JP6528056B2 - Method of producing stress sensitive cells using nucleic acid - Google Patents

Description

  The present invention relates to technology in the life science field and environmental analysis field, and in particular, to a technology of a method of evaluating biological effects of environmental stress using cultured cells.

  As a method of evaluating the biological effects of environmental stress represented by chemical substances (bioassay), using cultured cells such as mammals to substitute for animal experiments using mice, etc., cell proliferation rate and cell survival Methods are known to assess environmental stress by measuring rates. However, in this method, it takes time for the cultured cells to finally exhibit a phenotype such as cell death in response to environmental stress, and therefore, it has been required to enhance the sensitivity of this measurement.

  As a method to solve this problem, UGT (UDP glucuronyltransferase), which is involved in the metabolism of foreign substances inside and outside the body, is a chemical substance in cells by suppressing its gene expression using RNA interference method. A method has been reported that achieves high sensitivity of cytotoxicity evaluation (Patent Document 1). However, RNA interference method is known to have a side effect of suppressing the expression of genes other than the target gene, and the double stranded siRNA used is very expensive.

  Also, using a promoter sequence of a protein whose expression is known to be induced by a specific chemical substance (for example, HSP90β protein whose expression is induced by lipopolysaccharide), a reporter such as luciferase is downstream of the promoter. By introducing the gene-introduced sequence into cells, the presence of the specific chemical substance in the cultured cells can be detected sharply, thereby achieving a high sensitivity of cytotoxicity evaluation (reporter assay method). It is reported (patent documents 2, 3). However, these methods make use of the properties of a specific promoter in response to a specific chemical substance to individually measure the presence of the specific chemical substance, and the presence of various types of environmental stress In order to measure, it is necessary to construct individually the mechanism which responds to those stress.

Unexamined-Japanese-Patent No. 2010-265190 International Publication 2007/004361 JP 2011-087497

Mourtada-Maarabouni et al., Oncogene 28, 195-208, 2009 Kino et al., Sci Signal. 3, ra8, 2010 Tani et al., Genome Res. 22, 947-956, 2012

  The present invention does not use the problematic RNA interference method such as the above-mentioned side effects, etc., in enhancing the sensitivity of the environmental stress evaluation method using cultured cells such as mammals described above, and is also a reporter assay. It is an object of the present invention to provide a means for comprehensively sensitizing cultured cells to environmental stress rather than individually measuring the presence of a specific chemical substance.

  As a result of intensive studies to solve the above problems, the inventors of the present invention have found that cultured cells are chemically expressed by highly expressing GAS5 and / or RNA molecules having similar functions in cultured cells such as mammals. The present invention has been completed by finding that it is highly sensitive to environmental stress such as substances and ultraviolet light.

It has been reported that cells become more susceptible to apoptosis by increasing the amount of RNA expression of GAS (Growth arrest-specific 5) gene involved in the regulation of expression of apoptosis (cell death) suppressor gene in cultured human cells. (Non-Patent Documents 1 and 2).
The present inventors examined this under the idea that it could be used for the evaluation of various environmental stresses by cultured cells, and as a result, increased the amount of RNA expression of GAS5 in cultured cells of mammals. Thus, it was found that cultured cells react more rapidly and sensitively to sensitize chemical substances to environmental stress such as Mercury (II) Chloride and Cycloheximide (FIG. 4).

In addition, the present inventors previously expressed many types of non-coding RNAs that do not encode proteins in mammalian cells, and these are widely regarded as having high degradation rates in cells and those that do not. In addition, GAS5, which is one of such noncoding RNAs, has been found to be rapidly degraded in cells (Non-patent Document 3).
Although many of such noncoding RNAs are not yet known for their function, the present inventors have the idea that some of them may have the same function as GAS5. Below, with regard to RNAs with high degradation rates in the above cells, those with similar functions to GAS5 were searched for sensitivity to environmental stress of cells.

