JP6351976B2 - Vaccination in elderly patients - Google Patents

Description

  The present invention provides at least one antigen for use in the treatment of disease in an elderly patient, preferably at least 50 years old, more preferably at least 55 years old, 60 years old, 65 years old, 70 years old or older. A vaccine comprising at least one encoding mRNA, wherein said treatment relates to a vaccine that vaccinates a patient and causes an immune response in said patient. The present invention is further directed to kits and kits of parts comprising such vaccines and / or components thereof, and methods of applying such vaccines or kits.

  As is evident, humanity has become very old in the past decades, reaching an unexpected maximum age. However, along with this, the incidence of many diseases related to aging is clearly increasing. As studied extensively by Fueloep et al. (Non-Patent Document 1), the incidence of infectious diseases, cancer, and chronic inflammatory diseases (eg, atherosclerosis and neurodegenerative diseases) increases with age. Although it is not yet known what the exact cause of aging is, it can be recognized that changes in the immune system play an important role in both the aging process and the increase in aging-related diseases.

  The main role of the immune system is to protect organisms from pathogens, but due to immunity changes associated with aging, the elderly suffer from not only infectious diseases but also cancer and autoimmune diseases. It becomes easy to do. Clearly, the immune system is a complex interactive system consisting of many different factors. However, these components do not all change in the same way and do not contribute equally to aging. Although immunosenescence may be conceptualized as a dysregulation of a constitutively adaptable system, not only the pathway that connects these, but also its input / output is still roughly defined. At the whole organism level, in addition to controlling glucose metabolism, many studies have been reported on changes in endocrine and neural function, cardiovascular, muscle, and skeletal health. It should be noted that these diverse physiological changes also affect the immune system, but only a few researchers are addressing these issues, especially in humans. Much research has been done on immune changes related to aging (collectively known as “immune aging”), but due to interspecies differences and the lack of a definition of physiological aging. However, it is difficult to exclude some potential disease states, nutritional, genetic, and environmental differences among a number of factors, and their exact nature is still under discussion. There is room. However, the clinical consequences of reduced immune response with aging appear to be fairly clear. The clinical consequence is mainly an increase in the incidence and severity of cancer and autoimmune diseases in addition to infectious diseases. Many elderly subjects are actually killed by infectious diseases, even if the causes of death determined by the attending physician are quite different.

  The exact nature of these changes is still controversial, but the use of screening procedures (eg, the SENIEUR protocol) to rule out the underlying disease is actually related to physiological aging rather than pathology It helps to better characterize the changes that occur (see Non-Patent Document 1). An indicator of immunosenescence is a significant decrease in T cell function associated with aging. In this situation, it is generally accepted that the most significant changes occur in the cellular immune response that reflect large changes in T cells. Much of this is due to changes in the proportion of T cell subpopulations caused by antigen exposure and changes in the T cell activation pathway in addition to thymic regression. Changes occur in other parts of the immune system, but these are much lesser and can often occur secondary to changes in T cells (not only T cell-dependent B cells, but T Cellular feedback, especially innate components that are sensitive to antigen presenting cells). The changes in immune response associated with such aging are multifactorial, but it is reasonable to think that the extracellular environment is very important. Furthermore, physical data indicate that the innate immune response, including an important bridge between innate and adaptive immunity, and the ability to present antigens are not well tolerated against the aging process. All these changes result in an increased incidence of cancer, autoimmune diseases, and chronic inflammatory diseases, in addition to infections (see Non-Patent Document 1).

The major changes in T cells described above are particularly associated with CD4 + T cells and CD8 + T cells. The function of senescent CD4 + T cells has been extensively studied and distinct defects have been characterized, but the effects of senescence on CD8 + T cell function are poorly understood. The apparent deterioration of the effector function of CD8 + T cells has been suggested to result from changes in the composition of the pool of CD8 + T cells in relation to senescence, which is sufficient for naive CD8 + T cells from aged mice. Consistent with reports that it works. The ability of an individual to generate an effective T cell response to a newly encountered infection and to respond to vaccination requires maintaining a diverse repertoire of T cells. Thus, the reduced diversity of T cell repertoire associated with aging is believed to be a factor that impairs the ability of aging individuals to initiate an effective immune response against infections and vaccines. The functional diversity of the αβTCR repertoire in the spleen of young mice is estimated to be about 2 × 10 ⁶ clones (about 10 cells per clone). However, some senescence-related changes are thought to reduce both the size and diversity of the naïve T cell repertoire. The fewer T cells produced in the thymus, the fewer naive T cells in the periphery. In addition, the naive T cell repertoire is gradually limited as the accumulation of peripheral T cells exhibiting a memory phenotype that appears to be the result of the accumulation of antigenic experience in the individual progresses. The diversity of the memory repertoire is further impaired by the expression of clonal expansion of CD8 + T cells associated with senescence, which can account for 70% -80% or more of the total CD8 + T cell fraction in some aging animals. In summary, the decrease in the number and diversity of naive T cells generated from senescent thymus, the progressive increase in the proportion of antigen-experienced T cells compared to naive T cells, and the expression of large clonal proliferation is Substantially reduces the diversity of CD8 + T cells in mice (see Non-Patent Document 2).

  In this context, Non-Patent Document 2 shows the effect of aging on the diversity of antiviral CD8 + T cell responses in studies using well-characterized influenza virus models. The data of Non-Patent Document 2 show experimental evidence that a decrease in CD8 + T cell repertoire diversity associated with aging can have a major impact on the response to new infections and the development of heterosubtype immunity. provide. Importantly, disruption of the T cell repertoire specific for influenza virus epitopes with low precursor frequency and limited TCR diversity will selectively repertoire the virus epitopes that are typically immunodominant. Missing. The T cell repertoire is often characterized by either an exhaustive sequence analysis of individual cells or a spectral type analysis of a bulk population of T cells, and these two techniques provide different information.

  In addition to changes in CD4 + and CD8 + T cell responses, a shift from Th1 cytokines (including IFN-γ) to Th2 cytokines (including IL-10) with aging has been observed, and CTL activity against influenza virus exposure Associated with decline and reduced defense. Note that influenza virus is cleared by CTL by killing host cells infected with the virus through the granules. In this process, granzyme B (GrB) is regarded as an important cytolytic mediator and early marker of CTL response to influenza infection. Virus-specific CTLs are recruited to influenza-infected lungs by a Th1 response, particularly due to the production of IFN-γ. Although influenza-specific Th2 cytokines, including IL-10, do not promote recovery from influenza infection, these cytokines continue to be expressed at high levels at the site of influenza infection. Thus, the balance between Th1 and Th2 cytokines may also be important for viral clearance (see Non-Patent Document 3).

  It is believed that not only immunosenescence in the T cell response but also immunosenescence in the B cell response has a severe impact on immune defense in elderly patients. The B cell response in later years is mainly characterized by its serum profile (see Non-Patent Document 4). As discussed in [4], successful recovery from viral and bacterial infections requires a good humoral immune response, as indicated by increased levels of specific antibodies following infection. Surviving to age requires the creation of a huge “reserva” that responds well to a wide range of potential pathogens and is immune memory. The measurable titer of serum antibodies is stable and has the ability to be maintained over a long period of time. Antibody responses to viruses such as herpes zoster, measles, and mumps have a half-life of 50 years or more, but the half-life of antibody responses to non-replicating protein antigens such as tetanus and diphtheria toxin is 10 years. It is as short as 20 years. This suggests that the persistence of the antigen contributes to the continuous production of antibodies, as shown by studies in mice. Unfortunately, the ability to respond to new potential pathogens does not increase at an exponential rate throughout life. In fact, even for mechanistically different reasons, it can be found that elderly patients do not have the ability to respond to new antigens. This evidence in aging individuals comes from measuring changes in specific antibody levels at specific times after vaccination. As an example, the ability of influenza vaccines to induce protection is age related, being 70% -90% effective below 65 years old, but up to 30% -40% above 65 years old. Similarly, the response to pneumococcal polysaccharide and hepatitis B vaccine is impaired by aging, and in healthy elderly people, the duration of antibody response is short (see Non-Patent Document 4).

