JP2018083761A - Agent for inhibiting decomposition of muscle - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel technique to inhibit the decomposition of muscle.SOLUTION: The present invention provides an agent for inhibiting the decomposition of muscle, or food and drink for inhibiting the decomposition of muscle, containing lipoteichoic acid; and a method for inhibiting the decomposition of muscle, including making a user take lipoteichoic acid (excluding medical practice on humans).SELECTED DRAWING: None

Description

  The present invention relates to inhibition of muscle degradation, and particularly to inhibition of muscle degradation caused by the expression of Atrogin-1.

  For example, aging is known as muscle degradation in humans. Specifically, it is known that the decrease in skeletal muscle with aging begins around the age of 30, and the rate of decrease increases beyond the age of 60. This decrease in skeletal muscle mass and strength over a certain level is called sarcopenia, and about 10% of people in their 60s and 35% of late elderly people over 75 years old are actually sarcopenia. Sarcopenia not only increases the risk of decreased quality of life (QOL), fractures due to falls, hospitalization, bedridden, etc., but is also involved in the risk of worsening prognosis after acute disease and surgery.

This decrease in skeletal muscle due to aging is mainly caused by accelerated muscle degradation.
More specifically, skeletal muscle is formed by a balance between synthesis and decomposition, and skeletal muscle synthesis is promoted by exercise and nutrition intake. On the other hand, the degradation of skeletal muscle is promoted by aging, inactivity (Betrest, Gibbs fixation), nutritional starvation, disease and the like.

  For example, inflammatory cytokines (IL-6), tumor necrosis factor-α (TNF-α), glucocorticoids and the like produced in the body due to aging and stress in the body increase. These are known to promote muscle degradation.

  Elderly people often have excessive secretion of these cytokines and hormones due to aging and the like, and as a result, degradation of skeletal muscle is promoted.

  Here, a technique disclosed in Patent Document 1 has been proposed as a technique capable of suppressing a decrease in QOL in elderly people. Patent Document 1 relates to a physical activity promoter that supports an increase in muscle mass and activity, and uses Lactobacillus gasseri, which is a kind of lactic acid bacteria, as an active ingredient.

JP 2013-47192 A

The physical activity promoter disclosed in Patent Document 1 increases muscle mass by ingesting it, but does not suppress muscle degradation.
An object of this invention is to provide the novel technique which can suppress decomposition | disassembly of a muscle.

The prevention and improvement of sarcopenia is focused on promoting muscle synthesis through exercise and nutrition, but it is possible to efficiently prevent sarcopenia by improving the cause of muscle degradation that progresses from the internal environment.
It is known that the degradation of skeletal muscle is caused by proteolytic enzymes, and in particular, the ubiquitin-proteasome system is enhanced. In addition, two muscle-specific ubiquitin ligase genes [MAFbx (muscle atrophy F-box) / Agrgoin-1 and MuRF1 (muscle ring finger 1)] related to this are known.
Glucocorticoids, undernutrition, IL-6, TNF-α and inactivity (Betrest, Gibbs fixation, etc.) enhance these muscle-specific ubiquitin ligase genes, resulting in degradation of skeletal muscle. Thus, these genes are indicators of sarcopenia.
As a result of earnest research, the present inventor has suppressed the expression of Atrogin-1 by inhibiting the components contained in the Lactobacillus carbatus CP2998 strain, the degradation of skeletal muscle, and the inhibition of skeletal muscle degradation. The present invention was completed based on the discovery of lipoteichoic acid as a result of searching for components that act effectively.

The gist of the present invention is as follows.
[1] A muscle degradation inhibitor containing lipoteichoic acid.
[2] A food and drink for inhibiting muscle degradation, which contains lipoteichoic acid.
[3] A method of inhibiting muscle breakdown, including ingestion of lipoteichoic acid (except for human medical practice).

  ADVANTAGE OF THE INVENTION According to this invention, the novel technique which can suppress muscle decomposition | disassembly can be provided.

