JP2019024483A - Mildew resistant pumpkin plants using the same, and methods for imparting powdery mildew resistance to pumpkin plants - Google Patents

Abstract

To provide novel powdery mildew resistance markers of western pumpkin (Cucurbita maxima) plants, powdery mildew resistant pumpkin plants, methods for producing powdery mildew resistant pumpkin plants using the same, and methods for imparting powdery mildew resistance to pumpkin plants.SOLUTION: Disclosed herein is a powdery mildew resistant marker of western pumpkin plant comprising a powdery mildew resistance gene locus on the third chromosome, in particular, a powdery mildew resistance gene locus specified by at least one SNP marker selected from the group consisting of MSP_17500, MSP_8 and MSP_41353.SELECTED DRAWING: None

Description

  The present invention relates to a powdery mildew resistance marker for a pumpkin plant, a powdery mildew resistant pumpkin plant, a method for producing a powdery mildew resistant pumpkin plant using the same, and powdery mildew resistance to a pumpkin plant. It relates to a method for imparting sex.

  In the cultivation of pumpkin plants, diseases caused by powdery mildew are frequent diseases in pumpkin cultivation all over the world and are a serious problem worldwide. Plants infected with powdery mildew pathogens produce white powdery lesions on the leaves and stems. Thereafter, the growth is reduced due to the death of the leaves, and as a result, the yield of the fruit is reduced. In addition, it is known that a pumpkin plant is infected by a plurality of powdery mildew fungi (Non-Patent Document 1).

  Further, among the pumpkin plants, varieties exhibiting sufficient powdery mildew resistance have not been bred until now, and breeding of powdery mildew resistant varieties is required.

Eva Kristkova et.al., “Species spectra, distribution and host range of cucurbit powdery mildews in the Czech Republic, and in some other European and Middle Eastern countries”, 2009, Phytoparasitica, vol.37, pages 337-350

  Accordingly, the present invention provides a powdery mildew resistance marker for a new pumpkin plant, a powdery mildew resistant pumpkin plant, a method for producing a powdery mildew resistant pumpkin plant using the same, and a method for producing a powdery pumpkin plant. The purpose is to provide a method for imparting powdery mildew resistance.

  In order to achieve the above object, the powdery mildew resistance marker (hereinafter also referred to as “resistance marker”) of the pumpkin plant of the present invention is the powdery mildew resistance locus (hereinafter referred to as “the resistance marker”) on the third chromosome. It is also referred to as “resistance locus”.

  The powdery mildew resistant pumpkin plant of the present invention (hereinafter also referred to as “resistant pumpkin plant”) is characterized by including a powdery mildew resistant locus on the third chromosome.

The method for producing a powdery mildew resistant pumpkin plant of the present invention (hereinafter also referred to as “production method”) includes the following steps (a) and (b).
(A) a step of crossing the powdery mildew-resistant pumpkin plant of the present invention with another pumpkin plant (b) a powdery mildew from the pumpkin plant obtained from the step (a) or its progeny line Process for selecting disease-resistant pumpkin plants

  The method for imparting powdery mildew resistance to a pumpkin plant according to the present invention (hereinafter also referred to as “granting method”) introduces the powdery mildew resistance locus on chromosome 3 into a pumpkin plant. It is characterized by including.

  As a result of diligent research, the present inventors have found a novel powdery mildew resistance locus as a powdery mildew resistance marker showing powdery mildew resistance in pumpkin plants. The pumpkin plant containing the resistance marker exhibits powdery mildew resistance. Therefore, according to the powdery mildew resistance marker of the pumpkin plant of the present invention, for example, powdery mildew resistant pumpkin plants can be easily screened. Moreover, since the powdery mildew resistant pumpkin plant of this invention contains the said resistant locus, for example, it can show powdery mildew resistance, for example. For this reason, the powdery mildew-resistant pumpkin plant of the present invention does not require the conventional control with pesticides, and therefore, for example, the labor and cost problems of the pesticide spraying can be avoided.

FIG. 1 is a schematic diagram showing relative seating positions such as SNP (single nucleotide polymorphism) in the third chromosome. FIG. 2 is a photograph showing evaluation criteria for disease index of pumpkin plants in Example 1.

1. Powdery mildew resistance marker of pumpkin plant The powdery mildew resistance marker of the pumpkin plant of the present invention is characterized by including the powdery mildew resistance locus on the third chromosome as described above. The resistance marker of the present invention is characterized by including the powdery mildew resistance locus on the third chromosome, and other configurations and conditions are not particularly limited.

In the present invention, the “Pumpkin plant” is a plant classified as Cucurbita maxima of the genus Cucurbita . The pumpkin plant may be, for example, a hybrid with a related species. Examples of the related species include Cucurbita pepo and Cucurbita moschata .

In the present invention, the pathogenic bacteria of powdery mildew (hereinafter also referred to as “powdery mildew”) include Podosphaera xanthii (also referred to as “ Sphaerotheca fuliginea ”), Golovinomyces cichoracearum (also referred to as “ Erysiphe cichoracearum ”), and the like. Is Podosphaera xanthii .

  In the present invention, “powder resistance” is also referred to as “powder resistance”, for example. The resistance means, for example, the ability to inhibit or suppress the occurrence and progression of diseases caused by infection with powdery mildew fungus, specifically, for example, the occurrence of no disease, the stop of the progression of the disease that has occurred, and the occurrence Any of suppression of progression of the disease (also referred to as “inhibition”) may be used.

The pumpkin plant has chromosomes 1-20. Each chromosome in the pumpkin plant includes, for example, the base sequence information of the genome of Cucurbita maxima (variety name: Rimu) and the base sequence information of the genome of the target pumpkin plant and the base sequence information of the Rimu genome. It can be determined by comparison. The comparison can be performed with default parameters using, for example, analysis software such as BLAST and FASTA. The base sequence information of the Rimu genome can be obtained from, for example, the Cucurbit Genomics Database website (http://www.icugi.org/ or http://cucurbitgenomics.org/).

  The resistance marker of the present invention includes a resistance locus on the third chromosome, but the pumpkin plant having the resistance locus is, for example, any chromosome other than the third chromosome instead of the third chromosome. Above, it may have the resistance locus on the third chromosome. That is, the pumpkin plant having the resistance locus is chromosome 1, chromosome 2, chromosome 4, chromosome 5, chromosome 6, chromosome 7, chromosome 8, chromosome 9, chromosome 10, On the chromosome of any one of chromosome 11, chromosome 12, chromosome 13, chromosome 14, chromosome 15, chromosome 16, chromosome 17, chromosome 18, chromosome 19 and chromosome 20, It may have the resistance locus on chromosome 3.

  The resistance marker of the present invention may include, for example, the resistance locus on the third chromosome in a heterozygous form or a homozygous form. In the latter case, the resistant pumpkin plant may include at least one resistance marker on a chromosome other than the third chromosome. For example, one resistant locus may be included on a chromosome other than the third chromosome. Alternatively, two resistance loci may be included on chromosomes other than the third chromosome. When the two resistance loci are contained on a chromosome other than the third chromosome, the resistant pumpkin plant may contain, for example, the two resistance loci on the same chromosome or on different chromosomes. But you can.

