 50th base (C) and the 51st base (A) in the underlined portion enclosed in parentheses in SEQ ID NO: 3 are the SNP (c ₁ ) of the SNP (c), respectively. And the base corresponding to the SNP (c _{2) polymorphism.} In addition, the polynucleotide of (c1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (c2), the one or several are, for example, 1 to 15, 1 to 7, 1 to 5, 1 to 4, 1 to 3, 1 or 2. ..

In the polynucleotide of (c3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The polynucleotide of (d) is a nucleotide sequence containing the SNP (d), that is, solcap_snp_sl_100293', and is, for example, the polynucleotide of (d1), (d2), or (d3) below. The polynucleotides (d2) and (d3) are polynucleotides having the same functions as the polynucleotide of (d1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide (d2) or (d3) shows half-body wilt resistance.
(D) A polynucleotide (d2) consisting of the nucleotide sequence of the following (d1), (d2), or (d3) polynucleotide (d1) SEQ ID NO: 4, the 101st base (G), 117th base of the above (d1). Base (C), 127th base (G), and 148th base (A) are conserved, and one or several bases are deleted, substituted, inserted, and / in the above-mentioned base sequence (d1). Alternatively, the polynucleotide (d3) consisting of the added base sequence, the 101st base (G), the 117th base (C), the 127th base (G), and the 148th base (A) of the above (d1). Is preserved, and a polynucleotide consisting of a base sequence having 80% or more identity with respect to the base sequence of (d1) above.

In the above-mentioned polynucleotide (d1), the 101st base (G), the 117th base (C), the 127th base (G), and the 148th base (G) in the underlined portion enclosed in parentheses in SEQ ID NO: 4 ( A) is a base corresponding to the polymorphisms of SNP (d ₁ ) to _{SNP (d 3} ) and SNP (d _{4) of the SNP (d), respectively.} Further, the polynucleotide of (d1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (d2), the one or several are, for example, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 8, 1 to 6, 1 to 1. 4, 1 or 2.

In the polynucleotide of (d3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The polynucleotide of (e) is a nucleotide sequence containing the SNP (e), that is, solcap_snp_sl_100731', and is, for example, the polynucleotide of (e1), (e2), or (e3) below. The polynucleotides (e2) and (e3) are polynucleotides having the same functions as the polynucleotide of (e1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having a half-body wilt resistance locus identified by the polynucleotide of (e2) or (e3) exhibits half-body wilt resistance.
(E) Polynucleotide (e2) consisting of the base sequence of the following (e1), (e2), or (e3) polynucleotide (e1) SEQ ID NO: 5: 50th base (A), 59th base (e1) of the above (e1) Base (G) and 100th base (G) are conserved, and the base sequence of (e1) consists of a base sequence in which one or several bases are deleted, substituted, inserted and / or added. Polynucleotide (e3) The 50th base (A), 59th base (G), and 100th base (G) of the (e1) are stored, and 80 for the base sequence of the (e1). A polynucleotide consisting of a base sequence having% or more identity

In the polynucleotide (e1), the 50th base (A), the 59th base (G), and the 100th base (G) in the parenthesized part of SEQ ID NO: 5 are the SNPs, respectively. It is a base corresponding to the polymorphisms of SNP (e ₁ ), SNP (e ₂ ), and SNP (e _{3) of (e).} In addition, the polynucleotide of (e1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (e2), the one or several are, for example, 1 to 20, 1 to 15, 1 to 5, 1 to 4, 1 to 3, 1 or 2. ..

In the polynucleotide of (e3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The polynucleotide of (f) is a nucleotide sequence containing the SNP (f), that is, solcap_snp_sl_55410', and is, for example, the polynucleotide of (f1), (f2), or (f3) below. The polynucleotides (f2) and (f3) are polynucleotides having the same functions as the polynucleotide of (f1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide (f2) or (f3) shows half-body wilt resistance.
(F) A polynucleotide (f2) consisting of the nucleotide sequence of the following (f1), (f2), or (f3) polynucleotide (f1) SEQ ID NO: 6; (T) is preserved, and in the base sequence of (f1), a polynucleotide (f3) consisting of a base sequence in which one or several bases are deleted, substituted, inserted and / or added. 51st base (G) and 54th base (T) are conserved, and a polynucleotide consisting of a base sequence having 80% or more identity with respect to the base sequence of (f1).

In the polynucleotide of (f1), the 51st base (G) and the 54th base (T) of the underlined portion enclosed in parentheses in SEQ ID NO: 6 are the SNP (f ₁ ) of the SNP (f), respectively. And the base corresponding to the SNP (f _{2) polymorphism.} In addition, the polynucleotide of (f1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (f2), the one or several are, for example, 1 to 20, 1 to 15, 1 to 5, 1 to 4, 1 to 3, 1 or 2. ..

In the polynucleotide of (f3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The polynucleotide of (g) is a nucleotide sequence containing the SNP (g), that is, solcap_snp_sl_55399, and is, for example, the polynucleotide of (g1), (g2), or (g3) below. The polynucleotides (g2) and (g3) are polynucleotides having the same functions as the polynucleotide of (g1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide of (g2) or (g3) exhibits half-body wilt resistance.
(G) A polynucleotide (g2) consisting of the nucleotide sequence of the following (g1), (g2), or (g3) polynucleotide (g1) SEQ ID NO: 7 The 51st base (T) of the above (g1) is stored. , A polynucleotide (g3) consisting of a base sequence in which one or several bases are deleted, substituted, inserted and / or added in the base sequence of the above (g1). The 51st base (T) of the above (g1). Is preserved, and a polynucleotide consisting of a base sequence having 80% or more identity with respect to the base sequence of (g1).

In the polynucleotide (g1), the underlined base (T) in parentheses in SEQ ID NO: 7 is the base corresponding to the polymorphism of solcap_snp_sl_55399. In addition, the polynucleotide of (g1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (g2), the one or several are, for example, 1 to 20, 1 to 15, 1 to 5, 1 to 4, 1 to 3, 1 or 2. ..

In the polynucleotide of (g3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The polynucleotide of (h) is a nucleotide sequence containing the SNP (h), that is, solcap_snp_sl_71138', and is, for example, the polynucleotide of (h1), (h2), or (h3) below. The polynucleotides (h2) and (h3) are polynucleotides having the same functions as the polynucleotide of (h1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide (h2) or (h3) shows half-body wilt resistance.
(H) A polynucleotide (h2) consisting of the nucleotide sequence of the following (h1), (h2), or (h3) polynucleotide (h1) SEQ ID NO: 8 (h1) 51st base (T), 65th base (h1). The base (A) and the 92nd base (A) are conserved, and the base sequence of (h1) consists of a base sequence in which one or several bases are deleted, substituted, inserted and / or added. Polynucleotide (h3) The 51st base (T), 65th base (A), and 92nd base (A) of the above (h1) are conserved, and 80 with respect to the base sequence of the above (h1). A polynucleotide consisting of a base sequence having% or more identity

In the polynucleotide (h1), the 51st base (T), the 65th base (A), and the 92nd base (A) in the parenthesized part of SEQ ID NO: 8 are the SNPs, respectively. It is a base corresponding to the polymorphisms of SNP (h ₁ ), SNP (h ₂ ), and SNP (h _{3) of (h).} In addition, the polynucleotide of (h1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (h2), the one or several are, for example, 1 to 20, 1 to 15, 1 to 5, 1 to 4, 1 to 3, 1 or 2. ..

In the polynucleotide of (h3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The polynucleotide of (i) is a nucleotide sequence containing the SNP (i), that is, solcap_snp_sl_37097', and is, for example, the polynucleotide of (i1), (i2), or (i3) below. The polynucleotides (i2) and (i3) are polynucleotides having the same functions as the polynucleotide of (i1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide of (i2) or (i3) shows half-body wilt resistance.
(I) A polynucleotide (i2) consisting of the nucleotide sequence of the following (i1), (i2), or (i3) polynucleotide (i1) SEQ ID NO: 9 (i2) The 50th base (T) and the 51st base of the above (i1). Base (G) is preserved, and in the base sequence of (i1), a polynucleotide (i3) consisting of a base sequence in which one or several bases are deleted, substituted, inserted and / or added. 50th base (T) and 51st base (G) are conserved, and a polynucleotide consisting of a base sequence having 80% or more identity with respect to the base sequence of (i1).

