JP6762855B2 - Muscle breakdown inhibitor - Google Patents

Description

The present invention relates to suppression of muscle breakdown, and particularly to suppression of muscle breakdown caused by the expression of Atrogin-1.

As the decomposition of muscles in humans and the like, for example, those due to aging are known. Specifically, it is known that the decrease of skeletal muscle with aging starts around 30 years old, and the decrease rate increases after 60 years old. This decrease in skeletal muscle mass and muscle strength above a certain level is called sarcopenia, and it is determined that about 10% of people in their 60s and 35% of the elderly aged 75 and over are sarcopenia. Sarcopenia not only increases the risk of poor quality of life (QOL), fractures due to falls, hospitalization, bedridden, etc., but is also involved in the risk of acute illness and worsening prognosis after surgery.

The main cause of this age-related decrease in skeletal muscle is the promotion of muscle breakdown.
Specifically, skeletal muscle is formed by a balance between synthesis and decomposition, of which skeletal muscle synthesis is promoted by exercise and nutritional intake. On the other hand, decomposition of skeletal muscle is promoted by aging, inactivity (bed rest, cast fixation), nutrient starvation, disease and the like.

For example, inflammatory cytokines (IL-6), tumor necrosis factor-α (TNF-α), and glucocorticoids produced in the body due to aging and stress of the living body increase. These are known to promote muscle breakdown.

In many elderly people, the secretion of these cytokines and hormones is excessive due to aging and the like, and as a result, the decomposition of skeletal muscle is promoted.

Here, as a technique capable of suppressing a decrease in QOL in the elderly, a technique disclosed in Patent Document 1 has been proposed. Patent Document 1 contains Lactobacillus gasseri, which is a kind of lactic acid bacterium, as an active ingredient with respect to a physical activity promoter that supports an increase in muscle mass and activity.

Japanese Unexamined Patent Publication No. 2013-47192

The physical activity promoter disclosed in Patent Document 1 increases muscle mass by ingesting it, but does not suppress muscle decomposition.
An object of the present invention is to provide a novel technique capable of suppressing muscle decomposition.

Although the promotion of muscle synthesis by exercise and nutrition is focused on the prevention and improvement of sarcopenia, it is possible to effectively prevent sarcopenia by improving the cause of muscle decomposition that progresses from the internal environment.
It is known that skeletal muscle degradation is caused by proteolytic enzymes, and the ubiquitin-proteasome system is particularly enhanced. In addition, two muscle-specific ubiquitin ligase genes [MAFbx (muscle atrophy F-box) / Agrgoin-1 and MuRF1 (muscle ring finger 1)] related to this are known.
Glucocorticoids, undernutrition, IL-6, TNF-α and inactivity (bedrest, Gibbs fixation, etc.) enhance these muscle-specific ubiquitin ligase genes, resulting in degradation of skeletal muscle. Therefore, these genes are indicators of sarcopenia.
As a result of diligent research, the present inventor suppresses the expression of Atrogin-1 by ingesting the component contained in the Lactobacillus carbatus CP2998 strain, suppresses the decomposition of skeletal muscle, and suppresses the decomposition of skeletal muscle. The present invention was completed based on the fact that lipoteichoic acid was found as a result of searching for a component that acts effectively.

The gist of the present invention is as follows.
[1] A muscle decomposition inhibitor containing lipoteichoic acid.
[2] Foods and drinks for suppressing muscle decomposition containing lipoteichoic acid.
[3] Methods of suppressing muscle breakdown, including ingestion of lipoteichoic acid (excluding medical practice for humans).

According to the present invention, it is possible to provide a novel technique capable of suppressing muscle decomposition.

It is a graph which shows the relationship between each lactic acid bacterium and Atrogin-1 / GAPDH according to Test Example 1. FIG. 5 is a graph showing the relationship between each lactic acid bacterium and the weight of the gastrocnemius muscle according to Test Example 2. It is a graph which shows the relationship between the extract of the Lactobacillus carbatus CP2998 strain and Atrogin-1 / GAPDH according to Test Example 3. FIG. 5 is a graph showing the relationship between the Lactobacillus carbatus CP2998 strain and the expression level of Myogenin according to Test Example 4. It is a photograph which concerns on the Western blot of the bacterial cell suspension supernatant and butanol fraction (crude purified lipoteichoic acid) derived from CP2998 strain. It is a photograph relating to Western blot of 15% hydrophobic interaction chromatography (HIC), 25% HIC, 35% HIC, 45% HIC concentrated fraction derived from CP2998 strain. FIG. 5 is a graph showing the relationship between the 25% HIC and 35% HIC concentrated fractions containing lipoteichoic acid and the expression of Atroigin-1 according to Test Example 5.