  A powdery mildew resistance locus refers to a quantitative trait locus or gene region that confers powdery mildew resistance. The quantitative trait loci (QTL) generally refers to a chromosomal region involved in the expression of a quantitative trait. QTL can be defined using molecular markers that indicate specific loci on the chromosome. Techniques for defining QTL using the molecular markers are well known in the art.

  In the present invention, the molecular marker used for defining the resistance locus is not particularly limited. Examples of the molecular markers include SNP markers, AFLP (amplified fragment length polymorphism) markers, RFLP (restriction fragment length polymorphism) markers, microsatellite markers, SCAR (sequence-characterized amplified region) markers, and CAPS. (Cleaved amplified polymorphic sequence) marker. In the present invention, for example, one SNP may be used as the SNP marker, or a combination of two or more SNPs may be used as the SNP marker.

In the present invention, the powdery mildew resistance locus may be defined, for example, by (1) the SNP marker (hereinafter also referred to as “specific”), or (2) by a base sequence containing the SNP marker. It may be defined, (3) may be defined by the base sequence of the region between the two SNP marker sites, or may be defined by a combination thereof. When prescribed | regulated by the said combination, the said combination in particular is not restrict | limited, For example, the following combinations can be illustrated.
Combination of (1) and (2) Combination of (1) and (3) Combination of (2) and (3) Combination of (1), (2) and (3)

(1) Identification by SNP marker The resistance locus may be defined by, for example, the SNP marker as shown in (1) above. The SNP marker is not particularly limited, and examples thereof include MSP_17500, MSP_8, and MSP_41353. In addition, the following reference literature 1 can be referred for these SNP analysis, for example. MSP_17500, MSP_8, and MSP_41353 are SNP markers newly identified by the present inventors, and those skilled in the art can use the SNP marker based on a base sequence containing these SNP markers described later. The seating position of can be specified.
Reference 1: Guoyu Zhang et.al. (2012) “A high-density genetic map for anchoring genome sequences and identifying QTLs associated with dwarf vine in pumpkin (Cucurbita maxima Duch.)”, 2005, BMC Genomics, 16: 1101

The MSP — 17500 (hereinafter, also referred to as “SNP (a)”) is a polymorphism in which the underlined base (the 37th base of SEQ ID NO: 1) surrounded by parentheses in the base sequence of SEQ ID NO: 1 is C Indicates. That is, for example, when the SNP (a) is C, the Atlantic pumpkin plant is powdery mildew resistant, and when it is a base other than C (for example, T), the Atlantic pumpkin plant is powdery mildew. Indicates susceptibility. The base sequence of SEQ ID NO: 1 can be obtained from, for example, a pumpkin plant deposited under the receipt number FERM ABP-22336 described later. The SNP (a) can also be specified from known information on a database such as the above-mentioned web site, for example.
SEQ ID NO: 1
5'-CTTCATATTGTTTTGTGGTACACCATAAGCCAAGTA [ C ] GCCTTTCAGAAAACAAAGTAGATATTATAGCCTGACTGTCTATGAAGAACTAAAAAG-3 '

MSP_8 (hereinafter, also referred to as “SNP (b)”) is a polymorphism in which the underlined base in brackets (59th base of SEQ ID NO: 2) in the base sequence of SEQ ID NO: 2 is T Indicates. That is, for example, when the SNP (b) is T, the pumpkin plant is resistant to powdery mildew, and when it is a base other than T (for example, G), the pumpkin plant is powdery mildew. Indicates susceptibility. The base sequence of SEQ ID NO: 2 can be obtained from, for example, a pumpkin plant deposited under the receipt number FERM ABP-22336 described later. The SNP (b) can also be specified from known information on a database such as the above-mentioned web site, for example.
SEQ ID NO: 2
5'-ACATCTGAAAAAGTTGAAGCTGTTATGTGATGGAGAGATTGCAGAGTGGTTGAAAACG [ T ] T T G CTCCCCACCTTGCCAAACAGGTCAAA-3 '

The MSP — 41353 (hereinafter also referred to as “SNP (c)”) is a polymorphism in which the underlined base in brackets (the 34th base of SEQ ID NO: 3) in the base sequence of SEQ ID NO: 3 is C Indicates. That is, for example, when the SNP (c) is C, the pumpkin plant is resistant to powdery mildew, and when it is a base other than C (for example, T), the pumpkin plant is susceptible to powdery mildew. It shows that it is sex. The base sequence of SEQ ID NO: 3 can be obtained from, for example, a pumpkin plant deposited under the receipt number FERM ABP-22336 described later. The SNP (c) can also be identified from known information on a database such as the above-mentioned website.
SEQ ID NO: 3
5'-GAGAGTGGGCAACAATTTCCCCTTGAAGAAGAG [ C ] TCGTCGGCGGCGGTCATTGTGTGATTACTGGGA-3 '

  The sitting position of the SNP marker on the chromosome is not particularly limited. As shown in FIG. 1, the SNP markers are, for example, MSP_41353, MSP_8, and MSP_17500 in this order from the upstream side (MSP_14 side) to the downstream side (MSP_16 side) on the third chromosome of the pumpkin plant. Sitting. In FIG. 1, MSP_16 and MSP_14 are used to indicate the sitting positions of MSP_17500, MSP_8, and MSP_41353 on the third chromosome of the pumpkin plant, but either one or both are used as SNP markers. May be. In this case, in the explanation of MSP_16 and MSP_14, which will be described later, if the pumpkin plant polymorphism deposited under the receipt number FERM ABP-22336 is, the pumpkin plant is powdery mildew resistant and the receipt number FERM ABP. In the case of a base other than the polymorph of the pumpkin plant deposited at -22336, the pumpkin plant is susceptible to powdery mildew. When at least one of MSP_16 and MSP_14 is used as a SNP marker, it may be used in combination with at least one selected from the group consisting of MSP_17500, MSP_8, and MSP_41353.

  The number of the SNP markers that the resistance locus has is not particularly limited, and may be, for example, any one or two or more of the SNP markers, that is, two or all three. . In addition, the relationship between these three types of polymorphisms (SNP markers) and powdery mildew resistance has not been reported so far, and it was found in the powdery mildew resistance first discovered by the present inventors. It is a new polymorphism involved.

The combination of the SNP markers is not particularly limited, and examples thereof include the following combinations.
Combination of SNP (a) and SNP (b) Combination of SNP (a) and SNP (c) Combination of SNP (b) and SNP (c) Combination of SNP (a), SNP (b) and SNP (c) Among the combinations, since the correlation with powdery mildew resistance is higher, the following combinations are preferable, for example.
Combination of SNP (a), SNP (b), and SNP (c)

(2) Identification by base sequence including SNP marker The resistance locus may be defined by a base sequence including the SNP marker, for example, as shown in (2) above. The resistance gene locus may be composed of, for example, the base sequence or may include the base sequence.

  The base sequence containing the SNP marker is not particularly limited, and examples thereof include the polynucleotides (a), (b) and (c) described later. For example, the resistance loci include, for example, the polynucleotides (a), (b) and (c), wherein the polynucleotides include the SNP markers of the SNP (a), SNP (b) and SNP (c), respectively. It corresponds to.