In the polynucleotide of (i1), the 50th base (T) and the 51st base (G) in the underlined portion enclosed in parentheses in SEQ ID NO: 9 are the SNP (i ₁ ) of the SNP (i), respectively. And the base corresponding to the SNP (i _{2) polymorphism.} In addition, the polynucleotide of (i1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (i2), the one or several are, for example, 1 to 20, 1 to 15, 1 to 5, 1 to 4, 1 to 3, 1 or 2. ..

In the polynucleotide of (i3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The polynucleotide of (j) is a nucleotide sequence containing the SNP (j), that is, solcap_snp_sl_12147', and is, for example, the polynucleotide of (j1), (j2), or (j3) below. The polynucleotides (j2) and (j3) are polynucleotides having the same functions as the polynucleotide of (j1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide of (j2) or (j3) exhibits half-body wilt resistance.
(J) Polynucleotide (j2) consisting of the nucleotide sequence of the following (j1), (j2), or (j3) polynucleotide (j1) SEQ ID NO: 10 The 20th base (A), 51st of the above (j1). Base (C), 65th base (T), and 68th base (A) are conserved, and one or several bases are deleted, substituted, inserted, and / in the above base sequence (j1). Alternatively, the polynucleotide (j3) consisting of the added base sequence, the 20th base (A), the 51st base (C), the 65th base (T), and the 68th base (A) of the above (j1). Is preserved, and a polynucleotide consisting of a base sequence having 80% or more identity with respect to the base sequence of (j1) above.

In the above-mentioned polynucleotide (j1), the 20th base (A), the 51st base (C), the 65th base (T), and the 68th base (underlined) in parentheses in SEQ ID NO: 10 ( A) is a base corresponding to the polymorphisms of SNP (j ₁ ) to _{SNP (j 3} ) and SNP (j _{4) of the SNP (j), respectively.} Further, the polynucleotide of (j1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (j2), the one or several are, for example, 1 to 20, 1 to 15, 1 to 5, 1 to 4, 1 to 3, 1 or 2. ..

In the polynucleotide of (j3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The polynucleotide of (k) is a nucleotide sequence containing the SNP (k), that is, solcap_snp_sl_12152', and is, for example, the polynucleotide of (k1), (k2), or (k3) below. The polynucleotides (k2) and (k3) are polynucleotides having the same functions as the polynucleotide of (k1) in terms of resistance to half-body wilt disease at the resistance locus, respectively. The equivalent function means that, for example, a tomato plant having the half-body wilt resistance locus identified by the polynucleotide (k2) or (k3) exhibits half-body wilt resistance.
(K) Polynucleotide (k2) consisting of the nucleotide sequence of the following (k1), (k2), or (k3) polynucleotide (k1) SEQ ID NO: 11 The 51st base (C) and 86th base (k1) of the above (k1). Base (A) is preserved, and in the base sequence of (k1), a polynucleotide (k3) consisting of a base sequence in which one or several bases are deleted, substituted, inserted and / or added. 51st base (C) and 86th base (A) are conserved, and a polynucleotide consisting of a base sequence having 80% or more identity with respect to the base sequence of (k1).

In the polynucleotide of (k1), the 51st base (C) and the 86th base (A) in the underlined portion enclosed in parentheses in SEQ ID NO: 11 are the SNP (k ₁ ) of the SNP (k), respectively. And the base corresponding to the SNP (k _{2) polymorphism.} Further, the polynucleotide of (k1) can be obtained from, for example, a tomato plant deposited under the accession number FERM BP-22308 described later.

In the polynucleotide of (k2), the one or several are, for example, 1 to 20, 1 to 15, 1 to 5, 1 to 4, 1 to 3, 1 or 2. ..

In the polynucleotide of (k3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99%. That is all.

The number of base sequences containing the SNP marker contained in the resistance locus is not particularly limited, and for example, any one of the polynucleotides (a) to (j) and (k), or It may be two or more, that is, two, three, four, five, six, seven, eight, nine, ten or all eleven.

The combination of the base sequences containing the SNP marker is not particularly limited, and for example, the following combinations can be exemplified.
Combination of polynucleotides (a) and (b) Combination of polynucleotides (a) and (c) Combination of polynucleotides (b) and (c) The polynucleotides (d) and (g) Combination of polynucleotides of (d) and (i) Combination of polynucleotides of (d) and (i) Combination of polynucleotides of (d), (g), and (i) , (B), and (c) Combination of polynucleotides Among the above combinations, the following combinations are preferable because they have a higher correlation with resistance to half-body wilt.
Combination of polynucleotides (a), (b), and (c) Combination of polynucleotides (d), (g), and (i) Polypoly of (a) to (j) and (k). Nucleotide combination

In the present invention, the nucleotides (a) to (f) and (h) to (k) have (a2) to (f2) and (h2) to (k2) and (a3) to (f3) and (h3) to. The SNP marker set contained in each polynucleotide is stored in each of the polynucleotides (k3), but the present invention is not limited to this. For example, in each polynucleotide, any one of the SNP markers is stored. One or more may be stored. As a specific example, in the present invention, the polynucleotides (d2) and (d3) in the polynucleotide (d) are the 101st base (G), the 117th base (C), 127 of the (d1). The th base (G) and the 148th base (A) are conserved, but the present invention is not limited to this, and in the polynucleotides (d2) and (d3), the four bases are used. Any one, two or three bases may be preserved. Further, in this case, the polynucleotide of (d) is, for example, further selected from the group consisting of the polynucleotides of (a) to (c) and (e) to (k) as described above. It may be combined with one or at least one of the polynucleotides (g) and (i) above. Further, in the polynucleotides (i2) and (i3) in the polynucleotide (i), the 50th base (T) and the 51st base (G) of (i1) are stored, but this The invention is not limited to this, and any one of the two bases may be conserved in the polynucleotides (i2) and (i3). Further, in this case, the polynucleotide of (i) is, for example, further selected from the group consisting of the polynucleotides of (a) to (h), (j), and (k) as described above. It may be combined with at least one or at least one of the polynucleotides (d) and (g) above.

(3) Identification of the region between the sites of the two SNP markers The resistance locus is defined by, for example, the base sequence of the region between the sites of the two SNP markers, as shown in (3) above. May be done. Nucleotide sequence of the region between portions of the two SNP markers is not particularly limited, for example, in the chromosome, solcap_snp_sl_5840, solcap_snp_sl_14174 ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ' , Solcap_snp_sl_37097', solcap_snp_sl_12147', solcap_snp_sl_12152', and the base sequence of the region between the sites of two SNP markers selected from the group consisting of solcap_snp_sl_70781. The resistance locus is, for example, in the chromosome, solcap_snp_sl_5840, solcap_snp_sl_100293', solcap_snp_sl_55399, solcap_snp_sl_37097', and a region consisting of a sequence consisting of a sequence from solcap_snp_sl_37097'. When the base sequence of the region is defined by the SNPs (a) to (f) and (h) to (k), for example, any one of the SNPs constituting each SNP marker set is designated as SNPs (a) to SNPs (a) to (k). It may be used as (f) and (h) to (k), and preferably, the SNP markers represented by "solcap_snp_sl_number" in each SNP marker set are SNPs (a) to (f) and (h) to (h). It is used as k) (hereinafter, the same applies). The base sequence of the region between the sites of the two SNP markers is, for example, the site of the corresponding two SNP markers in the tomato plant (hereinafter, also referred to as “deposit line”) deposited under the accession number FERM BP-22308 described later. You can refer to the base sequence of the region between them. When referring to the base sequence of the deposit line, the base sequence of the region between the sites of the two SNP markers completely or partially matches, for example, the base sequence of the deposit line. In the latter case, the nucleotide sequence of the region between the sites of the two SNP markers is, for example, a tomato plant having a resistance locus specified by the nucleotide sequence of the region between the sites of the two SNP markers. It suffices to show disease resistance. When the resistance locus is specified in (3), it can be said that the resistance locus is, for example, located in the region between the sites of the two SNP markers.