Hereinafter, one embodiment of the present invention will be described in detail.
The present embodiment relates to a muscle decomposition inhibitor (hereinafter, also simply referred to as a decomposition inhibitor), and contains lipoteichoic acids (hereinafter, referred to as LTA). Lipoteichoic acid can be obtained, for example, by extracting from the lactic acid bacterium Lactobacillus carbatus CP2998 strain (hereinafter, also simply referred to as CP2998 strain).
Lactic acid bacteria are effective in improving and maintaining health. It is known to have an intestinal regulating effect, an immunostimulatory effect, an antidermatitis effect and an antistress effect. These have been shown to be effective not only in live bacteria but also in dead cells. Its active ingredients are diverse, such as lipids, sugar chains, DNA, RNA, peptidoglycan, polyphosphoric acid, and lipoteichoic acid contained in lactic acid bacteria.

Lipoteichoic acid is a compound composed of a glycerol phosphate polymer and a glycolipid. In lactic acid bacteria, lipoteichoic acid exists as a component in the cell wall, and the glycolipid site also binds to the cell membrane in a form forming a part of the cell membrane lipid.
Lipoteichoic acid has been reported to contribute to immunomodulation, intestinal adhesion, etc., but no report has been confirmed regarding suppression of muscle degradation.
As described above, lipoteichoic acid can be obtained by extracting from the Lactobacillus carbatus CP2998 strain, but the present invention is not limited to this, and those obtained by other methods may be used. Specifically, there are cases where it is extracted from other microorganisms or the like, or lipoteichoic acid itself is obtained and used.

Hereinafter, a case where lipoteichoic acid is extracted from the CP2998 strain will be described as an example.
Lactobacillus carbatas CP2998 strain is a type of lactic acid bacterium and was deposited at the Patent Microorganisms Depositary Center on April 15, 2015 under the accession number: NITE P-02033. The CP2998 strain is described in Japanese Patent Application No. 2015-104500.

The medium for culturing the CP2998 strain is not particularly limited as long as it is a medium in which the CP2998 strain can grow, and it should be appropriately selected from a medium generally used for culturing lactic acid bacteria, a modified medium thereof, and the like. Can be done.
Further, the carbon source and nitrogen source contained in the medium for culturing the CP2998 strain are not particularly limited. For example, as the carbon source, one or more kinds selected from the group consisting of glucose, sucrose, lactose, molasses and the like used for culturing ordinary microorganisms can be used. Further, as the nitrogen source, one type or two or more types selected from the group consisting of peptone, casein, casein decomposition product, whey, whey decomposition product and the like can be used.
Further, as a source of other nutrients, one or two or more selected from the group consisting of corn sticky pricker (CSL), yeast extract, meat extract, liver extract, tomato juice and the like may be used.
Further, the medium for culturing the CP2998 strain is a reducing agent such as L-cysteine; vitamins, nucleic acid-related substances, acetates and citrates, fatty acid esters, particularly preferably growth-promoting factors such as Tween 80; phosphoric acid. A compound or the like that can impart a buffering ability such as a salt may be appropriately added.
As a medium that can be used for culturing the CP2998 strain, for example, it is generally used for producing synthetic media such as MRS medium, squeezed juice of vegetables and fruits, and fermented milk such as milk, soymilk, and reduced defatted milk powder medium. Examples include the medium to be used.

The culture method of the CP2998 strain can be carried out, for example, by static culture or neutralization culture in which the pH is controlled to a constant level, but the culture method is not particularly limited as long as the bacteria grow well. For example, the cells are cultivated according to a conventional method of lactic acid bacterium culture, and can be obtained from the obtained culture by means of collecting bacteria such as centrifugation.

For the extraction of lipoteichoic acid, viable cells of CP2998 strain, wet bacteria, dried bacteria, treated products and the like can be appropriately used.
Examples of the processed product include a concentrate of fermented milk containing the CP2998 strain, a paste product, a dried product, a liquid product, a diluted product, a crushed product and the like. The dried product may be at least one selected from a spray-dried product, a freeze-dried product, a vacuum-dried product, and a drum-dried product. Further, the CP2998 strain used for extraction may be a dead cell. Killed cells can usually be obtained by heating the cells. The heating conditions are not particularly limited as long as the cells are killed, but in general, sufficient results can be obtained by heating at 90 ° C. for about 30 minutes. The method of heat treatment is also not particularly limited, and examples thereof include heat sterilization treatment, radiation sterilization treatment, and crushing treatment.
As the extraction solvent, for example, butanol, chloroform, ethyl acetate, hexane, diethyl ether, dimethyl sulfoxide, methanol, ethanol, water, or a mixed solvent thereof can be used.