  Epidemiological studies have further shown that autoantibody titers increase with age in a population of older individuals. These autoantibody titers are usually not associated with autoimmune diseases, probably due to the low affinity of the antibodies. More than half of healthy elderly individuals have antibodies against non-organ-specific autoantigens (such as nucleoprotein or IgG) due to the production of said antibodies as a byproduct of responses to other antigens. There is a possibility. Indeed, early studies have shown that immediately after vaccination with tetanus toxoid, the frequency of B cells producing rheumatoid factor increased significantly with increasing plasma concentrations of IgM rheumatoid factor. In addition, the prevalence of organ-specific antibodies (such as thyroid antibodies) increases in an age-dependent manner. As can be seen from studies that have shown that the prevalence of organ-specific autoantibodies over 100 years of age is similar to that seen in individuals younger than 50 years, this increase is not considered exponential. Further changes in serum profiles in older individuals were revealed by the presence of a single spike in the gel within the region of the electrophoresis gel associated with immunoglobulin. These paraproteins are produced by clones of plasma cells with specific monospecificity (a condition known as benign monoclonal immunoglobulin abnormalities). The prevalence of this condition increases with age: 3.2% of individuals over 50 years old, 5.3% of individuals over 70 years old and 7.5% of individuals over 85 years old Suffers from this disease. The difference in serum antibody profiles between these age groups is due to increased serum immunoglobulin levels among older individuals, increased presence of autoantibodies, and low affinity antibodies in older people, and individual B cells in some older individuals Includes the occurrence of a specific class of over-presentation of antibodies from clones (see Non-Patent Document 4).

  Changes in B cell responses in addition to T cell responses are not only noted in immune protection against pathogens, as described above, but also in vaccination methods in elderly patients when fighting infections, and in some cases cancer and autoimmune diseases The effect. Therefore, it was not surprising that similar observations were obtained in the treatment of elderly cancer patients, preferably when using vaccines in the art.

  One previous approach to overcoming the propositional deficiencies associated with virus-derived influenza vaccines refers to the administration of hemagglutinin (HA) and / or nucleoprotein (NP) influenza virus genes (non-patented). See reference 5.) Radu et al. Have been developed as a human vaccine due to the toxicity issues of such vaccinia-derived vaccines, despite the fact that recombinant vaccinia vaccines against old mice provide large antibody- and immune responses and complete protection. Discusses the finding that it is hindered. Thus, Radu et al. Can overcome the problems associated with aging in the immune response of aged mice by immunization with a recombinant vaccinia vaccine expressing the influenza hemagglutinin gene, and influenza protection in aged mice provides complete protection. It suggests that it can be triggered. Radu et al. Provide DNA-based plasmid vaccines that express hemagglutinin (HA) and nucleoprotein (NP) influenza virus genes, and such DNA-based plasmid vaccines (pHA and pNP, respectively) are safe in various animal species. And has been shown to be effective in inducing protective immunity against influenza. Radu et al. Concluded that old and adult mice vaccinated with pHA were protected to the same extent from lethal exposure to live WSN influenza virus. Radu et al. Further show that continuous antigen production after DNA vaccination stimulates B cells and T cells to the same extent in aged and adult mice, but the diversity of antibody responses in aged mice is higher than in adult mice. We concluded that it was limited. However, although such a strategy was promising at the time of conducting the above experiment, it required further administration of a DNA-based vector, which is considered dangerous because it is undesirably inserted into the genome. . Such DNA-based vectors are not attracting attention today because they may lead to disruption of functional genes and formation of cancer or anti-DNA antibodies.

  Further more realistic strategies for using vaccines in elderly patients, for example, to combat infectious diseases, are based on delivering current vaccines or new vaccine candidates with adjuvants. However, only a few adjuvants have been approved for human use. One major adjuvant approved for human use is, for example, alum, an adjuvant derived from aluminum salts. However, although approved for human use, aluminum salts, etc. are an effect that can be expected in other vaccination methods as well, sufficiently enhancing the immune response of seasonal influenza vaccines in early human clinical trials Could not provide. Further licensed adjuvant influenza vaccines include Fluad® (Novatis Vaccines) containing MF59 in combination with subunit vaccine formulations, Virosome vaccine Inflexal® V (Berna Biotech, a Crucell company) ), And Invivac® (Solvay). Although animal studies and human clinical trials revealed a higher immunogenic profile, defined as an increased antibody response with MF59 adjuvanted influenza vaccine, MF59 is potent in inducing a cellular immune response induced by type 1 Is not a good adjuvant. Unlike Fluad®, virosome vaccines represent a reconstituted influenza virus envelope that contains functional influenza surface proteins hemagglutinin and neuraminidase in a phospholipid bilayer. Several studies have shown the immunogenicity and local tolerance of influenza vaccines derived from virosomes. However, the development of virosome formulations is very complex and the cost of the article is high.

  In this situation, Riedl et al. (See Non-Patent Document 6) report on the development of a synthetic two-component adjuvant IC31® with the characteristics that it may contribute to the improvement of influenza vaccines. IC31® is a mixture of a novel immunostimulatory oligodeoxynucleotide containing deoxy-inosine / deoxy-cytosine (ODN1a) and the peptide KLKL5KLK (KLK). Apart from effective vaccine depot formation mediated by KLK, IC31® induces activation of antigen-presenting cells when combined with different types of antigens, and is predominantly type 1 T cell responses and B Strongly stimulates both cellular responses. In these studies, the immunostimulatory effect of IC31® on seasonal subunit influenza vaccines was examined. Non-Patent Document 6 provides evidence for antigen dose savings and the induction of type 1 humoral and cellular responses that persist and are apparent even in older animals. As shown in these experiments, when HI antibody was measured when a small amount of influenza vaccine was inoculated into old mice once in combination with IC31 (registered trademark), no immune enhancement was observed on the 21st or 80th day. It was. However, when boosted on the 21st day using the same amount of influenza vaccine containing IC31 (registered trademark), HI titers against all three strains were increased 3 weeks after boosting compared to when the vaccine was administered alone. Increased dramatically. Although the immune response has increased significantly, the strategy outlined in Non-Patent Document 6 requires additional booster doses after administration of the influenza vaccine improved with IC31®. Furthermore, this effect is believed to be at least partly dependent on the patient being treated being pre-exposed to a particular influenza strain, and thus may not be similar to an immune response against a completely new pathogen There is. It does not reflect the requirements of vaccination strategies, such as the treatment of cancer or autoimmune diseases.

  Studies on cancer vaccines are also being conducted. Gravekamp (see Non-Patent Document 7) shows T cell unresponsiveness in cancer patients and the elderly, results of cancer vaccination in preclinical models and clinical trials, and cancer vaccination for the elderly in preclinical models. It outlines current findings on recent data. Finally, Non-Patent Document 7 proposes an experimental approach to provide a more effective cancer vaccine in the elderly. Gravekamp has developed a Mage-b DNA vaccine and tested it in young and old mice of the syngeneic mouse tumor model 4TO7cg. This mouse tumor model is moderately metastatic (range: 2 to 20 metastases per mouse) and overexpresses Mage-b in primary tumors and metastases (8). When young and old mice were vaccinated with pcDNA3.1-Mage-b, 90% of the young mice were protected from metastasis, but only 60% did not metastasize in the old mice. It was. Analysis of spleen cells of tumor-bearing mice after in vitro restimulation showed high levels of IL-2 and IFN-γ in young mice, but undetectable levels in old mice, This suggests that the immune response in old mice is poor. Non-Patent Document 7 also repeated the study of this vaccine in the much more invasive metastasis model 4T1 (range: 5 to 300 metastases per mouse) that similarly overexpresses Mage-b. 1-Mage-b DNA vaccine was mixed with plasmid DNA secreting GM-CSF. In order to more efficiently mobilize APC into the peritoneal cavity (pc), thioglycolate was injected into the pc prior to each vaccination. Although the effect in young mice was stronger than in old mice, there was a marked decrease in the frequency of metastasis in both young and old mice. However, when the draining lymph nodes of tumor-bearing mice were analyzed, medium levels of IL-2 and IFN-γ were detected after re-stimulation in young mice, but not in old mice. In addition, FACS analysis of draining lymph nodes of tumor-bearing mice vaccinated with young and old Age-b after restimulation revealed that young mice had CD4 + and CD8 + responses (intracellular IL-2 and / or IFN-γ production). ) But not old mice. In aged mice, the activity of macrophages and NK cells was higher (intracellular production of IFN-γ and IL-2 receptor expression). This suggests that the innate immune response may contribute to the anti-tumor response in mice. Thus, Non-Patent Document 7 shows that even if the vaccine is optimized for the elderly, cancer vaccines may not be as effective in cancer patients who are usually elderly.

