JP6434704B2 - Coryneform bacteria transformed with xylooligosaccharide utilization - Google Patents

Description

  The present invention relates to a coryneform bacterium transformant that can efficiently use xylo-oligosaccharides, and more particularly to a coryneform bacterium transformant that has been subjected to a specific genetic manipulation in order to impart a function of using xylo-oligosaccharides. The present invention also relates to a highly efficient fermentation or reaction method using this transformant.

  Cellulosic biomass is useful as a raw material for producing biofuels such as organic compounds and ethanol by microbial conversion represented by fermentation. Cellulose biomass, unlike corn-based biomass such as corn starch and sugar, can be obtained at low cost in a wide variety of types such as agricultural waste, woody waste such as forest residue, and energy crops such as Susuki. . Cellulosic biomass is a raw material that will not become an obstacle to securing food resources such as grains in the future. Cellulosic biomass is composed of 35 mass% to 45 mass% cellulose, 30 mass% to 40 mass% hemicellulose, 10 mass% lignin, and 10 mass% other components. Cellulose is a polymer of glucose (C6 sugar: hexose). On the other hand, in hemicellulose, C5 sugar: pentose such as xylose and arabinose are the main constituent sugar components.

  Corn stover, wheat straw, rice straw, bagasse, etc., which are herbaceous cellulosic biomass, have high hemicellulose content, so after the pretreatment process and enzymatic saccharification process The saccharified liquid (mixed sugar) contains xylose and xylooligosaccharides derived from xylan, which is the main constituent of hemicellulose, in addition to glucose derived from cellulose (Non-Patent Document 1). Therefore, in order to make effective use of cellulosic biomass, establishment of highly efficient xylose utilization technology by microorganisms is indispensable, but hemicellulose cannot be completely decomposed in the pretreatment process and enzymatic saccharification process, so xylooligosaccharide remains. The problem is to do.

However, the industrial fermentation microorganisms used so far cannot use xylooligosaccharides. It has also been reported that xylooligosaccharide significantly inhibits cellulase in the enzymatic saccharification process (Non-Patent Paper 2).
Thus, complete decomposition of xylo-oligosaccharides is desired for effective utilization of herbaceous cellulose biomass, increased efficiency of the saccharification process, and improvement of hemicellulose decomposition efficiency. However, in order to completely decompose xylo-oligosaccharides with an enzyme, it is necessary to use a highly active cellulase or to add a xylan-degrading enzyme such as xylanase (Non-Patent Document 3), which leads to an increase in cost. Therefore, it has been desired to create a fermenting microorganism capable of directly using xylooligosaccharide, which enables reduction of the amount of enzyme used and is very advantageous in terms of cost.

Several bacteria are known that can use xylan. Xylooligosaccharides such as xylobiose and xylotriose degraded by extracellular endo-type xylanase are transported into the cell by specific transporters (transporters) present in the bacterial cell membrane, and by intracellular β-xylosidase It is broken down into D-xylose and metabolized through the pentose phosphate pathway and glycolysis. There are two known xylo-oligosaccharide transporters present in bacterial cell membranes. One is a xyloside / Na ⁺ (H ⁺⁾ symporter ^{(xyloside / Na + (H +} ) symporter), the other is a xyloside ABC transporter (xyloside ABC transporter).

A xyloside / Na ⁺ (H ⁺ ) symporter is a protein having a structure in which a peptide penetrates a cell membrane a plurality of times, and cotransports (thin port) xylo-oligosaccharides with sodium ions or protons. The xyloside / Na ⁺ (H ⁺ ) symporter (XynT) gene of Klebciella oxytoca is expressed in Escherichia coli and can be transported up to 6 units of xylosyl of the xylo-oligosaccharide (Non-Patent Document 4). In addition, the xyloside / Na ⁺ (H ⁺ ) symporter (XynT) gene of Klebciella pneumoniae is also expressed in E. coli, and it has been confirmed that it can transport 3 units of xylooligosaccharide xylosyl into cells (non-patented). Paper 5).

  The xyloside ABC transporter is a complex of a substrate binding protein, a transport protein, and an ATP binding protein. The xyloside ABC transporter requires ATP to transport xylo-oligosaccharides into cells in an energy-dependent manner. A substrate-binding protein of ABC transporter (BxlEFG) found in Streptomyces thermoviolaceus, and a substrate of ABC transporter (XynEFG) found in Thermobalaceus staerothermophilus Each of the binding proteins showed high affinity for xylo-oligosaccharide (Non-Patent Document 6 and Non-Patent Document 7).

Thus, there are two types of xylo-oligosaccharide transporters in bacterial cell membranes that can use xylo-oligosaccharides. In addition, reports have been made that these are expressed in different cells and applied to substance production. However, in the case where the isolated xyloside / Na ⁺ (H ⁺ ) symporter and xylosidase gene were expressed in E. coli, which is a heterologous cell, the ability to produce substances from xylooligosaccharides in the introduced E. coli was not sufficient (non-patented) Reference 4). In addition, the xyloside ABC transporter is in the stage of studying gene expression and transcriptional regulation in cells (Non-Patent Document 8), and is expressed in heterologous cells such as fermenting microorganisms and applied to substance production. There are no reports.

  The xylooligosaccharide transported into the cell by the transporter is broken down into monosaccharide D-xylose by β-xylosidase. Since β-xylosidase is extremely expensive, a method for producing β-xylosidase in a microorganism has been reported. For example, Patent Document 1 and Patent Document 2 disclose a method for producing β-xylosidase by extracting a β-xylosidase gene from a mold such as Aspergillus oryzae and transforming an Aspergillus strain. However, these are intended to recover D-xylose from lignocellulosic biomass by the produced enzyme.

Non-patent document 9 and Non-patent document 10 report the properties of β-xylosidase derived from bacteria, but the ratio of low ratios except for the reaction of some thermophilic β-xylosidases under high temperature conditions. There have been problems when using it as an enzyme that actually saccharifies lignocellulose, such as being active and susceptible to product inhibition by the degradation product D-xylose.
A method has been proposed in which fungal β-xylosidase such as Aspergillus oryzae is expressed on the surface of yeast, the xylooligosaccharide is decomposed into D-xylose, and D-xylose is taken into yeast and used. There was a problem that ethanol productivity was low and simultaneous use with glucose was impossible (Patent Document 3).

Here, Corynebacterium glutamicum and its recombinant strains can produce substances without growth in bioconversion reactions from sugars to organic compounds such as organic acids under anaerobic reduction conditions. It is a microorganism useful for the production (biorefinery) of chemicals and biofuels using saccharides derived from cellulosic biomass that do not compete with food as raw materials (Patent Document 4).
In the case of substance production, first, the cells (C. glutamicum) are aerobically cultured, then packed in a reaction vessel with high density, and the reaction is performed by adding a substrate under anaerobic conditions. Since it can react at high density, a compact reactor design is possible. The present inventors have disclosed a technique for producing ethanol with high efficiency by a transformant in which pyruvate decarboxylase gene and alcohol dehydrogenase gene derived from Zymomonas mobilis are introduced and expressed in Corynebacterium glutamicum (non-patent document). Reference 11).

  Furthermore, in fermentation methods using Saccharomyces cerevisiae, Zymomonas mobilis, Escherichia coli, etc., which produce substances with growth, phenols produced in pretreatment processes such as high-temperature and high-pressure treatment of cellulosic biomass before the saccharification process In addition, production inhibition by “fermentation-inhibiting substances” (growth-inhibiting substances) such as furans and organic acids is a major problem. However, our technology using Corynebacterium glutamicum allows bioconversion reaction to organic compounds such as organic acids without growth, so production inhibition by so-called “fermentation inhibitors” (growth inhibitors) (Non-patent Document 12).

  Although the wild strain of Corynebacterium glutamicum has the ability to enable bioconversion reactions with various advantages, it has been unable to utilize C5 sugars (pentoses) such as D-xylose as an original characteristic. In this regard, the inventors have disclosed a technique for imparting the availability of D-xylose by introducing and expressing the xylose isomerase gene and xylulokinase gene derived from Escherichia coli in Corynebacterium glutamicum. (Non-patent Document 13).

  However, there is a demand for the creation of microorganisms having excellent xylo-oligosaccharide utilization ability.

Japanese Patent Laid-Open No. 11-313683 Japanese Patent Publication No. 2013-59272 Japanese Patent Publication No. 2012-65604 WO01 / 96573A1

Wyman, C. E., B. E. Dale, R. T. Elander, M. R. Ladisch, Y. Y. Lee, C. Mitchinson, and J. N. Saddler. 2009. Comparative sugar recovery and fermentation data following pretreatment of poplar wood by leadingtechnologies. Biotechnol. Prog. 25: 333-339. Qing, Q., B. Yang, C. E. Wyman. 2010. Xylooligomers are strong inhibitors of cellulose hydrolysis by enzymes. Biores. Technol. 101: 9624-9630. Kumar, R., and C. E. Wyman. 2009. Effect of enzyme supplementation at moderate cellulase loadings on initial glucose and xylose release from corn stover solids pretreated by leading technologies.Biotechnol. Bioeng. 102: 457-467. Qian, Y., LP Yomano, JF Preston, HC Aldrich, and LO Ingram. 2003. Cloning, Characterization, and Functional Expression of the Klebsiella oxytoca Xylodextrin Utilization Operon (xynTB) in Escherichia coli. Appl Environ Microbiol. 69: 5957-5967 . Shin, H.-D., S. McClendon, T. Vo, and R. R. Chen. 2010. Escherichia coli Binary Culture Engineered for Direct Fermentation of Hemicellulose to a Biofuel. Appl Environ Microbiol. 76: 8150-8159 Tsujibo, H., M. Kosaka, S. Ikenishi, T. Sato, K. Miyamoto, and Y. Inamori. 2004. Molecular Characterization of a High-Affinity Xylobiose Transporter of Streptomyces thermoviolaceus OPC-520 and Its Transcriptional Regulation. J Bacteriol 186: 1029-1037. Shulami, S., G. Zaide, G. Zolotnitsky, Y. Langut, G. Feld, AL Sonenshein, and Y. Shoham. 2007. A two-component system regulates the expression of an ABC transporter for xylo-oligosaccharides in Geobacillus stearothermophilus J. Bacteriol. 73: 874-884. Andersen JM, Barrangou R, Abou Hachem M, Lahtinen SJ, Goh YJ, Svensson B, Klaenhammer TR., BMC Genomics. 2013 May 10; 14: 312.doi: 10.1186 / 1471-2164-14-312.Transcriptional analysis of oligosaccharide utilization by Bifidobacterium lactis Bl-04. Pinphanichakarn, P., T. Tangsakul, T. Thongnumwon, Y. Talawanich, and A. Thamchaipenet. 2004. Purification and characterization of beta-xylosidase from Streptomyces sp. CH7 and its gene sequence analysis. World J. Microbiol. Biotechnol. 20 : 727-733. Bachmann, S.L., and A.J.McCarthy.1989.Purification and characterization of a thermostable beta-xylosidase from Thermomonospora fusca.J.Gen.Microbiol.135: 293-299. Journal of Molecular Microbiology and Biotechnology, Vol. 8, 244-254. (2004). Applied and Environmental Microbiology, Vol.73, 2349-2353 (2007). Applied and Environmental Microbiology, Vol.72, 3418-3428 (2006).

  An object of the present invention is to provide a recombinant microorganism having an excellent function of using xylooligosaccharides necessary for effective utilization of cellulosic biomass resources, and a highly efficient method for producing an organic compound using the microorganism. .

In order to solve the above problems, the present inventor has been researched and created by introducing a foreign gene encoding a protein having xylo-oligosaccharide transport ability and a foreign gene encoding β-xylosidase into coryneform bacteria. It was found that the transformant efficiently produces an organic compound from xylooligosaccharide.
In addition, the introduction of the two foreign genes greatly improves the rate of utilization of xylooligosaccharides in the host coryneform bacterium, and D-glucose and xylooligosaccharides in the presence of both D-glucose and xylooligosaccharides. We found that it can be used in parallel and simultaneously.

The present invention has been completed based on the above findings, and provides the following transformants and methods for producing organic compounds.
Item 1. To the coryneform bacterium of the host, (A) a foreign gene encoding a protein having a xylo-oligosaccharide transporting ability that enables uptake of xylo-oligosaccharide from outside the cell into the cell, and (B) a protein having β-xylosidase activity. A coryneform bacterium transformant into which a foreign gene to be encoded has been introduced.
Item 2. Item 2. The coryneform bacterium transformant according to item 1, wherein the protein having xylooligosaccharide transport ability is an ABC transporter type transporter protein.
Item 3. A foreign gene encoding an ABC transporter type xylo-oligosaccharide transporter protein is
(a) DNA consisting of the base sequence of SEQ ID NO: 1, or
(b) DNA consisting of a base sequence having at least 90% homology with SEQ ID NO: 1 or DNA hybridizing under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 1, comprising ABC Item 3. The coryneform bacterium transformant according to Item 2, which is a DNA encoding a protein having a transporter-type transporter function.
Item 4. Item 2. The coryneform bacterium transformant according to item 1, wherein the xylo-oligosaccharide transporter that enables uptake of the xylo-oligosaccharide from outside the cell into the cell is a symporter-type transporter protein.
Item 5. A foreign gene encoding a symporter-type xylooligosaccharide transporter protein
(c) DNA consisting of the base sequence of SEQ ID NO: 2, or
(d) DNA consisting of a base sequence having at least 90% homology with SEQ ID NO: 2 or DNA hybridizing under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 2, Item 5. The coryneform bacterium transformant according to Item 4, which is a DNA encoding a protein having a porter-type transporter function.
Item 6. Item 2. The coryneform bacterium transformant according to Item 1, wherein the protein having xylooligosaccharide transport ability is an ABC transporter type transporter protein and a symporter type transporter protein.
Item 7. A foreign gene encoding an ABC transporter type xylo-oligosaccharide transporter protein is
(a) DNA consisting of the base sequence of SEQ ID NO: 1, or
(b) DNA consisting of a base sequence having at least 90% homology with SEQ ID NO: 1 or DNA hybridizing under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 1, comprising ABC DNA encoding a protein having a transporter type transporter function,
A foreign gene encoding a symporter-type xylooligosaccharide transporter protein
(c) DNA consisting of the base sequence of SEQ ID NO: 2, or
(d) DNA consisting of a base sequence having at least 90% homology with SEQ ID NO: 2 or DNA hybridizing under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 2, Item 7. The coryneform bacterium transformant according to item 6, which is a DNA encoding a protein having a porter-type transporter function.
Item 8. A foreign gene encoding a protein having β-xylosidase activity is
(e) DNA consisting of the base sequence of SEQ ID NO: 3, or
(f) DNA consisting of a base sequence having at least 90% homology with SEQ ID NO: 3 or DNA hybridizing under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 3, Item 8. A coryneform bacterium transformant according to any one of Items 1 to 7, which is a DNA encoding a protein having xylosidase activity.
Item 9. Item 9. The coryneform bacterium transformant according to any one of Items 1 to 8, wherein a foreign gene encoding a protein having an ATP-binding site is introduced.
Item 10. A foreign gene encoding a protein having an ATP-binding site is
(g) DNA consisting of the base sequence of SEQ ID NO: 4, or
(h) DNA consisting of a base sequence having at least 90% homology with SEQ ID NO: 4 or DNA hybridizing under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 4, comprising ATP Item 10. The coryneform bacterium transformant according to Item 9, which is a DNA encoding a protein having a binding site.
Item 11. Item 11. The coryneform bacterium transformant according to any one of Items 1 to 10, wherein the host coryneform bacterium is a coryneform bacterium having D-xylose utilization ability.
Item 12. Item 12. The coryneform bacterium transformant according to item 11, wherein the coryneform bacterium having D-xylose utilization ability is a transformant into which a foreign gene encoding xylose isomerase and a foreign gene encoding xylulokinase are introduced.
Item 13. Item 13. The coryneform bacterium transformant according to any one of Items 1 to 12, wherein the host coryneform bacterium is a transformant into which a foreign gene encoding a proton symporter of the L-arabinose transport system has been introduced.
Item 14. Corynebacterium glutamicum Ind-araE / pCRA811 (Accession number NITE BP-576), Corynebacterium glutamicum X5-Ind-araE / Plac-araBAD (Accession number NITE BP-577), Corynebacterium Item 14. The coryneform bacterium transformant according to Item 13, which is Glutamicum X5-Ind-araE-Δldh / pEthAra (Accession No. NITE BP-581).
Item 15. A foreign gene encoding an ABC transporter-type xylo-oligosaccharide transporter and a foreign gene encoding a protein having an ATP-binding site have been introduced, and these foreign genes are independently independent of Corynebacterium alkanolyticum. (Corynebacterium alkanolyticum), Microbacterium testaceum, Arthrobacter phenanthrenivorans, Cellulomonas flavigena, Bifidobacterium longum, Streptomyces cerevisiae Item 15. The coryneform bacterium transformant according to any one of Items 1 to 3 and 6 to 14, which is a gene derived from (Streptomyces thermoviolaceus) or Geobacillus staerothermophilus.
Item 16. A foreign gene that encodes a symporter-type xylooligosaccharide transporter has been introduced, and this foreign gene can be Clostridium acetobutylycum, Lactobacillus brevis, Bacillus subtilis, or Klebsiella oxytoca Item 16. A coryneform bacterium transformant according to any one of Items 1 and 3 to 15, which is a gene derived from oxytoca).
Item 17. Foreign genes encoding β-xylosidase include Corynebacterium alkanolyticum, Microbacterium testaceum, Arthrobacter phenanthrenivorans, Cellulomonas flavigena, Bifidobacterium longum, Streptomyces scabiei, Clostridium acetobutylicum, Clostridium cellulolyticum, Lactobacillus rhamnosus lus, Lactobacillus rhamnosus Polymixer (Paenibacillus polymyxa) or Geobacillus thermoleovorans (Geobacillus thermoleovorans) The coryneform bacterium transformant according to any one of Items 1 to 16, which is a gene derived from
Item 18. Item 18. The coryneform bacterium transformant according to any one of Items 1 to 17, wherein the coryneform bacterium transformant is Corynebacterium glutamicum XYD9 (Accession No. NITE P-01812).
Item 19. The step of reacting the coryneform bacterium transformant according to any one of Items 1 to 18 in a reaction solution containing xylooligosaccharide or containing xylooligosaccharide and glucose; and a step of recovering an organic compound from the culture; The manufacturing method of the organic compound containing this.
Item 20. Item 20. The method according to Item 19, wherein the organic compound is at least one selected from the group consisting of amino acids, organic acids, alcohols, nucleic acids, physiologically active substances, and organic gases.
Item 21. Item 21. The method according to Item 19 or 20, wherein the reaction is carried out in a reaction solution under reducing conditions.
Item 22. Item 22. The method according to Item 21, wherein the reaction solution under reducing conditions has a redox potential of -200 mV to -500 mV.