The search was performed as follows.
That is, GAS5 is known to be increased in expression level in starved cells. Therefore, exposure of model chemicals to HEK293 cells, which are mammalian cells, significantly increases the expression level of non-coding RNAs of unknown function that are reported to have a high degradation rate in cells, as in GAS5. RNA was identified (Figures 1 and 2).
Subsequently, by artificially increasing the abundance of RNA having the specified base sequence of non-coding RNA in cells, it was confirmed that the cells were more likely to cause cell death due to environmental stress.
Specifically, an expression plasmid vector containing a nucleic acid having the specific non-coding RNA base sequence described above is prepared by the method of recombinant DNA, and the expression plasmid vector is used in mammalian cells by using a nucleic acid transfer reagent or the like. By introducing and passing through for a certain period of time, the expression amount of the nucleic acid having the specific base sequence was increased several times or more in normal mammalian cells (FIGS. 3 to 5). Thereafter, cells whose abundance of nucleic acids having these specific base sequences has increased several times or more than normal cells are not significantly different from normal cells in cell growth rate under normal culture conditions. (Fig. 6), while it was confirmed that cell death can be measured more quickly and sensitively than general cells by applying various environmental stress including chemicals (Fig. 6) (Fig. 6). 7-10).
According to such a procedure, it was confirmed that two RNA molecules with high degradation rates in cells, IDI2-AS1 and SNHG15, have the same function as GAS5 with respect to the sensitivity of cells to environmental stress.
In addition, similar tests are performed on cells in which the expression level is increased by combining multiple species of these specific RNA molecules, and thus the sensitivity to environmental stress is better than when these are increased alone. It could be confirmed that the cells possessed were obtained (FIGS. 11 and 12).

That is, this application provides the following invention.
<1> A method for enhancing the sensitivity of cultured cells to environmental stress by highly expressing one or more RNA molecules selected from GAS5, IDI2-AS1 and SNHG15 in cultured cells.
<2> The method according to <1>, wherein the RNA molecule is GAS5.
<3> The method according to <1>, wherein the RNA molecule is IDI2-AS1 or SNHG15.
<4> The method according to <1>, wherein the RNA molecule is GAS5 and IDI2-AS1.
<5> The method according to <1>, wherein the RNA molecule is GAS5 and SNHG15.
<6> The method according to <1> to <3>, wherein the cultured cells are mammalian cultured cells.
<7> The method according to <1> to <6>, wherein the environmental stress is an environmental stress caused by a chemical substance.
<8> The method according to <1> to <6>, wherein the environmental stress is an environmental stress caused by ultraviolet light.
The cultured cell sensitized to environmental stress by the method as described in <9><1>-<8>.
The evaluation method of environmental stress characterized by using the cultured cell as described in <10><9>.
<11> An apparatus for evaluating environmental stress comprising the cultured cell according to <9>.
<12> With regard to non-coding RNA molecules that exert environmental stress on mammalian cells and have a high degradation rate in mammalian cells, an RNA molecule whose expression level is increased is identified, and the RNA molecule raises the cells against environmental stress. A method of screening an RNA molecule that sensitizes a cell to environmental stress, comprising assaying whether to sensitize or not.

According to the present invention, by artificially increasing the abundance of RNA having a specific non-coding RNA base sequence in a cultured cell, it has a function having higher sensitivity to environmental stress than normal cells. Sex cells can be generated, and by using this, the biological effects of various environmental stresses can be measured and evaluated rapidly and with high sensitivity.
According to the present invention, it is possible to comprehensively sensitize the biological effects of environmental stress on mammalian cells, rather than individually measuring the presence of certain chemical substances as in the reporter assay. It is.

The figure which shows the screening result of the non coding RNA whose expression level increases notably by exposure of a chemical substance. The figure which shows the correlation with the expression level of a non-coding RNA in which the expression level increases notably by exposure to a chemical substance, and a chemical substance concentration. The figure which shows the overexpression of GAS5 by the expression vector which integrated GAS5. FIG. 6 shows overexpression of IDI2-AS1 by an expression vector incorporating IDI2-AS1. The figure which shows the overexpression of SNHG15 by the expression vector which integrated SNHG15. The figure which shows the influence on the cell proliferation rate by the increase in expression level of GAS5, IDI2-AS1, and SNHG15. The figure which shows the effect | action of cycloheximide in the cell which overexpressed GAS5, IDI2-AS1, and SNHG15, respectively. The figure which shows the effect | action of the mercury chloride in the cell which overexpressed GAS5, IDI2-AS1, and SNHG15, respectively. The figure which shows the effect | action of the hydrogen-peroxide solution in the cell which overexpressed GAS5, IDI2-AS1, and SNHG15, respectively. The figure which shows the effect | action of the ultraviolet-ray in the cell which overexpressed GAS5, IDI2-AS1, and SNHG15, respectively. The figure which shows the effect | action of the ultraviolet-ray in the cell which overexpressed GAS5, GAS5 and IDI2-AS1, GAS5, and SNHG15, respectively. The figure which shows the relationship of the elapsed time after the irradiation of an ultraviolet-ray in the cell which overexpressed GAS5, GAS5 and IDI2-AS1, GAS5, and SNHG15, respectively, and the effect.