The solcap_snp_sl_5840 (hereinafter, also referred to as “SNP (l)”) indicates, for example, a polymorphism of the base in the underlined portion enclosed in parentheses in SEQ ID NO: 23. In the tomato plant deposited under the accession number FERM BP-22308 described later, the solcap_snp_sl_5840 indicates a polymorphism which is A, but the solcap_snp_sl_5840 may be a base other than A, that is, T, G, or C, for example. .. In addition, the nucleotide sequence of SEQ ID NO: 23 can be obtained from, for example, a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 23
5'-TGGCCACAATATATGCAAATCAAGGACTCGAGCCCTCTGAGAAGCCTACC [ A ] TGGCAGTGCTTACAGCGGAGATAGGGTGGAGAAGGATCGAAGGCGGCGAC-3'

The solcap_snp_sl_5840 can also be identified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 24 is, for example, the Heinz base sequence except for the solcap_snp_sl_5840, and the underlined base enclosed in parentheses is a polymorphism corresponding to the solcap_snp_sl_5840. In this way, the position of the solcap_snp_sl_5840 can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 24
5'-TGGCCACAATATATGCAAATCAAGGACTCGAGCCCTCTGAGAAGCCTACC [ A ] TGGCAGTGCTTACAGCGGAGATAGGGTGGAGAAGGATCGAAGGCGGCGAC-3'

The solcap_snp_sl_70781 (hereinafter, also referred to as “SNP (m)”) indicates, for example, a polymorphism of the underlined base in SEQ ID NO: 25, which is enclosed in parentheses. In the tomato plant deposited under the accession number FERM BP-22308 described later, the solcap_snp_sl_70781 indicates a polymorphism which is G, but the solcap_snp_sl_70781 may be a base other than G, that is, A, T, or C, for example. .. In addition, the nucleotide sequence of SEQ ID NO: 25 can be obtained, for example, from a tomato plant deposited under Accession No. FERM BP-22308, which will be described later.
SEQ ID NO: 25
5'-ACCGGAGCAGCAAGAGGACTTGCATACTTGCATGAAACGGCTAATCCTCC [ G ] GTGATTTATCGGGACTTTAAATCATCCAACATACTTCTAGATGAGAACTT-3'

The solcap_snp_sl_70781 can also be identified from known information on a database such as the above-mentioned website. The base sequence of SEQ ID NO: 26 is, for example, the Heinz base sequence except for the solcap_snp_sl_70781, and the underlined base enclosed in parentheses is the polymorphism corresponding to the solcap_snp_sl_70781. In this way, the position of the solcap_snp_sl_70781 can be specified from, for example, information on the known Heinz base sequence.
SEQ ID NO: 26
5'-ACCGGAGCAGCAAGAGGACTTGCATACTTGCATGAAACGGCTAATCCTCC [ G ] GTGATTTATCGGGACTTTAAATCATCCAACATACTTTTAGATGAGAACTT-3'

As described above, the region can be identified as an upstream end and a downstream end by, for example, the sites of the two SNP markers. The region may include, for example, between the sites of the two SNP markers, and may or may not include, for example, both or one of the sites of the two SNP markers. When the region includes the site of the SNP marker, the upstream end and the downstream end of the region are the SNP marker sites, but the upstream end and the downstream end. The base with the end portion may be, for example, the base underlined in the above-mentioned base sequence or other bases.

The two SNP markers that define the region are not particularly limited, and for example, the following combinations can be exemplified.
Combination of SNPs (c) and (l) Combination of SNPs (d) and (g) Combination of SNPs (d) and (i) Combination of SNPs (d) and (l) Combination of SNPs (d) and (m) Combination of SNP (g) and (i) Combination of SNP (g) and (l) Combination of SNP (g) and (m) Combination of SNP (i) and (l) Combination of SNP (i) and (m) Combination of SNP (l) and (m)

When the resistance locus is defined by the base sequence of the region between the sites of the two SNP markers, the resistance locus is further the SNP marker that seats on the region in the base sequence of the region. It is preferable to have. Specifically, the resistance locus in the nucleotide sequence of the region, for example, solcap_snp_sl_14174 ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_37097', solcap_snp_sl_12147 ', And at least one SNP marker selected from the group consisting of solcap_snp_sl_12152', or at least one SNP having at least one marker selected from the group consisting of solcap_snp_sl_100293', solcap_snp_sl_55399, and solcap_snp_sl_37097'.

The SNP marker that sits on the region may be, for example, one or both of the sites of the two SNP markers that define the region on the chromosome, or the two SNPs that define the region. It may be an SNP marker that sits between the parts of the marker. The former is also referred to as an SNP marker at the end of the region, and the latter is also referred to as an SNP marker inside the region. The SNP marker that sits on the region may be, for example, both the SNP marker at the end of the region and the SNP marker inside the region.

Examples of the SNP marker inside the region include an SNP marker sitting between the site of the SNP marker on the upstream side and the site of the SNP marker on the downstream side that define the region. It can be appropriately determined based on the sitting position of the SNP marker shown in FIG. The number of the SNP markers between the sites of the two SNP markers may be, for example, one or more, and as a specific example, all SNP markers seated between the sites of the SNP markers defining the region. be.

The combination of the base sequence of the region between the sites of the two SNP markers and the SNP marker in the base sequence of the region is not particularly limited, and for example, the following conditions (i), (ii), (iii), or (Iv) can be mentioned.
Condition (i)
Containing the base sequence of the region between the sites of solcap_snp_sl_5840 and solcap_snp_sl_70781 on the chromosome, and
Conditions having at least one SNP marker selected from the group consisting of solcap_snp_sl_100293', solcap_snp_sl_55399, and solcap_snp_sl_37097' in the base sequence of the region (ii).
Containing the base sequence of the region between the sites of solcap_snp_sl_5840 and solcap_snp_sl_70781 on the chromosome, and
In the nucleotide sequence of the region, solcap_snp_sl_14174 ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_37097', at least one SNP selected from the group consisting of solcap_snp_sl_12147 ', and Solcap_snp_sl_12152' Conditions with markers (iii)
Containing the base sequence of the region between the sites of solcap_snp_sl_5840 and solcap_snp_sl_70781 on the chromosome, and
Conditions having at least one SNP marker selected from the group consisting of solcap_snp_sl_14174', solcap_snp_sl_7034', and solcap_snp_sl_24321' in the base sequence of the region (iv).
Containing the base sequence of the region between the sites of solcap_snp_sl_5840 and solcap_snp_sl_24321' on the chromosome, and
In the base sequence of the region, it has at least one SNP marker selected from the group consisting of solcap_snp_sl_14174', solcap_snp_sl_7034', and solcap_snp_sl_24321'.

According to the half-body wilt resistance marker of the present invention, for example, half-body wilt resistance can be imparted to a tomato plant. In the present invention, the degree of resistance to half-body wilt disease of a tomato plant is expressed by, for example, the degree of disease onset calculated from the disease onset index by evaluating the disease onset index of the tomato plant according to the method described in Reference Information 4 below. be able to. For the calculation of the degree of morbidity by this method, the description of Example 1 described later can be referred to, and for example, a degree of morbidity of less than 2 can be set as disease resistance and a degree of morbidity of 2 or more can be set as morbidity. When determining the resistance to half-body wilt disease from the disease degree, the disease degree may be, for example, the disease degree of one tomato plant or the average disease degree of two or more tomato plants, but the latter Is preferable. In the latter case, the number of tomato plants used for determining the resistance to half-body wilt disease is not particularly limited, and is, for example, a number that can be statistically tested with a half-body wilt disease-susceptible tomato plant. For example, 8 to 20 strains.
Reference information 4: Tochigi Prefectural Agricultural Experiment Station result report, "Test of resistance to wilt disease (race 2) of tomato rootstock varieties", [online], [Search on May 17, 2016], Internet <http: // www.agrinet.pref.tochigi.lg.jp/nousi/seikasyu/seika21/sep_021_2_06.pdf>

2. Half-body wilt-resistant tomato plant The half-body wilt-resistant tomato plant of the present invention is characterized by having a half-body wilt resistance gene locus on chromosome 7 as described above. The half-body wilt-resistant tomato plant of the present invention is characterized by having a half-body wilt resistance locus on chromosome 7, and other configurations and conditions are not particularly limited. Since the half-body wilt resistance tomato plant of the present invention has the half-body wilt resistance marker of the present invention containing the half-body wilt resistance gene locus, for example, the half-body wilt resistance of the tomato plant of the present invention The description of sex markers can be used. In the present invention, the half-body wilt resistance locus on the 7th chromosome can be read as, for example, the half-body wilt resistance marker of the present invention.