Coryneform bacteria can produce substances in a state where growth is stopped, so that useful substances can be produced without consuming nutrients necessary for growth, and growth inhibition is not affected by the product, making it more compact. It is a useful microorganism that has the merit that the reactor can be designed. However, coryneform bacteria originally cannot use xylo-oligosaccharides, and thus cannot be used for substance production from a saccharified solution of cellulosic biomass containing a large amount of xylo-oligosaccharides. In this respect, since the transformant of the present invention is a coryneform bacterium and can efficiently produce an organic compound using xylo-oligosaccharide, it is extremely useful for efficiently producing a substance from a saccharified solution of cellulosic biomass. Microbial.
In addition, the coryneform bacterium transformant of the present invention completely cancels glucose suppression for xylo-oligosaccharide utilization, and can use D-glucose and xylo-oligosaccharide in parallel and simultaneously.
In the present specification, the coryneform bacterium transformant means that “D-glucose and xylooligosaccharide can be used in parallel and simultaneously” or “having simultaneous availability (ability)” means D-glucose and xylooligo When an organic compound is produced using the transformant of the present invention in a medium containing a mixed sugar of carbon as a carbon source, one of the sugars is consumed first and then the other sugar starts to be consumed. Means not.

  In general, microorganisms including coryneform bacteria preferentially consume D-glucose and begin consuming other sugars later or later when multiple sugars are present. However, since the cellulosic biomass has a high hemicellulose content, the saccharified solution after pretreatment and enzymatic saccharification contains xylan and xylo-oligosaccharides derived from xylan, which is the main component of hemicellulose, in addition to glucose derived from cellulose. Accordingly, when an organic compound is produced from a saccharified liquid of cellulosic biomass by a microorganism that consumes glucose preferentially, in general, xylooligosaccharide is consumed behind the consumption of glucose, and the production efficiency or the utilization efficiency of the raw material is increased. bad. In this respect, since the transformant of the present invention can efficiently use xylooligosaccharide and glucose in parallel and simultaneously, an organic compound can be efficiently produced using a saccharified solution of cellulosic biomass as a raw material.

  Therefore, the transformant of the present invention is extremely useful for efficiently producing biochemicals and biofuels from non-edible biomass such as agricultural residues and woody biomass.

It is a figure which shows the structure of each vector used in the Example. It is a figure which shows the proliferation on the aerobic condition of the transformant produced in the Example. It is a figure which shows the LC-ESIMS analysis result of the culture supernatant of the transformant produced in the Example. It is a figure which shows the sugar consumption of the transformant produced in the Example. It is a figure which shows the sugar consumption of the transformant produced in the Example. It is a figure which shows the LC-ESIMS analysis result of the culture supernatant of the transformant produced in the Example. It is a figure which shows the sugar consumption of the transformant produced in the Example. It is a figure which shows the LC-ESIMS analysis result of the culture supernatant of the transformant produced in the Example.

Hereinafter, the present invention will be described in detail.
(I) Transformant The transformant of the present invention is an exogenous protein encoding a protein having a xylooligosaccharide transport ability that allows the host coryneform bacterium to take up (A) xylooligosaccharide from outside the cell into the cell. A coryneform bacterium transformant into which a gene and a foreign gene encoding (B) a protein having β-xylosidase activity have been introduced.

A host coryneform bacterium is a group of microorganisms defined in the Bargeys Manual of Determinative Bacteriology, Vol. 8, 599 (1974), and is under normal aerobic conditions. If it grows in, it will not be specifically limited. Specific examples include Corynebacterium, Brevibacterium, Arthrobacter, Mycobacterium, Micrococcus, and the like. Among the coryneform bacteria, the genus Corynebacterium is preferable.

  Corynebacterium glutamicum, Corynebacterium efficiens, Corynebacterium ammoniagenes, Corynebacterium halotolerance, Corynebacterium alkanolyticum (Corynebacterium) alkanolyticum) and the like. Of these, Corynebacterium glutamicum is preferable because it is safe and has high availability of xylooligosaccharides. Corynebacterium glutamicum R strain (FERM P-18976), ATCC13032 strain, ATCC13869 strain, ATCC13058 strain, ATCC13059 strain, ATCC13060 strain, ATCC13232 strain, ATCC13286 strain, ATCC13287 strain, ATCC13655 strain, ATCC13745 Strains, ATCC13746 strain, ATCC13761 strain, ATCC14020 strain, ATCC31831 strain, MJ-233 (FERM BP-1497), MJ-233AB-41 (FERM BP-1498) and the like. Among these, R strain (FERM P-18976), ATCC13032 strain, and ATCC13869 strain are preferable.

  Depending on the molecular biological classification, coryneforms such as Brevibacterium flavum, Brevibacterium lactofermentum, Brevibacterium divaricatum, Corynebacterium lilium, etc. The name of the bacterium is the same as Corynebacterium glutamicum [Liebl, W. et al., Transfer of Brevibacterium divaricatum DSM 20297T, "Brevibacterium flavum" DSM 20411, "Brevibacterium lactofermentum" DSM 20412 and DSM 1412 , and Corynebacterium glutamicum and their distinction by rRNA gene restriction patterns. Int J Syst Bacteriol. 41: 255-260. (1991), Komagata Kazuo et al., Classification of coryneform bacteria, Fermentation and industry, 45: 944-963 (1987) ].

Examples of the genus Brevibacterium include Brevibacterium ammoniagenes (for example, ATCC6872 strain).
Examples of the genus Arthrobacter include Arthrobacter globiformis (for example, ATCC 8010 strain, ATCC 4336 strain, ATCC 21056 strain, ATCC 31250 strain, ATCC 31738 strain, ATCC 35698 strain) and the like.
Examples of the genus Mycobacterium include Mycobacterium bovis (for example, ATCC19210 strain, ATCC27289 strain).
Examples of the genus Micrococcus include Micrococcus freudenreichii (for example, No. 239 strain (FERM P-13221)), Micrococcus leuteus (for example, No. 240 strain (FERM P-13222)), Examples include Micrococcus ureae (for example, IAM1010 strain), Micrococcus roseus (for example, IFO3764 strain), and the like.

Wild strains of coryneform bacteria cannot use pentoses such as D-xylose. The host coryneform bacterium preferably has D-xylose availability so that various organic compounds can be efficiently produced from xylose produced from xylooligosaccharides by the action of β-xylosidase.
The method for imparting D-xylose utilization ability to coryneform bacteria is not particularly limited, and examples thereof include a method for introducing a D-xylose metabolism-related gene derived from another species into the coryneform bacteria.

  Metabolism of D-xylose to D-xylulose-5-phosphate in prokaryotes and some molds specifically includes xylose isomerase (xylA), which catalyzes the reaction from D-xylose to D-xylulose, and D -Performed by two enzyme-catalyzed reactions of xylulokinase (xylB) that catalyze the reaction of xylulose to D-xylulose-5-phosphate. By introducing each gene encoding these enzymes into coryneform bacteria, the ability to use D-xylose is imparted to the coryneform bacteria.

  For example, the present inventors have already introduced xylA gene and xylB gene derived from Escherichia coli as D-xylose metabolism-related genes into coryneform bacteria, and expressed them, thereby using D-xylose. A technology for imparting performance is disclosed (Appl. Environ. Microbiol. Vol.72, 3418-3428 (2006)). In the present invention, a coryneform bacterium to which D-xylose utilization ability produced by such a technique is imparted can be used. For example, as a method for imparting D-xylose utilization ability, a transformant into which a gene derived from a species other than the above Escherichia coli is introduced may be used.

  The xylA gene and the xylB gene are usually held in microorganisms having the ability to metabolize D-xylose. As the xylA gene and the xylB gene, Escherichia coli, Corynebacterium glutamicum (having only the xylB gene), Bacillus subtilis, Salmonella typhimurium, Bacillus halodurans (Bacillus halodurans) ), Sinorhizobium meliloti, and Agrobacterium tumefaciens, preferably derived from a microorganism selected from the group consisting of Agrobacterium tumefaciens. Among these, an xylA gene derived from Escherichia coli (for example, a gene consisting of the amino acid sequence of SEQ ID NO: 24) and an xylB gene (for example, a gene consisting of the amino acid sequence of SEQ ID NO: 25) are more preferable.

  In addition, in the amino acid sequence of xylA or xylB derived from these microorganisms, 1 to several (usually 1 to 5, preferably 1 to 3, more preferably 1 to 2) amino acids are deleted, added, Alternatively, a gene encoding an analog having a substituted amino acid sequence and having xylose isomerase activity or xylulokinase activity can also be used.

  The host coryneform bacterium preferably has a normally functioning glycolytic pathway and a pentose phosphate pathway in order to produce various organic compounds. Furthermore, it is preferable to contain an enzyme for converting pyruvic acid into a desired fermentation product such as succinic acid, acetic acid or lactic acid. Furthermore, it is preferable to have high resistance to ethanol; organic acids such as lactic acid, acetic acid, formic acid and the like; and sugar degradation products such as furfural and hydroxymethylfurfural. From this point, as the coryneform bacterium used in the present invention, Corynebacterium glutamicum R (FERM BP-18976), Corynebacterium glutamicum ATCC31831, or the like is preferable.

  These coryneform bacteria may be wild-type mutants that exist in nature, or artificial genetically modified strains. Examples of wild-type mutants include cellobiose-utilizing mutants such as FERM P-18977 and FERM P-18978 (Japanese Patent Application Laid-Open No. 2004-089029). As artificial genetically modified strains, ethanol-producing recombinant strains FERM P-17887 (FERM P-17887 is the same strain as FERM BP-7621), FERM P-17888 (FERM P-17888 is FERM BP And the strain described in J. Mol. Microbiol. Biotechnol., Vol 8, 243-254 (2004), that is, FERM P-19361 and FERM P-19362 described in Japanese Patent No. 4294735, etc. FERM P-18979 which is a recombinant cellobiose (JP-A-2004-089029), etc .; FERM P-19446 which is a succinic acid-producing recombinant strain (FERM P-19446 is the same strain as FERM BP-10060); ) And FERM P-19477 (FERM P-19477 is the same strain as FERM BP-10061). FERM P-19361 and FERM P-19362 are transformants obtained by introducing pyruvate decarboxylase gene and alcohol dehydrogenase gene derived from Zymomonas mobilis into Corynebacterium glutamicum.

  Further, Corynebacterium glutamicum R (FERM BP-18976), cellobiose-utilizing recombinant strain or mutant strain (FERM P-18979, FERM P-18977 and FERM P-18978), succinic acid-producing recombinant strain (FERM P- 19446 and FERM P-19477), and ethanol-producing recombinant strains (FERM P-17887 (FERM BP-7621), FERM P-17888 (FERM BP-7622) and J. Mol. Microbiol. Biotechnol., Vol 8,243-254 It is preferably a strain selected from the group consisting of the strains described in (2004) (that is, FERM P-19361 and FERM P-19362) and imparted with D-xylose availability. A particularly preferred coryneform bacterium in the present invention is Corynebacterium glutamicum R (FERM BP-18976) to which D-xylose utilization ability is imparted.

  In addition, since the saccharified solution after pretreatment and enzymatic saccharification of cellulosic biomass contains a large amount of xylose in addition to xylooligosaccharide, the host coryneform bacterium is a bacterium whose D-xylose uptake ability is improved from that of the wild type. It is preferable that As a bacterium having improved D-xylose uptake ability, a bacterium introduced with a foreign gene encoding an L-arabinose transport system proton symporter is preferable. The proton symporter gene of the L-arabinose transport system is known and is called araE. In bacteria, araE gene sequences and enzyme properties have been reported in the following strains and the like. Corynebacterium glutamicum (reissue 2009-154122), Bacillus subtilis (J. Bacteriol., Vol. 179, 7705-7711 (1997)), Klebsiella oxytoca 8017 [J. Bacteriol., Vol. 177, 5379-5380 (1995)], Escherichia coli [J. Biol. Chem., Vol. 263, 8003-8010 (1988)].

  The exogenous gene encoding a protein having proton symporter activity of L-arabinose transport system is derived from a microorganism selected from the group consisting of Corynebacterium glutamicum, Escherichia coli, Bacillus subtilis, Klebsiella oxytoca, and Salmonella typhimurium The araE gene is preferred, and the araE gene derived from Corynebacterium glutamicum is preferred.

  Among them, it hybridizes under stringent conditions with DNA consisting of the base sequence of SEQ ID NO: 26 derived from Corynebacterium glutamicum ATCC31831, or DNA consisting of a base sequence complementary to SEQ ID NO: 26, and the proton of the L-arabinose transport system It is preferable to use DNA encoding a protein having a symporter function.

  Corynebacterium glutamicum Ind-araE / pCRA811 (NITE BP-576), Corynebacterium glutamicum X5-Ind-araE as strains into which the araE gene derived from Corynebacterium glutamicum and the xylA gene and xylB gene derived from Escherichia coli were introduced. / Plac-araBAD (NITE BP-577) (all of which are independent administrative corporations Product Evaluation Technology Infrastructure Japan Patent Biological Deposit Center (2-5-8 Kazusa Kamashi, Kisarazu City, Chiba Prefecture, Japan zip code 292-0818)) Deposit date: May 28, 2008), and Corynebacterium glutamicum X5-Ind-araE-Δldh / pEthAra (NITE BP-581) (National Institute of Technology and Evaluation, Patent Biology Center) (Date of trust: June 4, 2008). These coryneform bacterial transformants use D-glucose and D-xylose in parallel and simultaneously.

Gene of protein having ability to transport xylooligosaccharide In order to enable the transformant of the present invention to incorporate xylooligosaccharide from outside the cell into the cell, a foreign gene encoding a protein having ability to transport xylooligosaccharide has been introduced. ing. As described above, as a protein having a xylo-oligosaccharide transport ability, a xyloside ABC transporter (hereinafter sometimes referred to as “ABC transporter-type transporter protein”) and a xyloside / Na ⁺ (H ⁺ ) symporter (hereinafter, Sometimes referred to as “symporter-type transporter protein”).