  EXAMPLES The present invention will next be described in more detail by way of examples, which should not be construed as limiting the invention thereto.

(Example 1) Screening of non-coding RNA whose expression level is significantly increased by chemical exposure (Part 1)
For human cell line HEK 293 cells (2 × 10 ⁵ cells / 12 well plate), a system was prepared in which 0 or 100 μM of Cycloheximide (Wako) was added to the cell culture medium. Each reagent was diluted with DMSO.
In this state, after incubating at 37 ° C., 5% CO ₂ for 24 hours, cell recovery and total RNA extraction were performed using RNAiso plus (TaKaRa).
Reverse transcription reaction was performed using PrimeScript RT Master Mix (Perfect Real Time) on 500 ng of total RNA obtained, and real-time PCR was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO), thereby causing intracellular degradation by previous research The expression levels of 24 types of noncoding RNAs with known functions and unknown functions, and GAPDH, which have been reported to be fast, were measured, and the quantified value of each noncoding RNA was normalized with the quantified value of the GAPDH gene ( Figure 1).
As a result, it was found that the expression levels of the three types of RNAs of GAS5, IDI2-AS1 and SNHG15 increased by at least 8-fold as compared with the case where no chemical substance was added when the chemical substance was added.
The primers used in real-time PCR are as follows.
CDKN2B-AS1 forward primer: 5'- TTGTTAGAAACCAGGCTGCAC-3 '
CDKN2B-AS1 reverse primer: 5'-TTCTCTCTTTTCTGTGGTTTCTCAAT-3 '
HOTAIR forward primer: 5'- CAGTGGGGAACTCTGACTCG-3 '
HOTAIR reverse primer: 5 '-GTGCCTGGTGCTCTCTTACC -3'
TUG1 forward primer: 5'- CCAGACCCTCAGTGCAAACT-3 '
TUG1 reverse primer: 5'- AATCAGGAGGCACAGGACA-3 '
GAS5 forward primer: 5'- CTTGCTCTGGACCAGCTTAAT-3 '
GAS5 reverse primer: 5 '-CAAGCGGACTCTCCATACCT -3'
MIR22HG forward primer: 5 '-CGGACGCAGTGATTTGCT-3'
MIR22HG reverse primer: 5'- GCTTTAGCTGGTCAGGACA-3 '
FLJ43663 forward primer: 5'- GGGATAATTTGCCATCTGGA -3 '
FLJ43663 reverse primer: 5 '-CCGTTTCTTCCTTTTCTCTCT-3'
LOC100216545 forward primer: 5 '-CAGCAAAATCTGGCCTACT -3'
LOC100216545 reverse primer: 5 '-GTCCAGCAATCTTTTCTCGT -3'
LINC00667 forward primer: 5'- AGTTTGCGCCTTTTGGTCT-3 '
LINC00667 reverse primer: 5 '-GGCCATGTGCAAAGGATTT -3'
HCG18 forward primer: 5'- CTGCCTTCTAGGGGCTCACT -3 '
HCG18 reverse primer: 5'- ACATGCTCCCACCAACTTTCA-3 '
LOC550112 forward primer: 5'- CTGAAATCAGAGCCCTCACA-3 '
LOC550112 reverse primer: 5'- TCAAGGACCTGGAAATGACC -3 '
LINC00662 forward primer: 5 '-GTTTGATTTCTCGCAGACCAG -3'
LINC00662 reverse primer: 5'- GCGAGGTCTAACCCAGGTG -3 '
GABPB1-AS1 forward primer: 5'- AGGGAAAGAAATATATGCCATTTCTA-3 '
GABPB1-AS1 reverse primer: 5'- ATCATTCCCGCCGCTTTCT-3 '
FLJ33630 forward primer: 5'- GCAATTATCACGGGAACCTAT-3 '
FLJ33630 reverse primer: 5'- AAATCTTATCTGCTTCCATTATTTGTAA-3 '
TTN-AS1 forward primer: 5'- TCCTTAGGCATCACCTAGCC-3 '
TTN-AS1 reverse primer: 5'- GATGGAGGAAGTAGAGTCATTGG -3 '
LOC728431 forward primer: 5 '-CATTCCCTAACCCGTGTCC -3'
LOC728431 reverse primer: 5'- TCCATCAAAGCCAGAC-3 '
LINC00473_v1 forward primer: 5'- TATGCGCGTCAGCATACTTT -3 '
LINC00473_v1 reverse primer: 5 '-TGTCCTGGCTCCCTGT -3'
LINC00473_v2 forward primer: 5'- TATGCGCGTCAGCATACTTT -3 '
LINC00473_v2 reverse primer: 5'-TCTCCCAAAGCACAACGAG-3 '
FAM222A-AS1 forward primer: 5'- CAACATGGAATGGAGACCA-3 '
FAM222A-AS1 reverse primer: 5'- CTTCCGGGATCCCAGTGT-3 '
LINC00152 forward primer: 5 '-GAGCCACCAGCTCTCCCT -3'
LINC00152 reverse primer: 5'- AAAAACGATCTTGCCGACAC-3 '
LINC0541471_v1 forward primer: 5 '-CAGATCTTCACAGCACAGTTCC -3'
LINC0541471_v1 reverse primer: 5 '-TGCTGATCCACTTTGCTTGT -3'
LINC0541471_v2 forward primer: 5 '-CACCAGCCTCTCCTGAA-3'
LINC0541471_v2 reverse primer: 5 '-TTCGATCAAGTGTGTCATAGAGC -3'
IDI2-AS1 forward primer: 5'- GTGTTAACAAAGACAACGCTGAA-3 '
IDI2-AS1 reverse primer: 5 '-AAGAGGCCTGAAAAAACCTT -3'
SNHG15 forward primer: 5 '-GCAACTCCTTTGCAAGATGC -3'
SNHG15 reverse primer: 5'- CTCAAGGAGGGACCTCAGC-3 '
ZFP91-CNTF forward primer: 5'- TTGTTCATACTTGGCGGTGA-3 '
ZFP91-CNTF reverse primer: 5 '-GGCGGGCCTAATCATTTT -3'
GAPDH forward primer: 5'- GCACCGTCAAGGCTGAGAAC-3 '
GAPDH reverse primer: 5'- TGGTGAAGCGCCAGTGGA -3 '