The half-body wilt-resistant tomato plant of the present invention is resistant to half-body wilt. The resistant tomato plant of the present invention is resistant to diseases caused by infection with the half-body wilt fungus of Race 3, for example, but is resistant to diseases caused by infection with the half-body wilt fungus of other races such as Race 1 and Race 2. It may show sex.

In the half-body wilt-resistant tomato plant of the present invention, the half-body wilt resistance is provided by the half-body wilt resistance locus on chromosome 7 as described above. The half-body wilt resistant tomato plant of the present invention has the resistance locus on chromosome 7, but instead of, for example, on any chromosome other than chromosome 7, on chromosome 7. May have a half-body wilt resistance chromosome. That is, the resistant tomato plant of the present invention is, for example, chromosome 1, chromosome 2, chromosome 3, chromosome 4, chromosome 5, chromosome 6, chromosome 8, chromosome 9, chromosome 10, chromosome 10. The half-body wilt resistance locus on the 7th chromosome may be present on any of the 11th chromosome and the 12th chromosome.

The resistant tomato plant of the present invention may contain, for example, one or two or more of the resistance loci. As a specific example, in a pair of chromosomes, one of the chromosomes may contain the resistance locus. (Heterozygotes), both chromosomes may contain the resistance locus (homozygotes), but the latter is preferred.

In the resistant tomato plant of the present invention, the resistance locus can be referred to, for example, the description of the half-body wilt disease resistance locus in the half-body wilt disease resistance marker of the tomato plant of the present invention.

Examples of the resistant tomato plant of the present invention include the tomato plant ( S. lycopersium ) deposited under accession number FERM BP-22308 or its progeny line. The progeny line has, for example, the resistance locus. The deposit information is shown below.
Type of deposit: International deposit deposit organization Name: National Institute of Technology and Evaluation Patent Organism Deposit Center Address: Japan 〒292-0818 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba Deposit number: FERM BP- 22308
Display for identification: Takai9
Original deposit date: May 19, 2016

The resistant tomato plant of the present invention can also be produced, for example, by introducing the resistance locus into a tomato plant. The method for introducing the resistance locus into the tomato plant is not particularly limited, and examples thereof include conventionally known genetic engineering methods. The resistance locus to be introduced can be exemplified by the above-mentioned resistance locus.

The resistant tomato plant of the present invention is not particularly limited in characteristics other than resistance to half-body wilt disease, such as trait and ecological characteristics.

The resistant tomato plants of the present invention may also have other resistances.

In the present invention, the "plant body" may mean either a plant individual indicating the whole plant or a part of the plant individual. The portion of the individual plant may be, for example, an organ, a tissue, a cell, a vegetative propagule, or the like. Examples of the organ include petals, corolla, flowers, leaves, seeds, fruits, stems, roots and the like. The tissue is, for example, a part of the organ. The plant part may be, for example, one type of organ, tissue and / or cell, or two or more types of organ, tissue and / or cell.

3. 3. Method for Producing Half-Body Wilt-Resistant Tomato Plant Next, the method for producing the half-body wilt-resistant tomato plant of the present invention will be described. The following methods are examples, and the present invention is not limited to these methods. In the present invention, the manufacturing method can also be referred to as, for example, a growing method. Further, in the present invention, the half-body wilt disease resistance locus can be rephrased as the resistance marker of the present invention, and the description thereof can be incorporated.

The method for producing a half-body wilt-resistant tomato plant of the present invention is characterized by including the following steps (a) and (b) as described above.
(A) Step of crossing a half-body wilt-resistant tomato plant of the present invention with another tomato plant (b) From the tomato plant obtained from the above-mentioned step (a) or its progeny line, half-body wilt resistance is obtained. Process of selecting tomato plants to prepare

The production method of the present invention is characterized by using the half-body wilt-resistant tomato plant of the present invention as a parent, and other steps and conditions are not limited in any way. As the production method of the present invention, for example, the description of the resistance marker of the present invention, the resistant tomato plant and the like can be incorporated.

The half-body wilt-resistant tomato plant used as the first parent in the step (a) may be the resistant tomato plant of the present invention. The resistant tomato plant is preferably, for example, a tomato plant deposited under accession number FERM BP-22308 as described above or a progeny line. The half-body wilt-resistant tomato plant used as the first parent in the step (a) can also be obtained, for example, by the screening method of the present invention described later. Therefore, the half-body wilt-resistant tomato plant is prepared, for example, by selecting from the test tomato plant (also referred to as a candidate tomato plant) by the following step (x) prior to the step (a). You may.
(X) A step of selecting the half-body wilt-resistant tomato plant of the present invention from the tomato plants to be tested.

In the step (x), the selection of the half-body wilt-resistant tomato plant can be said to be the selection of the tomato plant having the half-body wilt resistance locus. Therefore, the step (x) can be performed by, for example, the following steps (x1) and (x2).
(X1) Detection step for detecting the presence or absence of the half-body wilt resistance locus on the chromosome of the test tomato plant (x2) The presence of the half-body wilt resistance locus causes the test tomato plant to be detected. Selection process for selecting as a tomato plant resistant to half-body wilt

As described above, the selection in the step (x) is, for example, selection of a tomato plant having the resistance locus, and specifically, the resistance locus is detected in the test tomato plant. By doing so, the resistant tomato plant can be selected. In the step (x2), for example, when the resistance locus is present on one chromosome in a pair of chromosomes, the test tomato plant may be selected as the resistance tomato plant, or a pair. When the resistance locus is present on both chromosomes in the chromosome, the test tomato plant may be selected as the resistant tomato plant, but the latter is preferable. The detection of the resistance locus in the step (x1) defines, for example, the half-body wilt resistance locus as described in the half-body wilt resistance marker of the present invention, (1) the SNP. It can be detected by using a marker, (2) a base sequence containing the SNP marker, (3) a base sequence of a region between the sites of the two SNP markers, and a combination thereof.

The following specific examples will be given with respect to the selection in the step (x), but the present invention is not limited thereto. Further, regarding the half-body wilt disease resistance locus, the description in the half-body wilt disease resistance marker of the present invention can be incorporated.

(1) the selection of certain said (x) step by SNP markers, for example, solcap_snp_sl_14174 ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_37097', solcap_snp_sl_12147 ', and solcap_snp_sl_12152 It is a selection of tomato plants having a half-body wilt resistance locus identified by at least one SNP marker selected from the group consisting of'. The selection in step (x) is a plant having a half-body wilt resistance locus identified by at least one SNP marker selected from the group consisting of, for example, solcap_snp_sl_100293', solcap_snp_sl_55399', and solcap_snp_sl_37097'. There may be. The selected SNP marker is not particularly limited, and for example, the description of "(1) Identification by SNP marker" in the half-body wilt disease resistance marker of the present invention can be incorporated.

(2) Identification by Nucleotide Sequence Containing SNP Marker The selection in the step (x) is identified by, for example, at least one polynucleotide selected from the group consisting of (a) to (j) and (k). It is a selection of tomato plants having a half-body wilt resistance locus. The selection in the step (x) is, for example, a tomato having a half-body wilt resistance locus identified by at least one polynucleotide selected from the group consisting of (d), (g) and (i). It may be a selection of plants. The polynucleotides (a) to (j) and (k) can be referred to, for example, the explanation of "(2) Identification by base sequence containing SNP marker" in the resistance marker of the present invention.

(3) Identification of the region between the sites of the two SNP markers by the base sequence The selection in the step (x) includes, for example, solcap_snp_sl_5840, solcap_snp_sl_14174', solcap_snp_sl_7034', solcap_snp_sl_sl_snp_snp1s. solcap_snp_sl_55410 ', solcap_snp_sl_55399, solcap_snp_sl_71138', solcap_snp_sl_37097 ', solcap_snp_sl_12147', solcap_snp_sl_12152 ', and tomato with half body wilt resistance locus comprising the nucleotide sequence of the region between the sites of the two SNP markers selected from the group consisting of solcap_snp_sl_70781 Selection of plants. The selection in step (x) comprises, for example, solcap_snp_sl_5840, solcap_snp_sl_100293', solcap_snp_sl_55399', solcap_snp_sl_37097', and a solcap_sn. It may be a selection of tomato plants having a wilt disease resistance locus. The base sequence of the region between the sites of the two SNP markers is described in, for example, "(3) Identification of the region between the sites of the two SNP markers" in the half-body wilt resistance marker of the present invention. Can be used.