The polynucleotide (a) is a base sequence including the SNP (a), that is, MSP — 17500, and is, for example, the following polynucleotide (a1), (a2), or (a3). The polynucleotides (a2) and (a3) are polynucleotides having functions equivalent to those of the polynucleotide (a1) with respect to the powdery mildew resistance at the resistance locus, respectively. The equivalent function means that, for example, a pumpkin plant having a powdery mildew resistance locus specified by the polynucleotide (a2) or (a3) exhibits powdery mildew resistance.
(A) Polynucleotide (a2) comprising the nucleotide sequence of SEQ ID NO: 1 (a1), polynucleotide (a1) below (a1), (a2), or (a3) The 37th base (C) of (a1) is conserved A polynucleotide comprising a base sequence in which one or several bases are deleted, substituted, inserted and / or added in the base sequence of (a1) (a3) the 37th base (C) of (a1) A polynucleotide comprising a nucleotide sequence having 80% or more identity to the nucleotide sequence of (a1)

  In the polynucleotide (a1), the underlined base (C) enclosed in parentheses in SEQ ID NO: 1 is a base corresponding to the polymorphism of the SNP (a). The polynucleotide (a1) can be obtained, for example, from a pumpkin plant deposited under the receipt number FERM ABP-22336 described later.

  In the polynucleotide (a2), the one or several is, for example, 1 to 18, 1 to 12, 1 to 8, 1 to 4, 1 to 3, 1, or 2. . In the present invention, the numerical range of the number of bases and the like discloses, for example, all positive integers belonging to the range. That is, for example, the description “1 to 5” means all disclosures of “1, 2, 3, 4, 5” (hereinafter the same).

  In the polynucleotide (a3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% That's it. The identity can be determined by aligning two base sequences (hereinafter the same). Specifically, the identity can be calculated from default parameters using analysis software such as BLAST and FASTA (hereinafter the same).

The polynucleotide (b) is a base sequence containing the SNP (b), that is, MSP_8, and is, for example, the following polynucleotide (b1), (b2), or (b3). The polynucleotides (b2) and (b3) are polynucleotides having functions equivalent to those of the polynucleotide (b1) with respect to powdery mildew resistance at the resistance locus, respectively. The equivalent function means that, for example, a pumpkin plant having a powdery mildew resistance locus specified by the polynucleotide (b2) or (b3) exhibits powdery mildew resistance.
(B) polynucleotide (b2) comprising the nucleotide sequence of SEQ ID NO: 2 (b1), polynucleotide (b1) below (b1), (b3), or (b3) The 59th base (T) of (b1) is conserved A polynucleotide comprising the base sequence in which one or several bases have been deleted, substituted, inserted and / or added in the base sequence of (b1) (b3) the 59th base (T) of (b1) A polynucleotide comprising a nucleotide sequence having 80% or more identity to the nucleotide sequence of (b1)

  In the polynucleotide (b1), the underlined base (T) enclosed in parentheses in SEQ ID NO: 2 is a base corresponding to the polymorphism of the SNP (b). The polynucleotide (b1) can be obtained, for example, from a pumpkin plant deposited under the receipt number FERM ABP-22336 described later.

  In the polynucleotide (b2), the one or several is, for example, 1 to 17, 1 to 13, 1 to 8, 1 to 4, 1 to 3, 1, or 2. .

  In the polynucleotide (b3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% That's it.

  In the polynucleotides (b2) and (b3), it is preferable that at least one of the 60th base (T) and the 62nd base (G) indicated by the underline in (b1) is conserved. In this case, the description of the polynucleotides (b2) and (b3) can be used for the one or several and identity, respectively.

The polynucleotide (c) is a base sequence including the SNP (c), that is, MSP_41353, and is, for example, the following polynucleotide (c1), (c2), or (c3). The polynucleotides (c2) and (c3) are polynucleotides having functions equivalent to those of the polynucleotide (c1) with respect to powdery mildew resistance at the resistance locus, respectively. The equivalent function means, for example, that a pumpkin plant having a powdery mildew resistance locus specified by the polynucleotide (c2) or (c3) exhibits powdery mildew resistance.
(C) Polynucleotide (c2) comprising the nucleotide sequence of SEQ ID NO: 3 (c1), (c1), (c2), or (c3) A polynucleotide consisting of a base sequence in which one or several bases are deleted, substituted, inserted and / or added in the base sequence of (c1) (c3) the 34th base (C) of (c1) And a polynucleotide comprising a base sequence having 80% or more identity to the base sequence of (c1)

  In the polynucleotide (c1), the underlined base (C) enclosed in parentheses in SEQ ID NO: 3 is a base corresponding to the polymorphism of the SNP (c). The polynucleotide (c1) can be obtained, for example, from a pumpkin plant deposited under the receipt number FERM ABP-22336 described later.

  In the polynucleotide (c2), the one or several is, for example, 1 to 13, 1 to 6, 1 to 3, 1, or 2.

  In the polynucleotide (c3), the identity is, for example, 80% or more, 85% or more, 89% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% That's it.

  The number of base sequences including the SNP marker that the resistance locus has is not particularly limited, and for example, any one of the polynucleotides (a), (b), and (c), or It may be two or more, that is, two or all three.

A combination of base sequences including the SNP marker is not particularly limited, and examples thereof include the following combinations.
(A) and (b) polynucleotide combinations (a) and (c) polynucleotide combinations (b) and (c) polynucleotide combinations (a), (b) and (b) c) Combination of polynucleotides Among the above combinations, since the correlation with powdery mildew resistance is higher, the following combinations are preferable, for example.
Combination of the polynucleotides (a), (b), and (c)

  Examples of the base sequence including the SNP marker include a base sequence including MSP_16 (polynucleotide consisting of the base sequence of SEQ ID NO: 4) and a base sequence including MSP_14 (polynucleotide consisting of the base sequence of SEQ ID NO: 5) described later. At least one of them may be used. In this case, in each polynucleotide, for example, the polymorphism of each polynucleotide or the base indicated by the underline is conserved, and one or several bases are deleted, substituted, inserted and / or deleted in the base sequence of each polynucleotide. A polynucleotide comprising an added base sequence, or a polymorphism or underlined base of each polynucleotide is conserved, and comprises a base sequence having 80% or more identity to the base sequence of each polynucleotide. It may be a polynucleotide. The description of said (a2) and (a3) can be used for said 1 or several and identity, for example. Each of the polynucleotides may be used in combination with at least one selected from the group consisting of the polynucleotides (a), (b), and (c), for example.

(3) Identification of the region between two SNP marker sites by the nucleotide sequence As shown in (3) above, for example, the resistance locus is defined by the nucleotide sequence of the region between the two SNP marker sites. May be. The base sequence of the region between the two SNP marker sites is not particularly limited. For example, between the sites of two SNP markers selected from the group consisting of MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 in the chromosome. The base sequence of this region is exemplified. The base sequence of the region between the sites of the two SNP markers is, for example, the corresponding two SNP markers in a pumpkin plant deposited under the accession number FERM ABP-22336 described later (hereinafter also referred to as “deposited line”). Reference can be made to the base sequence of the region between the sites. When referring to the base sequence of the deposited system, the base sequence of the region between the sites of the two SNP markers, for example, completely or partially matches the base sequence of the deposited system. In the latter case, the base sequence of the region between the two SNP marker sites is, for example, an oyster pumpkin plant having a resistance locus specified by the base sequence of the region between the two SNP marker sites. What is necessary is just to show disease resistance. When the resistance locus is specified in (3), it can also be said that the resistance locus is seated in a region between the sites of the two SNP markers, for example.