  In summary, there is an urgent need to optimize the vaccine for elderly patients. More precisely, there is a need for a vaccine that provides a good immune response and does not have the problems shown in the prior art, or at least to a great extent alleviate these problems. Furthermore, it is highly envisaged to provide a vaccine that allows the induction of a Th1 immune response in elderly patients and preferably does not result in a shift from a Th1 immune response to a Th2 immune response after administration. Similarly, administration of DNA-derived vaccines should be avoided for reasons of possible integration of DNA into the genome, possible gene disruption, and formation of anti-DNA antibodies.

Fueloep et al., Clinical Interventions in Aging, 2007: 2 (I), 33-54). Yager et al., JEM, Vol. 205, March 17, 2008 McElhanney et al., The Journal of Immunology, 2006, 176: 6333-6339. Claire-Anne Siegrist and Richard Aspinall, Nature Reviews Immunology, Volume 9, March 2009, pp. 185-194 Radu et al., Viral Immunology, Vol. 12, Number 3, 1999 Riedl et al., Vaccine 26 (2008), 3461-3468) Claudia Gravekamp, Exp Gerontol. 2007 May; 42 (5): 441-450) Spynieska et al., 2005

  The object underlying the invention is more preferably solved by the subject matter of the appended claims, as outlined below.

  According to a first embodiment, the underlying object of the present invention is to treat diseases in elderly patients exhibiting at least 50 years old, more preferably at least 55 years old, 60 years old, 65 years old, 70 years old or older. A vaccine comprising at least one mRNA encoding at least one antigen for use in at least one of prevention and treatment, wherein said treatment comprises vaccination of said patient and elicits an immune response in said patient Solved by a vaccine characterized by

  Without being bound by theory, RNA vaccines properly integrate adjuvanticity and antigen expression, thereby mimicking the relevant aspects of viral infection. This improves their efficiency and simplifies handling and production compared to other inactivated (dead) vaccines that require the use of advanced adjuvants in the elderly. RNA synergizes with Toll-like receptor 3, Toll-like receptor 7, Toll-like receptor 8, RIG-I, MDA5, PKR and induces antigen-specific adaptive B and T cell responses A range of dedicated immunological pattern recognition receptors can be addressed, such as others that can serve to enhance the function. Importantly, due to the synthesis of the antigen in the transfected host cell, the mRNA vaccine directly introduces the antigen into the cellular antigen processing and presentation pathway, regardless of the host MHC haplotype, and into the MHC molecule. Access and induce a T cell response. This allows the induction of polyclonal T cell responses that can act synergistically with other immune responses including B cells. Also, presentation of the full spectrum of MHC binding epitopes may circumvent the limitations due to “holes” in the elderly T cell repertoire. In addition, internal production of antigens ensures precise post-translational modifications (eg proteolytic processing and glycosylation, etc.) that can positively affect immunogenicity. RNA vaccines also exhibit a safety function that makes them excellent for use in the elderly. For example, increased attenuated live vaccine reactivity is generally associated with this highly relevant target population (ie, asthma or severe disease (eg, cancer Etc.) and prevent use in humans with chronic conditions such as). However, given the short persistence and traceless decay of vaccine vectors over several days, the good immunogenicity observed is unexpected and varies in its effectiveness for the sustained expression of antigens. Contrast with the requirements of related plasmid DNA vaccines.

  At least one mRNA of the vaccine of the present invention as defined in the first embodiment of the present invention encoding at least one antigen is preferably for those skilled in the art suitable for eliciting an antigen-specific immune response in a patient. It can be selected from any known antigen. According to the present invention, the term “antigen” is recognized by the immune system and can elicit an antigen-specific immune response, for example by the formation of antibodies or antigen-specific T cells as part of an adaptive immune response. A substance that can be produced. In this context, the first step of the adaptive immune response is the activation of naive antigen-specific T cells, or different immune cells that can induce an antigen-specific immune response by antigen-presenting cells. This occurs in lymphoid tissues and organs through which naive T cells pass continuously. Three types of cells that can function as antigen presenting cells are dendritic cells, macrophages, and B cells. Each of these cells has a different function that elicits an immune response. Tissue dendritic cells take up antigens by phagocytosis and macropinocytosis, and are stimulated, for example, by contact with foreign antigens to migrate to local lymphoid tissues and differentiate into mature dendritic cells. Macrophages take up particulate antigens such as bacteria and are induced by infectious agents or other suitable stimuli to express MHC molecules. The unique ability to bind and absorb soluble protein antigens via their receptors on B cells is also important for inducing T cells. Presenting antigens on MHC molecules results in activation of T cells, which induces their proliferation and differentiation into armed effector T cells. The most important functions of effector T cells are the killing of cells infected by CD8 + cytotoxic T cells and the activation of macrophages by TH1 cells, and TH2 and TH1 cells, which cooperate to create cell-mediated immunity Both activate B cells to produce different classes of antibodies, thereby driving the humoral immune response. Rather than directly recognizing and binding antigens, their T cell receptors that instead recognize short peptide fragments such as pathogen proteins bound to MHC molecules on the surface of other cells T cells recognize the antigen.

  In the context of the present invention, the antigen encoded by at least one mRNA of the vaccine of the present invention typically comprises any antigen falling within the above definition, more preferably protein and peptide antigens. According to the present invention, the antigen encoded by at least one mRNA of the vaccine of the present invention is an extracellularly generated antigen, more typically an antigen that is not derived from the host organism (eg, human) itself (ie, Non-self antigens), more precisely antigens derived from host cells outside the host organism, such as pathogenic antigens, in particular viral antigens, bacterial antigens, fungal antigens, protist antigens, animal antigens (preferably Selected from animals or organisms disclosed herein), and allergic antigens. The antigen encoded by at least one mRNA of the vaccine of the present invention may further be an antigen produced in a cell, tissue or body, for example, by protein secretion, degradation, metabolism and the like. Such antigens include antigens derived from the host organism (eg, human) itself, such as tumor antigens, self-antigens such as autoimmune self-antigens, auto-antigens, etc. In addition, the (non-self) antigen described above is originally derived from a host cell outside the host organism, but is fragmented or degraded in the body, tissue or cell by, for example, (protease) degradation and metabolism.

  As the pathogenic antigen, for example, an antigen derived from influenza, preferably an antigen derived from influenza A, influenza B, influenza C or togotovirus, preferably hemagglutinin (HA) or neuraminidase (NA) of the influenza antigen Preferably, hemagglutinin subtypes H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14 or H15 derived influenza antigens and neuraminidase subtypes N1, N2 , N3, N4, N5, N6, N7, N8 or N9, or preferably influenza A subtype H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N3, H5 1, selected from H5N2, H7N7 or H9N2, or any further combination, or selected from matrix protein 1 (M1), ion channel protein M2 (M2), nucleoprotein (NP), etc. Examples include antigens derived from respiratory syncytial virus (RSV) including F protein and G protein.

  One further class of antigens encoded by at least one mRNA of the vaccine of the present invention includes allergic antigens. Allergic antigens are antigens that can be derived from humans or other sources that typically cause allergies in humans. Such allergic antigens can be selected from antigens derived from different sources such as animals, plants, fungi and bacteria. Examples of allergens related to this include, for example, antigens derived from grass, pollen, mold, medicine, or many environmental factors. Allergic antigens typically belong to different classes of compounds such as proteins or peptides, and fragments thereof, carbohydrates, polysaccharides, saccharides, lipids and phospholipids. Of particular interest in connection with the present invention is the antigen encoded by at least one mRNA of the vaccine of the present invention, ie protein antigen or peptide antigen and fragments or epitopes thereof or nucleic acid and fragments thereof, in particular such Protein antigens or nucleic acids encoding protein antigens and fragments or epitopes thereof and fragments thereof.

  Particularly preferred animal-derived antigens encoded by at least one mRNA of the vaccine of the present invention include, but are not limited to, mites (eg house dust mites), mosquitoes, bees (eg bees, bumblebees), cockroaches, ticks, moths ( For example, silkworm, bug, bug, bee, caterpillar, fruit fly, grasshopper, grasshopper, grasshopper, ant and aphid, shrimp, crab, krill, lobster, prawn ), Derived from crustaceans such as crayfish and large shrimp (scampi), derived from birds such as ducks, geese, seagulls, turkeys, ostriches and chickens, eel, herring, carp, Thailand, cod, halibut, catfish, beluga, salmon, flounder , Fish such as mackerel, cuttlefish and perch From scallops, octopus, abalone, snails, welks, squid, clams and mussels, molluscs, spiders, cows, rabbits, sheep, lions, jaguars, leopards, rats, pigs, buffalo, dogs, loris, Hamsters, guinea pigs, fallow deer, horses, cats, mice, ocelots, servals and other mammals, spiders and spotted arthropods, nematodes and other helminths, Trichinella species or roundworms, amphibians It may contain an antigen derived from squirt or the like. An animal-derived antigen is also an antigen contained in an animal product, preferably an antigen contained in an animal product derived from an animal such as milk, egg and meat as defined above, but any antigen from any of these animals It may contain antigens from these types of excreta or deposits.