As a specific example, the selection in the (x) step, for example, in the base sequence of the region, solcap_snp_sl_14174 ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_37097', solcap_snp_sl_12147 ', And selection of tomato plants having a half-body wilt resistance locus with at least one SNP marker selected from the group consisting of', and solcap_snp_sl_12152'. The selection in step (x) is, for example, a half-body locus resistance gene having at least one SNP marker selected from the group consisting of solcap_snp_sl_100293', solcap_snp_sl_55399', and solcap_snp_sl_37097' in the base sequence of the region. Selection of tomato plants may be used.

Further, the selection in the step (x) may be, for example, selection of a tomato plant having a half-body wilt resistance locus satisfying the above conditions (i), (ii), (iii), or (iv).

The chromosome that detects the presence or absence of the half-body wilt resistance locus is preferably chromosome 7.

The tomato plant used as the other parent in the step (a) is not particularly limited, and may be, for example, a tomato plant having or not having a known half-body wilt resistance gene, or other resistance. It may be a tomato plant having or not having, or the half-body wilt-resistant tomato plant of the present invention.

In the step (a), the method for crossing the half-body wilt-resistant tomato plant with the other tomato plant is not particularly limited, and a known method can be adopted.

The target for selecting a half-body wilt-resistant tomato plant in the step (b) may be, for example, the tomato plant obtained in the step (a) or a progeny line obtained from the tomato plant. .. Specifically, the target may be, for example, an F1 tomato plant obtained by crossing in the step (a), or a progeny line. The progeny line may be, for example, a self-propagating progeny or a back-crossing progeny of the F1 tomato plant obtained by the crossing in the step (a), or crossing the F1 tomato plant with another tomato plant. It may be a tomato plant obtained by.

In the step (b), selection of a half-body wilt-resistant tomato plant can be performed, for example, by directly or indirectly confirming half-body wilt resistance.

In the step (b), the direct confirmation can be performed by evaluating the obtained F1 tomato plant or its progeny line, for example, resistance to half-body wilt disease by the degree of disease as described above. Specifically, for example, it can be confirmed by inoculating the F1 tomato plant or its progeny line with a half-body wilt disease bacterium and evaluating the half-body wilt resistance by the degree of disease onset. In this case, for example, the F1 tomato plant or its progeny line showing an onset degree of less than 2 can be selected as a half-body wilt-resistant tomato plant.

Further, in the step (b), the selection by the indirect confirmation can be performed by, for example, the following steps (b1) and (b2).
(B1) A detection step of detecting the presence or absence of a half-body wilt resistance locus on a chromosome of a tomato plant or a progeny line obtained from the step (a) (b2) of the half-body wilt resistance locus. A selection step of selecting a tomato plant or a progeny line obtained in the above step (a) as a half-body wilt-resistant tomato plant due to its presence.

The selection by indirect confirmation of the half-body wilt resistance tomato plant in the step (b) is, for example, the same as the method described in the step (x), and the presence or absence of the half-body wilt resistance locus is detected. More specifically, it can be carried out by detecting the presence or absence of the half-body wilt disease resistance locus using the molecular marker.

In the production method of the present invention, it is preferable to further grow the half-body wilt-resistant tomato plant selected in the step (b).

As described above, the tomato plant or its progeny line in which the resistance to half-body wilt disease has been confirmed can be selected as the half-body wilt resistance tomato plant.

The production method of the present invention may further include a seeding step of collecting seeds from the progeny line obtained by crossing.

4. Screening method for half-body wilt-resistant tomato plant The screening method for half-body wilt-resistant tomato plant of the present invention (hereinafter, also referred to as “screening method”) is for producing half-body wilt-resistant tomato plant by crossing. As a parent, it comprises a step of selecting a tomato plant containing a half-body wilt resistance gene locus on chromosome 7 as a half-body wilt resistance marker of the tomato plant from a test tomato plant.

The screening method of the present invention is characterized by including a step of selecting a plant having a half-body wilt resistance locus on chromosome 7 as a half-body wilt resistance marker from a test tomato plant, and other The process and conditions are not limited in any way. According to the screening method of the present invention, a half-body wilt resistance marker can be obtained by the half-body wilt resistance marker of the present invention. As the screening method of the present invention, for example, the description of the resistance marker, the resistant tomato plant, the production method and the like of the present invention can be incorporated.

For the selection of the parents, for example, the description of the step (x) in the method for producing a half-body wilt-resistant tomato plant of the present invention can be incorporated.

Hereinafter, the present invention will be described in detail with reference to Examples, but the present invention is not limited to the embodiments described in the Examples.

[Example 1]
It was confirmed that a novel half-body wilt-resistant tomato plant showed resistance to the half-body wilt fungus of Race 3.

In order to develop a new tomato plant showing resistance to half-body wilt disease, a large amount of tomato line seeds collected by subculture at Takii & Co., Ltd. farm were bred and tested for half-body wilt resistance. rice field. As a result, a novel half-body wilt-resistant tomato strain ( S. lycopersium ) showing resistance to half-body wilt was obtained. This new half-body wilt resistant tomato plant was deposited under accession number FERM BP-22308. Hereinafter, this half-body wilt-resistant tomato plant is referred to as a deposit line.

An inoculation test was conducted on the deposited strain using the race 3 half-body wilt bacterium capable of infecting a tomato plant showing resistance to the race 2 half-body wilt disease. The inoculation test of the half-body wilt bacterium was carried out as follows according to the method described in the above-mentioned reference information 4.

As the half-body wilt disease bacterium, a bacterium derived from a naturally-occurring half-body wilt disease-affected tomato was used in a tomato cultivation field in Gifu prefecture. The half-body wilt bacterium was found in the tomato plant "Green Force (Takii Seed Co., Ltd., S. lycopersium )" showing resistance to the half-body wilt bacterium of Race 1 and the half-body wilt of Races 1 and 2 according to the following inoculation test. It was confirmed that it is a pathogen capable of infecting the tomato plant "Ganbaru Root Charis ( Aisan Seed Co., Ltd., S. lycopersium)" that is resistant to the disease, that is, it is a pathogen of Race 3. In addition, as tomato plants, the deposit line, Green Force, and root charis that did its best were used by 8 individuals each.

First, the half-body wilt bacterium was cultured with shaking in a sucrose-added potato decoction liquid medium having the following composition for 5 days, and filtered through double gauze. A spore suspension was prepared by adjusting the collected conidia to 1.0 × 10 ⁵ cells / mL with sterilized water, and this was used for inoculation. In addition, as the tomato plant to be used for the inoculation, seedlings in which two true leaves were developed were used. The roots of the seedlings were washed with tap water to remove the soil, and then the seedlings were soaked in the spore suspension for 1 minute to inoculate the half-body wilt fungus. After the inoculation, each strain was transplanted into a 50-well cell tray filled with sterilized soil, and grown at 20 ° C. for 12 hours under the conditions of day length for 3 weeks.

(Potato decoction liquid medium with sucrose added)
Potato (300.0g decoction) 1000mL
_{Ca (NO 3) 2 · 4H} 2 O 0.5g
_{Na 2 HPO 4 · 12H 2 O} 2.0g
Peptone 5.0g
Sucrose 20.0g
pH 6.8-7.0

The onset investigation was carried out according to the method of the above-mentioned reference information 4, and the onset index was evaluated according to the following criteria. Further, as an evaluation standard of the disease onset index, a representative example of an individual having a disease onset index 0 to 4 is shown in the photograph of FIG.
Disease index 0: Healthy disease index 1: Deciduous disease index of cotyledons 2: Yellowing of lower leaves and partial wilting and growth decline Disease index 3: Withered disease index of whole plant 4: Withering

Then, for each individual, the onset index was investigated according to the above criteria, and the onset degree of each strain was calculated from the following formula.
Incidence (N) = [(0 × n ₀ ) + (1 × n ₁ ) + (2 × n ₂ ) + (3 × n ₃ ) + (4 × n ₄ )] / Number of individuals surveyed In the above formula, _{"0 , 1 , 2 , 3 , 4} " indicate the onset index, respectively, and "n 0, n 1, n 2, n 3, n 4" indicate the onset index 0, the onset index 1, and the onset index 2, respectively. , The disease index 3 and the disease index 4 are shown.