(Example 2) Screening of non-coding RNA whose expression level is significantly increased by chemical exposure (Part 2)
In Example 1, the correlation between the expression level of each of GAS5, IDI2-AS1 and SNHG15 and the addition level of the chemical substance was examined in more detail for the three types of GAS5, IDI2-AS1 and SNHG15 in which the expression level of RNA significantly increased upon chemical substance addition. .
For HEK 293 cells (2 × 10 ⁵ cells / 12 well plate) which are human cells, systems in which cycloheximide (Wako) was added at 0, 1, 10 or 100 μM in cell culture medium were prepared respectively. Each reagent was diluted with DMSO.
In this state, after incubating at 37 ° C., 5% CO ₂ for 24 hours, cell recovery and total RNA extraction were performed using RNAiso plus (TaKaRa). Perform reverse transcription reaction using PrimeScript RT Master Mix (Perfect Real Time) with 500 ng of total RNA obtained, and perform real-time PCR using THUNDERBIRD SYBR qPCR Mix (TOYOBO) to obtain non-coding RNA with known function The expression levels of GAS5, non-coding RNAs of unknown function IDI2-AS1 and SNHG15, and GAPDH were measured, and the quantitative value of each non-coding RNA was normalized with the quantitative value of the GAPDH gene (FIG. 2).
As a result, it was found that the expression levels of the above three types of RNA, GAS5, IDI2-AS1 and SNHG15, increased in a chemical substance concentration-dependent manner.
Furthermore, as a result of searching for commonality of the sequences of these RNAs, one AU-rich element (AUUUA motif) that is considered to contribute to the instability of RNA, one for GAS5, one for IDI2-AS1, and two for SNHG15 I found that I had on the 3 'side. Thus, these RNAs share sequence identity.