It is a graph which shows the relationship between each lactic acid bacteria and Atrogin-1 / GAPDH concerning the test example 1. FIG. It is a graph which shows the relationship between each lactic acid bacteria and gastrocnemius muscle weight in connection with Test Example 2. It is a graph which shows the relationship between the extract of Lactobacillus carbatus CP2998 strain and Atrogin-1 / GAPDH according to Test Example 3. It is a graph which shows the relationship between the expression level of Lactobacillus carbatus CP2998 strain and Myogenin according to Test Example 4. It is the photograph concerning the western blotting of the cell suspension supernatant derived from CP2998 strain and the butanol fraction (crudely purified lipoteichoic acid). It is a photograph relating to a Western blot of 15% hydrophobic interaction chromatography (HIC), 25% HIC, 35% HIC and 45% HIC enriched fractions derived from CP2998 strain. FIG. 6 is a graph showing the relationship between 25% HIC and 35% HIC enriched fractions containing lipoteichoic acid and the expression of Atroigin-1 in Test Example 5. FIG.

Hereinafter, one embodiment of the present invention will be described in detail.
The present embodiment relates to a muscle degradation inhibitor (hereinafter also simply referred to as a degradation inhibitor) and contains lipoteichoic acids (hereinafter referred to as LTA). Lipoteichoic acid can be obtained, for example, by extraction from Lactobacillus carbatus CP2998 strain (hereinafter also simply referred to as CP2998 strain) which is a lactic acid bacterium.
Lactic acid bacteria are effective in improving and maintaining health. Intestinal regulating effect, immunostimulatory effect, anti-dermatitis and anti-stress effect are known. These have been shown to have effects not only on live bacteria but also on dead cells. The active ingredient is various, such as lipid, sugar chain, DNA, RNA, peptidoglycan, polyphosphoric acid, lipoteichoic acid contained in lactic acid bacteria.

Lipoteichoic acid is a compound composed of a glycerol phosphate polymer and a glycolipid. In lactic acid bacteria, lipoteichoic acid is present as a component in the cell wall, and the glycolipid site is also bound to the cell membrane in a form that forms part of the cell membrane lipid.
Regarding lipoteichoic acid, there are reports on its contribution to immune regulation, intestinal adhesion, etc., but no reports on suppression of muscle degradation have been confirmed.
As described above, lipoteichoic acid can be obtained by extraction from Lactobacillus carbatus CP2998 strain, but is not limited thereto, and may be obtained by other methods. Specifically, it may be used by extracting from other microorganisms or obtaining lipoteichoic acid itself.

Hereinafter, the case where lipoteichoic acid is extracted from CP2998 strain will be described as an example.
Lactobacillus carbatus CP2998 strain is a kind of lactic acid bacteria, and deposited with the Patent Microorganism Depositary Center on April 15, 2015 as the accession number: NITE P-02033. CP2998 shares are described in Japanese Patent Application No. 2015-104500.

The medium for culturing the CP2998 strain is not particularly limited as long as the CP2998 strain can grow, and it is appropriately selected from a medium commonly used in culturing lactic acid bacteria or a modified medium thereof. Can do.
Further, the carbon source and nitrogen source contained in the medium for culturing the CP2998 strain are not particularly limited. For example, as the carbon source, one or more selected from the group consisting of glucose, sucrose, lactose, molasses and the like used for normal microorganism culture can be used. Further, as the nitrogen source, one type or two or more types selected from the group consisting of peptone, casein, casein degradation product, whey, whey degradation product and the like can be used.
Moreover, you may make it use 1 or 2 or more types selected from the group which consists of corn steep liquor (CSL), a yeast extract, a meat extract, a liver extract, a tomato juice etc. as a supply source of another nutrient.
Furthermore, the medium for culturing the CP2998 strain is a reducing agent such as L-cysteine; vitamins, nucleic acid related substances, acetates and citrates, fatty acid esters, particularly preferably growth promoting factors such as Tween 80; phosphoric acid A compound capable of imparting buffering capacity such as a salt may be added as appropriate.
As a medium that can be used for cultivation of CP2998 strain, it is generally used for the production of fermented milk such as synthetic medium such as MRS medium, juice such as vegetables and fruits, milk, soy milk, reduced skim milk medium, etc. And the like.

  The CP2998 strain can be cultured by, for example, static culture or neutralization culture with a constant pH, but the culture method is not particularly limited as long as the bacteria grow well. For example, the cells can be cultured according to a conventional method for lactic acid bacteria culture, and can be obtained from the obtained culture by means of collecting bacteria such as centrifugation.