The MSP — 16 (hereinafter also referred to as “SNP (d)”) indicates, for example, a polymorphism of the underlined base surrounded by parentheses in SEQ ID NO: 4. In the pumpkin plant deposited under the receipt number FERM ABP-22336 described later, the SNP (d) indicates a polymorphism that is G, but the SNP (d) is, for example, a base other than G, that is, A , T, or C. The base sequence of SEQ ID NO: 4 can be obtained from, for example, a pumpkin plant deposited under the receipt number FERM ABP-22336 described later. The SNP (d) can also be specified from known information on a database such as the above-mentioned website.
SEQ ID NO: 4
5'-ATGAGGAATGATTACGTTTGGAAACTTTGCAGGTTGTGGGAGT [ G ] CTGGTTGGCAAGCCCCTGAACAACTTCTT-3 '

The MSP — 14 (hereinafter also referred to as “SNP (e)”) indicates, for example, a polymorphism of the underlined base surrounded by parentheses in SEQ ID NO: 5. In the pumpkin plant deposited under the receipt number FERM ABP-22336 described later, the SNP (e) indicates a polymorphism that is C, but the SNP (e) is, for example, a base other than C, that is, A , T, or G. The base sequence of SEQ ID NO: 5 can be obtained from, for example, a pumpkin plant deposited under the receipt number FERM ABP-22336 described later. The SNP (e) can also be specified from known information on a database such as the above-mentioned web site, for example.
SEQ ID NO: 5
5'-ATTGT C AC T AGAATTTGGCCAAACACTAAGTACCTGGATGTGATTGTGAC [ C ] GGAGCCATGGCTCAGTACATACCCACCTTGGAACTTTACAGTGGAGGG T TACCCATGGCTTGCAC T ATG-3 '

  As described above, for example, the upstream end portion and the downstream end portion can be identified by the two SNP marker portions. The region may be, for example, between the two SNP marker sites, and may or may not include both or one of the two SNP marker sites, for example. When the region includes the SNP marker site, the upstream end and the downstream end of the region become the SNP marker site, but the upstream end and the downstream side. The base with the end may be, for example, the underlined base in the above-described base sequence or other bases.

The two SNP markers that define the region are not particularly limited, and examples thereof include the following combinations.
Combination of SNPs (a) and (c) Combination of SNPs (a) and (e) Combination of SNPs (c) and (d) Combination of SNPs (d) and (e)

  When the resistance locus is defined by the base sequence of the region between the two SNP marker sites, the resistance locus further includes the SNP marker seated on the region in the base sequence of the region. It is preferable to have. Specifically, the resistance locus preferably has at least one SNP marker selected from the group consisting of MSP_17500, MSP_8, and MSP_41353 in the base sequence of the region.

  The SNP marker seated in the region may be, for example, one or both of the two SNP marker sites that define the region on the chromosome, or the two SNPs that define the region. It may be a SNP marker seated between the marker sites. The former is also referred to as an SNP marker at the end of the region, and the latter is also referred to as an SNP marker inside the region. The SNP marker seated on the region may be, for example, both the SNP marker at the end of the region and the SNP marker inside the region.

  The SNP marker in the region includes, for example, an SNP marker seated between a site of the upstream SNP marker that defines the region and a site of the downstream SNP marker, for example, This can be determined as appropriate based on the sitting position of the SNP marker shown in FIG. The number of the SNP markers between the two SNP marker sites may be, for example, one or more. As a specific example, all the SNP markers seated between the SNP marker sites defining the region are used. is there.

The combination of the base sequence of the region between the sites of the two SNP markers and the SNP marker in the base sequence of the region is not particularly limited, and examples thereof include the following condition (i) or (ii).
Condition (i)
The nucleotide sequence of the region between the sites of SNP (a) and SNP (c) in the chromosome, and
Condition (ii) having at least one SNP marker or SNP (b) selected from the group consisting of SNP (a), SNP (b), and SNP (c) in the base sequence of the region
A nucleotide sequence of a region between the sites of SNP (d) and SNP (e) in the chromosome, and
The nucleotide sequence of the region has at least one SNP marker or SNP (b) selected from the group consisting of SNP (a), SNP (b), and SNP (c)

  The resistance locus is, for example, a powdery mildew resistance locus on chromosome 3 of a pumpkin plant deposited under the accession number FERM ABP-22336 described later.

  According to the powdery mildew resistance marker of the present invention, for example, powdery mildew resistance can be imparted to a pumpkin plant. In the present invention, the degree of powdery mildew resistance of the pumpkin plant is expressed by the disease severity calculated from the disease index by evaluating the disease index of the pumpkin plant according to the method of Example 1 described later. Can do. For the calculation of the disease severity according to this method, the explanation of Example 1 described later can be used. For example, a disease severity of less than 2 can be set as disease resistance, and a disease severity of 2 or more can be set as susceptibility. When determining the powdery mildew resistance according to the disease severity, the disease severity may be, for example, the disease severity of one strain of a pumpkin plant or the average disease severity of two or more pumpkin plants. The latter is preferred. In the latter case, the number of pumpkin plants used for the determination of powdery mildew resistance is not particularly limited, and for example, is a number that can be statistically tested with powdery mildew-susceptible pumpkin plants. Specific examples are 5 to 20 shares and 5 shares.

2. Powdery mildew resistant pumpkin plant The powdery mildew resistant pumpkin plant of the present invention is characterized by having a powdery mildew resistant gene locus on the third chromosome as described above. The powdery mildew resistant pumpkin plant of the present invention is characterized by having a powdery mildew resistant locus on the third chromosome, and other configurations and conditions are not particularly limited. The powdery mildew resistant pumpkin plant of the present invention has the powdery mildew resistance marker of the present invention including the powdery mildew resistance locus of the powdery mildew of the present invention. Description of disease resistance markers can be cited. In the present invention, the powdery mildew resistance locus on the third chromosome can be read as, for example, the powdery mildew resistance marker of the present invention.

  The powdery mildew-resistant pumpkin plant of the present invention is resistant to powdery mildew.

  In the powdery mildew resistant pumpkin plant of the present invention, the powdery mildew resistance is caused by the powdery mildew resistant locus on the third chromosome as described above. The powdery mildew-resistant pumpkin plant of the present invention has the resistance locus on the third chromosome. For example, instead of the third chromosome, on any chromosome other than the third chromosome, the third chromosome It may have the above powdery mildew resistance locus. That is, the pumpkin plant having the resistance locus is chromosome 1, chromosome 2, chromosome 4, chromosome 5, chromosome 6, chromosome 7, chromosome 8, chromosome 9, chromosome 10, On the chromosome of any one of chromosome 11, chromosome 12, chromosome 13, chromosome 14, chromosome 15, chromosome 16, chromosome 17, chromosome 18, chromosome 19 and chromosome 20, It may have the resistance locus on chromosome 3.

  The resistant pumpkin plant of the present invention may include, for example, one or more of the resistance loci. As a specific example, in one pair of chromosomes, one chromosome is the resistance gene. It may contain a locus (heterozygous), and both chromosomes may contain the resistance locus (homozygous), but the latter is preferred because powdery mildew resistance is further improved.

  In the resistant pumpkin plant of the present invention, for example, the description of the powdery mildew resistance locus in the powdery mildew resistance marker of the horseshoe pumpkin plant of the present invention can be cited as the resistance locus.