Example 3 Overexpression of GAS5 by Expression Vector Incorporating GAS5 Using pcDNA3.1 (+) (Invitrogen), an expression vector for mammalian cells, the nucleotide sequence of human GAS5 (NCBI number) directly under the T7 promoter : A vector incorporating the first to the 631st bases of NR_002578 was prepared.
GAS5 is inserted vector and GAS5 is not inserted vector (Mock vector) 2.5 [mu] g, respectively introduced into HEK293 cells ^{(10 6 cells / 60 mm dish} ) using Lipofectamine 2000 Reagent (Invitrogen), 37 ℃, After incubation for 48 hours under 5% CO ₂ conditions, cell recovery and total RNA extraction were performed using RNAiso plus (TaKaRa).
Perform reverse transcription reaction using PrimeScript RT Master Mix (Perfect Real Time) for 500 ng of total RNA obtained, and perform real-time PCR using THUNDERBIRD SYBR qPCR Mix (TOYOBO) to express the expression levels of GAS5 and GAPDH. It measured and the quantified value of GAS5 was normalized by the quantified value of GAPDH (FIG. 3).
As a result, it was found that GAS5 was expressed about 66 times as high as that in which the vector in which GAS5 was inserted was introduced compared to that in which the vector in which GAS5 was not inserted was introduced.

(Example 4) Overexpression of IDI2-AS1 by Expression Vector Incorporating IDI2-AS1 Using pcDNA3.1 (+) (Invitrogen), an expression vector for mammalian cells, human IDI2-AS1 was obtained just under the T7 promoter. A vector was constructed in which the nucleotide sequence of SEQ ID NO: (NCBI number: the first base to the 1088th base of NR_024628) was incorporated.
Use Lipofectamine 2000 Reagent (Invitrogen) to introduce HEK293 cells (10 ⁶ cells / 60 mm dish) with 2.5 μg of the vector into which IDI2-AS1 has been inserted and the vector into which IDI2-AS1 has not been inserted (Mock vector). After incubation for 48 hours at 37 ° C., 5% CO ₂ , cell recovery and total RNA extraction were performed using RNAiso plus (TaKaRa).
Reverse transcription reaction was performed using PrimeScript RT Master Mix (Perfect Real Time) on 500 ng of total RNA obtained, and real-time PCR was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO) to express IDI2-AS1 and GAPDH. The amount was measured, and the quantitative value of IDI2-AS1 was normalized with the quantitative value of GAPDH (FIG. 4).
As a result, it was found that IDI2-AS1 was expressed approximately 41,497 times higher in the one into which the vector into which IDI2-AS1 was inserted was introduced than in the vector into which the vector into which IDI2-AS1 was not inserted was introduced.

(Example 5) The nucleotide sequence (NCBI number) of human SNHG15 directly under the T7 promoter using pcDNA3.1 (+) (Invitrogen), which is an expression vector for mammalian cells overexpressing SNHG15 by an expression vector incorporating SNHG15 : A vector incorporating 1st to 808th bases of NR_003697) was prepared.
SNHG15 is inserted vector and SNHG15 is not inserted vector (Mock vector) 2.5 [mu] g, respectively introduced into HEK293 cells ^{(10 6 cells / 60 mm dish} ) using Lipofectamine 2000 Reagent (Invitrogen), 37 ℃, After incubation for 48 hours under 5% CO ₂ conditions, cell recovery and total RNA extraction were performed using RNAiso plus (TaKaRa).
Perform reverse transcription reaction using PrimeScript RT Master Mix (Perfect Real Time) for 500 ng of total RNA obtained, and perform real-time PCR using THUNDERBIRD SYBR qPCR Mix (TOYOBO) to obtain the expression levels of SNHG15 and GAPDH. The measured value of SNHG15 was normalized with the measured value of GAPDH (FIG. 5).
As a result, it was found that SNHG15 was expressed approximately 56 times as high as that in which the vector into which SNHG15 was inserted was introduced compared to that into which the vector into which SNHG15 was not inserted was introduced.