An example of lipoteichoic acid extraction will be described more specifically. First, the cells are crushed. The crushing method may be wet or dry as long as a certain amount of crushing is performed. Jet mills, hole mills, starbursts and the like can be used. The crushed cells are suspended in a solution such as water, and the supernatant is collected by centrifugation. Extracted from the supernatant with butanol or ethanol can be obtained as a lipoteichoic acid-containing fraction.

The mode of the decomposition inhibitor of the present embodiment is not particularly limited, and can be produced as a drug, a quasi drug, a food or drink, or the like.
In the case of pharmaceuticals, quasi-drugs or foods and drinks, the lipoteichoic acid-containing fraction and the like according to the present embodiment are used as active ingredients, and for example, excipients, binders, stabilizers, disintegrants, lubricants and flavors. It can be formulated according to a standard method by appropriately mixing it with a odorant, a suspending agent, a coating agent, or any other component. The dosage form can be tablets, pills, capsules, granules, powders, powders, syrups and the like, and it is desirable to administer these orally.
Alternatively, although not particularly limited, when it is produced as a food or drink, it may be a special-purpose food such as a food for specified health use or a nutritionally functional food in addition to a normal food or drink. Specific examples of foods and drinks include nutritional supplements (supplements), dairy beverages, fermented milk, yogurt, cheese, formula milk powder, infant milk powder and other foods, nursing women's milk powder and other dairy products, fruit juice beverages, etc. Examples include processed egg products such as jelly, candy, and mayonnaise, sweets and breads such as bread, biscuits, crackers, pizza crusts, butter cakes, ice cream, gummy, and gum, liquid foods, and foods for the sick.
Further, the decomposition inhibitor of the present embodiment may be used as a feed for livestock, for example, by blending a lipoteichoic acid-containing fraction with a feed raw material.

The daily intake of the decomposition inhibitor of the present embodiment is also not particularly limited. For example, in the case of an adult, lipoteichoic acid according to the present embodiment is blended so as to be ingested in an amount of 0.1 to 10 g, preferably 0.5 to 5 g. The amount and the like may be adjusted. The content ratio of lipoteichoic acid in the muscle decomposition inhibitor of the present embodiment is not particularly limited, and may be appropriately adjusted according to the ease of production, the preferable daily dose, and the like.

As described above, according to the present embodiment, it is possible to provide a novel technique capable of suppressing muscle decomposition.
That is, the mode of ingestion of the lipoteichoic acid according to the present embodiment is not particularly limited, but for example, by ingesting the lipoteichoic acid in the above-mentioned pharmaceuticals containing lipoteichoic acid, quasi-drugs, foods, etc., muscle decomposition is suppressed. be able to. Specifically, it is possible to suppress the expression of the muscle-specific ubiquitin ligase gene Atrogin-1, which is involved in muscle degradation. Therefore, although there are individual differences, it can be expected to have the effect of suppressing the decomposition of muscles due to aging, for example, and suppressing the decrease in muscle mass. Further, the lipoteichoic acid according to the present embodiment can be obtained from, for example, a lactic acid bacterium strain, can be supplied in large quantities at a relatively low cost, and is extremely safe.

Hereinafter, the decomposition inhibitor of this embodiment will be described more specifically by way of examples. The present invention is not limited to this.