As an example, the resistant pumpkin plant of the present invention is the pumpkin plant ( Cucurbita maxima ) deposited under the accession number FERM ABP-22336 or its progeny line. The progeny line has, for example, the resistance locus. The deposit information is shown below.
Type of deposit: Domestic depositary depositor name: National Institute of Technology and Evaluation Patent Biological Depositary Center Address: Japan 2-5-8 Kazusa Kamashitsu, Kisarazu City, Chiba Prefecture 292-0818, Japan Receiving number: FERM ABP- 22336
Display for identification: Takii10
Date of receipt: June 1, 2017

  The resistant pumpkin plant of the present invention can also be produced, for example, by introducing the above-described resistance locus into a pumpkin plant. The method for introducing the resistance locus into the pumpkin plant is not particularly limited, and examples thereof include crossing with the resistant pumpkin plant or embryo culture, and conventionally known genetic engineering techniques. Examples of the resistance locus to be introduced include the aforementioned resistance locus. In the case of introduction by crossing with the resistant pumpkin plant, the resistant pumpkin plant preferably includes, for example, the resistance locus in a homozygous form.

  Regarding the resistant pumpkin plant of the present invention, characteristics other than powdery mildew resistance, such as traits and ecological characteristics, are not particularly limited.

  The resistant pumpkin plant of the present invention may further have other resistance.

  In the present invention, the “plant body” may mean either a plant individual indicating the whole plant or a part of the plant individual. Examples of the plant individual part include organs, tissues, cells, vegetative propagation bodies, and the like. Examples of the organ include petals, corolla, flowers, leaves, seeds, fruits, stems, roots and the like. The tissue is, for example, a part of the organ. The plant part may be, for example, one kind of organ, tissue and / or cell, or two or more kinds of organ, tissue and / or cell.

3. Next, a method for producing the powdery mildew-resistant pumpkin plant of the present invention will be described. The following methods are examples, and the present invention is not limited to these methods. In the present invention, the production method can also be referred to as a growth method, for example. In the present invention, the powdery mildew resistance locus can be rephrased as the resistance marker of the present invention, and the description thereof can be used.

As described above, the method for producing a powdery mildew-resistant pumpkin plant of the present invention includes the following steps (a) and (b).
(A) the process of crossing the powdery mildew-resistant pumpkin plant of the present invention with another pumpkin plant (b) powdery mildew from the pumpkin plant or its progeny line obtained from the step (a) Process for selecting resistant pumpkin plants with resistance

  The production method of the present invention is characterized by using the powdery mildew resistant pumpkin plant of the present invention as a parent, and other processes and conditions are not limited at all. For the production method of the present invention, for example, the description of the resistance marker of the present invention, the resistant pumpkin plant, etc. can be used.

In the step (a), the powdery mildew-resistant pumpkin plant used as the first parent may be the resistant pumpkin plant of the present invention. The resistant pumpkin plant is preferably, for example, a pumpkin plant deposited at accession number FERM ABP-22336 as described above, or a progeny line thereof. In the step (a), the powdery mildew resistant pumpkin plant used as the first parent can also be obtained, for example, by the screening method of the present invention described later. Therefore, the powdery mildew-resistant pumpkin plant is obtained, for example, from the test pumpkin plant (also referred to as “candidate pumpkin plant”) by the following step (x), for example, prior to the step (a). You may select and prepare.
(X) a step of selecting the powdery mildew-resistant Atlantic pumpkin plant of the present invention from the tested pumpkin plant

In the step (x), selection of the powdery mildew-resistant pumpkin plant can be referred to as selection of a pumpkin plant having the powdery mildew resistance locus. For this reason, the said (x) process can be performed by the following (x1) process and (x2) process, for example.
(X1) a detection step of detecting the presence or absence of the powdery mildew resistance locus on the chromosome of the test powdery pumpkin plant. (X2) the presence of the powdery mildew resistance gene locus causes the test pumpkin plant to be detected. Selection process as a powdery mildew resistant pumpkin plant

  As described above, the selection in the step (x) is, for example, selection of a corn pumpkin plant having the resistance locus, and specifically, the resistance locus for the test pumpkin plant. By detecting the above, the resistant pumpkin plant can be selected. In the step (x2), for example, when the resistance locus is present on one chromosome in a pair of chromosomes, the test pumpkin plant may be selected as the resistant pumpkin plant, When the resistance locus is present on both chromosomes in a pair of chromosomes, the test pumpkin plant may be selected as the resistant pumpkin plant, but the latter is preferred. The detection of the resistance locus in the step (x1) defines, for example, the powdery mildew resistance locus as described in the powdery mildew resistance marker of the present invention. (1) The SNP It can be detected using a marker, (2) a base sequence containing the SNP marker, (3) a base sequence in a region between the two SNP marker sites, and a combination thereof.

  Examples of the selection in the step (x) include the following specific examples, but the present invention is not limited thereto. The explanation for the powdery mildew resistance marker of the present invention can be used for the powdery mildew resistance locus.

(1) Identification by SNP marker The selection in the step (x) has, for example, a powdery mildew resistance locus identified by at least one SNP marker selected from the group consisting of MSP_17500, MSP_8, and MSP_41353. A selection of pumpkin plants. The selected SNP marker is not particularly limited, and for example, the description of “(1) identification by SNP marker” in the powdery mildew resistance marker of the present invention can be cited.

(2) Identification by nucleotide sequence including SNP marker The selection in the step (x) is identified by, for example, at least one polynucleotide selected from the group consisting of (a), (b), and (c) Selection of pumpkin plants having a powdery mildew resistance locus. For the polynucleotides (a), (b), and (c), for example, the description of “(2) Identification by a base sequence containing a SNP marker” in the resistance marker of the present invention can be used.

(3) Identification by the nucleotide sequence of the region between two SNP marker sites The selection in the step (x) was selected from the group consisting of MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 in the chromosome, for example It is selection of a pumpkin plant having a powdery mildew resistance locus including a base sequence in a region between two SNP marker sites. The base sequence of the region between the two SNP marker sites is, for example, the description of “(3) Identification by the base sequence of the region between the two SNP marker sites” in the powdery mildew resistance marker of the present invention. Can be used.

  As a specific example, the selection in the step (x) is, for example, a powdery mildew resistance locus having at least one SNP marker selected from the group consisting of MSP_17500, MSP_8, and MSP_41353 in the base sequence of the region. The selection of pumpkin plants that have

  The selection in the step (x) may be, for example, selection of a pumpkin plant having a powdery mildew resistance locus satisfying the condition (i) or (ii).

  The chromosome for detecting the presence or absence of the powdery mildew resistance locus is preferably the third chromosome.

  In the step (a), the pumpkin plant used as the other parent is not particularly limited, and may be, for example, a known pumpkin plant having or not having powdery mildew resistance, or other resistance. It may be a pumpkin plant having or not having sex, or the powdery mildew-resistant pumpkin plant of the present invention.

  In the step (a), the method for crossing the powdery mildew resistant corn pumpkin plant with the other potato pumpkin plant is not particularly limited, and a known method can be adopted.