(Example 6) Effect on cell proliferation rate by increasing expression amount of GAS5, IDI2-AS1, SNHG15 Vector used in Example 3, 4, 5 GAS5, IDI2-AS1 or SNHG15 inserted vector and empty vector 2.5 μg and using Lipofectamine 2000 Reagent (Invitrogen) were respectively introduced into HEK293 cells ^{(10 6 cells / 60 mm dish} ), 37 ℃, after 4 hours at 5% CO2 conditions, 96 well plate the cells from 60 mm dish It was replanted.
In addition, 2.5 μg of the vector into which GAS5 used in Example 3 was inserted, 2.5 μg of the vector into which GAS5 used in Example 3 was inserted, and 2.5 μg of the vector into which IGIDI2-AS1 used in Example 4 was inserted, HEK 293 cells (10 ⁶ using Lipofectamine 2000 Reagent (Invitrogen), 2.5 μg of the vector into which GAS5 used in Example 3 was inserted, 2.5 μg of the vector into which SNHG 15 used in Example 4 was inserted, and 2.5 μg of empty vector The cells were introduced into cells / 60 mm dish) and incubated at 37 ° C., 5% CO 2 for 4 hours, and then the cells were replated from 60 mm dishes to 96 well plates.
Subsequently, viable cell counts were performed using Cell Counting Kit-8 (Dojindo) after incubation at 37 ° C., 5% CO ₂ for 0, 24, 48, or 72 hours (FIG. 6A and FIG. 6B). . The experiment was performed at n = 4.
As a result, those into which a vector into which GAS5, IDI2-AS1 or SNHG15 has been inserted, or into which GAS5, GAS5 and IDI2-AS1, GAS5 and SNHG15 have been inserted, are vectors into which an empty vector has been introduced. In comparison, none of them showed a statistically significant difference in cell proliferation rate (t-test: p> 0.01).

(Example 7) Effect of cycloheximide in cells overexpressing GAS5, IDI2-AS1 and SNHG15 respectively GAS5, IDI2-AS1 or SNHG15 used in Examples 3, 4 and 5 and empty vector 2.5 μg and using Lipofectamine 2000 Reagent (Invitrogen) were respectively introduced into HEK293 cells ^{(10 6 cells / 60 mm dish} ), 37 ℃, after 4 hours incubation under 5% CO _2, 96 well cells from 60 mm dish It was replanted on a plate.
Subsequently, after incubating at 37 ° C., 5% CO ₂ for 20 hours, cycloheximide (Wako) was added to the cell culture medium at 0, 1, 10 or 100 μM. Each reagent was diluted with DMSO. Then, after incubating at 37 ° C., 5% CO ₂ conditions for 24 hours, viable cell count was performed using Cell Counting Kit-8 (Dojindo) (FIG. 7). The experiment was performed at n = 4.
As a result, in the vector into which GAS5, IDI2-AS1 or SNHG15 was inserted, the number of viable cells was reduced compared to the vector into which empty vector was introduced, especially the vector into which GAS5 was inserted It was found that the introduced cells had a statistically significant decrease in the number of viable cells when the addition amount of cycloheximide was 1 μM (t-test: p <0.01).

(Example 8) Effect of mercury chloride in cells overexpressing GAS5, IDI2-AS1, and SNHG15 respectively GAS5, IDI2-AS1 or SNHG15 used in Examples 3, 4 and 5, and empty vector 2.5 μg is introduced into HEK 293 cells (10 ⁶ cells / 60 mm dish) using Lipofectamine 2000 Reagent (Invitrogen) and incubated at 37 ° C., 5% CO ₂ for 4 hours, and then the cells are grown from 60 mm dishes to 96 mm. Replanted on a well plate.
Subsequently, the cells were incubated at 37 ° C., 5% CO ₂ for 20 hours, and 0, 0.1, 1, or 10 μg / mL of mercury chloride (Mercury (II) Chloride) was added to the cell culture. Each reagent was diluted with DMSO. Then, after incubating at 37 ° C. under 5% CO ₂ conditions for 24 hours, viable cell count was performed using Cell Counting Kit-8 (Dojindo) (FIG. 8). The experiment was performed at n = 4.
As a result, the number of viable cells was statistically higher than that of the vector into which GAS5, IDI2-AS1 or SNHG15 had been introduced at the amount of 1 μg / mL of mercury chloride introduced, respectively. It was found to be significantly decreased (t-test: p <0.01).