  Most preferably, as a particularly preferred animal-derived antigen encoded by at least one mRNA of the vaccine of the invention, a disease as defined herein, preferably an infectious disease or an autoimmune disease as defined herein, Alternatively, it may contain antigens from such animals that cause any further disease as defined herein.

  Plant-derived antigens encoded by at least one mRNA of the vaccine of the present invention include, but are not limited to, kiwi, pineapple, jackfruit, papaya, lemon, orange, mandarin, melon, strawberry, strawberry, litchi, apple , Cherry paradise apple (cherry paradise apple), mango, passion fruit, plum, apricot, nectarine, pear, passion fruit, raspberry, grapes and other fruits, garlic, onion, leek, soy, celery, cauliflower, turnip, paprika , Chickpeas, fennel, zucchini, cucumbers, carrots, yams, beans, olives, tomatoes, potatoes, lentils, lettuce, avocado, parsley, horseradish, chili moya Derived from vegetables such as beet, pumpkin and spinach, derived from spices such as mustard, coriander, saffron, pepper and anise, derived from crops such as oats, buckwheat, barley, rice, wheat, corn, rape and sesame, cashew, walnut, butter Trees such as nuts, pistachios, almonds, hazelnuts, peanuts, Brazil nuts, pecans and chestnuts, alder trees, hornbeam, cedar, birch, hazel, beech, ash, privet, oak, plane tree, cypress and palm Origin, Ragweed, Carnation, Forsythia, Sunflower, Lupine, Chamomile, Lilac, Passiflora and other flowers, Shibamugi, Common Vent, Bromegrass, Bermudagrass, Hurghaya, Hosomugi, etc., or Poppy, Pilet Um, it can include psyllium, tobacco, asparagus, other antigens derived from plants such as Artemisia and cress.

  Antigens derived from fungi encoded by at least one mRNA of the vaccine of the present invention include, but are not limited to, for example, Alteria sp., Aspergillus sp., Beauveria sp. ), Candida sp., Cladosporium sp., Endothia sp., Curraria sp., Embellisia sp., Epicoccum spi ), Fusarium sp., Malassezia sp., Penicillium sp. It may include Pureosupora genus (Pleospora sp.) And Saccharomyces (Saccharomyces sp.) Antigens derived from such.

  Antigens derived from bacteria encoded by at least one mRNA of the vaccine of the present invention include, but are not limited to, for example, Bacillus tetani, Staphylococcus aureus and Streptomyces griseus ( Antigens from Streptomyces grieseus) and the like.

  One further class of antigens encoded by at least one mRNA of the vaccine of the present invention includes tumor antigens. “Tumor antigens” are preferably located on the surface of (tumor) cells. Tumor antigens may also be selected from proteins that are overexpressed in tumor cells compared to normal cells. Moreover, tumor antigens also include antigens that are not (but not originally) denatured cells themselves (or originally not) but are expressed in cells associated with the envisaged tumor. Also included herein are growth factors such as tumor supply vessels or antigens associated with their (re) formation, in particular those associated with their neovascularization, such as VEGF and bFGF. Antigens associated with tumors further include antigens derived from cells or tissues, particularly antigens derived from cells or tissues in which tumors are implanted. In addition, some substances (usually proteins or peptides) are expressed in patients with cancer disease (announced or unannounced), resulting in increased concentrations of those substances in the patient's body fluids . These substances are also referred to as “tumor antigens”, but are not antigens in the strict sense of immune response inducers. The class of tumor antigens is further divided into tumor specific antigens (TSA) and tumor associated antigens (TAA). TSA is presented only from tumor cells and not from normal “healthy” cells. They are typically derived from tumor specific mutations. More common TAAs are usually presented to both tumor cells and healthy cells. These antigens are recognized and antigen presenting cells can be destroyed by cytotoxic T cells. In addition, tumor antigens can also arise on the surface of tumors, for example in the form of mutated receptors. In this case, they can be recognized by the antibody. According to the present invention, the terms “cancer disease” and “tumor disease” are used interchangeably herein.