For extraction of lipoteichoic acid, viable cells, wet bacteria, dry bacteria, treated products, etc. of the CP2998 strain can be used as appropriate.
Examples of processed products include concentrates, pasted products, dried products, liquid products, diluted products, and crushed products of fermented milk containing CP2998 strain. The dried product can be at least one selected from spray-dried products, freeze-dried products, vacuum-dried products, and drum-dried products. The CP2998 strain used for extraction may be dead cells. Dead cells can usually be obtained by heating the cells. The heating conditions are not particularly limited as long as the cells are killed, but in general, sufficient results can be obtained by heating at 90 ° C. for about 30 minutes. The method for the heat treatment is not particularly limited, and examples thereof include a heat sterilization treatment, a radiation sterilization treatment, and a crushing treatment.
As the extraction solvent, for example, butanol, chloroform, ethyl acetate, hexane, diethyl ether, dimethyl sulfoxide, methanol, ethanol, water, or a mixed solvent thereof can be used.

  An example of extraction of lipoteichoic acid will be described more specifically. First, the cells are crushed. The crushing method may be wet or dry as long as constant crushing is performed. A jet mill, a hall mill, a starburst, etc. can be used. The crushed cells are suspended in a solution such as water, and the supernatant is collected by centrifugation. What was extracted from the supernatant using butanol or ethanol can be obtained as a lipoteichoic acid-containing fraction.

It does not specifically limit about the aspect of the decomposition inhibitor of this embodiment, It can manufacture as a pharmaceutical, a quasi drug, food / beverage products, etc.
When a pharmaceutical product, quasi-drug or food or drink is used, the lipoteichoic acid-containing fraction according to this embodiment is used as an active ingredient, and for example, an excipient, a binder, a stabilizer, a disintegrant, a lubricant, It can be formulated as usual by mixing with flavoring agents, suspending agents, coating agents and other optional components as appropriate. The dosage form can be tablets, pills, capsules, granules, powders, powders, syrups, etc., and these are preferably administered orally.
Or although it does not specifically limit, when manufactured with the aspect as food / beverage products, special-purpose foods, such as food for specific health, nutritional functional foods, etc. other than normal food / beverage products may be sufficient. Specific examples of foods and drinks include, for example, dairy products such as nutritional supplements (supplements), milk drinks, fermented milk, yogurt, cheese, prepared milk powder, infant milk powder, foods such as infant milk powder, fruit juice drinks, Examples include processed eggs such as jelly, candy, and mayonnaise, bread, biscuits, crackers, pizza crust, butter cake, ice cream, gummi, gum, and other confectionery / bread, liquid food, food for the sick, and the like.
Moreover, the decomposition inhibitor of this embodiment is good also as a feed for livestock, for example by mix | blending a lipoteichoic acid containing fraction with a feed raw material, for example.

  There is no particular limitation on the daily intake of the decomposition inhibitor of this embodiment. For example, in the case of an adult, 0.1 to 10 g, preferably 0.5 to 5 g of lipoteichoic acid according to this embodiment is formulated. What is necessary is just to adjust quantity. The content ratio of lipoteichoic acid in the muscle decomposition inhibitor of the present embodiment is not particularly limited, and may be appropriately adjusted according to ease of production, a preferable daily dose, and the like.

As mentioned above, according to this embodiment, the novel technique which can suppress decomposition | disassembly of muscle can be provided.
That is, although the aspect of ingestion of the lipoteichoic acid according to the present embodiment is not particularly limited, for example, by taking it in the form of a pharmaceutical, quasi-drug, food or the like containing the above-described lipoteichoic acid, the muscle decomposition is suppressed. be able to. Specifically, the expression of the muscle-specific ubiquitin ligase gene Atrogin-1 involved in muscle degradation can be suppressed. Therefore, although there are individual differences, for example, it is possible to expect an effect of suppressing the degradation of muscle mass by suppressing muscle degradation due to aging or the like. In addition, the lipoteichoic acid according to the present embodiment can be obtained from, for example, a lactic acid strain, can be supplied in large quantities at a relatively low cost, and is extremely safe.

  Hereinafter, the decomposition inhibitor of this embodiment will be described in more detail by way of examples. Note that the present invention is not limited to this.