  ABC transporter protein genes include Corynebacterium alkanolyticum, Microbacterium testaceum, Arthrobacter phenanthrenivorans, Cellulomonas flavigena (Cellulomonas flavigena) ), Bifidobacterium longum, Streptomyces thermoviolaceus, or Geobacillus staerothermophilus, more preferably a gene from Corynebacterium alkanolyticum preferable.

The foreign gene encoding the ABC transporter type xylo-oligosaccharide transporter protein is:
(a) DNA consisting of the base sequence of SEQ ID NO: 1, or
(b) a stringent condition with DNA comprising a nucleotide sequence having 90% or more identity with SEQ ID NO: 1, in particular 95% or more, in particular 98% or more, or DNA comprising a nucleotide sequence complementary to SEQ ID NO: 1 A DNA that hybridizes with DNA and that encodes a protein having an ABC transporter type transporter function is preferable.
In the present invention, the transporter function of the ABC transporter is such that Corynebacterium glutamicum expressing xylA gene and xylB gene derived from Escherichia coli and β-xylosidase gene derived from Corynebacterium alkanolyticum is used as a target gene. The resulting transformant is cultured in a medium containing xylooligosaccharide, and consumption of xylobiose is monitored by HPLC. When xylobiose consumption is detected, it is determined to have this function.

  The gene of the symporter transporter protein is preferably a gene derived from Clostridium acetobutylycum, Lactobacillus brevis, Bacillus subtilis, or Klebsiella oxytoca. More preferred.

The foreign gene encoding the symporter type xylooligosaccharide transporter protein is
(c) DNA consisting of the base sequence of SEQ ID NO: 2, or
(d) DNA having a nucleotide sequence having 90% or more, particularly 95% or more, particularly 98% or more, or DNA having a complementary nucleotide sequence to SEQ ID NO: 2 and stringent conditions A DNA that hybridizes with a DNA encoding a protein having a symporter-type transporter function is preferable.
In the present invention, the symporter-type transporter function is obtained by expressing a target gene in Corynebacterium glutamicum in which an xylA gene and an xylB gene derived from Escherichia coli and a β-xylosidase gene derived from Corynebacterium alkanolyticum are expressed. The obtained transformant is cultured in a medium containing xylooligosaccharide, and consumption of xylobiose is monitored by HPLC. When xylobiose consumption is detected, it is determined that this function is possessed.

The transformant of the present invention is preferably further introduced with a foreign gene encoding a protein having an ATP-binding site, so that an organic compound can be produced more efficiently using xylooligosaccharides. Become.
In particular, the ABC transporter type transporter protein requires a protein having an ATP-binding site. When the protein having xylo-oligosaccharide transport ability is an ABC transporter type transporter protein, a protein having a host ATP-binding site can be used, but a foreign gene encoding a protein having an ATP-binding site is introduced. It is preferable to do.

  Examples of genes for proteins having an ATP-binding site include Clostridium acetobutylicum, Microbacterium testaceum, Arthrobacter phenanthrenivorans, Cellulomonas flavigena (Cellulomonas flavigena). ), Bifidobacterium longum, Streptomyces thermoviolacens, or Geobacillus stearothermophilus, more preferably a gene from Corynebacterium alkanolyticum preferable.

A foreign gene encoding a protein having an ATP-binding site is:
(g) DNA consisting of the base sequence of SEQ ID NO: 4, or
(h) DNA having a nucleotide sequence having 90% or more, particularly 95% or more, particularly 98% or more of SEQ ID NO: 4 or DNA having a nucleotide sequence complementary to SEQ ID NO: 4 under stringent conditions A DNA that hybridizes with a DNA encoding a protein having an ATP-binding site is preferred.
In the present invention, whether or not it has an ATP-binding site is determined by determining whether the Escherichia coli-derived xylA and xylB genes, the Corynebacterium alkanolyticum-derived β-xylosidase gene, and the Corynebacterium alkanolyticum-derived ABC transporter The target gene is expressed in Corynebacterium glutamicum in which the gene encoding the type of xylooligosaccharide transporter protein is expressed, and the resulting transformant is cultured in a medium containing xylooligosaccharide and the consumption of xylobiose is monitored by HPLC. When an increase in the xylobiose consumption rate is detected, it is determined to have an ATP-binding site.

  The gene encoding a protein having xylooligosaccharide transport ability to be introduced into the host may be an ABC transporter type transporter protein gene or a symporter type transporter protein gene.

  Examples of xylooligosaccharides include xylobiose composed of two xylose units, xylotriose composed of three xylose units, xylose tetraose composed of four xylose units, and arabinoxylooligosaccharides having three to six xylose units. , Including a variety of things. The ABC transporter type transporter protein has a slow uptake rate of xylooligosaccharides, but there are many types of xylooligosaccharides that can be taken up. On the other hand, the symporter-type transporter protein has a fast xylooligosaccharide uptake rate, but has few types of xylooligosaccharides. Therefore, it is also preferable to introduce both the ABC transporter type transporter protein gene and the symporter type transporter protein gene.

β-xylosidase β-xylosidase is preferably resistant to feedback inhibition by xylose. Examples of such β-xylosidase include Corynebacterium alkanolyticum, Microbacterium testaceum, Arthrobacter phenanthrene renibolans, Cellulomonas flavigena, Bifidobacterium longum, Streptomyces scabiei, Clostridium acetobutylicum, Clostridium cellulolyticum, Lactobacillus rhamnosus, Lactobacillus brevis, Paenibacillus polymyxa, or Geobacillus thermoreoboles (Gobacillus thermoranoles) Of these, the β-xylosidase gene derived from Corynebacterium alkanolyticum is preferable.

The foreign gene encoding β-xylosidase is
(e) DNA consisting of the base sequence of SEQ ID NO: 3, or
(f) DNA having a nucleotide sequence having 90% or more, particularly 95% or more, particularly 98% or more, or DNA having a complementary nucleotide sequence to SEQ ID NO: 3 and stringent conditions A DNA that hybridizes with a DNA encoding a protein having β-xylosidase activity is preferable.
In the present invention, β-xylosidase activity is determined by using 100 μg of crude enzyme extracted from Corynebacterium glutamicum expressing the target gene using 100 mM Tris-HCl (pH 7.5) buffer, and 1 ml of 100 mM Tris-HCl. (pH 7.5) The reaction solution was reacted with p-nitrophenyl β-xylopyranoside at a final concentration of 1 mM at 33 ° C. for 10 minutes in the reaction solution, and the absorbance at 410 nm of the reaction solution was measured. Determined to have xylosidase activity.

  In the present invention, “stringent conditions” refers to hybridization in a 6 × SSC salt concentration hybridization solution at a temperature of 50 to 60 ° C. for 16 hours in a 0.1 × SSC salt concentration solution. This is the condition for cleaning.

  In the present invention, the identity between base sequences is calculated using the calculation software GENETYX (registered trademark) Ver. It is a value calculated using 8 (manufactured by Genetics).

  In order to improve the productivity of organic compounds, the coryneform bacterium transformant created by the present invention increases the flow rate of the pentose phosphate pathway, increases resistance to ethanol, osmotic pressure, or organic acids, and byproducts (objects). Can further include genetic modifications that produce one or more of the characteristics such as reduced production (understood to mean carbon-containing molecules other than the product of Such genetic modification can be specifically introduced by overexpression of a foreign gene and / or inactivation of an endogenous gene; classical mutagenesis; screening and / or selection of a target mutant. .

  The coryneform bacterium transformant of the present invention can produce various organic compounds such as amino acids, organic acids, alcohols, nucleic acids, physiologically active substances, and organic gases as fermentation products using xylo-oligosaccharides as a raw material.

(II) Organic Compound Production Method The above-described coryneform bacterium transformant of the present invention is reacted in a reaction solution containing xylooligosaccharide, or containing xylooligosaccharide and glucose or an oligomer or polymer composed of glucose units. An organic compound or fermentation product can be produced by a method comprising a step and a step of recovering the organic compound or fermentation product from the culture.

Prior to the reaction in the reaction solution containing xylo-oligosaccharides of microorganisms , the transformants are preferably cultured and grown at a temperature of about 25 to 38 ° C. for about 12 to 48 hours under aerobic conditions.

As a medium used for aerobic culture of the transformant prior to the culture medium reaction, a natural medium or a synthetic medium containing a carbon source, a nitrogen source, inorganic salts, and other nutrient substances can be used.
As carbon sources, sugars (monosaccharides such as glucose, fructose, mannose, xylose, arabinose, galactose; disaccharides such as sucrose, maltose, lactose, cellobiose, xylobiose, trehalose; polysaccharides such as starch; molasses etc.), Sugar alcohols such as mannitol, sorbitol, xylitol, glycerin; organic acids such as acetic acid, citric fermentation, lactic acid, fumaric acid, maleic acid, and gluconic acid; alcohols such as ethanol and propanol; hydrocarbons such as normal paraffin Can also be used.
A carbon source can be used individually by 1 type or in mixture of 2 or more types.

As the nitrogen source, inorganic or organic ammonium compounds such as ammonium chloride, ammonium sulfate, ammonium nitrate and ammonium acetate, urea, aqueous ammonia, sodium nitrate, potassium nitrate and the like can be used. Further, corn steep liquor, meat extract, peptone, NZ-amine, protein hydrolyzate, nitrogen-containing organic compounds such as amino acids, and the like can also be used. A nitrogen source can be used individually by 1 type or in mixture of 2 or more types. The concentration of the nitrogen source in the medium varies depending on the nitrogen compound used, but is usually about 0.1 to 10 (w / v%).
Examples of inorganic salts include monopotassium phosphate, dipotassium phosphate, magnesium sulfate, sodium chloride, ferrous nitrate, manganese sulfate, zinc sulfate, cobalt sulfate, and calcium carbonate. One inorganic salt can be used alone, or two or more inorganic salts can be mixed and used. The concentration of inorganic salts in the medium varies depending on the inorganic salt used, but is usually about 0.01 to 1 (w / v%).

Examples of nutritional substances include meat extract, peptone, polypeptone, yeast extract, dry yeast, corn steep liquor, skim milk powder, defatted soy hydrochloride hydrolyzate, extracts of animals and plants or microbial cells, and degradation products thereof. The concentration of the nutrient substance in the medium varies depending on the nutrient substance to be used, but is usually about 0.1 to 10 (w / v%).
Furthermore, vitamins can be added as necessary. Examples of vitamins include biotin, thiamine (vitamin B1), pyridoxine (vitamin B6), pantothenic acid, inositol, nicotinic acid and the like.
The pH of the medium is preferably about 6-8.

  A specific preferable medium for coryneform bacteria is A medium [Inui, M. et al., Metabolic analysis of Corynebacterium glutamicum during lactate and succinate productions under oxygen deprivation conditions.J. Mol. Microbiol. Biotechnol. 7: 182- 196 (2004)), BT medium (Omumasaba, CA et al., Corynebacterium glutamicum glyceraldehyde-3-phosphate dehydrogenase isoforms with opposite, ATP-dependent regulation. J. Mol. Microbiol. Biotechnol. 8: 91-103 (2004)) Etc. In these media, the saccharide concentration may be used within the above range.

As the reaction solution, a natural reaction solution or a synthetic reaction solution containing a carbon source containing xylooligosaccharide, a nitrogen source, inorganic salts, and the like can be used.
The carbon source includes xylo-oligosaccharide, but can also include D-glucose in addition to xylo-oligosaccharide. In addition to xylo-oligosaccharides, oligomers or polymers composed of D-glucose units such as maltose, cellulose, and starch can also be included. In order to liberate D-glucose units from such carbohydrates, an appropriate carbohydrate degrading enzyme (alpha glucosidase, glucanase, amylase, etc.) may be added to the reaction medium, producing this enzyme in coryneform bacterial transformants. You may let them.

The reaction medium may contain carbon sources other than xylo-oligosaccharides, D-glucose, oligomers or polymers that produce D-glucose. Such a carbon source may be any sugar that can be used by the coryneform bacterium transformant of the present invention, but is a monosaccharide such as fructose, mannose, arabinose, galactose; sucrose, lactose, cellobiose, trehalose, etc. Disaccharide; molasses etc. are mentioned. In addition, non-edible agricultural waste such as rice straw, bagasse and corn stover, and multiple sugars such as glucose, xylose and xylooligosaccharides obtained by saccharifying energy crops such as switchgrass, napiergrass and miscanthus with saccharifying enzymes A saccharified solution containing can also be used.
As a carbon source, in addition to sugars, sugar alcohols such as mannitol, sorbitol, xylitol, and glycerin; organic acids such as acetic acid, fermentation, lactic acid, fumaric acid, maleic acid, and gluconic acid; alcohols such as ethanol and propanol Hydrocarbons such as normal paraffin can also be used.
A carbon source can be used individually by 1 type or in mixture of 2 or more types.
The concentration of the saccharide in the reaction solution is preferably about 1 to 20 (w / v%), more preferably about 2 to 10 (w / v%), and still more preferably about 2 to 5 (w / v%). .
Moreover, what is necessary is just to make the density | concentration in the reaction liquid of all the carbon sources containing saccharides normally about 2-5 (w / v%).

As the nitrogen source, inorganic or organic ammonium compounds such as ammonium chloride, ammonium sulfate, ammonium nitrate and ammonium acetate, urea, aqueous ammonia, sodium nitrate, potassium nitrate and the like can be used. Further, corn steep liquor, meat extract, peptone, NZ-amine, protein hydrolyzate, nitrogen-containing organic compounds such as amino acids, and the like can also be used. A nitrogen source can be used individually by 1 type or in mixture of 2 or more types. The concentration of the nitrogen source in the reaction solution varies depending on the nitrogen compound used, but is usually about 0.1 to 10 (w / v%).
Examples of inorganic salts include monopotassium phosphate, dipotassium phosphate, magnesium sulfate, sodium chloride, ferrous nitrate, manganese sulfate, zinc sulfate, cobalt sulfate, and calcium carbonate. An inorganic salt can be used individually by 1 type or in mixture of 2 or more types. The concentration of the inorganic salt in the reaction solution varies depending on the inorganic salt used, but is usually about 0.01 to 1 (w / v%).

Furthermore, vitamins can be added as necessary. Examples of vitamins include biotin, thiamine (vitamin B1), pyridoxine (vitamin B6), pantothenic acid, inositol, nicotinic acid and the like.
The pH of the reaction solution is preferably about 6-8.

  Specific preferred reaction solutions for coryneform bacteria include the BT medium described above, non-edible agricultural waste such as rice straw, bagasse and corn stover, or energy crops such as switchgrass, napiergrass and miscanthus. A saccharified solution saccharified with an enzyme may be mentioned. In these media, the saccharide concentration may be used within the above range.

Reaction conditions The reaction temperature, that is, the survival temperature of the transformant is preferably about 20 to 50 ° C, more preferably about 25 to 47 ° C. If it is the said temperature range, an organic compound can be manufactured efficiently.
The reaction time is preferably about 1 to 7 days, more preferably about 1 to 3 days.
The culture may be any of batch type, fed-batch type, and continuous type. Among these, the batch type is preferable.
The reaction may be carried out under aerobic conditions or under reducing conditions.

<Reduction conditions>
Under reducing conditions, coryneform bacteria do not substantially grow and organic compounds can be produced more efficiently.
The reduction condition is defined by the oxidation-reduction potential of the reaction solution. The oxidation-reduction potential of the reaction solution is preferably about −200 mV to −500 mV, more preferably about −250 mV to −500 mV.
The reduction state of the reaction solution can be estimated simply with a resazurin indicator (decolorization from blue to colorless in the reduction state), but using a redox potentiometer (for example, BROADLEY JAMES, ORP Electrodes) Can be measured.