  In the step (b), the target for selecting the powdery mildew-resistant pumpkin plant may be, for example, the pumpkin plant obtained from the step (a), or a progeny obtained from the pumpkin plant. A system may be used. Specifically, the target may be, for example, an F1 pumpkin plant obtained by crossing in step (a) or a progeny line. The progeny line may be, for example, an inbred progeny or a backcross progeny of the F1 pumpkin plant obtained by crossing in the step (a), or the F1 pumpkin plant and other pumpkin plants of F1. It may be a pumpkin plant obtained by crossing.

  In the step (b), the powdery mildew-resistant pumpkin plant can be selected, for example, by confirming powdery mildew resistance directly or indirectly.

  In the step (b), the direct confirmation can be performed by evaluating, for example, the powdery mildew resistance of the F1 pumpkin plant or its progeny obtained as described above based on the severity of the disease. . Specifically, for example, powdery mildew fungus is inoculated to the F1 pumpkin plant or its progeny line, and powdery mildew resistance can be confirmed by evaluating the disease severity according to the disease severity. In this case, for example, the F1 pumpkin plant or its progeny line having a disease severity of less than 2 can be selected as a powdery mildew-resistant pumpkin plant.

In the step (b), the selection by the indirect confirmation can be performed by, for example, the following steps (b1) and (b2).
(B1) a detection step of detecting presence or absence of a powdery mildew resistance locus on the chromosome of the pumpkin plant or its progeny obtained from the step (a) (b2) the powdery mildew resistance locus A selection step of selecting, as a powdery mildew-resistant pumpkin plant, the pumpkin plant or its progeny line obtained by the step (a) due to the presence of

  The selection by indirect confirmation of powdery mildew resistant pumpkin plants in the step (b) is, for example, similar to the method described in the step (x), and the presence or absence of the powdery mildew resistance locus. More specifically, the detection can be performed by detecting the presence or absence of the powdery mildew resistance locus using the molecular marker.

  In the production method of the present invention, it is preferable to further grow the powdery mildew resistant resistant pumpkin plant selected in the step (b).

  In this manner, the above-mentioned pumpkin plant or its progeny line, which has been confirmed to be resistant to powdery mildew, can be selected as a powdery mildew-resistant pumpkin plant.

  The production method of the present invention may further include a seeding step of collecting seeds from the progeny line obtained by crossing.

  The production method of the present invention may include only the step (a), for example.

4). Screening Method for Powdery Mildew-resistant Pumpkin Plant The screening method for powdery mildew-resistant pumpkin plant of the present invention (hereinafter also referred to as “screening method”) produces powdery mildew-resistant pumpkin plant by crossing. A step of selecting a pumpkin plant containing a powdery mildew resistance locus on the third chromosome as a powdery mildew resistance marker of the pumpkin plant as a parent for testing. And

  The screening method of the present invention is characterized in that it comprises a step of selecting a pumpkin plant having a powdery mildew resistance locus on chromosome 3 as a powdery mildew resistance marker from a test pumpkin plant. Other processes and conditions are not limited at all. According to the screening method of the present invention, a powdery mildew resistant parent can be obtained by the powdery mildew resistance marker of the present invention. For the screening method of the present invention, for example, the description of the resistance marker of the present invention, the resistant pumpkin plant and the production method can be cited.

  For the selection of the parent, for example, the description of the step (x) in the method for producing the powdery mildew-resistant pumpkin plant of the present invention can be used.

5). Method for imparting powdery mildew resistance to a pumpkin plant The method for imparting powdery mildew resistance to a pumpkin plant according to the present invention introduces a powdery mildew resistance locus on chromosome 3 into a pumpkin plant. It is characterized by including the introducing | transducing process to perform. The imparting method of the present invention is characterized by including an introduction step of introducing a powdery mildew resistance locus on the third chromosome into a pumpkin plant, and other steps and conditions are not particularly limited. According to the imparting method of the present invention, the powdery mildew resistance locus on the third chromosome, ie, the powdery mildew resistance marker of the present invention, is introduced into the powdery mildew pumpkin plant. Can be granted. For example, the description of the resistance marker, the resistant pumpkin plant, the production method, the screening method, and the like of the present invention can be cited as the application method of the present invention.

  In the introduction step, the method for introducing the powdery mildew resistance locus on the third chromosome is not particularly limited. Examples of the introduction method include crossing with the resistant pumpkin plant or embryo culture, and conventionally known genetic engineering techniques. Examples of the resistance locus to be introduced include the aforementioned resistance locus. In the case of introduction by crossing with the resistant pumpkin plant, the resistant pumpkin plant preferably includes, for example, the resistance locus in a homozygous form.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, this invention is not limited to the aspect described in the Example.

[Example 1]
The new powdery mildew-resistant pumpkin plant has been confirmed to be resistant to powdery mildew fungus, analysis of the genetic pattern of the powdery mildew resistant locus and the new powdery mildew resistant locus Was identified.

In order to develop a new pumpkin plant exhibiting resistance to powdery mildew, a large amount of seeds of a pumpkin line collected by subculture at Takii Seed Co., Ltd. was bred to test for powdery mildew resistance. Went. As a result, a novel powdery mildew-resistant pumpkin strain ( Cucurbita maxima ) showing powdery mildew resistance was obtained. Hereinafter, this powdery mildew resistant pumpkin plant is referred to as a parental line.

  Separately, an F2 population obtained by crossing a powdery mildew resistant strain and a powdery mildew susceptible strain was prepared, and its DNA was extracted. Then, the DNA is subjected to Sequence-Based Genotyping (Keygene), creation of a linkage map using software (Carte Blanche, Keygene), and linkage analysis using software (QTL cartographer, NC STATE University). I did it. As a result, one QTL having a peak LOD value of 25.8 calculated by CIM (composite interval mapping) was detected on the third chromosome.

  And MSP_14 and MSP_16, which are polymorphisms in the vicinity of the peak value, were designed as SNP markers.

  By crossing the parental line with a fixed line of powdery mildew-susceptible pumpkin plant owned by Takii Seed Co., Ltd. (hereinafter also referred to as “susceptible line”), 93 F2 segregated populations (hereinafter, It was also called “93 lines”.

  The 93 strains were inoculated with powdery mildew. The inoculation test of powdery mildew was performed as follows.

As the powdery mildew fungus ( Podosphaera xanthii ), a product derived from a pumpkin plant suffering from powdery mildew disease that naturally developed in a pumpkin field in Konan City, Shiga Prefecture was used. The powdery mildew fungus was confirmed to be a pathogenic fungus capable of infecting the diseased pumpkin plant by the following inoculation test.

First, the powdery mildew was cultured on a pumpkin plant (Ebisu, Takii Seed Co., Ltd.) grown in an isolated greenhouse. After collecting the conidia by scraping the flora of the powdery mildew fungus on the leaves of the pumpkin plant, the collected conidia are adjusted with sterilized water to 1.0 × 10 ⁴ / mL. A spore suspension was prepared and used for inoculation. In addition, seedlings in which two true leaves were developed were used as the pumpkin plants used for the inoculation. Using a hand spray, 2 mL of the conidial suspension was sprayed uniformly over the entire strain of one pumpkin plant. After the spraying, the pumpkin plant was grown for 14 days in a greenhouse at 15-25 ° C., 60-80% humidity and natural light. Then, on the grown pumpkin plant, the disease survey was conducted as follows.