[Preparation of lactic acid bacteria suspension]
Each lactic acid bacterium was smeared on a MRS agar medium (Difco) with about one platinum loop from a glycerol stock, and cultured at 30 ° C. for 24-48 hours under anaerobic conditions. Colonies that grew on the agar were picked and suspended in MRS liquid medium (Difco) and cultured at 30 ° C. for 24 hours. Thereafter, the cells were collected from the lactic acid bacteria culture solution by centrifugation. Distilled water was added to the collected cells and centrifuged again, and the supernatant was removed to wash the cells. The obtained lactic acid bacterial cells were heated at 105 ° C. for 20 minutes, and then dried dead bacterial cells were prepared using a freeze dryer. A suspension of the lactic acid bacterial cells, which are the dried dead cells, in water or a solvent was used as a lactic acid bacterial suspension.
[Test Example 1] Atrogin-1 expression inhibition evaluation
As an in vitro test, C2C12 cells (DS Pharma Biomedical), which are mouse striated cells, were used. C2C12 cells were suspended in Dulbecco's modified Eagle's medium (Sigma) containing 10% fetal bovine serum, 1% Penicillin-Streptomaycin, and 1.9 × 10 ⁴ cells / ml, and 1 ml each was added to a 12-well plate. Thereafter, the cells were cultured at 37 ° C. and 5% CO _{2 for} 72 hours to 80% confluence while changing the medium every 2-3 days.
Next, the medium was changed to Dulbecco's modified medium containing 2% horse serum and 1% Penicillin-Streptomaycin and low glucose, and cultured for 4 days while changing the medium every 2-3 days to differentiate C2C12 cells. Thereafter, a low glucose Dulbecco modified medium containing 1% Penicillin-Streptomaycin was added. Add lactic acid bacteria suspension to the medium to a concentration of 100 mg / ml, and add dexamethasone (DX), which is known to increase Atorogin-1 expression in skeletal muscle, to 50 mM. Added to the medium. Thereafter, cellular RNA was recovered using RNeasy Plus Mini (QIAGEN). RNA was diluted with sterilized distilled water to 100 ng / ml, and cDNA was prepared using High Capacity cDNA Reverse Transcription Kit (Applied Biosytems). Furthermore, the expression levels of GAPDH and Atorogin-1 were measured using 7500 Fast (Applied Biosystems), and the value of Atrogin-1 / GAPDH was determined. For the measurement, Fast SYBR Green Master Mix (Applied Biosystems) was used. As a primer, Atrogin-1 expression is Atrogin-1F, 5 ′ ATCCCAGCACACGACAACAC 3 ′ and Atrogin-1R, 5 ′ CGGCAACTGCATCTCTTC 3 ′, GAPDH expression is GAPDH F 5 ′ ATGGCCTTCCGTGTTCCTAC 3 ′ and GAPDH R, 5 ′ TGCCTGCTTCACCACCTTC 3 'was used.
Measurements were performed at N = 3 using dexamethasone as an index.

  The results are shown in Figure 1. As a result of evaluation of 10 lactic acid bacteria strains, Lactobacillus amylobolus No1 strain, CP1750 strain (accession number: FERM BP-10532) and Lactobacillus carbatus CP2998 strain showed high activity.

[Test Example 2] Muscle degradation inhibition test using rats
Seven-week old male SD rats were acclimatized for one week and then grouped so that the body weight was uniform. Each group had 8 animals per group. Each lactic acid bacteria suspension was orally administered to the lactic acid bacteria administration group at a dose rate of 1 g / kg. In addition, a group in which leucine was orally administered at 1 g / kg was also set as a positive control. Dexamethasone (Mesadron injection: Kobayashi Kako Co., Ltd.) was administered subcutaneously at 600 mg / kg. After one week of oral administration of the lactic acid bacteria suspension, the lactic acid bacteria suspension and dexamethasone were administered for 2 days, necropsied on the third day, the gastrocnemius muscle was extracted, and the muscle mass was measured.

  The result is shown in figure 2. The gastrocnemius muscle weight was significantly reduced in the dexamethasone administration group compared to the control. The leucine administration group showed a recovery trend compared to the dexamethasone administration group. In the lactic acid bacteria administration group, the CP1750 strain and CP2998 strain administration groups showed a tendency to recover gastrocnemius muscle, similar to leucine.