As a method for adjusting the reaction solution under reducing conditions, a known method can be used without limitation. For example, an aqueous solution for reaction solution may be used as a liquid medium for the reaction solution instead of distilled water, etc., and the method for adjusting the aqueous solution for reaction solution is, for example, a culture solution preparation for absolute anaerobic microorganisms such as sulfate reducing microorganisms. Method (Pfennig, N. et al., (1981): The dissimilatory sulfate-reducing bacteria, In The Prokaryotes, A Handbook on Habitats Isolation and Identification of Bacteria, Ed. By Starr, MP et al., P926- 940, Berlin, Springer Verlag.) And “Agricultural Chemistry Experiment Book Vol.3, Department of Agricultural Chemistry, Faculty of Agriculture, Kyoto University, 1990, 26th edition, published by Sangyo Tosho Co., Ltd.” Can be obtained.
Specifically, an aqueous solution for reaction solution under reducing conditions can be obtained by removing dissolved gas by heat treatment or decompression treatment of distilled water or the like. In this case, it is dissolved by treating distilled water or the like under reduced pressure of about 10 mmHg or less, preferably about 5 mmHg or less, more preferably about 3 mmHg or less for about 1 to 60 minutes, preferably about 5 to 40 minutes. An aqueous solution for reaction solution under reducing conditions can be prepared by removing gas, particularly dissolved oxygen.
In addition, an appropriate reducing agent (for example, thioglycolic acid, ascorbic acid, cysteine hydrochloride, mercaptoacetic acid, thiolacetic acid, glutathione, sodium sulfide, etc.) can be added to prepare an aqueous solution for a reaction solution under reducing conditions.
An appropriate combination of these methods is also an effective method for preparing an aqueous solution for reaction solution under reducing conditions.

  It is preferable to maintain the reaction solution under reducing conditions during the reaction. In order to maintain the reducing conditions in the middle of the reaction, it is desirable to prevent oxygen contamination from the outside of the reaction system as much as possible. Specifically, the reaction system is made of an inert gas such as nitrogen gas or carbon dioxide gas. The method of enclosing is mentioned. As a method for more effectively preventing oxygen contamination, in order to efficiently function the metabolic function of the aerobic bacteria of the present invention during the reaction, addition of a pH maintenance adjustment solution of the reaction system and various nutrient solution In such a case, it is effective to remove oxygen from the added solution in advance.

Recovery of organic compound By culturing as described above, various organic compounds are produced in the reaction solution. The organic compound can be recovered by recovering the reaction solution, but the organic compound can also be separated from the reaction solution by a known method. Examples of such known methods include an ion exchange resin method, a concentration method, a crystallization method, and an activated carbon adsorption elution method. Organic compounds include amino acids (such as alanine, valine, threonine, lysine, tryptophan, and methionine), organic acids (such as lactic acid, succinic acid, and acetic acid), alcohols (such as ethanol, butanol, isobutanol, and isopropanol), nucleic acids, and physiological activities. Substance, organic gas, etc. are mentioned.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited to these Examples.

Example 1 Cloning and Expression of Xylooligosaccharide Degrading Enzyme Gene
(1) Extraction of chromosomal DNA from microorganisms Extraction of chromosomal DNA from Corynebacterium glutamicum R (FERM P-18976) can be performed using the A medium [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO _{4 7 g, KH 2 PO 4} 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g in 1 L of distilled water To the dissolution, add a 50% (w / v) glucose solution as a carbon source to a final concentration of 4%, inoculate using a platinum loop, and shake culture at 33 ° C until the logarithmic growth phase. After collecting the cells, chromosomal DNA was collected from the collected cells using a DNA genome extraction kit (trade name: GenomicPrep Cells and Tissue DNA Isolation Kit, manufactured by Amersham) according to the instruction manual.

Chromosomal DNA extraction from Corynebacterium alkanolyticum ATCC 21511 was performed using A medium [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO ₄ 0.5 g, K _{2 HPO 4 0.5 g, MgSO 4 .7H} 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H 2 O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g dissolved in 1 L of distilled water] and carbon source to a final concentration of 4% After adding a 50% (w / v) glucose solution, inoculating with a platinum loop, shaking culture at 33 ° C until the logarithmic growth phase, collecting the cells and collecting DNA genome extraction kit (trade name) : GenomicPrep Cells and Tissue DNA Isolation Kit, manufactured by Amersham), chromosomal DNA was recovered from the collected cells according to the instruction manual.
Chromosomal DNA (Catalog No. ATCC824D-5) from Clostridium acetobutylicum ATCC 824 was obtained from the American Type Culture Collection (ATCC).

(2) Construction of cloning vector
Construction of Cloning Vectors pCRB52Tk, pCRB11Tk Plasmid pCRB214 [FEBS Lett. 586: 4228-4232 (2012)] was cleaved with restriction enzyme BamHI, and after agarose electrophoresis, NucleoSpin Gel and PCR Clean-Up (Takara Bio Inc.) Tac promoter (hereinafter referred to as Ptac sequence) recovered from Corynebacterium glutamicum tpi gene Shine-Dalgarno (SD) sequence and cloning vector pKK223-3 (Pharmacia) rrnBT1T2 bidirectional terminator sequence (hereinafter referred to as “Ptac sequence”) The approximately 0.7-kb DNA fragment linked to the terminator sequence) and the plasmid pCRB52G (SEQ ID NO: 27) were cleaved with restriction enzymes BamHI and BglII, and after agarose electrophoresis, NucleoSpin Gel and PCR Clean-Up DNA replication origin pBY503 ori sequence and pHSG298 (Takara Bio Inc.) collected by Takara Bio Inc. PCRB52 DNA fragment containing 5.0-kbp or plasmid pCRB11G (SEQ ID NO: 28) containing the restriction enzyme BamHI and BglII, agarose electrophoresis, NucleoSpin Gel and PCR Clean-Up (Takara Bio Inc.) A 4.5-kbp pCRB11 DNA fragment containing the DNA replication origin pCG1 ori sequence and pHSG398 (manufactured by Takara Bio Inc.) recovered by the company was mixed, and this was mixed with 1 μl of T4 DNA ligase 10 × buffer and T4 DNA ligase (Takara) 1 unit of each component was added, made up to 10 μl with sterile distilled water, reacted at 15 ° C. for 3 hours, and bound. These were designated as Ligation A solution and B solution, respectively.

Escherichia coli HST02 was transformed by the calcium chloride method [J. Mol. Biol. 53: 159-162 (1970)] using the resulting ligation solution A or solution B, and kanamycin 50 μg / ml (ligation solution A) or It was applied to an LB agar medium (1% polypeptone, 0.5% yeast extract, 0.5% sodium chloride, and 1.5% agar) containing 50 μg / ml of chloramphenicol (ligation B solution).
The growing strain on the medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with restriction enzymes NdeI and BamHI to confirm the inserted fragment. As a result, in the plasmid derived from the ligation A solution, in addition to the about 5.3-kb DNA fragment of the cloning vector pCRB52 containing the tac promoter, an about 0.4-kb DNA fragment containing the terminator sequence was observed. The cloning vector containing this Ptac sequence was named pCRB52T.

  In addition, in the plasmid derived from the ligation B solution, an about 0.4-kb DNA fragment containing a terminator sequence was observed in addition to the about 4.8-kb DNA fragment of the cloning vector pCRB11 containing the tac promoter. The cloning vector containing the plasmid Ptac sequence was named pCRB11T.

A 25-bp DNA fragment (hereinafter referred to as a linker) prepared by annealing the following pair of oligonucleotides at 52 ° C and pCRB52T or pCRB11T were cleaved with the restriction enzyme NdeI, and NucleoSpin Gel and PCR Clean-Up (Takara Bio) 5.7-kbp DNA fragment containing DNA replication origin pBY503 ori sequence and pHSG298 (manufactured by Takara Bio Inc.) or 4.2 containing DNA replication origin pCG1 ori sequence and pHSG398 (manufactured by Takara Bio Inc.) -kbp DNA fragment was mixed, and each component of 1 unit of T4 DNA ligase 10x buffer and 1 unit of T4 DNA ligase (Takara Bio Inc.) was added to 10 μl with sterilized distilled water. Reacted for 3 hours and allowed to bind. These were designated as Ligation C solution and D solution, respectively.
Using the obtained ligation solution C or solution D, Escherichia coli JM109 was transformed by the calcium chloride method [Journal of Molecular Biology, 53, 159 (1970)], and LB agar medium containing 50 μg / ml kanamycin [1% polypeptone , 0.5% yeast extract, 0.5% sodium chloride, and 1.5% agar).

Oligonucleotide for creating linker
(a-9) 5'-TATGGAATTCACGCGT GGTACC GA -3 '(SEQ ID NO: 5)
(b-9) 5'-TATC GGTACC ACGCGTGAATTCCA-3 '(SEQ ID NO: 6)
In addition, NdeI sticky ends are formed at both ends of a linker prepared by annealing oligonucleotides (a-9) and (b-9), and a KpnI restriction enzyme site is contained inside the linker.

  Using the obtained colony as a direct template, a plasmid with a linker inserted in the desired direction is selected by amplifying an approximately 250-bp DNA fragment by the following PCR method. Then, plasmid DNA was extracted from the culture solution. A cloning vector containing a linker sequence obtained from pCRB52T (Ligation C solution) was named pCRB52Tk. A cloning vector containing a linker sequence obtained from pCRB11T (Ligation D solution) was named pCRB11Tk.

Colony selection primer
(a-10) 5'-TATCGGTACCACGCGTGAATTCCA-3 '(SEQ ID NO: 6)
(b-10) 5'-GGGGTACCGGCTGTGCAGGTCGTAAATCAC-3 '(SEQ ID NO: 7)
The primer (a-10) corresponds to the antisense oligonucleotide used for preparing the linker, and the primer (b-10) is located at the 5 ′ end of the Ptac sequence.

  Actual PCR was performed under the following conditions using a TaKaRa thermal cycler (Takara Bio Inc.) and KAPA Taq EXtra DNA Polymerase (Nippon Genetics Co., Ltd.) as a reaction reagent.

Reaction solution:
KAPATaq Extra DNA Polymerase (5 U / μl) 0.5 μl
5x KAPATaq Extra Buffer (Mg ²⁺ free) 10 μl
25 mM MgCl ₂ solution 3.5 μl
KAPA dNTP Mix (10mM each) 1.5μl
Primer (a-10) and (b-10) each 2μl (final concentration 0.4μM)
Sterile distilled water 30.5μl
The above was mixed, 50 μl of the reaction solution was dispensed into 10 μl aliquots, a small amount of colonies were added to each reaction solution, and subjected to PCR.

PCR cycle:
Denaturation process: 98 ° C, 10 seconds Annealing process: 50 ° C, 5 seconds Extension process: 72 ° C, 30 seconds One cycle was performed for 25 cycles.

  10 μl of the reaction solution generated above is electrophoresed on a 0.8% agarose gel. When the target plasmid is contained, an approximately 250-bp DNA fragment is detected.

(3) Cloning of xylo-oligosaccharide-utilizing enzyme gene
Cloning of xylooligosaccharide-utilizing enzyme gene derived from Corynebacterium alkanolyticum xylD gene encoding β-xylosidase derived from Corynebacterium alkanolyticum, ABC transporter type xylooligosaccharide transporter protein group (hereinafter, (ABC transporter), a xylEFGD operon encoding β-xylosidase, and a DNA fragment containing an msiK gene encoding a protein having an ATP-binding site (hereinafter, ATP-binding protein) was amplified by the following PCR method.

  In order to clone the xylD gene, xylEFGD operon and msiK gene during PCR, SEQ ID NO: 3 (Corynebacterium alkanolyticum xylD gene), SEQ ID NO: 1 (Corynebacterium alkanolyticum xylEFGD gene) and SEQ ID NO: 4 (Coryne) Based on the bacterial alkanolity cam msiK gene, the following pair of primers was used.

xylD gene amplification primer (a-1); 5'-GAGAATTC CATATG ACCGCCCCCGGATCCGCA-3 '(SEQ ID NO: 8)
(B-1); 5'-GG GGTACC TCAGCTGACGGGTGCCTCGGCC -3 '(SEQ ID NO: 9)
The primer (a-1) has an NdeI restriction enzyme site, and the primer (b-1) has a KpnI restriction enzyme site.

xylEFGD gene amplification primer (a-2); 5'-GG GGTACC TCAGCTGACGGGTGCCTCGGCC -3 '(SEQ ID NO: 10)
(B-2); 5'-GGGAATTC CATATG AGAGCACACAGGATCCTGACG-3 '(SEQ ID NO: 11)
The primer (a-2) has a KpnI restriction enzyme site, and the primer (b-2) has an NdeI restriction enzyme site.

misK gene amplification primer (a-3); 5'-GC GGTACC ACTACGGATCGTCCGGCACGTA-3 '(SEQ ID NO: 12)
(B-3); 5′-CC GGTACC TTACGCCGAGACGATCGCCTTG -3 ′ (SEQ ID NO: 13)
In addition, a KpnI restriction enzyme site is added to the primer (a-3) and the primer (b-3).

Cloning of Clostridium acetobutylicum-derived Xylooligosaccharide Utilizing Enzyme Gene A DNA fragment containing the xynT gene encoding a symporter-type xylo-oligosaccharide transporter protein (hereinafter referred to as symporter) derived from Clostridium acetobutylicum was amplified by the following PCR method.
In order to clone the xynT gene during PCR, the following pair of primers was used based on SEQ ID NO: 2 (Clostridial acetobutylicum xynT gene).

xynT gene amplification primer (a-4); 5'- GGAATTC CATATG ATAGGAAGTTTTAAAATTAAAATGAG -3 '
(SEQ ID NO: 14)
(B-4); 5'- CG GGATCC TCATAAATTTAAATTCTCCCCTCTATTTA -3 '
(SEQ ID NO: 15)
The primer (a-4) has an NdeI restriction enzyme site, and the primer (b-4) has a BamHI restriction enzyme site.

  Template DNA: Corynebacterium alkanolyticum is chromosomal DNA extracted from Corynebacterium alkanolyticum ATCC 21511 obtained from American Type Culture Collection (ATCC), Clostridium acetobutylicum is obtained from American Type Culture Collection (ATCC) Clostridium acetobutylicum ATCC 824-derived chromosomal DNA was used.

  Actual PCR was performed using a TaKaRa thermal cycler (Takara Bio Inc.) and PrimeSTAR GXL DNA Polymerase (Takara Bio Inc.) as a reaction reagent under the following conditions.

Reaction solution:
PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 1μl
5x PrimeSTAR GXL Buffer (Mg ²⁺ plus) 10μl
dNTP Mixture (2.5mM each) 4μl
Template DNA 1μl (DNA content 1μg or less)
2 primers as described above *) 1μl each (final concentration 0.2μM)
Sterile distilled water 32 μl
The above was mixed and 50 μl of the reaction solution was subjected to PCR.
*) When amplifying the Corynebacterium alkanolyticum xylD gene, combine primer (a-1) and (b-1) .To amplify the Corynebacterium alkanolyticum xylEFGD gene, (b-2), primer (a-3) and (b-3) to amplify the Corynebacterium alkanolyticum msiK gene, primer (a-4) to amplify Clostridium acetobutylicum xynT gene ) And (b-4).

PCR cycle:
Denaturation process: 98 ° C 10 seconds Annealing process: 50 ° C 5 seconds Extension process: 68 ° C
Corynebacterium alkanolytic cam xylD gene 90 seconds Corynebacterium alkanolyticum xylEFGD gene 180 seconds Corynebacterium alkanolyticum msiK gene 60 seconds Clostridium acetobutylicum xynT gene 60 seconds or more were performed for 30 cycles.

  10 μl of the reaction solution generated above was electrophoresed on a 0.8% agarose gel, about 2.4-kb for the xylD gene derived from the Corynebacterium alkanolyticum strain, and about 5.6--for the xylEFGD gene derived from the Corynebacterium alkanolyticum strain. In the case of kb, about 1.1-kb in the case of the msiK gene derived from the Corynebacterium alkanolyticum strain, and about 1.5-kb in the case of the xynT gene derived from the Clostridium acetobutylicum strain, a DNA fragment was detected. Each DNA fragment was purified by NucleoSpin Gel and PCR Clean-Up (manufactured by Takara Bio Inc.).