(Example 9) Effect of aqueous hydrogen peroxide in cells overexpressing GAS5, IDI2-AS1 and SNHG15 respectively GAS5, IDI2-AS1 or SNHG15 used in Example 3, 4 and 5 and empty vector the vector 2.5 [mu] g, respectively introduced into HEK293 cells ^{(10 6 cells / 60 mm dish} ) using Lipofectamine 2000 Reagent (Invitrogen), 37 ℃, after 4 hours incubation under 5% CO _2, the cells 60 mm dish It was replanted to 96 well plate.
Subsequently, after incubating at 37 ° C. under 5% CO ₂ for 20 hours, 0, 20, 40, 60 or 80 μM of hydrogen peroxide solution (H ₂ O ₂ ) was added to the cell culture medium. Each reagent was diluted with water. Thereafter, the cells were incubated at 37 ° C. under 5% CO ₂ for 24 hours, and then viable cell count was performed using Cell Counting Kit-8 (Dojindo) (FIG. 9). The experiment was performed at n = 4.
As a result, the number of viable cells in each of the vectors into which GAS5, IDI2-AS1 or SNHG15 was inserted was smaller than that in which the empty vector had already been introduced when the amount of hydrogen peroxide solution added was 20 μM. It was found that there was a statistically significant decrease (t-test: p <0.01).

(Example 10) Effect of ultraviolet light on cells overexpressing GAS5, IDI2-AS1 and SNHG15 respectively The vector into which GAS5, IDI2-AS1 or SNHG15 was inserted used in Example 3, 4 and 5 and empty vector 2.5 μg and using Lipofectamine 2000 Reagent (Invitrogen) were respectively introduced into HEK293 cells ^{(10 6 cells / 60 mm dish} ), 37 ℃, after 4 hours incubation under 5% CO _2, 96 well cells from 60 mm dish It was replanted on a plate.
Subsequently, the cells were incubated at 37 ° C., 5% CO ₂ for 20 hours, and the cell culture medium was irradiated with 0, 20,000, 40,000, 60,000 or 80,000 μJ / cm ² of ultraviolet light, followed by medium exchange. Then, after incubating at 37 ° C. under 5% CO ₂ conditions for 24 hours, viable cell count was performed using Cell Counting Kit-8 (Dojindo) (FIG. 10). The experiment was performed at n = 4.
As a result, for the vector into which GAS5 or IDI2-AS1 was inserted, the number of living cells was reduced compared to the vector into which empty vector was introduced, and in particular, the vector into which IDI2-AS1 was inserted In the introduced product, it was found that the number of living cells was already statistically significantly decreased at an ultraviolet intensity of 40,000 μJ / cm ² (t-test: p <0.01).

(Example 11) Effect of ultraviolet light on cells overexpressing GAS5, GAS5 and IDI2-AS1, GAS5 and SNHG15 respectively 2.5 μg of vector inserted with GAS5 used in Example 3, GAS5 used in Example 3 2.5 μg of the inserted vector and 2.5 μg of the vector into which IGIDI2-AS1 used in Example 4 was inserted, 2.5 μg of the vector into which GAS5 used in Example 3 was inserted, and SNHG15 used in Example 4 were inserted 2.5 μg of vector and 2.5 μg of empty vector were respectively introduced into HEK 293 cells (10 ⁶ cells / 60 mm dish) using Lipofectamine 2000 Reagent (Invitrogen) and incubated for 4 hours at 37 ° C., 5% CO ₂ After that, the cells were replated from a 60 mm dish to a 96 well plate.
Subsequently, the cells were incubated at 37 ° C., 5% CO ₂ for 20 hours, and the cell culture medium was irradiated with 0, 20,000, 40,000, 60,000 or 80,000 μJ / cm ² of ultraviolet light, followed by medium exchange. Then, after incubating at 37 ° C. under 5% CO ₂ conditions for 24 hours, viable cell count was performed using Cell Counting Kit-8 (Dojindo) (FIG. 11). The experiment was performed at n = 4.
As a result, the vector into which GAS5 is inserted, the vector into which GAS5 is inserted and the vector into which IDI2-AS1 is inserted, or the vector into which GAS5 is inserted and into which the vector into which SNHG15 is inserted are empty respectively A decrease in the number of living cells was observed compared to those in which the vector was introduced, and in particular, a vector into which GAS5 was inserted and a vector into which IDI2-AS1 was inserted, or a vector into which GAS5 was inserted and a vector into which SNHG15 was inserted The number of viable cells is greater than 90% when the vector into which the empty vector or the vector into which GAS5 has been introduced is introduced at 20,000 μJ / cm ² to 80,000 μJ / cm ² , respectively. It was found that the number was 50% or less and statistically significantly decreased (t-test: p <0.01). Thus, with regard to ultraviolet light, the vector into which GAS5 has been inserted and the vector into which IDI2-AS1 has been inserted, or the vector into which GAS5 has been inserted and SNHG15, as compared to those into which a vector into which GAS5 has been inserted has been introduced alone. It was found that the number of living cells was significantly reduced when the inserted vector was introduced.