Examples of tumor antigens encoded by at least one mRNA of the vaccine of the present invention include, but are not limited to, for example, 5T4, 707-AP (707 alanine proline), 9D7, AFP (α-fetoprotein), AlbZIP HPG1 , Α5β1-integrin, α5β6-integrin, α-methylacyl-coenzyme A racemase, ART-4 (adenocarcinoma antigen recognized by T cell 4), B7H4, BAGE-1 (B antigen), BCL-2, BING- 4, CA 15-3 / CA 27-29, CA 19-9, CA 72-4, CA125, calreticulin, CAMEL (CTL-recognizing antigen of melanoma), CASP-8 (caspase-8), cathepsin B Cathepsin L, CD19, CD20, CD22, CD25, CD 0, CD33, CD40, CD52, CD55, CD56, CD80, CEA (carcinoembryonic antigen), CLCA2 (calcium activated chloride channel-2), CML28, coactosin-like protein, collagen XXIII, COX-2, CT-9 / BRD6 (bromodomain testis specific protein), Cten (C-terminal-tensin-like protein), cyclin B1, cyclin D1, cyp-B (cyclophilin B), CYPB1 (cytochrome P450 1B1), DAM-10 / MAGE-B1 (differentiation antigen melanoma 10), DAM-6 / MAGE-B2 (differentiation antigen melanoma 6), EGFR / Her1, EMMPRIN (tumor cell-bound extracellular matrix metalloproteinase inducer /), EpCam (epithelial cell adhesion) Child), EphA2 (Ephrin type A receptor 2), EphA3 (Ephrin type A receptor 3), ErbB3, EZH2 (enhancer of zest homolog 2), FGF-5 (fibroblast growth factor-5), FN (fibronectin) ), Fra-1 (Fos-related antigen-1), G250 / CAIX (glycoprotein 250), GAGE-1 (G antigen 1), GAGE-2 (G antigen 2), GAGE-3 (G antigen 3), GAGE -4 (G antigen 4), GAGE-5 (G antigen 5), GAGE-6 (G antigen 6), GAGE-7b (G antigen 7b), GAGE-8 (G antigen 8), GDEP (different to prostate) Gene expressed in the form), GnT-V (N-acetylglucosaminyltransferase V), gp100 (glycoprotein 100 kDa), GPC3 (glypican 3) HAGE (helicase antigen), HAST-2 (human signet ring tumor-2), hepsin, Her2 / neu / ErbB2 (human epithelial receptor-2 / neurological), HERV-K-MEL, HNE (human neutrophils) Elastase), homeobox NKX 3.1, HOM-TES-14 / SCP-1, HOM-TES-85, HPV-E6, HPV-E7, HST-2, hTERT (human telomerase reverse transcriptase), iCE (intestine Carboxylesterase), IGF-1R, IL-13Ra2 (interleukin 13 receptor α2 chain), IL-2R, IL-5, immature laminin receptor, kallikrein 2, kallikrein 4, Ki67, KIAA0205, KK-LC-1 ( Kitakyushu Lung Cancer Antigen 1), KM-HN-1, LAGE-1 (L antigen), Livin, M GE-A1 (melanoma antigen-A1), MAGE-A10 (melanoma antigen-A10), MAGE-A12 (melanoma antigen-A12), MAGE-A2 (melanoma antigen-A2), MAGE-A3 (melanoma antigen-A3), MAGE-A4 (melanoma antigen-A4), MAGE-A6 (melanoma antigen-A6), MAGE-A9 (melanoma antigen-A9), MAGE-B1 (melanoma antigen-B1), MAGE-B10 (melanoma antigen-B10), MAGE-B16 (melanoma antigen-B16), MAGE-B17 (melanoma antigen-B17), MAGE-B2 (melanoma antigen-B2), MAGE-B3 (melanoma antigen-B3), MAGE-B4 (melanoma antigen-B4), MAGE-B5 (melanoma antigen-B5), MAGE- B6 (melanoma antigen-B6), MAGE-C1 (melanoma antigen-C1), MAGE-C2 (melanoma antigen-C2), MAGE-C3 (melanoma antigen-C3), MAGE-D1 (melanoma antigen-D1), MAGE- D2 (melanoma antigen-D2), MAGE-D4 (melanoma antigen-D4), MAGE-E1 (melanoma antigen-E1), MAGE-E2 (melanoma antigen-E2), MAGE-F1 (melanoma antigen-F1), MAGE- H1 (melanoma antigen-H1), MAGE2 (MAGE-like 2), mammaglobin A, MART-1 / Melan-A (melanoma antigen / melanoma antigen A recognized by T cell-1), MART-2 (T cell) -2 recognized melanoma antigen), substrate protein 22, MC1 R (melanocortin 1 receptor), M-CSF (macrophage colony stimulating factor gene), mesothelin, MG50 / PXDN, MMP 11 (M phase phosphoprotein 11), MN / CA IX-antigen, MRP-3 (multidrug resistance-related) Protein 3), MUC1 (mucin 1), MUC2 (mucin 2), NA88-A (NA cDNA clone of patient M88), N-acetylglucosaminyltransferase-V, Neo-PAP (Neo-poly (A) polymerase) NGEP, NMP22, NPM / ALK (Nucleophosmin / undifferentiated lymphoma kinase fusion protein), NSE (neuron specific enolase), NY-ESO-1 (New York esophageous cancer 1), NY-ESO-B, OA1 (white cataract type 1 protein), FA-iLRP (oncofetal antigen-immature laminin receptor), OGT (O-linked N-acetylglucosamine transferase), OS-9, osteocalcin, osteopontin, p15 (protein 15), p15, p190 minor bcr-abl, p53 PAGE-4 (prostate GAGE-like protein-4), PAI-1 (plasminogen activator inhibitor 1), PAI-2 (plasminogen activator inhibitor 2), PAP (prostatic acic phosphatase) PART-1, PATE, PDEF, Pim-1-kinase, Pin1 (propyl isomerase), POTE, PRAME (melanoma selectively expressed antigen), prostain, proteinase-3, PSA (prostate specific antigen), PSCA, PSGR, PS , PSMA (prostate specific membrane antigen), RAGE-1 (renal antigen), RHAMM / CD168 (receptor for hyaluronic acid-mediated motility), RU1 (renal ubiquitous 1), RU2 (renal ubiquitous) (Rena ubiquitous) 1), S-100, SAGE (sarcoma antigen), SART-1 (squamous epithelial antigen rejection tumor 1), SART-2 (squamous epithelial antigen rejection tumor 1), SART-3 (squamous epithelial antigen rejection tumor) 1), SCC (squamous cell carcinoma antigen), Sp17 (sperm protein 17), SSX-1 (synovial sarcoma X cutting point 1), SSX-2 / HOM-MEL-40 (synovial sarcoma X cutting point), SSX-4 (Synovial sarcoma X breakpoint 4), STAMP-1, STEAP (6 transmembrane epithelial antigens of prostate), survivin (survi ving), survivin-2B (intron 2-retaining survivin), TA-90, TAG-72, TARP, TGFb (TGFβ), TGFbRII (TGFβ receptor II), TGM-4 (prostate specific transglutaminase), TRAG- 3 (Taxol resistance-related protein 3), TRG (testin-related gene), TRP-1 (tyrosine-related protein 1), TRP-2 / 6b (TRP-2 / new exon 6b), TRP-2 / INT2 ( TRP-2 / intron 2), Trp-p8, tyrosinase, UPA (urokinase-type plasminogen activator), VEGF (vascular endothelial growth factor), VEGFR-2 / FLK-1 (vascular endothelial growth factor receptor-2) ), And WT1 (Wilm 'oncogene) Or an antigen selected from, for example, but not limited to, α-actinin-4 / m, ARTC1 / m, bcr / abl (breakpoint cluster region-Abelson fusion protein), β- Catenin / m (β-catenin), BRCA1 / m, BRCA2 / m, CASP-5 / m, CASP-8 / m, CDC27 / m (cell division cycle 27), CDK4 / m (cyclin-dependent kinase 4), CDKN2A / m, CML66, COA-1 / m, DEK-CAN (fusion protein), EFTUD2 / m, ELF2 / m (elongation factor 2), ETV6-AML1 (Ets mutant gene 6 / acute myeloid leukemia 1 gene fusion protein), FN1 / m (fibronectin ^{1), GPNMB / m, HLA} -A * 0201-R170I (HLA Arginine replaced with isoleucine at residue 170 of the α-helix of the α2-domain of the A2 gene), HLA-A11 / m, HLA-A2 / m, HSP70-2M (mutated heat shock protein 70-2) , KIAA0205 / m, K-Ras / m, LDLR-FUT (LDR-fucosyltransferase fusion protein), MART2 / m, ME1 / m, MUM-1 / m (melanoma ubiquitous mutation 1), MUM-2 / m (melanoma) Ubiquitous mutation 2), MUM-3 / m (melanoma ubiquitous mutation 3), myosin class I / m, neo-PAP / m, NFYC / m, N-Ras / m, OGT / m, OS-9 / m, p53 / M, Pml / RARa (promyelocytic leukemia / retinoic acid receptor α), PRDX5 / m, PT RK / m (receptor protein tyrosine phosphatase kappa), RBAF600 / m, SIRT2 / m, SYT-SSX-1 (synaptotagmin I / synovial sarcoma X fusion protein), SYT-SSX-2 (synaptotagmin I / synovial sarcoma X Cancer disease selected from the group comprising: fusion protein), TEL-AML1 (translocation Ets-family leukemia / acute myeloid leukemia 1 fusion protein), TGFbRII (TGFβ receptor II), and TPI / m (triosephosphate isomerase) The mutant antigen expressed in may be included. However, according to a specific embodiment, mRNA encoding at least one antigen of gp100, MAGE-A1, MAGE-A3, MART-1 / Melan-A, survivin and tyrosinase, more preferably gp100, MAGE-A1 , MAGE-A3, MART-1 / Melan-A, survivin, and tyrosinase antigen-encoding mRNA that is complexed with or stabilized by protamine (eg, about 80 μg mRNA and 128 μg protamine ratio) can be excluded from the scope of the present invention. In a preferred embodiment, the tumor antigen encoded by at least one mRNA of the vaccine of the invention is 5T4, 707-AP, 9D7, AFP, AlbZIP HPG1, α-5-β-1-integrin, α-5-β- 6-integrin, α-actinin-4 / m, α-methylacyl-coenzyme A racemase, ART-4, ARTC1 / m, B7H4, BAGE-1, BCL-2, bcr / abl, β-catenin / m, BING- 4, BRCA1 / m, BRCA2 / m, CA 15-3 / CA 27-29, CA 19-9, CA72-4,
CA125, calreticulin, CAMEL, CASP-8 / m, cathepsin B, cathepsin L, CD19, CD20, CD22, CD25, CDE30, CD33, CD40, CD52, CD55, CD56, CD80, CDC27 / m, CDK4 / m CDKN2A / m, CEA, CLCA2, CML28, CML66, COA-1 / m, coactocin-like protein, collagen XXIII, COX-2, CT-9 / BRD6, Cten, cyclin B1, cyclin D1, cyp-B, CYPB1, DAM-10, DAM-6, DEK-CAN, EFTUD2 / m, EGFR, ELF2 / m, EMMPRIN, EpCam, EphA2, EphA3, ErbB3, ETV6-AML1, EZH2, FGF-5, FN, Frau-1, 250, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE7b, GAGE-8, GDEP, GnT-V, gp100, GPC3, GPNMB / m, HAGE, HAST- 2, Hepsin, Her2 / neu, HERV-K-MEL, HLA-A ^* 0201-R171, HLA-A11 / m, HLA-A2 / m, HNE, Homeobox NKX3.1, HOM-TES-14 / SCP- 1, HOM-TES-85, HPV-E6, HPV-E7, HSP70-2M, HST-2, hTERT, iCE, IGF-1R, IL-13Ra2, IL-2R, IL-5, immature laminin receptor, kallikrein -2, Kallikrein-4, Ki67, KIAA0205, KIAA0205 / m, KK-LC -1, K-Ras / m, LAGE-A1, LDLR-FUT, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-A10, MAGE-A12, MAGE -B1, MAGE-B2, MAGE-B3, MAGE-B4, MAGE-B5, MAGE-B6, MAGE-B10, MAGE-B16, MAGE-B17, MAGE-C1, MAGE-C2, MAGE-C3, MAGE-D1 , MAGE-D2, MAGE-D4, MAGE-E1, MAGE-E2, MAGE-F1, MAGE-H1, MAGE2, Mammaglobin A, MART-1 / Melan-A, MART-2, MART-2 / m, substrate Protein 22, MC1R, M-CSF, ME1 / m, mesothelin, MG50 / P DN, MMP11, MN / CA IX-antigen, MRP-3, MUC-1, MUC-2, MUM-1 / m, MUM-2 / m, MUM-3 / m, myosin class I / m, NA88-A N-acetylglucosaminyltransferase-V, Neo-PAP, Neo-PAP / m, NFYC / m, NGEP, NMP22, NPM / ALK, N-Ras / m, NSE, NY-ESO-1, NY-ESO -B, OA1, OFA-iLRP, OGT, OGT / m, OS-9, OS-9 / m, osteocalcin, osteopontin, p15, p190 minor bcr-abl, p53, p53 / m, PAGE-4, PAI-1 , PAI-2, PART-1, PATE, PDEF, Pim-1-kinase, Pin-1, Pml / PARα, POTE, PRA E, PRDX5 / m, prostain, proteinase-3, PSA, PSCA, PSGR, PSM, PSMA, PTPRK / m, RAGE-1, RBAF600 / m, RHAMM / CD168, RU1, RU2, S-100, SAGE, SART -1, SART-2, SART-3, SCC, SIRT2 / m, Sp17, SSX-1, SSX-2 / HOM-MEL-40, SSX-4, STAMP-1, STEAP, Survivin, Survivin-2B, SYT -SSX-1, SYT-SSX-2, TA-90, TAG-72, TARP, TEL-AML1, TGFβ, TGFβRII, TGM-4, TPI / m, TRAG-3, TRG, TRP-1, TRP-2 / 6b, TRP / INT2, TRP-p8, tyrosinase, UPA, VEGF, V GFR-2 / FLK-1, and is selected from the group consisting of WT1.