(4) Construction of xylo-oligosaccharide degrading enzyme gene expression plasmid
Cloning of Xylooligosaccharide Degrading Enzyme Gene into pCRB52Tk About 10 μl of a 2.4-kb DNA fragment containing the xylD gene derived from the Corynebacterium alkanolyticum strain amplified by PCR shown in (3) above was digested with restriction enzymes NdeI and KpnI. About 10 μl of about 5.6-kb DNA fragment containing xylEFGD gene derived from bacterial alkanolyticum strain was digested with restriction enzymes NdeI and KpnI, and about 10 μl of about 1.5-kb DNA fragment containing xynT gene derived from Clostridium acetobutylicum strain was digested with restriction enzymes NdeI and BamHI . 2 μl of cloning vector pCRB52Tk containing tac promoter is cleaved with restriction enzymes NdeI and KpnI for xylD gene and xylEFGD gene, and with restriction enzymes NdeI and BamHI for xynT gene and dephosphorylated with Alkaline Phosphatase, Calf Intestinal (CIP) Then, it is purified by NucleoSpin Gel and PCR Clean-Up (manufactured by Takara Bio Inc.), mixed with the gene to be inserted and mixed with 10 μl of T4 DNA ligase 10 × buffer, T4 DNA ligase (manufactured by Takara Bio Inc.) 1 Each component of the unit was added, made up to 10 μl with sterile distilled water, reacted at 15 ° C. for 3 hours, and bound. This was designated as Ligation E solution, F solution, and G solution.

  The resulting ligation E solution, F solution and G solution were transformed into Escherichia coli HST02 by the calcium chloride method [J. Mol. Biol. 53: 159-162 (1970)], and LB agar containing kanamycin 50 μg / ml It was applied to a medium [1% polypeptone, 0.5% yeast extract, 0.5% sodium chloride, and 1.5% agar].

  Each of the growing strains on the medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture solution, and each plasmid was cleaved with a restriction enzyme to confirm the inserted fragment. As a result, in addition to the plasmid pCRB52Tk DNA fragment of about 5.7-kb, in the case of the xylD gene (ligation E solution) derived from the Corynebacterium alkanolyticum strain, the inserted fragment of about 2.4-kb is derived from the Corynebacterium alkanolyticum strain. In the case of the xylEFGD gene (ligation F solution), an insertion fragment of about 5.6-kb was observed, and in the case of the xynT gene derived from a Clostridium acetobutylicum strain (ligation G solution), an insertion fragment of about 1.5-kb was observed.

Plasmid containing xylD gene from Corynebacterium alkanolyticum strain is pCRF100 (Fig. 1), plasmid containing xylEFGD gene from Corynebacterium alkanolyticum strain is pCRF101 (Fig. 1), and plasmid containing xynT gene from Clostridium acetobutylicum strain It was named pCRF104 (FIG. 1).
Also, 10 μl of an about 1.1-kb DNA fragment containing the msiK gene derived from the Corynebacterium alkanolyticum strain amplified by PCR shown in the above (3) and 10 μl of the plasmid pCRF101 containing the xylEFGD gene derived from the Corynebacterium alkanolyticum strain were used. Each was cleaved with the restriction enzyme KpnI, dephosphorylated with Alkaline Phosphatase, Calf Intestinal (CIP), purified with NucleoSpin Gel and PCR Clean-Up (manufactured by Takara Bio Inc.), and then mixed with T4 DNA. Each component of ligase 10 × buffer 1 μl and T4 DNA ligase (Takara Bio Inc.) 1 unit was added to 10 μl with sterilized distilled water, reacted at 15 ° C. for 3 hours, and bound. This was designated as Ligation H solution.

The obtained ligation H solution was transformed with Escherichia coli HST02 by the calcium chloride method [J. Mol. Biol. 53: 159-162 (1970)], and LB agar medium containing 50 μg / ml kanamycin [1% 0.5% yeast extract, 0.5% sodium chloride, and 1.5% agar).
Using the obtained colony as a direct template, a plasmid with a linker inserted in the desired direction is selected by amplifying an approximately 1.5-kb DNA fragment by the following PCR method. Then, plasmid DNA was extracted from the culture solution. A plasmid containing the xylEFGD gene derived from the Corynebacterium alkanolyticum strain and the msiK gene derived from the Corynebacterium alkanolyticum strain was named pCRF102 (FIG. 1).

Colony selection primer (a-11); 5'-GC GGTACC ACTACGGATCGTCCGGCACGTA -3 '(SEQ ID NO: 12)
(b-11); 5'-GGGGTACCGTAGAAACGCAAAAAGGCCATCCGTC-3 '(SEQ ID NO: 7)
The primer (a-11) is a sense primer for amplifying the msiK gene, and the primer (b-11) is located in a terminator sequence.

  Actual PCR was performed under the following conditions using a TaKaRa thermal cycler (Takara Bio Inc.) and KAPA Taq EXtra DNA Polymerase (Nippon Genetics Co., Ltd.) as a reaction reagent.

Reaction solution:
KAPATaq Extra DNA Polymerase (5 U / μl) 0.5 μl
5x KAPATaq Extra Buffer (Mg ²⁺ free) 10 μl
25 mM MgCl ₂ solution 3.5 μl
KAPA dNTP Mix (10mM each) 1.5μl
Primer (a-11) and (b-11) each 2μl (final concentration 0.4μM)
Sterile distilled water 30.5μl
The above was mixed, 50 μl of the reaction solution was dispensed into 10 μl aliquots, a small amount of colonies were added to each reaction solution, and subjected to PCR.

PCR cycle:
Denaturation process: 98 ° C., 10 seconds annealing process: 52 ° C., 5 seconds extension process: 72 ° C. 30 cycles or more were performed for 25 cycles.
10 μl of the reaction solution generated above is electrophoresed on a 0.8% agarose gel. When the target plasmid is contained, an approximately 1.5-kb DNA fragment is detected.

Cloning construction of xylooligosaccharide- degrading enzyme gene-introduced strain into pCRB11Tk High-copy that can coexist with the expression plasmid pCRF102 shown above to increase the expression level of xylD gene derived from Corynebacterium alkanolyticum, a xylooligosaccharide-degrading enzyme gene We decided to clone the xylD gene into the plasmid pCRB11Tk.
About 10 μl of the 2.4-kb DNA fragment containing the xylD gene derived from the Corynebacterium alkanolyticum strain amplified by PCR shown in (3) above and 2 μl of the cloning vector pCRB11Tk containing the tac promoter were digested with restriction enzymes NdeI and KpnI. After purification by NucleoSpin Gel and PCR Clean-Up (Takara Bio Inc.), each DNA fragment was mixed and mixed with T4 DNA ligase 10 × buffer 1 μl, T4 DNA ligase (Takara Bio Inc.) 1 unit The components were added to 10 μl with sterilized distilled water, reacted at 15 ° C. for 3 hours, and bound. This was designated as Ligation I solution.

The resulting ligation I solution was transformed with Escherichia coli HST02 by the calcium chloride method [J. Mol. % Polypeptone, 0.5% yeast extract, 0.5% sodium chloride, and 1.5% agar).
The growing strain on the medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture solution, and the plasmid was cleaved with a restriction enzyme to confirm the inserted fragment. As a result, in addition to a DNA fragment of plasmid pCRB11Tk of about 5.2-kb, an inserted fragment of about 2.4-kb of xylD gene derived from Corynebacterium alkanolyticum was observed. This plasmid was named pCRF103 (FIG. 1).

Cloning of β-xylosidase gene into E. coli expression system vector To analyze the enzymatic properties of Corynebacterium alkanolyticum XylD, expression to express XylD fused with histidine tag at the N-terminus in E. coli A vector was constructed.
An approximately 2.4-kb DNA fragment containing the xylD gene of Corynebacterium alkanolyticum was amplified by PCR using the following pair of primers.

xylD gene amplification primer (a-5); 5'- GCCGGCAAC CATATG ACCGAACTGCCCCCTCT -3 '(SEQ ID NO: 16)
(B-5); 5'- AGGA AGATCT CAGCTGACGGGTGCCTCGGCC -3 '(SEQ ID NO: 17)
The primer (a-1) has an NdeI restriction enzyme site, and the primer (b-1) has a BglII restriction enzyme site.

As the template DNA, chromosomal DNA extracted from Corynebacterium alkanolyticum ATCC 21511 obtained from American Type Culture Collection (ATCC) was used as Corynebacterium alkanolyticum.
Actual PCR was performed using a TaKaRa thermal cycler (Takara Bio Inc.) and PrimeSTAR GXL DNA Polymerase (Takara Bio Inc.) as a reaction reagent under the following conditions.

Reaction solution:
PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 1μl
5x PrimeSTAR GXL Buffer (Mg ²⁺ plus) 10μl
dNTP Mixture (2.5mM each) 4μl
Template DNA 1μl (DNA content 1μg or less)
Primer (a-5) and (b-5) each 1μl (final concentration 0.2μM)
Sterile distilled water 32 μl
The above was mixed and 50 μl of the reaction solution was subjected to PCR.

PCR cycle:
Denaturation process: 98 ° C., 10 seconds annealing process: 50 ° C., 5 seconds extension process: 68 ° C. 90 seconds or more was set as one cycle, and 30 cycles were performed.

  10 μl of the reaction solution generated above was electrophoresed on a 0.8% agarose gel, and in the case of the xylD gene derived from the Corynebacterium alkanolyticum strain, a DNA fragment of about 2.4-kb could be detected. The amplified DNA fragment was purified by NucleoSpin Gel and PCR Clean-Up (manufactured by Takara Bio Inc.).

  Restricted to 2 μl of the expression vector pColdII (manufactured by Takara Bio Inc.) capable of expressing recombinant protein by cleaving 10 μl of 2.4-kb DNA fragment of Corynebacterium alkanolyticum xylD gene with NdeI and BglII and fusing a histidine tag to the N-terminus After digestion with enzymes NdeI and BamHI and purification by NucleoSpin Gel and PCR Clean-Up (Takara Bio Inc.), each DNA fragment was mixed and mixed with 1 μl of T4 DNA ligase 10 × buffer, T4 DNA ligase ( 1 unit of each component was added, made up to 10 μl with sterile distilled water, reacted at 15 ° C. for 3 hours, and bound. This was designated as Ligation J solution.

The obtained ligation solution J was transformed with Escherichia coli HST02 by the calcium chloride method [J. Mol. 0.5% yeast extract, 0.5% sodium chloride, and 1.5% agar).
The growing strain on the medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture solution, and the plasmid was cleaved with a restriction enzyme to confirm the inserted fragment. As a result, in addition to a DNA fragment of about 4.4-kb of plasmid pColdII, an inserted fragment of about 2.4-kb of the xylD gene derived from the Corynebacterium alkanolyticum strain was observed. This plasmid was designated as pCRF105.

(5) Expression and Purification of Xylooligosaccharide Degrading Enzyme in Escherichia coli The above expression plasmid pCRF105 was transformed into Escherichia coli BL21 (DE3) for expression of recombinant protein by the calcium chloride method [J. Mol. Biol. 53: 159-162 (1970)]. The strain was transformed and spread on LB agar medium (1% polypeptone, 0.5% yeast extract, 0.5% sodium chloride, and 1.5% agar) containing 50 μg / ml of ampicillin. The obtained transformant was inoculated into LB medium [1% polypeptone, 0.5% yeast extract, 0.5% sodium chloride] containing ampicillin 50 μg / ml, and cultured with shaking at 37 ° C. overnight. The cells were collected by centrifugation, the cells were suspended in a new medium, added to 100 ml LB medium (1% polypeptone, 0.5% yeast extract, 0.5% sodium chloride) containing 50 μg / ml of ampicillin and cultured at 37 ° C. with shaking. . When the turbidity OD610 of the culture solution reached 0.5, 0.5 mM IPTG (isopropyl 1-thio-beta-d-galactoside) was added to the culture solution, and cultured with shaking at 15 ° C. for 24 hours to induce protein expression.

Cells were collected by centrifugation 24 hours after induction of expression, and the cells were suspended in 10 ml lysis buffer [100 mM (Tris-HCl (pH 8.0), 0.5 M NaCl, 25 mM imidazole, 10 mM 2-mercaptoethanol)] After centrifugation of the bacterial cell disruption solution, the supernatant was applied to a HisTrap HP column (1 ml, manufactured by GE Healthcare Japan, Inc.) and washed with a 20 ml washing buffer [100 mM (Tris-HCl [ After washing the column with pH 8.0], 0.5 M NaCl, 25 mM imidazole], the histidine-tagged XylD protein was eluted with 4 ml elution buffer [100 mM (Tris-HCl [pH 8.0], 0.5 M NaCl, 250 mM imidazole]. The eluted protein solution was exchanged with buffer A [20 mM NaPi [pH 7.0], 1 mM EDTA, 5 mM MgCl ₂ ] by dialysis, and then HiTrap Q HP column (1 ml, GE Healthcare Japan, Inc.). AKTA FPLC system (manufactured by GE Healthcare Japan Co., Ltd.) and continuously changing the NaCl concentration to 1.0 M. Each collected fraction was subjected to SDS-PAGE, and fractions containing a single band of about 86 kDa were collected to obtain a purified histidine-tagged XylD protein.The protein concentration was Bio-Rad protein assay kit. Quantification was performed using (Bio-Rad).

(6) Construction of xylose utilization strain (construction of X2AraE strain)
It is considered that introduction of a xylooligosaccharide transporter and β-xylosidase makes it possible to take in and decompose xylooligosaccharide, but in order to use xylooligosaccharide as a carbon source, xylose produced by the decomposition of xylooligosaccharide must be available. Corynebacterium glutamicum R strain does not have the ability to use xylose, but it has already been confirmed that xylose can be used with Corynebacterium glutamicum X1 strain into which a single copy of E. coli-derived xylA-xylB gene has been introduced into the chromosome. [Appl. Microbiol. Biotechnol. 81: 691-699 (2008)]. In addition, in order to further enhance the utilization of xylose, one copy of Corynebacterium was introduced into X2 strain [Appl. Microbiol. Biotechnol. 81: 691-699 (2008)] in which two copies of the xylA-xylB gene derived from E. coli were introduced into the chromosome. The arabinose transporter araE gene derived from glutamicum ATCC31831 was introduced.

The araE gene markerless plasmid pCRD108 [Appl. Microbiol. Biotechnol. 85: 105-115 (2009)] is a plasmid that cannot replicate in Corynebacterium glutamicum R. This is a plasmid for introducing the araE gene into the SSIs 11 region [Appl. Environ. Microbiol., 71: 3369-3372 (2005)], which is reported to be not essential. pCRD108 was used to transform Corynebacterium glutamicum X2 strain by the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] It was applied to A agar medium [A liquid medium and 1.5% agar] containing kanamycin 50 μg / ml. Single crossover strain obtained in the above medium, 10% (W / V) sucrose-containing BT agar medium [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO ₄ 0.5 g, K _{2 HPO 4 0.5 g, MgSO 4} .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H 2 O 1 ml, 0.02% ( w / v) 1 ml of biotin solution and 2 ml of 0.01% (w / v) thiamin solution were dissolved in 1 L of distilled water and applied to 1.5% agar.

When plasmid pCRD108 is a single crossover with a homologous region on the chromosome, kanamycin resistance by expression of kanamycin resistance gene on pCRD108 and lethality in sucrose-containing medium by expression of sacR-sacB gene of Bacillus subtilis On the other hand, in the case of the double crossover strain, kanamycin sensitivity due to loss of the kanamycin resistance gene on pCRD108 and growth in a sucrose-containing medium due to loss of the sacR-sacB gene are shown. Therefore, the markerless chromosome gene-introduced strain exhibits kanamycin sensitivity and sucrose-containing medium growth. Therefore, a strain showing kanamycin sensitivity and viability of medium containing sucrose was selected.
Corynebacterium glutamicum X2AraE was named as a strain obtained by introducing two copies of E. coli-derived xylA-xylB gene and one copy of Corynebacterium glutamicum ATCC31831 araE gene into the chromosome of this Corynebacterium glutamicum R strain ( Table 1).

(7) Construction of markerless xynT gene transfer vector LKSind8-xynT
The DNA region necessary for introducing the xynT gene into the chromosome without a marker in the Corynebacterium glutamicum X2AraE strain is a sequence that is reported to be not essential for the growth of Corynebacterium glutamicum R [ Appl. Environ. Microbiol. 71: 3369-3372 (2005)] (SSI region). This DNA region (Indel8 region) was amplified by the following PCR method.