These results are shown in Table 1 below. As shown in Table 1 below, the disease onset is less than 2 in the deposited strain, whereas the disease onset is 2 in the green force resistant to race 1 and the hard root charis resistant to races 1 and 2. That was all. From these results, the resistant tomato plant of the present invention is also effective against the half-body wilt disease bacterium of Race 3, which is a half-body wilt disease bacterium capable of infecting a tomato plant containing a known half-body wilt resistance gene. I understand.

[Example 2]
We analyzed the inheritance pattern of the half-body wilt resistance locus in a novel half-body wilt-resistant tomato plant.

By crossing the tomato plant of the deposit line (accession number FERM BP-22308) with Green Force, an F2 segregation population of 72 individuals (hereinafter, also referred to as "72 line") was obtained.

Then, the inoculation test of the half-body wilt disease bacterium was performed on the 72 strains in the same manner as in Example 1, and the onset index of each individual was evaluated. In addition, the disease index of each individual was evaluated in the same manner for 8 deposited strains and 8 green forces.

These results are shown in Table 2 below. As shown in Table 2 below, some individuals of the 72 strains showed an onset index of less than 2. In addition, from the ratio of the number of individuals with an onset index of less than 2 to the number of individuals with an onset index of 2 or more, the resistance to half-body wilt disease of the deposit line (accession number FERM BP-22308) is a resistance containing a small number of resistance genes. It was speculated that it was controlled by the sex locus. The above speculation does not limit the present invention in any way.

[Example 3]
A novel half-body wilt disease resistance locus was identified for the 72 strains of the F2 isolated population in Example 2.

DNA extracted from each of the 72 strains was genotyped by SOLCAP's SNP assay (see References 1 to 3 above), and linkage maps were created using software (Join Map), and software (QTL cartographer, NC). Linkage analysis was performed using (manufactured by STATE University).

The result is shown in FIG. FIG. 3 is a graph showing the relationship between the position on chromosome 7 and the rod score. In FIG. 3, the leftmost numerical value in the figure indicates the position on chromosome 7, the numerical value next to the arrow on the left side of the chromosome indicates the distance between each position, and the lower arrow indicates the rod score. As shown in FIG. 3, on chromosome 7, one region with a high correlation with the onset index, which showed 13.44 as the peak value of the rod score, was identified. The region is a region containing the SNPs identified by solcap_snp_sl_100293, solcap_snp_sl_55399, and solcap_snp_sl_37097. From this result, it was clarified that the novel half-body wilt disease resistance locus is located on chromosome 7.

[Example 4]
It was confirmed that half-body wilt-resistant tomato plants could be selected using solcap_snp_sl_55399.

By crossing the deposited line with the half-body wilt disease-susceptible tomato plant "Momotaro Eight (Takii & Co., Ltd., S. lycopersium )", an F2 segregation population of 80 individuals (hereinafter, also referred to as "80 line") is formed. Obtained. Then, the SNP assay was performed on the 80 strains by the same method as in Example 3 to identify the polymorphic base corresponding to the SNP marker solcap_snp_sl_55399. Then, 15 individuals containing solcap_snp_sl_55399 in a resistant homozygous form (resistant line) and 18 individuals containing solcap_snp_sl_55399 in a morbid homozygous type (pathogenic line) were identified. Then, the disease index was evaluated for the resistant line and the diseased line in the same manner as in Example 1, and the disease degree of each line was calculated.

These results are shown in Table 3 below. As shown in Table 3 below, the disease-causing strain was less than 2 in the resistant strain, whereas the disease-causing degree was 2 or more in the susceptible strain. Further, when the disease index of the resistant line and the diseased line was subjected to a t-test of homoscedasticity, p <0.001, and the resistant line significantly affected the diseased line. The index was declining. From these results, it was found that half-body wilt-resistant tomato plants can be selected using solcap_snp_sl_55399.

[Example 5]
For the 72 lines of F2 segregating population in Example 2, solcap_snp_sl_5840, solcap_snp_sl_14174, solcap_snp_sl_7034, solcap_snp_sl_24321, solcap_snp_sl_100293, solcap_snp_sl_100761, solcap_snp_sl_55410, solcap_snp_sl_55399, solcap_snp_sl_71138, solcap_snp_sl_37097, solcap_snp_sl_12147, using Solcap_snp_sl_12152, and Solcap_snp_sl_70781, performs linkage analysis, Solcap_snp_sl_14174 ', solcap_snp_sl_7034, solcap_snp_sl_24321', solcap_snp_sl_100293 ', solcap_snp_sl_100761', solcap_snp_sl_55410 ', solcap_snp_sl_55399, solcap_snp_sl_71138', solcap_snp_sl_37097 ', solcap_snp_sl_12147', and Solcap_snp_sl_12152 'that linked the resistance locus, and area identified by these SNP markers It was confirmed that the resistance locus was locused.

In the same manner as in Example 3, DNA extracted from each of the 72 strains was genotyped by the SLP assay of SOLCAP, and a linkage map was created using software (Join Map), and software (QTL cartographer, NC STATE). Linkage analysis was performed using (manufactured by University).

The result is shown in FIG. FIG. 4 is a graph showing the relationship between the position on chromosome 7 and the rod score. In FIG. 4, the leftmost numerical value in the figure indicates the position on chromosome 7, the numerical value next to the arrow on the left side of the chromosome indicates the distance between each position, and the lower arrow indicates the rod score. As shown in FIG. 4, 14.44 was shown as the peak value of the rod score. Further, solcap_snp_sl_14174, solcap_snp_sl_7034, solcap_snp_sl_24321, solcap_snp_sl_100293, solcap_snp_sl_100761, solcap_snp_sl_55410, solcap_snp_sl_55399, solcap_snp_sl_71138, solcap_snp_sl_37097, solcap_snp_sl_12147, and region specified by solcap_snp_sl_12152 the rod score is 3.3 or more, a high correlation with the disease index area It was confirmed that there was. This result, solcap_snp_sl_14174 ', solcap_snp_sl_7034, solcap_snp_sl_24321', solcap_snp_sl_100293 ', solcap_snp_sl_100761', solcap_snp_sl_55410 ', solcap_snp_sl_55399, solcap_snp_sl_71138', solcap_snp_sl_37097 ', solcap_snp_sl_12147', and Solcap_snp_sl_12152 'is resistance gene linkage that Zajo resistant locus be, and area identified by these SNP markers, i.e., in chromosome 7, solcap_snp_sl_5840, solcap_snp_sl_14174, solcap_snp_sl_7034, solcap_snp_sl_24321, solcap_snp_sl_100293, solcap_snp_sl_100761, solcap_snp_sl_55410, solcap_snp_sl_55399, solcap_snp_sl_71138, solcap_snp_sl_37097, solcap_snp_sl_12147, the group consisting of Solcap_snp_sl_12152, and solcap_snp_sl_70781 It was found that the resistance gene was locused in the region between the sites of the two SNP markers selected from.

This application claims priority on the basis of Japanese application Japanese Patent Application No. 2016-107236 filed on May 30, 2016 and incorporates all of its disclosures herein.

Although the present invention has been described above with reference to the embodiments and examples, the present invention is not limited to the above embodiments and examples. Various changes that can be understood by those skilled in the art can be made to the structure and details of the present invention within the scope of the present invention.

As described above, according to the half-body wilt resistance marker of the tomato plant of the present invention, for example, a half-body wilt resistant tomato plant can be easily screened. Further, since the tomato plant resistant to half-body wilt disease of the present invention contains, for example, the resistance locus, it is possible to exhibit resistance to half-body wilt disease, for example. Further, the tomato plant containing the resistance marker is resistant to, for example, a pathogen of half-body wilt disease (for example, race 3) capable of infecting the tomato plant containing the resistance gene of the prior art document. show. Therefore, since the half-body wilt-resistant tomato plant of the present invention does not need to be controlled by a pesticide as in the conventional case, for example, the problem of labor and cost of spraying the pesticide can be avoided. Therefore, the present invention is extremely useful in the agricultural field such as breeding.