The disease survey was conducted by evaluating the disease index according to the following criteria. Moreover, the representative example of the individual | organism | solid of the disease index 0-4 is shown in the photograph of FIG. In addition, in FIG. 2, white is a location where spore formation is seen.
Disease index 0: No symptoms Disease index 1: Unclear spore formation is observed in several places on the inoculated leaves (less than 5% of the area of the inoculated leaf table)
Disease index 2: Clear sporulation is observed but limited (more than 5% and less than 25% of the surface area of the inoculated leaf)
Disease index 3: Clear sporulation is observed and observed in various places of inoculated leaves (more than 25% and less than 50% of the surface area of the inoculated leaves)
Disease index 4: Clear sporulation is observed and most of the inoculated leaves are covered (more than 50% of the surface area of the inoculated leaves)

For each individual, the disease index was investigated according to the above criteria, and the disease severity of each strain was determined from the following formula.
Disease severity (N) = [(0 × n ₀ ) + (1 × n ₁ ) + (2 × n ₂ ) + (3 × n ₃ ) + (4 × n ₄ )] / number of individuals studied “ ₀ , ₁ , ₂ , ₃ , ₄ ” indicates the disease index, and “n ₀ , n ₁ , n ₂ , n ₃ , n ₄ ” indicates the disease index 0, the disease index 1, and the disease index 2 respectively. The number of individuals with disease index 3 and disease index 4 is shown.

  In addition, the DNA was extracted from the 93 strains, and the polymorphism of MSP_16 was analyzed.

  These results are shown in Table 1 below. As shown in Table 1 below, for MSP_16, in the resistant homozygous type (A) or heterozygous type (H), the disease severity was less than 2, whereas in the susceptible homozygous type (B) The disease severity was 2 or more. From these results, it was found that the resistant pumpkin plant of the present invention is effective against powdery mildew. Further, from the relationship between the disease index of the 93 strains and the appearance frequency of the individual, it was found that the inheritance pattern of powdery mildew resistance of the parent strain is incomplete dominant of one factor. Furthermore, it was found that MSP_16 can be used as a marker for the powdery mildew resistance locus on the third chromosome.

[Example 2]
A novel powdery mildew resistance locus was identified for a novel powdery mildew resistant pumpkin plant.

  A backcross progeny BC1 line was obtained by crossing the parental line with the susceptible line. The BC1 line was further backcrossed with the susceptible Atlantic pumpkin plant three times to obtain the BC4 line. For each backcross progeny, a pumpkin plant containing MSP_16 and MSP_14 in a heterozygous form was selected.

  MSP_17500, MSP_8, and MSP_41353, which are polymorphisms in the vicinity of the peak value of QTL of Example 1, were newly designed as SNP markers. And about the said 93 system | strain and BC4 system | strain, the polymorphic base corresponding to MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 was identified. As a result, it was found that the distance between MSP_16 and MSP_14 in the third chromosome was 1.6 cM from the difference in SNP marker polymorphism between the 93 strain and the BC4 strain.

  Next, in the 93 strain and the BC4 strain, 6 individuals (hereinafter also referred to as “6 strains”) having different genotypes of the SNP marker were selected. Then, the six lines were self-bred to obtain a progeny progeny. And the inoculation test was implemented similarly to the said Example 1 about the said self breeding progeny. The results are shown in Table 2 below. In Table 2 below, A indicates that the SNP marker is retained in a homozygous resistant manner, H indicates that the SNP marker is retained heterozygously, and B indicates that the SNP marker is susceptible. It shows that it has homozygosity. In Table 2 below, A and H are shaded. As shown in Table 2 below, in individuals in which MSP_17500, MSP_8, and MSP_41353 are resistant homozygous (A) or heterozygous (H), individuals showing resistance in the inbred progeny were obtained. From these results, it was confirmed that among the SNP markers, MSP_17500, MSP_8, and MSP_41353 are SNP markers showing high correlation with powdery mildew resistance. Moreover, since it showed high correlation with MSP_17500, MSP_8, and MSP_41353, it was found that the region between the sites of MSP_16 and MSP_14, which are regions containing the SNP marker, showed high correlation with powdery mildew resistance. .

[Example 3]
It was confirmed that the other locust pumpkin plants do not have the resistance loci possessed by the novel powdery mildew resistance-resistant pumpkin plants.

  The BC4 strain was further cross-bred twice with the susceptible strain to obtain the BC6 strain. For each backcross progeny, a pumpkin plant containing MSP — 41353 in a heterozygous form was selected. Next, the BC6F1 line was obtained by self-breeding the BC6 line. The BC6F1 line was further self-bred twice in the same manner to obtain a self-bred progeny BC6F3 line. For the BC6F3 line, a pumpkin plant containing MSP — 41353 in a resistant homozygous form was selected (selected BC6F3 line). The selected BC6F3 line was deposited with the receipt number FERM ABP-22336. Hereinafter, the selected BC6F3 line is also referred to as a deposited line.

  Next, the disease severity was calculated in the same manner as in Example 1 for each pumpkin plant (n = 5) in Table 3 below including the deposited line. In addition, polymorphic bases corresponding to MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 were identified for each pumpkin plant including the deposited line. These results are shown in Table 3 below. In Table 3 below, A indicates that the SNP marker is retained in a resistant homozygous form, and B indicates that the SNP marker is retained in a susceptible homozygous form. In Table 3 below, A is shaded. As shown in Table 3 below, the deposited line showed powdery mildew resistance, and all SNP markers MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 were retained in a resistant homozygous form. On the other hand, the pumpkin plants except the deposited line are susceptible to powdery mildew, and all SNP markers MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 are possessed in a susceptible homozygous form. It was. In addition, the deposited line has a greatly reduced disease severity compared to PI 135370, PI 137866, PI 165027, PI 166046, PI 458673, and PI 458675, which are known as powdery mildew resistant pumpkin plants. Therefore, it was found that these varieties have a novel resistance locus different from the powdery mildew resistance locus. From these results, the resistance locus possessed by the powdery mildew-resistant pumpkin plant of the present invention is a novel resistance locus, and the resistance locus is identified by MSP_17500, MSP_8, and MSP_41353. I knew it was possible.

  Next, polymorphic bases corresponding to MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 were identified for each of the pumpkin plants in Table 4 below including the deposited line. Each pumpkin plant except the deposited line is known to be susceptible to powdery mildew. In Table 4 below, A indicates that the SNP marker is retained in a resistant homozygous form, and B indicates that the SNP marker is retained in a susceptible homozygous form. In Table 4 below, A is shaded. As shown in Table 4 below, the deposited lines possessed all homologous SNP markers for MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14. In contrast, the pumpkin plants excluding the deposited line possessed all the SNP markers MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 in a susceptible homozygous form. From these results, it was found that the resistance locus can be identified by MSP_17500, MSP_8, and MSP_41353.

  As mentioned above, although this invention was demonstrated with reference to embodiment and an Example, this invention is not limited to the said embodiment and Example. Various changes that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention.

  As described above, according to the powdery mildew resistance marker of a pumpkin plant of the present invention, for example, a powdery mildew resistant pumpkin plant can be easily screened. Moreover, since the powdery mildew resistant pumpkin plant of this invention contains the said resistant locus, for example, it can show powdery mildew resistance, for example. For this reason, the powdery mildew-resistant pumpkin plant of the present invention does not require the conventional control with pesticides, and therefore, for example, the labor and cost problems of the pesticide spraying can be avoided. Therefore, the present invention is extremely useful in the agricultural field such as breeding.