  According to a particularly preferred embodiment, the tumor antigen encoded by at least one mRNA of the vaccine of the invention is MAGE-A1 (eg MAGE-A1 with accession number M77481), MAGE-A2, MAGE-A3, MAGE- A6 (eg, MAGE-A6 with accession number NM_005363), MAGE-C1, MAGE-C2, Melan-A (eg, Melan-A with accession number NM_005511), GP100 (eg, GP100 with accession number M77348), Tyrosinase (eg, tyrosinase with accession number NM_000372), survivin (eg, survivin with accession number AF077735), CEA (eg, C with accession number NM_004363) A), Her-2 / neu (eg, Her-2 / neu with accession number M11730), WT1 (eg, WT1 with accession number NM_000378), PRAME (eg, PRAME with accession number NM_006115), EGFRI (epithelium) Growth factor receptor 1) (eg, EGFRI (epidermal growth factor receptor 1) with accession number AF2888738), MUC1, mucin-1 (eg, mucin-1 with accession number NM — 002456), SEC61G (eg, accession number) SEC61G of NM_014302), hTERT (for example, hTERT of accession number NM_198253), 5T4 (for example, 5T4 of accession number NM_006670), NY-Eso-1 (for example, AP NY-ESO1 session number NM_001327), TRP-2 (e.g., TRP-2 accession numbers NM_001922), STEAP, PCA, is selected PSA, from the group consisting of PSMA, and the like.

  Influenza A virus (HA antigen, NA antigen, NP antigen, M2 antigen, M1 antigen), influenza B virus (HA antigen, NA antigen), respiratory syncytial virus (F antigen, G antigen, M antigen, SH antigen), Parainfluenza virus (glycoprotein antigen), varicella-zoster virus / zoster, human papillomavirus (L1, L2, E6, E7), human immunodeficiency virus (gp120 antigen, gag antigen, env antigen), SARS CoV (spike protein) Staphylococcus aureus (IsdA antigen, IsdB antigen, toxin antigen), Bordetella pertussis (toxin), poliovirus (VP1-4), malaria parasite (NANP antigen, CSP protein antigen, ssp2 antigen, amal antigen, msp142 antigen), pneumonia Streptococcus (Pht antigen, PcsB antigen, Stk Antigen), diphtheria, tetanus, measles, mumps, rubella, rabies virus (G antigen, N antigen), Staphylococcus aureus (toxin antigen), Clostridium difficile (toxin antigen), Mycobacterium tuberculosis (inactive antigen) And antigens derived from Candida albicans are particularly preferred.

  The antigen encoded by at least one mRNA of the vaccine of the present invention described herein may further comprise an antigen, particularly a protein antigen or a peptide antigen fragment as described herein. Such antigen fragments in connection with the present invention preferably have a length of about 6 to about 20 or more amino acids, eg, preferably about 8 to about 10, such as 8, 9 Or fragments processed and presented with MHC class I molecules having 10 (or 11 or 12 amino acids in length) amino acids in length, or preferably about 13 or more amino acids in length, eg 13, 14 , 15, 16, 17, 18, 19, or 20 or more of the amino acid sequence of the processed and presented fragments of MHC class II molecules. You may select from arbitrary parts. These fragments are typically recognized by T cells in the form of a complex consisting of peptide fragments and MHC molecules. That is, the fragments are not recognized in their native form.

  Fragments of antigens as defined herein may also contain epitopes of those antigens. Epitopes (also referred to as “antigenic determinants”) are typically located on the surface of a (native) protein or peptide antigen as defined herein, preferably 5-15 amino acids, more preferably Fragments that can be recognized by antibodies (ie in their native form) having 5 to 12 amino acids, even more preferably 6 to 9 amino acids.

  According to a further particularly preferred embodiment, the tumor antigen encoded by at least one mRNA of the vaccine of the invention is a mixture of antigens, eg preferably for the treatment of a disease or disorder as defined herein (indication). A kit of active (immunostimulatory) compositions or parts to induce an immune response (preferably, each antigen is included as part of the kit) may be formed. For this purpose, the vaccine of the present invention encodes at least one, preferably 2, 3, 4, or more (preferably different) antigens, each mRNA as described herein. The obtained at least one mRNA may be included. Alternatively, the vaccine of the present invention comprises at least one, two, three, four or more (preferably different) mRNAs, each mRNA encoding at least one antigen as described herein. May be included.

  Such a mixture of antigens encoded by at least one mRNA of the vaccine of the invention is preferably, for example, in the treatment of prostate cancer (PCa), preferably at least one of neoadjuvant and hormone refractory prostate cancer, and It may be used in the treatment of diseases or disorders associated with. For this purpose, the vaccine of the present invention encodes at least one, preferably 2, 3, 4, or more (preferably different) antigens, each mRNA as described herein. The obtained at least one mRNA may be included. Alternatively, the vaccine of the present invention comprises at least one, two, three, four or more (preferably different) mRNAs, each mRNA encoding at least one antigen as described herein. May be included. Preferably, the antigen is at least PSA (prostate specific antigen) = KLK3 (kallikrein-3), PSMA (prostate specific membrane antigen), PSCA (prostate stem cell antigen), and STEAP (prostate 6 transmembrane epithelial antigen). It is selected from either.

  Furthermore, the mixture of antigens encoded by at least one mRNA of such a vaccine of the present invention is preferably selected from, for example, three main subtypes: lung squamous cell carcinoma, adenocarcinoma, and large cell lung cancer May be used to treat non-small cell lung cancer (NSCLC), or disorders associated therewith. For this purpose, the vaccine according to the invention has at least one, preferably 2, 3, 4, 5, 6, 7, 8, each mRNA as described herein. It may comprise at least one mRNA capable of encoding 9, 10, 11 or 12 (preferably different) antigens. Alternatively, the vaccine of the invention has at least one, preferably 2, 3, 4, 5, 6, 7 each mRNA encoding at least one antigen as described herein. , 8, 9, 10, 11 or 12 (preferably different) mRNAs. Preferably, such antigens are those of hTERT, WT1, MAGE-A2, 5T4, MAGE-A3, MUC1, Her-2 / neu, NY-ESO-1, CEA, Survivin, MAGE-C1, and MAGE-C2. It is selected from at least one.

  In the above embodiments, each of the above defined antigens can be encoded by one (monocistronic) mRNA. In other words, in this case, at least one mRNA of the vaccine of the present invention is at least two (such as three and four) (monocistronic) mRNA, where at least two (3 Each (such as one and four) (monocistronic) mRNA may comprise, for example, an mRNA selected from only one (preferably different) antigen, preferably one of the above combinations of antigens.