Claims (12)

A half-length wilt resistance gene locus on chromosome 7 seen including,
The half-body wilt resistance locus is identified by at least one polynucleotide selected from the group consisting of the following (a) to (j) and (k). plant.
(A) The polynucleotide of (a1) or (a3) below
(A1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1
(A3) The 9th base (G), 51st base (G), and 95th base (G) of the (a1) are stored, and 90% or more of the base sequence of the (a1). At the half-body wilt resistance locus, a polynucleotide having the same base sequence as that of the above-mentioned (a1) with respect to the half-body wilt resistance.
(B) The polynucleotide of (b1) or (b3) below
(B1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2
(B3) The second base (G), the eighth base (G), the eleventh base (A), the 43rd base (C), and the 51st base (T) of the above (b1) are conserved. The polynucleotide of (b1) is composed of a base sequence having 90% or more identity with respect to the base sequence of (b1), and at the half-body wilt resistance gene locus, with respect to the half-body wilt resistance. Polynucleotide with the same function as
(C) The polynucleotide of (c1) or (c3) below
(C1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3
(C3) The 50th base (C) and the 51st base (A) of the above (c1) are conserved, and consist of a base sequence having 90% or more identity with respect to the base sequence of the above (c1). , A polynucleotide having a function equivalent to that of the polynucleotide of (c1) with respect to the resistance to half-body wilt at the locus of resistance to half-body wilt.
(D) The polynucleotide of (d1) or (d3) below
(D1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4
(D3) The 101st base (G), the 117th base (C), the 127th base (G), and the 148th base (A) of the above (d1) are stored, and the base of the above (d1) is stored. A polynucleotide consisting of a base sequence having 90% or more identity with respect to the sequence and having a function equivalent to that of the polynucleotide (d1) with respect to the half-body wilt resistance gene locus at the half-body wilt resistance gene locus.
(E) The polynucleotide of (e1) or (e3) below
(E1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5
(E3) The 50th base (A), the 59th base (G), and the 100th base (G) of the (e1) are stored, and 90% or more of the base sequence of the (e1). At the half-body wilt resistance locus, a polynucleotide having the same base sequence as that of the above-mentioned (e1) with respect to the half-body wilt resistance.
(F) The polynucleotide of (f1) or (f3) below
(F1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6
(F3) The 51st base (G) and the 54th base (T) of the above (f1) are conserved, and consist of a base sequence having 90% or more identity with respect to the base sequence of the above (f1). , A polynucleotide having the same function as the polynucleotide of (f1) with respect to the resistance to half-body wilt at the locus of resistance to half-body wilt.
(G) The following polynucleotide (g1) or (g3)
(G1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7.
(G3) The 51st base (T) of the (g1) is conserved and consists of a base sequence having 90% or more identity with respect to the base sequence of the (g1), and the half-body wilt resistance gene. In the locus, a polynucleotide having the same function as the polynucleotide of (g1) above with respect to resistance to half-body wilt.
(H) The polynucleotide of (h1) or (h3) below
(H1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8
(H3) The 51st base (T), the 65th base (A), and the 92nd base (A) of the (h1) are stored, and 90% or more of the base sequence of the (h1). At the half-body wilt resistance locus, a polynucleotide having the same base sequence as that of the above-mentioned (h1) with respect to the half-body wilt resistance.
(I) The polynucleotide of (i1) or (i3) below
(I1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9
(I3) The 50th base (T) and the 51st base (G) of the above (i1) are conserved, and consist of a base sequence having 90% or more identity with respect to the base sequence of the above (i1). , A polynucleotide having the same function as the polynucleotide of (i1) with respect to the half-body wilt resistance locus at the half-body wilt resistance locus.
(J) The polynucleotide of (j1) or (j3) below
(J1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10.
(J3) The 20th base (A), the 51st base (C), the 65th base (T), and the 68th base (A) of the (j1) are stored, and the base of the (j1) is stored. A polynucleotide consisting of a base sequence having 90% or more identity with respect to the sequence and having a function equivalent to that of the polynucleotide (j1) with respect to the half-body wilt resistance gene locus at the half-body wilt resistance gene locus.
(K) The polynucleotide of (k1) or (k3) below
(K1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11
(K3) The 51st base (C) and the 86th base (A) of the (k1) are conserved, and consist of a base sequence having 90% or more identity with respect to the base sequence of the (k1). , A polynucleotide having the same function as the polynucleotide of (k1) with respect to the resistance to half-body wilt at the locus of resistance to half-body wilt. The resistance locus in the chromosome, solcap_snp_sl_5840, solcap_snp_sl_14174 ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_37097', solcap_snp_sl_12147 group consisting ', solcap_snp_sl_12152', and solcap_snp_sl_70781 comprising the nucleotide sequence of a region between the sites of the two SNP markers selected from, half body wilt resistant tomato plant of claim 1. The half-body wilt-resistant tomato plant according to claim 1 or 2 , wherein the half-body wilt-resistant tomato plant is the tomato plant specified by Accession No. FERM BP-22308 or a progeny line. The half-body wilt-resistant tomato plant according to any one of claims 1 to 3 , wherein the half-body wilt-resistant tomato plant is a plant body or a portion thereof. The half-body wilt-resistant tomato plant according to any one of claims 1 to 4 , wherein the half-body wilt-resistant tomato plant is a seed. A method for producing a half-body wilt-resistant tomato plant, which comprises the following steps (a) and (b).
(A) A step of crossing a half-body wilt-resistant tomato plant according to any one of claims 1 to 5 with another tomato plant (b) A tomato plant obtained from the above-mentioned step (a) or a subsequent step. The process of selecting half-body wilt-resistant tomato plants from the generation line The method for producing a half-body wilt-resistant tomato plant according to claim 6, which comprises the following step (x) prior to the step (a).
(X) A step of selecting a half-body wilt-resistant tomato plant according to any one of claims 1 to 5 from a tomato plant to be tested. The half-body wilt-resistant tomato plant according to claim 7, wherein the selection in the step (x) is selection of a half-body wilt-resistant tomato plant containing a half-body wilt resistance gene locus on chromosome 7. Production method. Half-body wilt disease in which the selection in the step (x) has a half-body wilt disease resistance locus identified by at least one polynucleotide selected from the group consisting of the following (a) to (j) and (k). The method for producing a half-body wilt-resistant tomato plant according to claim 8, which is a selection of a resistant tomato plant.
(A) Polynucleotide (a3) consisting of the nucleotide sequence of the following (a1) or (a3) (a1) SEQ ID NO: 1 The 9th base (G) and 51st base (G) of the above (a1) , And the 95th base (G) are conserved and consist of a base sequence having 90% or more identity with respect to the base sequence of (a1). Polynucleotide having the same function as the polynucleotide of (a1) in terms of disease resistance (b) Polynucleotide (b1) consisting of the nucleotide sequence of SEQ ID NO: 2 below (b1) or (b3) The second base (G), the eighth base (G), the eleventh base (A), the 43rd base (C), and the 51st base (T) of (b1) are stored, and the above-mentioned ( It consists of a base sequence having 90 % or more identity with respect to the base sequence of b1), and has the same function as the polynucleotide of (b1) with respect to the resistance to half-body wilt at the half-body wilt resistance gene locus. Polynucleotide (c) consisting of the nucleotide sequence of the following (c1) or (c3) (c1) SEQ ID NO: 3 (c3) The 50th base (C) and the 51st base (c1) of the above (c1). The base (A) is conserved and consists of a base sequence having 90 % or more identity with respect to the base sequence of the above (c1). Polynucleotide having the same function as the polynucleotide of (c1) (d) Polynucleotide consisting of the nucleotide sequence of the following (d1) or (d3) (d1) SEQ ID NO: 4 (d3) 101 of the above (d1) The th base (G), the 117th base (C), the 127th base (G), and the 148th base (A) are conserved, and 90 % or more of the base sequence of the above (d1) is obtained. A polynucleotide (e) below (e1) or ( The polynucleotide (e1) of the e3) The polynucleotide (e3) consisting of the nucleotide sequence of SEQ ID NO: 5 The 50th base (A), the 59th base (G), and the 100th base (G) of the above (e1). Is preserved, and a base having 90 % or more identity with respect to the base sequence of (e1) above. A polynucleotide consisting of a sequence and having a function equivalent to that of the