In the PCR, the following pair of primer sets were used.
Indel8 region amplification primer set for xynT gene transfer
(a-6); 5'-GG ACTAGT AAGGCCGCTGCGGAGGGAACTGT -3 '
(SEQ ID NO: 18)
(b-6); 5'- CGACAACGGCTGCACAC TCTAGA CCGCGGATATCAATCTC -3 '
(SEQ ID NO: 19)
(a-7); 5'- GAGATTGATATCCGCGG TCTAGA GTGTGCAGCCGTTGTCG -3 '
(SEQ ID NO: 20)
(b-7); 5'-GG ACTAGT GCATCTGCATGCGCAGTGGAC -3 '
(SEQ ID NO: 21)

The primers (a-6) and (b-7) have a SpeI restriction enzyme site, and the primers (b-6) and (a-7) have an XbaI restriction enzyme site.
As the template DNA, chromosomal DNA extracted from Corynebacterium glutamicum R was used.
Actual PCR was performed using a TaKaRa thermal cycler (Takara Bio Inc.) and PrimeSTAR GXL DNA Polymerase (Takara Bio Inc.) as a reaction reagent under the following conditions.

Reaction solution:
PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 1μl
5x PrimeSTAR GXL Buffer (Mg2 + plus) 10μl
dNTP Mixture (2.5mM each) 4μl
Template DNA 1μl (DNA content 1μg or less)
Primer (a-6) and (b-6) or Primer (a-7) and (b-7) each 1μl (final concentration 0.2μM)
Sterile distilled water 32 μl
The above was mixed and 50 μl of the reaction solution was subjected to PCR.

PCR cycle:
Denaturation process: 98 ° C., 10 seconds annealing process: 50 ° C., 5 seconds extension process: 68 ° C. 90 seconds or more was set as one cycle, and 30 cycles were performed.
The reaction solution generated above was electrophoresed on a 0.8% agarose gel, and a DNA fragment of about 1.5-kb was purified by NucleoSpin Gel and PCR Clean-Up (manufactured by Takara Bio Inc.).

DNA amplified from primer (a-7) and (b-7) and 3 'end 20-bp of DNA fragment (Indel8-1) amplified from primers (a-6) and (b-6) The 5 'end 20-bp of the fragment (referred to as Indel8-2) is designed so that the sequences overlap, and can be ligated by annealing both DNA fragments after heat denaturation.
The actual ligation reaction was performed using a TaKaRa thermal cycler (Takara Bio Inc.) and PrimeSTAR GXL DNA Polymerase (Takara Bio Inc.) as a reaction reagent under the following conditions.

Reaction solution:
PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 1μl
5x PrimeSTAR GXL Buffer (Mg2 + plus) 10μl
dNTP Mixture (2.5mM each) 4μl
DNA fragment Indel8-1 and Indel8-2 1 μl each
Sterile distilled water 34 μl
The above was mixed and 50 μl of the reaction solution was subjected to PCR.

PCR cycle:
Denaturation process: 98 ° C, 10 seconds Annealing process: 50 ° C, 5 seconds Extension process: 68 ° C, 90 seconds or more, with 15 cycles.

A second PCR was performed under the following conditions using the reaction solution after the ligation reaction as a template.
Reaction solution:
PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 1μl
5x PrimeSTAR GXL Buffer (Mg ²⁺ plus) 10μl
dNTP Mixture (2.5mM each) 4μl
1 μl of reaction solution after ligation reaction
Primer (a-6) and (b-7) each 1μl (final concentration 0.2μM)
Sterile distilled water 34 μl
The above was mixed and 50 μl of the reaction solution was subjected to PCR.

PCR cycle:
Denaturation process: 98 ° C., 10 seconds annealing process: 50 ° C., 5 seconds extension process: 68 ° C. 180 seconds or more was set as one cycle, and 20 cycles were performed.
The reaction solution generated above was electrophoresed on a 0.8% agarose gel, and a DNA fragment of about 3.0-kb was purified by NucleoSpin Gel and PCR Clean-Up (manufactured by Takara Bio Inc.).

The purified amplification product was cleaved with the restriction enzyme SpeI, and the markerless gene disruption plasmid pCRA725 [J. Mol. Microbiol. Biotechnol. 8: 243-254 (2004), (JP 2006-124440)] was digested with the restriction enzyme XbaI. After cutting, dephosphorylation with Alkaline Phosphatase, Calf Intestinal (CIP) was performed. After purifying each DNA fragment with NucleoSpin Gel and PCR Clean-Up (Takara Bio Inc.), both were mixed, and this was mixed with 1 μl of T4 DNA ligase 10 × buffer, T4 DNA ligase (Takara Bio Inc.) 1 Each component of the unit was added, made up to 10 μl with sterile distilled water, reacted at 15 ° C. for 3 hours, and bound. This was designated as ligation K solution. The obtained ligation K solution was transformed with Escherichia coli HST02 by the calcium chloride method [J. Mol. Biol. 53: 159-162 (1970)], and LB agar medium containing 50 μg / ml kanamycin [1% polypeptone, 0.5% yeast extract, 0.5% sodium chloride, and 1.5% agar).
The growing strain on the medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture solution, and the plasmid was cleaved with a restriction enzyme to confirm the inserted fragment. As a result, in addition to the approximately 4.0-kb DNA fragment of plasmid pCRA725, an approximately 3.0-kb DNA fragment in the indel8 region was detected. This plasmid was designated LKSind8.

A DNA fragment containing the Ptac-xynT-terminator sequence (hereinafter referred to as xynT expression cassette) was amplified by PCR using pCRF104 as a template under the following conditions.
Primer for xynT expression cassette amplification
(a-8); 5'-GG ACTAGT GGCTGTGCAGGTCGTAAATCAC -3 '(SEQ ID NO: 22)
(b-8); 5'-GG ACTAGT GTAGAAACGCAAAAAGGCCATCCGTC-3 '(SEQ ID NO: 23)
In addition, a SpeI restriction enzyme site is added to the primers (a-8) and (b-8). As the template DNA, pCRF104 was used.

Actual PCR was performed using a TaKaRa thermal cycler (Takara Bio Inc.) and PrimeSTAR GXL DNA Polymerase (Takara Bio Inc.) as a reaction reagent under the following conditions.
Reaction solution:
PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 1μl
5x PrimeSTAR GXL Buffer (Mg ²⁺ plus) 10μl
dNTP Mixture (2.5mM each) 4μl
Template DNA 1μl (DNA content 1μg)
Primers (a-8) and (b-8) each 1μl (final concentration 0.2μM)
Sterile distilled water 32 μl
The above was mixed and 50 μl of the reaction solution was subjected to PCR.

PCR cycle:
Denaturation process: 98 ° C, 10 seconds Annealing process: 60 ° C, 5 seconds Extension process: 68 ° C, 90 seconds or more, one cycle, 20 cycles.

  The reaction solution generated above was electrophoresed on a 0.8% agarose gel, and a DNA fragment of about 2.0-kb was purified by NucleoSpin Gel and PCR Clean-Up (manufactured by Takara Bio Inc.).

The purified amplification product was cleaved with the restriction enzyme SpeI, and LKSind8 was cleaved with the restriction enzyme XbaI and then dephosphorylated with Alkaline Phosphatase, Calf Intestinal (CIP). After purifying each DNA fragment with NucleoSpin Gel and PCR Clean-Up (Takara Bio Inc.), both were mixed, and this was mixed with 1 μl of T4 DNA ligase 10 × buffer, T4 DNA ligase (Takara Bio Inc.) 1 Each component of the unit was added, made up to 10 μl with sterile distilled water, reacted at 15 ° C. for 3 hours, and bound. This was designated as Ligation L solution. The resulting ligation L solution was transformed into Escherichia coli HST02 by the calcium chloride method [J. Mol. 0.5% yeast extract, 0.5% sodium chloride, and 1.5% agar).
The growing strain on the medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture solution, and the plasmid was cleaved with a restriction enzyme to confirm the inserted fragment. This plasmid was named Ind-xynT.

(8) Construction of xynT gene chromosome transfer strain
The plasmid Ind-xynT for introducing xynT gene is a plasmid that cannot replicate in Corynebacterium glutamicum R. Ind-xynT was prepared according to the method of the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] X2AraE A agar medium [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO ₄ 0.5 g, K ₂ HPO ₄ 0.5 g, MgSO ₄ .7H ₂ O 0.5 g, 0.06% (w / v) Fe ₂ SO ₄ .7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g, and agar 15 g were dissolved in 1 L of distilled water.

Furthermore, the strain obtained in the above medium was added to A agar medium containing 10% (wt / vol) of sucrose [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO _{4 0.5 g, K 2 HPO 4 0.5} g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H 2 O 1 ml , 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g, and agar 15 g dissolved in 1 L of distilled water] did.

When plasmid Ind-xynT undergoes one-point homologous recombination with a homologous region on the chromosome, it depends on kanamycin resistance by expression of kanamycin resistance gene on Ind-xynT and by expression of sacR-sacB gene of Bacillus subtilis In contrast to sucrose lethality, when two-point homologous recombination occurred, kanamycin sensitivity due to loss of the kanamycin resistance gene of Ind-xynT and viability in a sucrose-containing medium due to loss of the sacR-sacB gene Show. Therefore, the intended xynT gene chromosome-introduced strain exhibits kanamycin sensitivity and sucrose-containing medium growth.
The strain that showed kanamycin sensitivity and growth of sucrose-containing medium was named Corynebacterium glutamicum X2AraET (Table 1).

(9) Construction of Xylooligosaccharide Degrading Enzyme Gene-Introduced Strain Xylooligosaccharide Degrading Enzyme Gene-Introduced Strain X1 [Appl. Microbiol. Biotechnol. 81: 691-699 (2008)] strain, or two copies of Escherichia coli xylA-xylB gene and one copy of Corynebacterium glutamicum ATCC31831 strain arabinose on the chromosome of Corynebacterium glutamicum R strain Corynebacterium glutamicum X2AraE strain into which the transporter araE gene was introduced, and further X2AraET strain into which X2AraE strain was chromosomally introduced with clostridium acetobutylicum xynT were used as hosts.

By using the above-mentioned plasmid pCRF100 (FIG. 1), by the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)], Corynebacterium glutamicum X1 [Appl Microbiol Biotechnol. 81: 691-699 (2008)] strain was transformed and A agar medium containing 50 μg / ml kanamycin [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, _{KH 2 PO 4 0.5 g, K} 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g, agar 15 g in 1 L of distilled water Dissolved]. The growing strain on this medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with a restriction enzyme to confirm the inserted plasmid. As a result, introduction of the plasmid pCRF100 prepared above was confirmed. The resulting strain was named Corynebacterium glutamicum XYD1 (Table 1).

Similarly, by using the above-described plasmid pCRF101 (FIG. 1), the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] bacterium glutamicum X1 [Appl Microbiol Biotechnol 81:. 691-699 (2008)] strain was transformed, a agar medium [(NH ₂₎ containing kanamycin _{50μg / ml 2 CO 2 g,} (NH 4) 2 SO 4 _{7 g, KH 2 PO 4 0.5} g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO _{4 .2H 2 O 1 ml, 0.02} % (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g, distilled water agar 15 g Dissolved in 1 L]. The growing strain on this medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with a restriction enzyme to confirm the inserted plasmid. As a result, introduction of the plasmid pCRF101 prepared above was confirmed. The resulting strain was named Corynebacterium glutamicum XYD2 (Table 1). A portion of the liquid culture was stored at −80 ° C. as a glycerol stock after adding an equal volume of 50% glycerol.

Similarly, by using the above-described plasmid pCRF102 (FIG. 1), the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] Bacterium glutamicum X1 [Appl Microbiol Biotechnol. 81: 691-699 (2008)] strain was transformed and A agar medium containing 50 μg / ml kanamycin [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO _{4 7 g, KH 2 PO 4 0.5} g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO _{4 .2H 2 O 1 ml, 0.02} % (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g, distilled water agar 15 g Dissolved in 1 L]. The growing strain on this medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with a restriction enzyme to confirm the inserted plasmid. As a result, introduction of the plasmid pCRF102 prepared above was confirmed. The resulting strain was named Corynebacterium glutamicum XYD3 (Table 1). A portion of the liquid culture was stored at −80 ° C. as a glycerol stock after adding an equal volume of 50% glycerol.

Similarly, using the above-described plasmids pCRF102 and pCRF103 (FIG. 1), the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] , Corynebacterium glutamicum X1 [Appl Microbiol Biotechnol. 81: 691-699 (2008)] strain was transformed into A agar medium [(NH ₂ ) ₂ CO containing kanamycin 50 μg / ml and chloramphenicol 5 μg / ml. _{2 g, (NH 4) 2} SO 4 7 g, KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino 7 g of acid and 15 g of agar were dissolved in 1 L of distilled water. The growing strain on this medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with a restriction enzyme to confirm the inserted plasmid. As a result, introduction of the plasmids pCRF102 and pCRF103 prepared above was confirmed. The resulting strain was named Corynebacterium glutamicum XYD4 (Table 1). A portion of the liquid culture was stored at −80 ° C. as a glycerol stock after adding an equal volume of 50% glycerol.

Similarly, by using the above-described plasmids pCRF103 and pCRF104 (FIG. 1), the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] , Corynebacterium glutamicum X1 [Appl Microbiol Biotechnol. 81: 691-699 (2008)] strain was transformed into A agar medium [(NH ₂ ) ₂ CO containing kanamycin 50 μg / ml and chloramphenicol 5 μg / ml. _{2 g, (NH 4) 2} SO 4 7 g, KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino 7 g of acid and 15 g of agar were dissolved in 1 L of distilled water.

  The growing strain on this medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with a restriction enzyme to confirm the inserted plasmid. As a result, introduction of the plasmids pCRF103 and pCRF104 prepared above was confirmed. The resulting strain was named Corynebacterium glutamicum XYD5 (Table 1). A portion of the liquid culture was stored at −80 ° C. as a glycerol stock after adding an equal volume of 50% glycerol.

Similarly, by using the expression vectors pCRB52Tk and pCRB11Tk, the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] Transform X2AraE strain, and agar agar containing kanamycin 50 μg / ml and chloramphenicol 5 μg / ml [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO ₄ 0.5 g _{, K 2 HPO 4 0.5 g,} MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H 2 O 1 ml, 0.02 % (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g and agar 15 g were dissolved in 1 L of distilled water. The growing strain on this medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with a restriction enzyme to confirm the inserted plasmid. As a result, the introduction of expression vectors pCRB52Tk and pCRB11Tk was observed. The resulting strain was named Corynebacterium glutamicum XYD6 (Table 1). A portion of the liquid culture was stored at −80 ° C. as a glycerol stock after adding an equal volume of 50% glycerol.

Similarly, using the above-described plasmids pCRF102 and pCRF103 (FIG. 1), the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] , Corynebacterium glutamicum X2AraE strain, A agar medium containing 50 μg / ml kanamycin and 5 μg / ml chloramphenicol [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH _{2 PO 4 0.5 g, K 2} HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO4.2H2O 1 ml , 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g, and agar 15 g dissolved in 1 L of distilled water] did. The growing strain on this medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with a restriction enzyme to confirm the inserted plasmid. As a result, introduction of the plasmids pCRF102 and pCRF103 prepared above was confirmed. The resulting strain was named Corynebacterium glutamicum XYD7 (Table 1). A portion of the liquid culture was stored at −80 ° C. as a glycerol stock after adding an equal volume of 50% glycerol.

Similarly, by using the above-described plasmids pCRF103 and pCRF104 (FIG. 1), the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] , Corynebacterium glutamicum X2AraE strain, A agar medium containing 50 μg / ml kanamycin and 5 μg / ml chloramphenicol [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH _{2 PO 4 0.5 g, K 2} HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2 H2 O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g, agar 15 g dissolved in 1 L of distilled water ] Was applied. The growing strain on this medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with a restriction enzyme to confirm the inserted plasmid. As a result, introduction of the plasmids pCRF103 and pCRF104 prepared above was confirmed. The resulting strain was named Corynebacterium glutamicum XYD8 (Table 1). A portion of the liquid culture was stored at −80 ° C. as a glycerol stock after adding an equal volume of 50% glycerol.

Similarly, using the above-described plasmids pCRF102 and pCRF103 (FIG. 1), the electric pulse method [Agric. Biol. Chem. 54: 443-447 (1990) and Res. Microbiol. 144: 181-185 (1993)] , Corynebacterium glutamicum X2AraET strain, transformed into Kanamycin 50 μg / ml and chloramphenicol 5 μg / ml A agar medium ((NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH _{2 PO 4 0.5 g, K 2} HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H 2 O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g, agar 15 g dissolved in 1 L of distilled water ] Was applied. The growing strain on this medium was subjected to liquid culture by a conventional method, plasmid DNA was extracted from the culture, and the plasmid was cleaved with a restriction enzyme to confirm the inserted plasmid. As a result, introduction of the plasmids pCRF102 and pCRF103 prepared above was confirmed. The resulting strain was named Corynebacterium glutamicum XYD9 (Table 1). A portion of the liquid culture was stored at −80 ° C. as a glycerol stock after adding an equal volume of 50% glycerol.