  According to a particularly preferred embodiment, the at least one mRNA of the vaccine according to the invention is (at least) one bicistronic or multicistronic mRNA, preferably an mRNA, ie for example preferably one of the antigen combinations described above. It may comprise (at least) one mRNA carrying two or more coding genes of at least two (preferably different) antigens selected from one. For example, such a coding sequence of at least two (preferably different) antigens of (at least) one bicistronic or multicistronic mRNA comprises at least one IRES (internal ribosome entry site as defined below) ) May be separated. Thus, the term “encodes at least two (preferably different) antigens” is not limited thereto, but (at least) one (bicistronic or multicistronic) mRNA is, for example, the group described above At least two, three, four, five, six, seven, eight, nine, ten, eleven or twelve or more (preferably different) antigens, or fragments thereof, Alternatively, it can mean that a variant can be encoded. In this context, the so-called IRES (internal ribosome entry site) sequence, as defined herein, can function as a single ribosome binding site, but it is also translated by the ribosome independently of each other. Can serve to provide bicistronic or multicistronic RNA as defined herein that encodes a plurality of proteins. Examples of IRES sequences that can be used in accordance with the present invention include picornavirus (eg FMDV), pestivirus (CFFV), poliovirus (PV), encephalomyocarditis virus (ECMV), foot-and-mouth disease virus (FMDV), type C Derived from hepatitis virus (HCV), swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV), or cricket paralysis virus (CrPV),

  According to a further particularly preferred embodiment, the at least one mRNA of the vaccine according to the invention comprises at least one monocistronic mRNA as defined herein and at least one bicistronic or multicistronic as defined herein. Of RNA, preferably a mixture of mRNA. At least one monocistronic RNA and at least one of at least one bicistronic or multicistronic RNA preferably encodes a different antigen, or a fragment or variant thereof, wherein the antigen is Preferably it is selected from one of the above antigens, more preferably one of the above combinations. However, the at least one monocistronic RNA and the at least one bicistronic or multicistronic RNA are also preferably selected from one of the antigens, preferably (partially in the above combination). ) May encode the same antigen (provided that at least one mRNA of the vaccine of the invention provides a total of at least two (preferably different) antigens as defined herein). Such an embodiment may be advantageous for the administration of at least one mRNA of one or several vaccines of the invention, eg alternating, eg time dependent, to a patient in need thereof. The components of such a vaccine can be included in a (different part) kit of parts of the composition or can be administered separately as, for example, the same composition of the vaccine of the invention as defined in connection with the present invention.

  In a further preferred embodiment, at least one mRNA (or any further nucleic acid as defined herein) of the vaccine of the invention may also occur in the form of a modified nucleic acid.

  According to a first aspect, at least one mRNA (or any further nucleic acid as defined herein) of a vaccine of the invention is substantially subject to degradation in vivo (eg exonuclease or endonuclease). It may be provided as a “stabilized nucleic acid” that is resistant.

  In this context, at least one mRNA (or any further nucleic acid as defined herein) of the vaccine of the invention may comprise a backbone modification, a sugar modification or a base modification. A backbone modification relevant to the present invention is a modification in which the phosphate of the nucleotide backbone contained in at least one mRNA (or any further nucleic acid as defined herein) of the vaccine of the present invention is chemically modified. It is. A sugar modification in connection with the present invention is a chemical modification of the nucleotide sugar of at least one mRNA (or any additional nucleic acid as defined herein) of the vaccine of the present invention. Furthermore, a base modification in connection with the present invention is a chemical modification of the base part of the nucleotide of at least one mRNA (or any further nucleic acid as defined herein) of the vaccine of the present invention.

  According to a further aspect, at least one mRNA (or any additional nucleic acid as defined herein) of a vaccine of the invention can comprise a lipid modification. Such lipid-modified nucleic acids typically include nucleic acids as defined herein, such as mRNA or any additional nucleic acid. Such a lipid-modified mRNA of the vaccine of the invention (or any additional lipid-modified nucleic acid as defined herein) typically further comprises at least one linker covalently linked to the nucleic acid molecule, and each linker Contains at least one lipid covalently linked. Alternatively, the lipid-modified mRNA (or any additional lipid-modified nucleic acid as defined herein) of the vaccine of the invention is at least one nucleic acid molecule as defined herein, eg, an mRNA, or any further nucleic acid as defined herein. And at least one (bifunctional) lipid covalently linked (without a linker) to the nucleic acid molecule. According to a third alternative, the lipid-modified mRNA (or any further lipid-modified nucleic acid as defined herein) of the vaccine according to the invention is a nucleic acid molecule as defined herein, eg mRNA or any A further nucleic acid, at least one linker covalently bound to the nucleic acid molecule, and at least one lipid covalently bound to each linker, and at least one (bifunctional) covalently bound to the nucleic acid molecule (without the linker) Sex) Contains lipids.

  At least one mRNA (or any additional nucleic acid as defined herein) of the vaccine of the invention is similarly stable by various techniques to prevent degradation of the mRNA (or any additional nucleic acid molecule). You may make it. It is known in the art that general RNA instability and (fast) degradation present serious problems for the application of RNA-derived compositions. This RNA instability is typically due to the RNase (ribonuclease), and combinations with such ribonucleases sometimes break down RNA in solution completely. Thus, the natural degradation of RNA in the cytoplasm of the cell is very precisely controlled, and contamination with RNase is generally performed by a special treatment, particularly diethyl pyrocarbonate (DEPC), before using the composition. Can be removed. Many mechanisms of natural degradation are known in the art in this regard and can be used as well. For example, end structures are typically very important, especially in mRNA. As an example, the natural mRNA usually has a so-called “cap structure” (modified guanosine nucleotide) at the 5 ′ end and typically has a maximum of 200 adenosine nucleotides (so-called poly A tail) at the 3 ′ end. There is an array.

  According to another aspect, at least one mRNA of the vaccine of the invention may be modified and is thus stabilized by modifying the G / C content of the mRNA, preferably its coding region.

  In a particularly preferred embodiment of the present invention, the G / C content of the coding region of at least one mRNA of the vaccine of the present invention comprises a specific wild-type coding sequence, ie the G / C content of the coding region of unmodified mRNA. It is modified in comparison and is particularly increased. The encoded amino acid sequence of the mRNA is preferably not modified as compared to the encoded amino acid sequence of a particular wild type mRNA.

  Modification of the G / C content of at least one mRNA of the vaccines of the invention is based on the fact that the sequence of any mRNA region that is translated is important for efficient translation of that mRNA. Thus, the composition and sequence of various nucleotides is important. Specifically, sequences with increased G (guanosine) / C (cytosine) content are more stable than sequences with increased (adenosine) / U (uracil) content. In accordance with the present invention, the codons of a coding sequence or mRNA and therefore the wild type coding sequence or mRNA so that they contain an increased amount of G / C nucleotides while maintaining the translated amino acid sequence. It can be changed in comparison. With respect to the fact that several codons code for one and the same amino acid (so-called degeneracy of the genetic code), the codon that is most advantageous for stability can be determined (so-called alternative codon usage).

  Preferably, the G / C content of the coding region of at least one mRNA of the vaccine of the present invention is at least 7%, more preferably at least 15%, particularly preferably compared to the G / C of the coding region of wild-type mRNA. Increased by at least 20%. According to a particular aspect, at least 5%, 10%, 20% in the region encoding the protein or peptide or fragment thereof, as defined herein, or a variant thereof, or a wild-type mRNA sequence or coding sequence, 30%, 40%, 50%, 60%, more preferably at least 70%, even more preferably at least 80%, most preferably at least 90%, 95%, or 100% of replaceable codons are replaced, Increases the G / C content of the sequence.

  In this connection, the G / C content of at least one mRNA of the vaccine according to the invention, in particular in the protein coding region, is maximized compared to the wild type sequence (ie 100% of the codons that can be substituted). It is particularly preferable to increase the ratio.

  According to the present invention, a further preferred modification of at least one mRNA of the vaccine of the present invention, particularly when the nucleic acid is mRNA or is in the form of encoding mRNA, the translation efficiency is the tRNA of the cell. It is based on the finding that it is also determined by the different frequency of appearance. Thus, when a so-called “rare codon” is present in an increased range in at least one mRNA of the vaccine of the present invention, the corresponding modified mRNA is significantly less than when there is a codon encoding a relatively “frequent” tRNA. It is translated only to a limited extent.