polynucleotide of (e1) with respect to resistance to half-body wilt at the half-body wilt resistance locus (f) The polynucleotide of (f1) or (f3) below. (F1) Polynucleotide (f3) consisting of the base sequence of SEQ ID NO: 6 The 51st base (G) and 54th base (T) of the above (f1) are stored, and the base sequence of the above (f1) is conserved. , 90 % or more of the nucleotide sequences having the same identity, and at the half-body wilt resistance gene locus, the polynucleotide (g) having the same function as the above-mentioned (f1) polynucleotide with respect to the half-body wilt resistance is as follows. The nucleotide (g1) or the polynucleotide (g1) consisting of the nucleotide sequence of SEQ ID NO: 7 (g1) The 51st base (T) of the (g1) is stored in the nucleotide sequence of the (g1). On the other hand, a nucleotide (h) consisting of a base sequence having 90 % or more identity and having the same function as the polynucleotide of (g1) with respect to the resistance to half-body wilt at the half-body wilt resistance gene locus. ) Polynucleotide (h1) consisting of the following nucleotide (h1) or (h3) nucleotide sequence of SEQ ID NO: 8 (h3) The 51st base (T), the 65th base (A), and the 65th base (A) of the above (h1). The 92nd base (A) is conserved and consists of a base sequence having 90 % or more identity with respect to the base sequence of (h1). At the half-body wilt resistance gene locus, the half-body wilt resistance Polynucleotide having the same function as the polynucleotide of (h1) in terms of sex (i) Polynucleotide of the following (i1) or (i3) (i1) Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 (i3) The above (i1) ), The 50th base (T) and the 51st base (G) are conserved, and the base sequence has 90 % or more identity with respect to the base sequence of (i1). At the sex locus, the nucleotide sequence having the same function as the polynucleotide of (i1) with respect to resistance to half-body wilt (j) The nucleotide sequence of the polynucleotide (j1) SEQ ID NO: 10 of the following (j1) or (j3) Polynucleotide (j3) Consisting of the above (j1), the 20th base (A), the 51st base (C), the 65th base (T), and the 68th base (A) are stored. 90 for the base sequence of j1) A nucleotide (k) below (k1) consisting of a base sequence having% or more identity and having the same function as the polynucleotide of (j1) in terms of resistance to half-body wilt at the half-body wilt resistance locus. ) Or (k3) Nucleotide (k1) Nucleotide consisting of the base sequence of SEQ ID NO: 11 (k3) The 51st base (C) and 86th base (A) of the above (k1) are stored, and the above (k1) is stored. It consists of a base sequence having 90 % or more identity with respect to the base sequence of k1), and has the same function as the polynucleotide of (k1) in terms of resistance to half-body wilt at the half-body wilt resistance gene locus. Polynucleotide with The selection in the (x) step, in the chromosome, solcap_snp_sl_5840, solcap_snp_sl_14174 ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_37097', solcap_snp_sl_12147 ', solcap_snp_sl_12152', and solcap_snp_sl_70781 The selection of a half-body wilt-resistant tomato plant having a half-body wilt-resistant locus containing the nucleotide sequence of the region between the sites of two SNP markers selected from the group consisting of the group according to claim 8 or 9 . A method for producing a tomato plant resistant to half-body wilt. As a parent for producing a half-body wilt resistance tomato plant by crossing, a tomato plant containing a half-body wilt resistance gene locus on chromosome 7 as a half-body wilt resistance marker of the tomato plant was selected from the test tomato plant. Including the selection process
The half-body wilt resistance locus is identified by at least one polynucleotide selected from the group consisting of the following (a) to (j) and (k). Plant screening method.
(A) The polynucleotide of (a1) or (a3) below
(A1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1
(A3) The 9th base (G), 51st base (G), and 95th base (G) of the (a1) are stored, and 90% or more of the base sequence of the (a1). At the half-body wilt resistance locus, a polynucleotide having the same base sequence as that of the above-mentioned (a1) with respect to the half-body wilt resistance.
(B) The polynucleotide of (b1) or (b3) below
(B1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2
(B3) The second base (G), the eighth base (G), the eleventh base (A), the 43rd base (C), and the 51st base (T) of the above (b1) are conserved. The polynucleotide of (b1) is composed of a base sequence having 90% or more identity with respect to the base sequence of (b1), and at the half-body wilt resistance gene locus, with respect to the half-body wilt resistance. Polynucleotide with the same function as
(C) The polynucleotide of (c1) or (c3) below
(C1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3
(C3) The 50th base (C) and the 51st base (A) of the above (c1) are conserved, and consist of a base sequence having 90% or more identity with respect to the base sequence of the above (c1). , A polynucleotide having a function equivalent to that of the polynucleotide of (c1) with respect to the resistance to half-body wilt at the locus of resistance to half-body wilt.
(D) The polynucleotide of (d1) or (d3) below
(D1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4
(D3) The 101st base (G), the 117th base (C), the 127th base (G), and the 148th base (A) of the above (d1) are stored, and the base of the above (d1) is stored. A polynucleotide consisting of a base sequence having 90% or more identity with respect to the sequence and having a function equivalent to that of the polynucleotide (d1) with respect to the half-body wilt resistance gene locus at the half-body wilt resistance gene locus.
(E) The polynucleotide of (e1) or (e3) below
(E1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5
(E3) The 50th base (A), the 59th base (G), and the 100th base (G) of the (e1) are stored, and 90% or more of the base sequence of the (e1). At the half-body wilt resistance locus, a polynucleotide having the same base sequence as that of the above-mentioned (e1) with respect to the half-body wilt resistance.
(F) The polynucleotide of (f1) or (f3) below
(F1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6
(F3) The 51st base (G) and the 54th base (T) of the above (f1) are conserved, and consist of a base sequence having 90% or more identity with respect to the base sequence of the above (f1). , A polynucleotide having the same function as the polynucleotide of (f1) with respect to the resistance to half-body wilt at the locus of resistance to half-body wilt.
(G) The following polynucleotide (g1) or (g3)
(G1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7.
(G3) The 51st base (T) of the (g1) is conserved and consists of a base sequence having 90% or more identity with respect to the base sequence of the (g1), and the half-body wilt resistance gene. In the locus, a polynucleotide having the same function as the polynucleotide of (g1) above with respect to resistance to half-body wilt.
(H) The polynucleotide of (h1) or (h3) below
(H1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8
(H3) The 51st base (T), the 65th base (A), and the 92nd base (A) of the (h1) are stored, and 90% or more of the base sequence of the (h1). At the half-body wilt resistance locus, a polynucleotide having the same base sequence as that of the above-mentioned (h1) with respect to the half-body wilt resistance.
(I) The polynucleotide of (i1) or (i3) below
(I1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9
(I3) The 50th base (T) and the 51st base (G) of the above (i1) are conserved, and consist of a base sequence having 90% or more identity with respect to the base sequence of the above (i1). , A polynucleotide having the same function as the polynucleotide of (i1) with respect to the half-body wilt resistance locus at the half-body wilt resistance locus.
(J) The polynucleotide of (j1) or (j3) below
(J1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10.
(J3) The 20th base (A), the 51st base (C), the 65th base (T), and the 68th base (A) of the (j1) are stored, and the base of the (j1) is stored. A polynucleotide consisting of a base sequence having 90% or more identity with respect to the sequence and having a function equivalent to that of the polynucleotide (j1) with respect to the half-body wilt resistance gene locus at the half-body wilt resistance gene locus.
(K) The polynucleotide of (k1) or (k3) below
(K1) A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11
(K3) The 51st base (C) and the 86th base (A) of the (k1) are conserved, and consist of a base sequence having 90% or more identity with respect to the base sequence of the (k1). , A polynucleotide having the same function as the polynucleotide of (k1) with respect to the resistance to half-body wilt at the locus of resistance to half-body wilt. The resistance locus in the chromosome, solcap_snp_sl_5840, solcap_snp_sl_14174 ', solcap_snp_sl_7034', solcap_snp_sl_24321 ', solcap_snp_sl_100293', solcap_snp_sl_100761 ', solcap_snp_sl_55410', solcap_snp_sl_55399, solcap_snp_sl_71138 ', solcap_snp_sl_37097', solcap_snp_sl_12147 group consisting ', solcap_snp_sl_12152', and solcap_snp_sl_70781 The method for screening a half-body wilt-resistant tomato plant according to claim 11, which comprises a base sequence of a region between two SNP marker sites selected from.

Images