[Test Example 3] Suppression of Atrogin-1 expression by extract
Using CP2998 strain, the Atrogin-1 expression inhibitory effect of each fraction of the bacterial cell extract was compared.
After adding 5 ml of distilled water (DW) to 0.5 g of CP2998 strain cells and suspending well, it was centrifuged at 6,000 rpm for 10 minutes. Thereafter, only the supernatant was collected so that the cells did not enter, and lyophilized to obtain a DW fraction.
Further, 5 ml of distilled water (DW) was added to 0.5 g of CP2998 strain cells and well suspended, and then 15 ml of chloroform: methanol (1: 2) was further suspended. Thereafter, 5 ml each of DW and chloroform was added and well suspended. The lower chloroform layer was recovered by centrifugation at 6,000 rpm for 10 minutes. The obtained chloroform layer was dried under reduced pressure to recover the solid content (chloroform fraction). 1% BSA (Sigma) was added so that the solid content was 10 mg / ml, and the cells were subjected to the same cell test as in Test Example 1. The upper DW: methanol layer was also recovered, and the solid content was recovered by drying under reduced pressure (DW: methanol fraction). It was dissolved in phosphate buffered saline (PBS) so as to be 10 mg / ml, and it was subjected to the same cell test as in Test Example 1.
As a control group, IGF-1 (TAKARA) at a final concentration of 100 ng / ml and PBS were added and incubated at 37 ° C. for 16 hours, respectively.

  The results are shown in Figure 3. FIG. 3 shows values when PBS is 1. Inhibition of Atrogin-1 expression was observed in the chloroform fraction, DW: methanol fraction, and DW fraction. Among them, the chloroform fraction was confirmed to have particularly high activity.

[Test Example 4] Myogenin expression level promotion evaluation The expression level of Myogenin known as an index of skeletal muscle differentiation was compared. That is, C2C12 cells were cultured to 80% confluent using Dulbecco's modified Eagle medium containing 10% fetal bovine serum, 1% Penicillin-Streptomaycin, and low glucose, and then 2% horse serum, 1% Penicillin-Streptomaycin-containing low glucose-containing Dulbecco. The medium was changed to an improved medium. Furthermore, CP2998 strain lactic acid bacteria suspension and leucine were added to a final concentration of 10 mg / ml and cultured for 4 days. Subsequently, RNA was extracted and the gene expression level of Myogenin was measured using Real time PCR according to the method of Miyata et al. (Miyata et al. Journal of Physical Therapy Science, 21 (1): 81-84 2009). .
The results are shown in FIG. The expression level of Myogenin by leucine was higher than that of PBS, whereas the expression level of Myogenin by CP2998 strain was lower than that of PBS. From this, it was clarified that the CP2998 strain does not have a skeletal muscle synthesis promoting action and has a different effect on C2C12 cells from leucine.

[Lipoteichoic acid extraction from cells and qualitative test]
Method (crude LTA extraction method): 6.4 g of lactic acid bacteria (CP2998 strain, heat-killed cells) was dissolved in 80 mL of ultrapure water (DW). Using a wet pulverizer (Sugino machine, Starburst), it was carried out 12 times under the condition of 245 MPa, and the cells were crushed. Thereafter, the mixture was centrifuged at 5,900 g for 25 minutes to obtain a supernatant. Further, an equal amount of butanol was added, and the mixture was stirred at room temperature for 30 minutes, centrifuged at 5,900 g for 17 minutes, and the aqueous layer was lyophilized.
Method (Propanol Elution Method): To 0.2 g of LTA-containing butanol extraction fraction, 20 mL of 15% (v / v) propanol / 100 mM sodium acetate HIC buffer (hereinafter 15% HIC buffer) was added and dissolved. After treatment with a 0.45 um filter (ADVANTEC), it was applied to an HIC column Octyl Sepharose 4 Fast Flow (50 mL). After binding LTA into the column, 15% HIC buffer was allowed to flow twice as much as the column (100 mL). The LTA-containing butanol extract fraction (20 mL) and the 15% HIC buffer (100 mL) eluate were collected as the same fraction. Similarly, elute with 25% HIC buffer at 1 column volume (50 mL), 35% HIC buffer at 2 column volumes (100 mL), and 45% HIC buffer at 1 column volume (50 mL). Fractions were collected (first HIC). The flow-through fraction of the LTA-containing butanol extract obtained in the first HIC and the elution fraction of 15% HIC buffer were applied to the column once again, and the elution was performed again with each HIC buffer with a different propanol. (Second HIC). Each elution fraction was concentrated under reduced pressure, and dialyzed to obtain 15% HIC, 25% HIC, 35% HIC, and 45% HIC concentrated fractions, respectively.
Method (LTA qualitative method): The above sample and SDS-PAGE sample buffer were mixed 1: 1, and heated in a heat block at 100 ° C. for 5 minutes. A polyacrylamide gel was set in the electrophoresis tank and filled with SDS-PAGE buffer, and then 20 uL of the cooled sample and 5 uL of molecular weight marker were applied. SDS-PAGE was performed at 20 mA for 75 minutes. A PVDF membrane was previously immersed in a transfer buffer, and after electrophoresis, it was set in a transfer device together with the gel. The transfer was performed at 120 mA for 90 minutes. After the transfer, the membrane was placed in a 5% (w / v) skim milk solution and blocked for 1 hour with shaking. Thereafter, 5% (w / v) skim milk was discarded, and the membrane was immersed in a mouse-derived anti-LTA monoclonal antibody Clone55 (Hycult biotech) solution diluted 500 times, and an antigen-antibody reaction was performed for 1.5 hours. After the reaction, the plate was washed with PBS-T, immersed in a 1,000-fold diluted HRP-conjugated anti-mouse antibody (Cell Signaling Technology) solution, and reacted for 1.5 hours. After the reaction, the plate was washed with PBS-T, chemiluminescent with SignalFire ECL Reagent (Cell Signaling Technology), and exposed to an X-ray film.
Western blotting of the butanol-extracted fraction at each purification stage was performed using LTA antibody, confirming the presence of LTA. Specifically, LTA was first contained in the cell suspension supernatant and the butanol fraction (crudely purified LTA) (FIG. 5). In 15% HIC, 25% HIC, 35% HIC, and 45% HIC concentrated fractions obtained by separating crude LTA with HIC buffer, it was confirmed that 25% and 35% HIC concentrated fractions contained lipoteichoic acid. (Figure 6).