(Example 12) Relationship between elapsed time after irradiation of ultraviolet light and its action in cells overexpressing GAS5, GAS5 and IDI2-AS1, GAS5 and SNHG15 respectively As in Example 11, HEK293 cells (10 ⁶ The cells were introduced into cells / 60 mm dish) and incubated at 37 ° C., 5% CO ₂ for 4 hours, and then the cells were replated from a 60 mm dish to a 96 well plate.
Subsequently, after incubating at 37 ° C. under 5% CO ₂ for 20 hours, the cell culture medium was irradiated with 80,000 μJ / cm ² of ultraviolet light. Then, after incubating at 37 ° C., 5% CO ₂ conditions for 0, 6, 24 hours, viable cell count was performed using Cell Counting Kit-8 (Dojindo) (FIG. 12). The experiment was performed at n = 4.
As a result, the vector into which GAS5 has been inserted and the vector into which IDI2-AS1 has been introduced, and into which the vector into which GAS5 has been inserted and the vector into which SNHG15 has been introduced, the vector into which an empty vector has been introduced It was found that the number of viable cells was statistically significantly decreased at 6 hours as compared to (t-test: p <0.01).

  The method of the present invention can obtain comprehensive knowledge on the influence of environmental stress on living body quickly and highly sensitively, and can be used in the field of diagnosis, inspection, research and the like for environmental stress.

Claims (12)

  By introducing an expression vector that expresses the RNA molecule of IDI2-AS1 or, in addition thereto, an RNA molecule of GAS5 in the cultured cell, the cultured cell can be highly expressed by expressing it. How to increase sensitivity to environmental stress.   The method according to claim 1, characterized in that the RNA molecule is IDI2-AS1.   The method according to claim 1, characterized in that the RNA molecule is GAS5 and IDI2-AS1.   In cultured cells, to highly express the RNA molecule of SNHG15 and the RNA molecule of GAS5, or additionally, the RNA molecule of IDI2-AS1, by introducing and expressing an expression vector that expresses the RNA molecule. A method to sensitize cultured cells to environmental stress.   The method according to any one of claims 1 to 4, wherein the environmental stress is an environmental stress caused by a chemical substance. The method according to any one of claims 1 to 4 , wherein the environmental stress is an environmental stress due to ultraviolet light.   By introducing an expression vector that expresses the RNA molecule of the RNA molecule of SNHG15 or, in addition to this, in addition to the RNA molecule of IDI2-AS1 in the cultured cell, the cultured cell can be expressed by high expression. How to increase sensitivity to environmental stress caused by chemical substances.   The method according to any one of claims 1 to 7, wherein the cultured cells are mammalian cultured cells.   The cultured cell sensitized to environmental stress by the method as described in any one of Claims 1-8.   A method for evaluating environmental stress, which comprises using the cultured cell according to claim 9.   An apparatus for evaluating environmental stress, comprising the cultured cell according to claim 9.   With regard to non-coding RNA molecules that exert environmental stress on mammalian cells and have a high degradation rate in mammalian cells, identify RNA molecules that increase their expression level, and highly express the RNA molecules in cells using expression vectors And screening the RNA molecule to sensitize the cell to environmental stress, which comprises assaying whether the cell sensitizes to environmental stress or not.

Images