  The outline of gene recombination described in Example 1 is summarized in Table 1 and FIG. Corynebacterium glutamicum XYD9 has been deposited with the Patent Biological Depositary Center of the National Institute of Technology and Evaluation (2-5-8 Kazusa Kamashi, Kisarazu City, Chiba, Japan (zip code 292-0818)) Date of trust: March 13, 2014, accession number: NITE P-01812).

*) The abbreviations shown in the table are as follows.
ESC; Escherichia coli
COG; Corynebacterium glutamicum
COA; Corynebacterium alkanolyticum
CLA; Clostridium acetobutylicum

(10) Analysis of glucose and xylobiose Glucose and xylobiose in the culture broth were analyzed by the following HPLC.
A sample prepared by diluting 50 μl of the culture supernatant with 950 μl of water is used as a sample, and an HPLC device (manufactured by Tosoh Corporation) is used with a column of HPX-87P column (manufactured by BIO-RAD), a column temperature of 85 ^° C., water Was used as a mobile phase to separate sugars at a flow rate of 0.6 ml min- ¹ . Sugar was detected by a differential refractive index detector.

(11) Analysis of xylo- oligosaccharides and organic acids The xylo-oligosaccharides in the culture broth were analyzed by the following LC-ESIMS.
20 μl of the culture supernatant was mixed with 80 μl of acetonitrile and centrifuged, and the supernatant was used as a sample. Separation of xylo-oligosaccharides was performed using a TSKgel Amide-80 column (4.5 cm x 0.2 mm, manufactured by Tosoh Corporation) with an HPLC system (manufactured by Shimadzu Corporation) at a column temperature of 60 ^° C and a flow rate of 0.2 ml min ^-1 . The eluent composition was 10 mM ammonium acetate / acetonitrile with a continuous gradient (15 minutes) from 25/75 to 65/35.
Xylooligosaccharide was detected by using AB SCIEX QTRAP 5500 LC / MS / MS System (Applied Biosystems / MDS Analytical Technologies) and detecting negative ions to which acetic acid was added. The standard was purchased from Megazyme.
The organic acid in the culture was analyzed by the following HPLC.
A sample was prepared by mixing 50 μl of the supernatant on the culture with 950 μl of a 0.75 mM H ₂ SO ₄ aqueous solution. Separation of organic acids was performed with an HPLC system (manufactured by Shimadzu Corp.) using TSKgel OApack-A colum (30 cm x 7.8 mm, manufactured by Tosoh Corporation) at a column temperature of 40 ^° C and a flow rate of 1.0 ml min ^-1 . The eluent composition was 0.75 mM H ₂ SO ₄ aqueous solution. The organic acid was detected with a UV detector.

Example 2 Enzymatic Analysis of Xylooligosaccharide Degrading Enzyme The enzyme activity of XylD derived from Corynebacterium alkanolyticum obtained by fusing a histidine tag to the N-terminal obtained in Example 1 (5) above was measured.
β-xylosidase activity was measured at 33 ° C under a temperature of 33 ° C by adding 0.04, 0.1, 0.4 to the substrate p-nitrophenyl-β-D-xylopyranoside (hereinafter abbreviated as pNPX) in 100 mM HEPES (pH 7.0). The reaction was started by adding 1 μl of 1 μg / μl enzyme solution to the reaction solution added at 0.8, 2.0 or 2.0 mM concentration, and free p-nitrophenol was generated by Beckman DU800 spectrophotometer (manufactured by Beckman Coulter). This was done by monitoring the absorbance at nm. In addition, α-arabinofuranosidase activity was measured in the same manner as described above by adding p-nitrophenyl-α-arabinofuranoside (pNPA) as a substrate at each concentration of 0.2, 0.4, 1.0, 2.0 or 4.0 mM. Km and Vmax were obtained from the Lineweaver-Burk plot obtained from 1 / v and 1 / [S].

  As a result, the β-xylosidase of XylD derived from Corynebacterium alkanolyticum had Km, Vmax, and turn over number of 2.4 mM, 1.3 μmol s-1 μg-1, and 111 s-1 μg-1, respectively. In β-xylosidase of bacteria and fungi, the general β-xylosidase turnover nubmer is 0.02 to 30 s-1 μg-1, so β-xylosidase activity of XylD derived from Corynebacterium alkanolyticum is known to be a known xylosidase It became clear that it was in a high class among. The α-arabinofuranosidase activity of XylD derived from Corynebacterium alkanolyticum is Km, Vmax, and turn over number are 50.0 mM, 0.06 μmol s-1 μg-1, and 5 s-1 μg-1, respectively. -It was also shown to have arabinofuranosidase activity (Table 2).

  β-xylosidase is generally known to undergo product inhibition by xylose, and a typical inhibition constant Ki value for xylose is 2-10 mM. Therefore, we examined the product inhibition by xylose of XylD derived from Corynebacterium alkanolyticum.

  Inhibition constant Ki value was measured using 1 ml of 100 mM HEPES (pH 7.0) containing the substrate pNPX at a concentration of 0.4, 1.2 or 2.0 mM and xylose added at a concentration of 40, 60, 80 or 100 mM. The reaction was started by adding 1 μl of an enzyme solution of 1 μg / μl, and free p-nitrophenol was produced by monitoring absorption at 410 nm using a Beckman DU800 spectrophotometer (manufactured by Beckman Coulter). Each pNPX concentration condition was plotted with xylose concentration [I] and 1 / v, and the Ki value was determined from the intersection of the Lineweaver-Burk plots obtained from each pNPX concentration. As a result, the Ki value for xylose of Corynebacterium alkanolyticum XylD was 65 mM, and it was revealed that it is a class that is not susceptible to xylose inhibition among known β-xylosidases.

Example 3 Aerobic growth test using xylooligosaccharide as a carbon source Corynebacterium glutamicum X1, XYD1, and XYD2 (Table 1) were prepared using 50 μl of glycerol stock solution, 50 μg / ml of kanamycin and 4% [wt / vol] glucose. 2.5 ml A medium _{[(NH 2) 2 CO 2} g _{containing, (NH 4) 2 SO 4} 7 g, KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe ₂ SO ₄ .7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin 2 ml of solution, 2 g of yeast extract, and 7 g of vitamin assay casamino acid were dissolved in 1 L of distilled water] and then precultured by shaking culture at 33 ° C. for 16 hours.

2 ml of the preculture was collected by centrifugation, and BT medium [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO ₄ 0.5 g, K ₂ HPO ₄ 0.5 g, MgSO ₄ .7H ₂ O 0.5 g, 0.06% (w / v) Fe ₂ SO ₄ .7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml The cells were washed twice with 2% 0.01% (w / v) thiamin solution dissolved in 1 L of distilled water.

10 ml of BT medium containing kanamycin 50 μg / ml and 2% [wt / vol] xylo-oligosaccharide (Wako Pure Chemical) [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO _{4 0.5 g, K 2 HPO 4 0.5} g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H 2 O 1 ml , 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml dissolved in 1 L of distilled water] And cultured for 80 hours with shaking. The result is shown in FIG. In FIG. 2, the rhombus (♦) indicates the growth curve of the X1 strain, the square (■) indicates the growth curve of the XYD1 strain, and the triangle (▲) indicates the growth curve of the XYD2 strain.
The X1 and XYD1 strains could not grow, but only the XYD2 strain could grow.

Example 4 Substrate-specific Corynebacterium glutamicum XYD2 strain (Table 1) of XylEFG 50 μl of glycerol stock solution, 2.5 ml of A medium containing kanamycin 50 μg / ml and 4% [wt / vol] glucose [(NH ₂ ) _{2 CO 2 g, (NH 4)} 2 SO 4 7 g, KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay 7 g of casamino acid dissolved in 1 L of distilled water] was inoculated, and precultured by shaking culture at 33 ° C. for 16 hours.

2 ml of the preculture was collected by centrifugation, and BT medium [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO ₄ 0.5 g, K ₂ HPO ₄ 0.5 g, MgSO ₄ .7H ₂ O 0.5 g, 0.06% (w / v) Fe ₂ SO ₄ .7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml The cells were washed twice with 2% 0.01% (w / v) thiamin solution dissolved in 1 L of distilled water.

10 ml of medium A containing [kanamycin 50μg / ml and 0.5% [wt / vol] xylo-oligosaccharide (Wako Pure Chemical Industries) [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO _{4 0.5 g, K 2 HPO 4} 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H 2 O 1 Bacteria after washing in 1 ml of 0.02% (w / v) biotin solution, 1 ml of 0.01% (w / v) thiamin solution, 2 g of yeast extract and 7 g of vitamin assay casamino acid in 1 L of distilled water The body was transferred to an OD610 of 0.5 and cultured with shaking at 33 ° C. for 30 hours.

  The culture medium after centrifugation was centrifuged, and the supernatant was analyzed by LC-ESIMS. The result of the analysis of the medium immediately before the culture is shown in FIG. Xylooligosaccharides (Wako Pure Chemical Industries) have X2 (Xylobiose), X3 (Xylotriose), X4 (Xylotetraose), and oligosaccharides P3 to P6 corresponding to pentose oligomers with a molecular weight of 3 to 6 units. These are thought to be arabinoxylo-oligosaccharides. The results of analysis of the medium after culturing the XYD2 strain are shown in FIG. In the XYD2 strain, in addition to X2 (xylobiose), X3 (xylotriose), and X4 (xylotetraose) xylo-oligosaccharides, oligosaccharides P3 to P5 that seem to be arabinoxylo-oligosaccharides were almost completely consumed.

Embodiment 5 FIG. High expression effect of MsiK (ATP binding protein)
The sugar consumption of the XYD2 and XYD3 strains in the glucose and xylooligosaccharide mixed sugar medium was compared.
The xylEFGD gene cluster was expressed in Corynebacterium glutamicum X1 so that xylooligosaccharides could be efficiently incorporated. However, in the xylEFG gene cluster, there was no gene encoding an ATP-binding protein essential for ABC transporters, and it was considered that a factor complementary to the ATP-binding protein was expressed in Corynebacterium glutamicum.
The gene structure similar to the xylEFG gene cluster is similar to the genus Streptomyces [Appl. Environ. Microbiol. 65: 2636-2643 (1999). and J Bacteriol. 186: 1029-1037. (2004)] and the genus Bacillus [J Bacteriol. 192: 5312-5318. (2010).] ATP-binding protein MsiK, which is also found in ABC transporter genes involved in oligosaccharide uptake such as xylobiose and cellobiose reported in Streptomyces) [J Bacteriol. 179: 2092-2095. (1997).], Or MsmX (Bacillus genus) [J Bacteriol. 192: 5312-5318. (2010).] As ATP-binding proteins of these ABC transporters Function.
The use of native MsiK rather than a heterologous bacterial homologue suggests that the ABC transporter composed of XylEFG may function more efficiently. Therefore, the newly cloned msiK gene from Corynebacterium alkanolyticum The high expression effect of was confirmed.

In addition, the xylosidase activity of the XYD2 strain and the XYD3 strain (Table 1) was almost the same (Table 3).

For Corynebacterium glutamicum XYD2 and XYD3, add 50 μl of glycerol stock solution, 2.5 ml of A medium containing 50 μg / ml of kanamycin and 4% [wt / vol] glucose [(NH ₂ ) ₂ CO 2 g, (NH _{4) 2 SO 4 7 g,} KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO4.7H2O + 0.042% (w / v _{) MnSO 4 .2H 2 O 1 ml} , 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g of distilled water 1 L After inoculation, the cells were precultured at 33 ° C. for 16 hours by shaking culture.

2 ml of the preculture was collected by centrifugation, and BT medium [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO ₄ 0.5 g, K ₂ HPO ₄ 0.5 g, MgSO ₄ .7H ₂ O 0.5 g, 0.06% (w / v) Fe ₂ SO ₄ .7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml The cells were washed twice with 2% 0.01% (w / v) thiamin solution dissolved in 1 L of distilled water.

10 ml of BT medium containing kanamycin 50 μg / ml, 0.4% [wt / vol] xylo-oligosaccharide and 0.4% [wt / vol] glucose [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, _{KH 2 PO 4 0.5 g, K} 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml dissolved in 1 L of distilled water] Transferred and cultured at 33 ° C with shaking. The results of monitoring glucose and xylobiose consumption by HPLC are shown in FIG. In FIG. 4, the broken line indicates the sugar consumption of the XYD2 strain, the solid line indicates the glucose consumption, the circle (●) indicates glucose, and the triangle (▲) indicates xylobiose consumption. The results showed that both XYD2 and XYD3 strains were able to use glucose and xylobiose at the same time. The high expression of MsiK derived from alkanolytic cam increased the xylobiose consumption rate more than 3 times (Table 4).

Example 6 Utilization of symporter-type xylo- oligosaccharide transporter protein In addition to xyloside ABC transporters such as XylEFG-MsiK, symporters that do not require ATP energy such as Klebsiella oxytoca XynT [ Appl. Environ. Microbiol. 69: 5957-5967. (2003).] Is known. Therefore, the CA_C3451 gene of Clostridium acetobutylicum showing homology with Klebsiella oxytoca XynT was cloned and inserted downstream of the tac promoter of pCRB52Tk. This gene is hereinafter referred to as xynT. The homology of Clostridium acetobutylicum XynT to Klebsiella oxytoca XynT was 32.8% identity at the amino acid level. Clostridium acetobutylicum Expression plasmid pCRF104 (FIG. 1) incorporating the xynT gene and XylD high expression plasmid pCRF103 (FIG. 1) were simultaneously introduced to construct XYD5 strain (Table 1). In addition, as an xyloside ABC transporter expression strain, pCRF102 (Fig. 1) incorporating the Corynebacterium alkanolyticum xylEFGD-msiK gene and the XylD high expression plasmid pCRF103 (Fig. 1) were simultaneously introduced to construct the XYD4 strain (Table 1). The xylo-oligosaccharide consumption rates of both strains were compared.

Corynebacterium glutamicum XYD4 and XYD5 strains, glycerol stock solution 50 μl, kanamycin 50 μg / ml, chloramphenicol 5 μg / ml and 2.5 ml A medium containing 4% [wt / vol] glucose [(NH ₂ ) _{2 CO 2 g, (NH 4} ) 2 SO 4 7 g, KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4. 7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay 7 g of casamino acid dissolved in 1 L of distilled water] was inoculated, and precultured by shaking culture at 33 ° C. for 16 hours.

2 ml of the preculture was collected by centrifugation, and BT medium [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO ₄ 7 g, KH ₂ PO ₄ 0.5 g, K ₂ HPO ₄ 0.5 g, MgSO ₄ .7H ₂ O 0.5 g, 0.06% (w / v) Fe ₂ SO ₄ .7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml The cells were washed twice with 2% 0.01% (w / v) thiamin solution dissolved in 1 L of distilled water.

Kanamycin 50 μg / ml, Chloramphenicol 5 μg / ml, 10 ml of A medium containing 0.8% [wt / vol] xylo-oligosaccharide and 4% [wt / vol] glucose [(NH ₂ ) ₂ CO 2 g, (NH _{4) 2 SO 4 7 g,} KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% ( w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g The cells after washing were dissolved in 1 L of water] so that the OD610 was 0.2, and cultured with shaking at 33 ° C. The results of comparing the consumption of glucose and xylobiose by monitoring with HPLC are shown in FIG. The broken line indicates the XYD4 strain, the solid line indicates the XYD5 strain, the circle (●) indicates glucose and the triangle (▲) indicates xylobiose consumption. As a result, the consumption rate of xylobiose was 1.4 mM / h for the XYD4 strain, 1.8 mM / h for the XYD5 strain (Table 5), and the XYD5 strain expressing the symporter-type transporter was faster.