[Preparation of lactic acid bacteria suspension]
For each lactic acid bacterium, about one loopful of glycerol stock was smeared on MRS agar medium (Difco) and cultured at 30 ° C. for 24-48 hours under anaerobic conditions. Colonies grown on agar were caught, suspended in MRS liquid medium (Difco), and cultured at 30 ° C. for 24 hours. Then, the cells were collected by centrifugation from the lactic acid bacterium culture solution. Distilled water was added to the collected cells, and the cells were centrifuged again to remove the supernatant, and the cells were washed. The obtained lactic acid bacteria cells were heated at 105 ° C. for 20 minutes, and then dried dead cells were prepared in a freeze-dryer. The obtained dried lactic acid bacterium cells suspended in water or a solvent were used as a lactic acid bacterium suspension.
[Test Example 1] Evaluation of Atrogin-1 expression suppression
As an in vitro test, C2C12 cells (DS Pharma Biomedical), which are mouse striated cells, were used. C2C12 cells were suspended in 10% fetal bovine serum, 1% Penicillin-Streptomaycin, and low glucose in Dulbecco's Improved Eagle's Medium (Sigma) at 1.9 x 10 ⁴ cells / ml, and 1 ml each was added to a 12-well plate. After that, the cells were cultured under 37 ° C. and 5% CO ₂ conditions for 72 hours to 80% confluent while changing the medium every 2 to 3 days.
Next, the medium was replaced with 2% horse serum and 1% Penicillin-Streptomaycin-containing low glucose-containing Dalveco-improved medium, and the cells were cultured for 4 days while changing the medium every 2 to 3 days to differentiate C2C12 cells. Then, 1% Penicillin-Streptomaycin-containing low glucose Dulbecco improved medium was added. Lactic acid bacteria suspension was added to the medium to a concentration of 100 mg / ml, and dexamethasone (DX), which is known to increase the expression of Atorogin-1 in skeletal muscle, was added to 50 mM. It was added to the medium. Then, using RNeasy Plus Mini (QIAGEN), RNA of cells was recovered. RNA was diluted with sterile distilled water to 100 ng / ml, and cDNA was prepared using the High Capacity cDNA Reverse Transcription Kit (Applied Biosytems). Furthermore, the expression levels of GAPDH and Atorogin-1 were measured using 7500 Fast (Applied Biosystems), and the values of Atrogin-1 / GAPDH were determined. Fast SYBR Green Master Mix (Applied Biosystems) was used for the measurement. As primers, Atrogin-1 expression is Atrogin-1F, 5'ATCCCAGCACACGACAACAC 3'and Atrogin-1R, 5'CGGCACACTGCATCTCTTC 3', and GAPDH expression is GAPDH F 5'ATGGCCTTCCGTGTTCCTAC 3'and GAPDH R, 5'TGCCTGCTTCACCTCTC. 3'was used.
Measurements were performed at N = 3 using dexamethasone as an index.

The results are shown in Figure 1. As a result of evaluating 10 lactic acid bacteria strains, Lactobacillus amyloboras No. 1 strain was internationally deposited at the Patent Organism Depositary on February 20, 2006, and CP1750 strain described in International Publication No. 2006/093133 (trust number: FERM BP-10532) and Lactobacillus carbatus CP2998 strain showed high activity.

[Test Example 2] Muscle decomposition suppression test using rats
7-week-old male SD rats were acclimatized for 1 week and then grouped for uniform weight. Each county had 8 animals per group. Each lactic acid bacterium suspension was orally administered to the lactic acid bacterium administration group at an administration rate of 1 g / kg. In addition, a group in which 1 g / kg of leucine was orally administered as a positive control was also set. Dexamethasone (Mesadron Note: Kobayashi Kako Co., Ltd.) was administered subcutaneously at 600 mg / kg. After oral administration of the lactic acid bacterium suspension for one week, the lactic acid bacterium suspension and dexamethasone were administered for 2 days, and on the 3rd day, autopsy was performed, and the gastrocnemius muscle was extracted and the muscle mass was measured.

The result is shown in figure 2. Gastrocnemius muscle weight was significantly reduced in the dexamethasone-treated group compared to the control. The leucine-administered group showed a recovery tendency as compared with the dexamethasone-administered group. In the lactic acid bacteria-administered group, the CP1750 and CP2998 strain-administered groups showed a tendency to recover the gastrocnemius muscle, similar to leucine.

[Test Example 3] Inhibition of Atrogin-1 expression by extract
Using the CP2998 strain, the Atrogin-1 expression inhibitory effect of each fraction of the bacterial cell extract was compared.
5 ml of distilled water (DW) was added to 0.5 g of the CP2998 strain cells, and the mixture was well suspended and then centrifuged at 6,000 rpm for 10 minutes. Then, only the supernatant was collected so that the cells did not enter, and freeze-dried to obtain a DW fraction.
In addition, 5 ml of distilled water (DW) was added to 0.5 g of CP2998 strain cells and suspended well, and then 15 ml of chloroform: methanol (1: 2) was added and further suspended. Then, 5 ml each of DW and chloroform was added and suspended well. The mixture was centrifuged at 6,000 rpm for 10 minutes, and the lower chloroform layer was recovered. The obtained chloroform layer was dried under reduced pressure to recover the solid content (chloroform fraction). 1% BSA (Sigma) was added to the solid content so as to be 10 mg / ml, and the cells were subjected to the same cell test as in Test Example 1. The upper DW: methanol layer was also recovered, and the solid content was recovered by drying under reduced pressure (DW: methanol fraction). It was dissolved in phosphate buffered saline (PBS) to 10 mg / ml and subjected to the same cell test as in Test Example 1.
As a control group, IGF-1 (TAKARA) and PBS having a final concentration of 100 ng / ml were added, and each was incubated at 37 ° C. for 16 hours.