Claims (18)

A powdery mildew resistance marker for pumpkin plants, comprising a powdery mildew resistance locus on chromosome 3. The powdery mildew resistance marker of a pumpkin plant according to claim 1, wherein the powdery mildew resistance locus is specified by at least one SNP marker selected from the group consisting of MSP_17500, MSP_8, and MSP_41353. 3. The pumpkin plant according to claim 1, wherein the powdery mildew resistance locus is specified by at least one polynucleotide selected from the group consisting of the following (a), (b), and (c): Powdery mildew resistance marker.
(A) polynucleotide (a3) comprising the nucleotide sequence of SEQ ID NO: 1 (a1) or polynucleotide (a1) below (a3): the 37th base (C) of (a1) is stored; (a1) And having a function equivalent to that of the polynucleotide (a1) with respect to powdery mildew resistance at the powdery mildew resistance locus. Polynucleotide (b) Polynucleotide (b3) of the following (b1) or (b3) (b1) SEQ ID NO: 2 (b3) The 59th base (T) of (b1) is stored, b1) a nucleotide sequence having an identity of 95% or more, and at the powdery mildew resistance locus, the powdery mildew resistance (C) a polynucleotide having the same function as the polynucleotide of (b1) (c) a polynucleotide of (c1) or (c3) below (c1) a polynucleotide comprising the base sequence of SEQ ID NO: 3 (c3) 34 of (c1) above The base sequence (C) is conserved and has a base sequence having 95% or more identity to the base sequence of (c1), and the powdery mildew resistance at the powdery mildew resistance locus A polynucleotide having the same function as the polynucleotide of (c1) The powdery mildew resistance locus comprises a base sequence of a region between two SNP marker sites selected from the group consisting of MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 in the chromosome. 4. The powdery mildew resistance marker for a pumpkin plant according to any one of 3 above. A powdery mildew resistant pumpkin plant characterized by comprising a powdery mildew resistance locus on chromosome 3. 6. The powdery mildew resistant pumpkin plant of claim 5, wherein the powdery mildew resistance locus is identified with at least one SNP marker selected from the group consisting of MSP_17500, MSP_8, and MSP_41353. The powdery mildew according to claim 5 or 6, wherein the powdery mildew resistance locus is specified by at least one polynucleotide selected from the group consisting of the following (a), (b), and (c): Resistant pumpkin plant.
(A) polynucleotide (a3) comprising the nucleotide sequence of SEQ ID NO: 1 (a1) or polynucleotide (a1) below (a3): the 37th base (C) of (a1) is stored; (a1) And having a function equivalent to that of the polynucleotide (a1) with respect to powdery mildew resistance at the powdery mildew resistance locus. Polynucleotide (b) Polynucleotide (b3) of the following (b1) or (b3) (b1) SEQ ID NO: 2 (b3) The 59th base (T) of (b1) is stored, b1) a nucleotide sequence having an identity of 95% or more, and at the powdery mildew resistance locus, the powdery mildew resistance (C) a polynucleotide having the same function as the polynucleotide of (b1) (c) a polynucleotide of (c1) or (c3) below (c1) a polynucleotide comprising the base sequence of SEQ ID NO: 3 (c3) 34 of (c1) above The base sequence (C) is conserved and has a base sequence having 95% or more identity to the base sequence of (c1), and the powdery mildew resistance at the powdery mildew resistance locus A polynucleotide having the same function as the polynucleotide of (c1) The said resistance locus contains the base sequence of the area | region between the site | parts of two SNP markers selected from the group which consists of MSP_16, MSP_17500, MSP_83, MSP_41353, and MSP_14 in the said chromosome. Powdery mildew-resistant pumpkin plant according to claim 1. 9. The powdery mildew resistant pest according to claim 5, wherein the powdery mildew resistant pumpkin plant is a pumpkin plant identified by the accession number FERM ABP-22336 or its progeny line. Pumpkin plant. The powdery mildew resistant pumpkin plant according to any one of claims 5 to 9, wherein the powdery mildew resistant pumpkin plant is a plant body or a part thereof. The powdery mildew-resistant pumpkin plant according to any one of claims 5 to 10, wherein the powdery mildew-resistant pumpkin plant is a seed. A method for producing a powdery mildew-resistant Atlantic pumpkin plant, comprising the following steps (a) and (b):
(A) a step of crossing the powdery mildew resistant pumpkin plant according to any one of claims 5 to 11 with another pumpkin plant (b) a pumpkin obtained from the step (a) A process for selecting powdery mildew-resistant pumpkin plants from plants or their progeny Prior to the step (a), the method for producing the powdery mildew resistant pumpkin plant according to claim 12, comprising the following step (x).
(X) A step of selecting the powdery mildew-resistant pumpkin plant according to any one of claims 5 to 11 from the test pumpkin plant. The powdery mildew-resistant pumpkin plant according to claim 13, wherein the selection in the step (x) is selection of a powdery mildew-resistant pumpkin plant containing a powdery mildew resistance locus on the third chromosome. Manufacturing method. Wherein the selection in the step (x) is a powdery mildew resistant pumpkin plant having a powdery mildew resistant locus identified by at least one SNP marker selected from the group consisting of MSP — 17500, MSP — 8 and MSP — 41353. The method for producing a powdery mildew resistant resistant pumpkin plant according to claim 14, which is a selection. The powdery mildew having the powdery mildew resistance locus identified by the at least one polynucleotide selected from the group consisting of the following (a), (b), and (c) in the selection in the step (x) The method for producing a powdery mildew resistant pumpkin plant according to claim 14 or 15, wherein the disease resistant pumpkin plant is selected.
(A) polynucleotide (a3) comprising the nucleotide sequence of SEQ ID NO: 1 (a1) or polynucleotide (a1) below (a3): the 37th base (C) of (a1) is stored; (a1) And having a function equivalent to that of the polynucleotide (a1) with respect to powdery mildew resistance at the powdery mildew resistance locus. Polynucleotide (b) Polynucleotide (b3) of the following (b1) or (b3) (b1) SEQ ID NO: 2 (b3) The 59th base (T) of (b1) is stored, b1) a nucleotide sequence having an identity of 95% or more, and at the powdery mildew resistance locus, the powdery mildew resistance (C) a polynucleotide having the same function as the polynucleotide of (b1) (c) a polynucleotide of (c1) or (c3) below (c1) a polynucleotide comprising the base sequence of SEQ ID NO: 3 (c3) 34 of (c1) above The base sequence (C) is conserved and has a base sequence having 95% or more identity to the base sequence of (c1), and the powdery mildew resistance at the powdery mildew resistance locus A polynucleotide having the same function as the polynucleotide of (c1) Powdery mildew resistance, wherein the selection in the step (x) includes a nucleotide sequence of a region between two SNP marker sites selected from the group consisting of MSP_16, MSP_17500, MSP_8, MSP_41353, and MSP_14 in the chromosome The method for producing a powdery mildew resistant pumpkin plant according to any one of claims 14 to 16, wherein the powdery mildew resistant pumpkin plant having a genetic locus is selected. A method for imparting powdery mildew resistance to a pumpkin plant, comprising an introduction step of introducing a powdery mildew resistance locus on chromosome 3 into the pumpkin plant.