Example 7 Substrate specificity of XynT In addition to X2 (xylobiose), X3 (xylotriose), and X4 (xylobitetraose), the xylooligosaccharide used in this study is an oligo corresponding to a pentose oligomer with a molecular weight of 3 to 6 units. The sugars P3 to P6 are included and these appear to be arabinoxylo-oligosaccharides. FIG. 6 (1) shows the LCMS result of the supernatant on the medium immediately before the culture. As shown in Example 4 above, XylEFGD expression strains can consume all except oligosaccharide P6. Therefore, in order to examine the substrate specificity of Clostridium acetobutylicum XynT, the supernatant on the medium after culturing the XYD4 and XYD5 strains shown in Example 6 above was analyzed by LC-ESIMS. As a result, in the XYD4 strain shown in FIG. 6 (2), all but oligosaccharide P6 can be consumed, but in the XYD5 strain shown in FIG. 6 (3), X2 (xylobiose), X3 (xylotriose), X4 (xylotetra). Aus) was completely consumed, but almost no consumption was observed with respect to oligosaccharides P3 to P6 which seem to be arabinoxylo-oligosaccharides. This indicates that Clostridium acetobutylicum XynT has a high uptake rate of xylo-oligosaccharides but hardly arabinoxylo-oligosaccharides.

Example 8 FIG. Sugar consumption and organic acid production under reducing conditions
For XYD6 strain, XYD7, and XYD8 strain (Table 1), glucose, xylooligosaccharide consumption, and organic acid production under reducing conditions were examined.
Agar agar medium [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) _{2 SO 4 7 g, KH 2} PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / _{v) MnSO 4 .2H 2 O 1} ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g, agar 15 g Was dissolved in 1 L of distilled water]. After 24 hours, the cells were categorized into kanamycin 50 μg / ml, chloramphenicol 5 μg / ml, and 10 ml A medium containing 4% [wt / vol] glucose [(NH ₂ ) ₂ CO 2 g, (NH ₄ ) ₂ SO _{4 7 g, KH 2 PO 4 0.5} g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO _{4 .2H 2 O 1 ml, 0.02} % (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, dissolved in distilled water 1 L the vitamin assay casamino acid 7 g After inoculating (A ₆₁₀ > 10), shake culture at 33 ° C for 6 hours, and 8 ml of the culture solution contains 50 μg / ml kanamycin, 5 μg / ml chloramphenicol, and 4% [wt / vol] glucose 1L A medium _{[(NH 2) 2 CO 2} g, (NH 4) 2 SO 4 7 g, KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06% (w / v) Fe ₂ SO ₄ .7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) thiamin solution 2 ml, yeast extract 2 g, vitamin assay casamino acid 7 g dissolved in 1 L of distilled water] Pre-cultured by shaking culture at 200 rpm for 14 hours.

The preculture 1L cells were collected by centrifugation, BT-U medium _{1L [(NH 4) 2 SO} 4 7 g, KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g , 0.06% (w / v) Fe 2 SO 4 .7H 2 O + 0.042% (w / v) MnSO 4 .2H 2 O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) The cells were washed twice with 2 ml of thiamin solution dissolved in 1 L of distilled water.

BT-U medium the cells 6 g of washed _{48 ml [(NH 4) 2} SO 4 7 g, KH 2 PO 4 0.5 g, K 2 HPO 4 0.5 g, MgSO 4 .7H 2 O 0.5 g, 0.06 % (w / v) Fe ₂ SO ₄ .7H ₂ O + 0.042% (w / v) MnSO ₄ .2H ₂ O 1 ml, 0.02% (w / v) biotin solution 1 ml, 0.01% (w / v) Dissolve 2 ml of thiamin solution in 1 L of distilled water], transfer 40 ml of the solution to a reaction vessel, and mix glucose / xylo-oligosaccharide (15% [wt / vol] glucose + 7.5% [wt / vol] xylooligosaccharide) ) 10 ml was added to initiate the reaction under reducing conditions. The reaction temperature was 33 ° C., and the pH was maintained at pH 7.5 by adding 2.5 N aqueous ammonia using a pH controller.

The results of monitoring glucose and xylobiose consumption and organic acid production by HPLC are shown in FIG. The solid line shows sugar consumption and the broken line shows organic acid production. Circles (●) indicate glucose and triangles (▲) indicate xylobiose consumption. Diamonds (♦) indicate production of lactic acid and squares (■) indicate production of succinic acid. As a result, in the vector-introduced strain XYD6 strain not containing the protein gene having the xylo-oligosaccharide transport ability and β-xylosidase gene shown in FIG. ) And XYD8 strain shown in FIG. 7 (3) showed simultaneous use of glucose and xylobiose. Xylobiose consumption rate was 9.3 mM / h in XYD7 strain expressing XylEFG-MsiK derived from Corynebacterium alkanolyticum as a xylooligosaccharide transporter, and 58.4 mM / h in XYD8 strain expressing XynT derived from Clostridium acetobutylicum (Table 6). ), The XYD8 strain showed about 6 times the xylobiose consumption rate than the XYD7 strain. In the XYD7 and XYD8 strains that were able to consume xylo-oligosaccharides, the production of organic acids was significantly higher than the XYD6 strain, a vector-introduced strain that was not able to consume xylo-oligosaccharides.

Example 9 Substrate specificity under reducing conditions FIG. 8 shows the results of LC-ESIMS analysis of the supernatant on the reaction solution 24 hours after the reaction under the reducing conditions in Example 8 above. In the control strain XYD6 strain into which the vector containing no protein gene having the xylo-oligosaccharide transport ability and β-xylosidase gene shown in FIG. 8 (1) was introduced, no oligosaccharide consumption was observed. In the Corynebacterium alkanolyticum XylEFGD-MsiK expression strain shown in Fig. 8 (2), in addition to X2 (xylobiose), X3 (xylotriose), and X4 (xylotetraose), P3 and P4 that appear to be arabinoxylo-oligosaccharides Both of them were almost consumed, but unlike the aerobic culture shown in FIG. 3 (2) of Example 4 above, P5 was hardly consumed. In the XYD7 strain in which Clostridium acetobutylicum XynT shown in FIG. 8 (3) is expressed, X2 (xylobiose), X3 (xylotriose), X4 as in the aerobic culture shown in FIG. 6 (3) of Example 7 above. (Xylotetraose) was completely consumed, but P4 and P5 which seem to be arabinoxylo-oligosaccharides were not consumed at all. However, P3 was almost consumed.

Example 10 Saccharide consumption Corynebacterium alkanolyticum XylEFGD-MsiK-expressing XYD7 strain expressing xylo-oligosaccharide is slow, but arabinoxylo-oligosaccharide There are many varieties. On the other hand, the XYD8 strain expressing Clostridium acetobutylicum XynT has a fairly high uptake rate of xylo-oligosaccharides, but can hardly take up arabinoxylo-oligosaccharides. Therefore, we thought that if both transporters were co-expressed, xylooligosaccharides could be taken up quickly and arabinoxylooligosaccharides could be taken up.

  Corynebacterium glutamicum XYD9 strain (Table 1) was reacted under reducing conditions under the same conditions as shown in Example 8 above, and glucose and xylobiose consumption and organic acid production were monitored by HPLC. 7 (4). The solid line shows sugar consumption and the broken line shows organic acid production. Circles (●) indicate glucose and triangles (▲) indicate xylobiose consumption. Diamonds (♦) indicate production of lactic acid and squares (■) indicate production of succinic acid. The consumption rate of xylobiose was 49.6 mM / h, which was slightly lower than 58.4 mM / h of the XYD8 strain, but still showed a faster consumption rate compared to 9.3 mM / h of the XYD7 strain (Table 6).

  FIG. 8 (4) shows the results of LC-ESIMS analysis of the supernatant on the reaction solution 24 hours after the reaction under reducing conditions. In addition to X2 (xylobiose), X3 (xylotriose), and X4 (xylotetraose), XYD9 strain completely consumed P3, P4 and P5, which seem to be arabinoxylo-oligosaccharides. This indicates that the XYD9 strain has a fast uptake of xylo-oligosaccharide and can also take in arabinoxylo-oligosaccharide.

  The coryneform bacterium transformant of the present invention is extremely useful for efficiently producing biochemicals and biofuels from non-edible biomass such as agricultural residues and woody biomass.

Claims (19)

To the coryneform bacterium of the host, (A) a foreign gene encoding a protein having a xylo-oligosaccharide transporting ability that enables uptake of xylo-oligosaccharide from outside the cell into the cell, and (B) a protein having β-xylosidase activity. A coryneform bacterium transformant into which a foreign gene to be encoded is introduced,
A coryneform bacterium transformant, wherein the introduced foreign gene is at least one DNA selected from the following (a) and (b):
(a) DNA consisting of the nucleotide sequence of SEQ ID NO: 1
(b) DNA comprising a nucleotide sequence having a homology of 90% or more with SEQ ID NO: 1 or DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to SEQ ID NO: 1, comprising ABC DNA encoding a protein having a transporter-type transporter function To the coryneform bacterium of the host, (A) a foreign gene encoding a protein having a xylo-oligosaccharide transporting ability that enables uptake of xylo-oligosaccharide from outside the cell into the cell, and (B) a protein having β-xylosidase activity. A coryneform bacterium transformant into which a foreign gene to be encoded is introduced,
The foreign gene (A) is a DNA encoding the ABC transporter type (a) and / or (b) below and the symporter type transporter protein (c) and / or (d) below: Is there
The foreign gene of (A) is DNA encoding the ABC transporter type transporter protein of (a) and / or (b) below, or
A coryneform bacterium transformant, wherein the foreign gene of (B) is at least one DNA selected from the following (e) and (f):
(a) DNA consisting of the nucleotide sequence of SEQ ID NO: 1
(b) DNA comprising a nucleotide sequence having a homology of 90% or more with SEQ ID NO: 1 or DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to SEQ ID NO: 1, comprising ABC DNA encoding a protein having a transporter-type transporter function
(c) DNA consisting of the base sequence of SEQ ID NO: 2
(d) a DNA comprising a nucleotide sequence having 90% or more homology with SEQ ID NO: 2 or a DNA hybridizing under stringent conditions with a DNA comprising a nucleotide sequence complementary to SEQ ID NO: 2, DNA encoding a protein having a porter-type transporter function
(e) DNA consisting of the base sequence of SEQ ID NO: 3
(f) DNA consisting of a base sequence having 90% or more homology with SEQ ID NO: 3 or DNA hybridizing under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 3, -DNA encoding a protein having xylosidase activity To the coryneform bacterium of the host, (A) a foreign gene encoding a protein having a xylo-oligosaccharide transporting ability that enables uptake of xylo-oligosaccharide from outside the cell into the cell, and (B) a protein having β-xylosidase activity. A coryneform bacterium transformant into which a foreign gene to be encoded is introduced,
The foreign gene (A) is a DNA encoding ABC transporter type and / or symporter type transporter protein, and is at least one kind of DNA selected from the following (a) to (d): And
A coryneform bacterium transformant, wherein the foreign gene of (B) is at least one DNA selected from the following (e) and (f):
(a) DNA consisting of the nucleotide sequence of SEQ ID NO: 1
(b) DNA comprising a nucleotide sequence having a homology of 90% or more with SEQ ID NO: 1 or DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to SEQ ID NO: 1, comprising ABC DNA encoding a protein having a transporter-type transporter function
(c) DNA consisting of the base sequence of SEQ ID NO: 2
(d) a DNA comprising a nucleotide sequence having 90% or more homology with SEQ ID NO: 2 or a DNA hybridizing under stringent conditions with a DNA comprising a nucleotide sequence complementary to SEQ ID NO: 2, DNA encoding a protein having a porter-type transporter function
(e) DNA consisting of the base sequence of SEQ ID NO: 3
(f) DNA consisting of a base sequence having 90% or more homology with SEQ ID NO: 3 or DNA hybridizing under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 3, -DNA encoding a protein having xylosidase activity   The coryneform bacterium transformant according to claim 2 or 3, wherein the protein having xylooligosaccharide transport ability is an ABC transporter type transporter protein and a symporter type transporter protein. A foreign gene encoding an ABC transporter type xylo-oligosaccharide transporter protein is
(a) DNA consisting of the base sequence of SEQ ID NO: 1, or
(b) DNA comprising a nucleotide sequence having a homology of 90% or more with SEQ ID NO: 1 or DNA hybridizing under stringent conditions with DNA comprising a nucleotide sequence complementary to SEQ ID NO: 1, comprising ABC DNA encoding a protein having a transporter type transporter function,
A foreign gene encoding a symporter-type xylooligosaccharide transporter protein
(c) DNA consisting of the base sequence of SEQ ID NO: 2, or
(d) a DNA comprising a nucleotide sequence having 90% or more homology with SEQ ID NO: 2 or a DNA hybridizing under stringent conditions with a DNA comprising a nucleotide sequence complementary to SEQ ID NO: 2, The coryneform bacterium transformant according to claim 4, which is a DNA encoding a protein having a porter-type transporter function.   Furthermore, the coryneform bacterium transformant according to any one of claims 1 to 5, wherein a foreign gene encoding a protein having an ATP-binding site has been introduced. A foreign gene encoding a protein having an ATP-binding site is
(g) DNA consisting of the base sequence of SEQ ID NO: 4, or
(h) DNA consisting of a base sequence having 90% or more homology with SEQ ID NO: 4 or DNA hybridizing under stringent conditions with DNA consisting of a base sequence complementary to SEQ ID NO: 4, comprising ATP The coryneform bacterium transformant according to claim 6, which is a DNA encoding a protein having a binding site.   The coryneform bacterium transformant according to any one of claims 1 to 7, wherein the host coryneform bacterium is a coryneform bacterium having D-xylose utilization ability.   9. The coryneform bacterium transformant according to claim 8, wherein the coryneform bacterium having D-xylose utilization ability is a transformant into which a foreign gene encoding xylose isomerase and a foreign gene encoding xylulokinase are introduced. .   The coryneform bacterium transformant according to any one of claims 1 to 9, wherein the host coryneform bacterium is a transformant into which a foreign gene encoding a proton symporter of L-arabinose transport system is introduced.   Corynebacterium glutamicum Ind-araE / pCRA811 (Accession number NITE BP-576), Corynebacterium glutamicum X5-Ind-araE / Plac-araBAD (Accession number NITE BP-577), Corynebacterium The coryneform bacterium transformant according to claim 10, which is glutamicum X5-Ind-araE-Δldh / pEthAra (accession number NITE BP-581).   A foreign gene encoding an ABC transporter-type xylo-oligosaccharide transporter and a foreign gene encoding a protein having an ATP-binding site have been introduced, and these foreign genes are independently independent of Corynebacterium alkanolyticum. (Corynebacterium alkanolyticum), Microbacterium testaceum, Arthrobacter phenanthrenivorans, Cellulomonas flavigena, Bifidobacterium longum, Streptomyces cerevisiae The coryneform bacterium transformant according to any one of claims 1 to 11, which is a gene derived from (Streptomyces thermoviolaceus) or Geobacillus staero thermophilus.   A foreign gene encoding a symporter-type xylo-oligosaccharide transporter has been introduced, and this foreign gene is clostridium acetobutylycum, Lactobacillus brevis, Bacillus subtilis, or Klebsiella oxytoca The coryneform bacterium transformant according to any one of claims 1 to 12, which is a gene derived from oxytoca).   Foreign genes encoding β-xylosidase include Corynebacterium alkanolyticum, Microbacterium testaceum, Arthrobacter phenanthrenivorans, Cellulomonas flavigena, Bifidobacterium longum, Streptomyces scabiei, Clostridium acetobutylicum, Clostridium cellulolyticum, Lactobacillus rhamnosus lus, Lactobacillus rhamnosus Polymixer (Paenibacillus polymyxa) or Geobacillus thermoleovorans (Geobacillus thermoleovoran) The coryneform bacterium transformant according to any one of claims 1 to 13, which is a gene derived from s).   The coryneform bacterium transformant according to any one of claims 1 to 14, wherein the transformant of the coryneform bacterium is Corynebacterium glutamicum XYD9 (accession number NITE P-01812).   The step of reacting the coryneform bacterium transformant according to any one of claims 1 to 15 in a reaction solution containing xylooligosaccharide, or containing xylooligosaccharide and glucose or an oligomer or polymer comprising a glucose unit; Recovering the organic compound from the culture, and a method for producing the organic compound.   The method according to claim 16, wherein the organic compound is at least one selected from the group consisting of amino acids, organic acids, alcohols, nucleic acids, physiologically active substances, and organic gases.   The method according to claim 16 or 17, wherein the reaction is carried out in a reaction solution under reducing conditions.   The method according to claim 18, wherein the oxidation-reduction potential of the reaction solution under reducing conditions is -200 mV to -500 mV.