[Test Example 5] Atrogin-1 expression inhibition test Method: As an in vitro test, C2C12 cells (DS Pharma Biomedical Maker), which are mouse striated cells, were used. C2C12 cells were suspended in Dulbecco's modified Eagle's medium (Sigma) containing 10% fetal bovine serum, 1% Penicillin-Streptomaycin, and added to a 12-well plate at a rate of 2.0 × 10 ⁴ cells / ml. Thereafter, the cells were cultured at 37 ° C. and 5% CO ₂ until they reached 100% confluence. After replacing with HS medium, the cells were cultured for 72 hours to be differentiated. Next, the medium was changed to Dulbecco's modified medium containing 2% horse serum and 1% Penicillin-Streptomaycin and low glucose, and cultured for 6 days while changing the medium every 2 to 3 days to differentiate C2C12 cells. Thereafter, a low glucose Dulbecco modified medium containing 1% Penicillin-Streptomaycin was added. To the medium, the lactic acid bacteria suspension was added to a concentration of 100 mg / ml, and dexamethasone was added to the medium to a concentration of 1 uM. Moreover, the LTA-containing fraction was added with the equivalent of bacterial cells, and the HIC fraction was added with the equivalent of the LTA-containing fraction.
Thereafter, cellular RNA was recovered using RNeasy Plus Mini (QIAGEN). RNA was diluted with sterilized distilled water to 100 ng / ml, and cDNA was prepared using High Capacity cDNA Reverse Transcription Kit (Applied Biosytems). Furthermore, the expression levels of GAPDH and Atorogin-1 were measured using 7500 Fast (Applied Biosystems), and the value of Atrogin-1 / GAPDH was determined. For the measurement, Fast SYBR Green Master Mix (Applied Biosystems) was used. The primer used in Test Example 1 was used. Measurement was performed at N = 3 with dexamethasone set to 100 without addition (PBS only).

  FIG. 7 shows the results of the Atrogin-1 inhibition test. The control (CON, PBS) was set as 1, and the results were shown. When the Atrogin-1 inhibitory effect of the lipoteichoic acid-containing fraction corresponding to the bacterial cell content was confirmed against the bacterial cells, it was confirmed that the bacterial cells had the same inhibitory effect as the bacterial cells. As a result, the 25% and 35% HIC fractions showed the same Atorign-1 inhibitory effect as the bacterial cells and LTA-containing fractions. As shown in FIG. 6, the 25% and 35% fractions contained lipoteichoic acid, and there was activity in the fraction containing lipoteichoic acid.

Claims (3)

  A muscle decomposition inhibitor containing lipoteichoic acid.   A food and drink for inhibiting muscle degradation, containing lipoteichoic acid.   A method for inhibiting muscle breakdown, including ingesting lipoteichoic acid (except for medical practice for humans).