The results are shown in Figure 3. FIG. 3 shows the value when PBS is 1. Chloroform fraction, DW: Methanol fraction, DW fraction all showed the effect of suppressing the expression of Atrogin-1. Among them, it was confirmed that the chloroform fraction was particularly active.

[Test Example 4] Evaluation of promotion of Myogenin expression level We compared the expression level of Myogenin, which is known as an index of skeletal muscle differentiation. That is, C2C12 cells were cultured to 80% confluent in 10% fetal bovine serum, 1% Penicillin-Streptomaycin-containing, low-glucose-containing Dalbeco-improved Eagle's medium, and then 2% horse serum, 1% Penicillin-Streptomaycin-containing low-glucose-containing Dalbeco It was replaced with improved medium. Furthermore, a suspension of lactic acid bacteria of CP2998 strain and leucine were added to a final concentration of 10 mg / ml, and the cells were cultured for 4 days. After that, RNA was extracted and the gene expression level of Myogenin was measured using Real time PCR according to the method of Miyata et al. (Miyata et al. Journal of Physical Therapy Science, 21 (1): 81-84 2009). ..
The results are shown in FIG. The expression level of Myogenin by leucine was higher than that of PBS, whereas the expression level of Myogenin by CP2998 strain was lower than that of PBS. From this, it was clarified that the CP2998 strain does not have a skeletal muscle synthesis promoting action and has a different effect on C2C12 cells from leucine.

[Lipoteichoic acid extraction from cells and qualitative test]
Method (crude LTA extraction method): 6.4 g of lactic acid bacteria (CP2998 strain, heat-killed cells) were dissolved in 80 mL ultrapure water (DW). Using a wet crusher (Sugino Machine, Starburst), the cells were crushed 12 times under the condition of 245 MPa. Then, the mixture was centrifuged at 5,900 g for 25 minutes to obtain a supernatant. Further, an equal amount of butanol was added, and the mixture was stirred at room temperature for 30 minutes, centrifuged at 5,900 g for 17 minutes, and the aqueous layer was freeze-dried to obtain a lipoteichoic acid-containing butanol extract fraction.
Method (Propanol elution method): To 0.2 g of the butanol extract fraction containing LTA, 20 mL of 15% (v / v) propanol / 100 mM sodium acetate HIC buffer (hereinafter referred to as 15% HIC buffer) was added and dissolved. After treatment with a 0.45um filter (ADVANTEC), it was applied to the HIC column Octyl Sepharose 4 Fast Flow (50 mL). After binding LTA into the column, 15% HIC buffer was flushed in twice the amount (100 mL) of the column. The eluate of 20 mL of the butanol extract containing LTA and 100 mL of 15% HIC buffer was collected as the same fraction. Similarly, run 25% HIC buffer at 1 times the column volume (50 mL), 35% HIC buffer at 2 times the column volume (100 mL), and 45% HIC buffer at 1 times the column volume (50 mL) to elute. Fractions were collected (1st HIC). The pass-through fraction of the LTA-containing butanol extract fraction obtained in the first HIC and the elution fraction of the 15% HIC buffer were applied to the column again, and elution was performed again with each HIC buffer having a different propanol. (Second HIC). Each eluted fraction was concentrated under reduced pressure and dialyzed to obtain 15% HIC, 25% HIC, 35% HIC and 45% HIC concentrated fractions, respectively.
Method (LTA qualitative method): The above sample and SDS-PAGE sample buffer were mixed 1: 1 and heated at 100 ° C. for 5 minutes in a heat block. A polyacrylamide gel was set in the electrophoresis tank, filled with SDS-PAGE buffer, and then 20 uL of the cooled sample and 5 uL of the molecular weight marker were applied. SDS-PAGE was performed at 20 mA for 75 minutes. The PVDF membrane was immersed in the transfer buffer in advance, and after electrophoresis, it was set in the transfer device together with the gel. Transfer was performed at 120 mA for 90 minutes. After transfer, the membrane was placed in a 5% (w / v) skim milk solution and blocked for 1 hour with shaking. Then, 5% (w / v) skim milk was discarded, and the membrane was immersed in a mouse-derived anti-LTA monoclonal antibody Clone55 (Hycult biotech) solution diluted 500-fold, and an antigen-antibody reaction was carried out for 1.5 hours. After the reaction, the cells were washed with PBS-T, immersed in a 1,000-fold diluted HRP-binding anti-mouse antibody (Cell Signaling Technology) solution, and reacted for 1.5 hours. After the reaction, the mixture was washed with PBS-T, chemiluminescent with SignalFire ECL Reagent (Cell Signaling Technology), and exposed to an X-ray film.
Western blotting of the butanol extract fractions at each purification step was performed using LTA antibody, and it was confirmed that LTA was present. Specifically, LTA was first contained in the cell suspension supernatant and the butanol fraction (crude purified LTA) (Fig. 5). In the 15% HIC, 25% HIC, 35% HIC, and 45% HIC concentrated fractions obtained by fractionating the crude LTA with HIC buffer, it was confirmed that the 25% and 35% HIC concentrated fractions contained lipoteichoic acid. (Fig. 6).

[Test Example 5] Atrogin-1 expression suppression test Method: As an in vitro test, C2C12 cells (DS Pharma Biomedical Maker), which are mouse striated cells, were used. C2C12 cells were suspended in Dulbecco's improved Eagle's Medium (Sigma) containing 10% fetal bovine serum, 1% Penicillin-Streptomaycin, and low glucose at 2.0 × 10 ⁴ cells / ml, and 1 ml each was added to a 12-well plate. After that, the cells were cultured to 100% confluent under 37 ° C. and 5% CO ₂ conditions. After exchanging with HS medium, the cells were cultured for 72 hours and differentiated. Next, the medium was replaced with 2% horse serum and 1% Penicillin-Streptomaycin-containing low glucose-containing Dalbecco-improved medium, and the cells were cultured for 6 days while changing the medium every 2 to 3 days to differentiate C2C12 cells. Then, 1% Penicillin-Streptomaycin-containing low glucose Dulbecco improved medium was added. Lactic acid bacteria suspension was added to the medium to a concentration of 100 mg / ml, and dexamethasone was added to the medium to a concentration of 1 uM. In addition, the LTA-containing fraction was added with the equivalent of bacterial cells, and the HIC fraction was added with the equivalent of the LTA-containing fraction.
Then, using RNeasy Plus Mini (QIAGEN), RNA of cells was recovered. RNA was diluted with sterile distilled water to 100 ng / ml, and cDNA was prepared using the High Capacity cDNA Reverse Transcription Kit (Applied Biosytems). Furthermore, the expression levels of GAPDH and Atorogin-1 were measured using 7500Fast (Applied Biosystems), and the values of Atrogin-1 / GAPDH were determined. Fast SYBR Green Master Mix (Applied Biosystems) was used for the measurement. The primer used in Test Example 1 was used. The measurement was carried out at N = 3 with dexamethasone as 100 without additives (PBS only).

Figure 7 shows the results of the Atrogin-1 suppression test. The results are shown by comparing with the control (CON, PBS) set to 1. When the Atrogin-1 inhibitory effect of the lipoteichoic acid-containing fraction corresponding to the bacterial cell content was confirmed on the bacterial cells, it was confirmed that the inhibitory effect was similar to that of the bacterial cells. Furthermore, as a result, the 25% and 35% HIC fractions showed the same Atorign-1 inhibitory effect as the bacterial cells and LTA-containing fractions. As shown in FIG. 6, the 25% and 35% fractions contained lipoteichoic acid, and the fraction containing lipoteichoic acid had activity.

Claims (4)

A muscle degradation inhibitor containing lipoteichoic acid derived from Lactobacillus carbatus CP2998 strain (accession number: NITE BP-02033) . A food or drink for suppressing muscle decomposition containing lipoteichoic acid derived from Lactobacillus carbatus CP2998 strain (accession number: NITE BP-02033) . A method of suppressing muscle breakdown, including ingesting lipoteichoic acid derived from Lactobacillus carbatus CP2998 strain (accession number: NITE BP-02033) (excluding medical practice for humans). Lactobacillus carbatas CP2998 strain (accession number: NITE BP-02033).