  Preferably, the coding region of at least one mRNA of the vaccine of the present invention is such that at least one codon of the wild type sequence encoding a relatively rare tRNA in the cell is relatively frequent in the cell and said relatively rare. It is modified relative to the corresponding region of the wild-type mRNA or coding sequence so that it is exchanged for a codon that encodes a tRNA carrying the same amino acid as the tRNA. By this modification, the sequence of at least one mRNA of the vaccine of the present invention is inserted into a codon from which a frequently occurring tRNA is obtained, particularly if the nucleic acid is mRNA or is in the form of encoding mRNA. It has been modified as follows. In other words, according to the present invention, by this modification, all codons of the wild-type sequence that encode a relatively rare tRNA in the cell are in each case codons that encode a relatively frequent tRNA in the cell. In either case, it carries the same amino acid as the relatively rare tRNA.

  It is known to those skilled in the art which tRNAs occur relatively frequently in cells and in contrast which tRNAs occur relatively rarely in cells (see, eg, Akashi, Curr. Opin. Genet. Dev. 2001, 11 (6): 660-666). Particularly preferred are codons that use the most frequently occurring tRNAs for a particular amino acid, eg, Gly codons that use the most frequently occurring tRNAs in (human) cells.

  According to the present invention, the amino acid sequence encoded by the coding region of said mRNA is modified with an increased, in particular maximized sequence G / C content, in the modified at least one mRNA of the vaccine of the present invention. It is particularly preferred to connect with “frequent” codons. This preferred embodiment allows the provision of at least one mRNA of the vaccine according to the invention, in particular efficiently translated and stabilized (modified).

According to a further preferred embodiment of the invention, at least one mRNA of the vaccine of the invention as defined herein, or any further nucleic acid molecule as defined herein, is preferably 5 ′ and 3 ′. At least one of the stabilizing sequences. These stabilizing sequences in the untranslated region of at least one of 5 ′ and 3 ′ have the effect of increasing the half-life of the nucleic acid in the cytosol. These stabilizing sequences can have 100% sequence identity with sequences naturally occurring in viruses, bacteria and eukaryotes, but can also be partially or fully synthesized. For example, the untranslated sequence (UTR) of the (α-) globin gene from Homo sapiens or Xenopus can be mentioned as examples of stabilizing sequences that can be used in the present invention to stabilize nucleic acids. Other examples of stabilizing sequences are included in the 3′UTR of highly stable RNA encoding (α-) globin, type I collagen, 15-lipoxygenase or tyrosine hydroxylase (Holvic et al., Proc. Natl. Acad. Sci. USA 1997, 94: 2410-2414), having the general formula (C / U) CCAN _x CCC (U / A) Py _x UC (C / U) CC (SEQ ID NO: 383). Such stabilizing sequences can of course also be used alone or in combination with another stabilizing sequence or in combination with stabilizing sequences known to those skilled in the art.

  Nevertheless, substitutions, additions or deletions are preferably performed using at least one mRNA or any further nucleic acid molecule of the vaccine of the invention as defined herein, in particular the nucleic acid is in the form of mRNA. In some cases, it is performed using a DNA matrix for the production of nucleic acid molecules by well-known site-directed mutagenesis or oligonucleotide ligation methods (eg, Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor). Laboratory Press, 3rd ed., Cold Spring Harbor, NY, 2001). In such a process, the corresponding DNA molecule may be transcribed in vitro for the preparation of at least one mRNA of the vaccine of the invention as defined herein. This DNA matrix preferably comprises a suitable promoter for in vitro transcription, for example a T7 promoter or SP6 promoter, followed by a termination signal for in vitro transcription, followed by the desired nucleic acid sequence of said at least one mRNA to be prepared. . The DNA molecules that form the matrix of at least one mRNA of interest may be prepared by fermentative growth and subsequent isolation as part of a plasmid capable of replicating in bacteria. Plasmids that may be mentioned as suitable for the present invention include, for example, plasmid pT7Ts (GenBank Accession No. U26404; Lai et al., Development 1995, 121: 2349-2360), pGEM (trademark registered) series, such as pGEM (trademark registered)- 1 (GenBank accession number X65300; from Promega) and pSP64 (GenBank accession number X65327) (Griffin and Griffin (ed.), PCR Technology: Current Innovation, CRC Press, BoFL, 200 Mezei and Starts, Purification of PCR Product See also).

  As used herein, a nucleic acid molecule as defined herein, eg, at least one mRNA of a vaccine of the invention, or any further nucleic acid molecule as defined herein, is at least a One mRNA may be modified as outlined above.

  In addition, a nucleic acid molecule as defined herein, e.g. at least one mRNA of a vaccine according to the invention, or any further nucleic acid molecule as defined herein used in connection with the present invention is e.g. It may be prepared using any method known in the art including not only phase synthesis but also synthetic methods such as in vitro methods such as in vitro transcription reactions.

  According to one preferred embodiment of the present invention, the at least one mRNA of the vaccine of the present invention is any further excipient, transfection agent, or complex formation for increasing the transfection efficiency of at least one mRNA. It may be administered naked without an agent.

In a further preferred embodiment of the invention, at least one mRNA of the vaccine of the invention is accompanied by any further excipients, transfection agents, or complexing agents for increasing the transfection efficiency of at least one mRNA. . Particularly preferred agents in this context that are suitable for increasing transfection efficiency are cationic or polycationic compounds including protamine, nucleolin, spermine or spermidine, or poly-L-lysine (PLL). ), Polyarginine, basic polypeptide, HIV binding peptide, HIV-1 Tat (HIV), Tat derived peptide, penetratin, VP22 derived or similar peptide, HSV, VP22 (herpes simplex), MAP, KALA or protein transduction Domain (PTD), PpT620, proline-rich peptide, arginine-rich peptide, lysine-rich peptide, MPG peptide, Pep-1, L-oligomer, calcitonin peptide, antennapedia-derived peptide (especially Drosophila antennapedia), pAntp, pIsl, FGF, lactoferrin, transportan, buforin 2, Bac715-24, SynB, SynB (1), pVEC, hCT-derived peptide, SAP, or histone-containing peptide (CPP) Other cationic peptides or proteins. In addition, preferred cationic or polycationic proteins or peptides may be selected from the following proteins or peptides having the following total formula:
(Arg) _l ; (Lys) _m ; (His) _n ; (Orn) _o ; (Xaa) _x
Here, l + m + n + o + x = 8 to 15, and l, m, n, or o are 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 independently of each other. , 13, 14 or 15 (where Arg, Lys, His and Orn represent at least 50% of the total amino acids of the oligopeptide) and Xaa represents Arg, Lys, His or Orn. It may be any amino acid selected from non-native (= naturally occurring) or non-native amino acids, where x is any number selected from 0, 1, 2, 3 or 4; (However, the total content of Xaa does not exceed 50% of the total amino acids of the oligopeptide).
Particularly preferred cationic peptides in this regard are, for example, Arg ₇ , Arg ₈ , Arg ₉ , H ₃ R ₉ , R ₉ H ₃ , H ₃ R ₉ H ₃ , YSSR ₉ SSY, (RKH) ₄ , and Y (RKH) ₂ R and the like. More preferred cationic or polycationic compounds that can be used as transfection agents include cationic polysaccharides such as chitosan and polybrene, for example cationic polymers such as polyethyleneimine (PEI), such as DOTMA ([1 -(2,3-dioleyloxy) propyl)]-N, N, N-trimethylammonium chloride), DMRIE, diC14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DOPC, DODAP, DOPE ( Dioleyl phosphatidylethanolamine), DOSPA, DODAB, DOIC, DMEPC, DOGS (dioctadecylamidoglycylspermine), DIMRI (D dimyristo-oxypropyldimethylhydroxyethylammonium) Bromide), DOTAP (dioleoyloxy-3- (trimethylammonio) propane, DC-6-14 (O, O-ditetradecanoyl-N- (α-trimethylammonioacetyl) diethanolamine chloride), CLIP1 ( RAC-[(2,3-dioctadecyloxypropyl) (2-hydroxyethyl)]-dimethylammonium chloride), CLIP6 (rac- [2 (2,3-dihexadecyloxypropyl-oxymethyloxy) ethyl] trimethyl Ammonium), CLIP9 (rac- [2 (2,3-dihexadecyloxypropyl-oxysuccinyloxy) ethyl] -trimethylammonium and oligofectamine or the like, or, for example, β-amino acid polymer or reverse Modified polyamide, etc. Amino acids, modified polyethylene such as PVP (poly (N-ethyl-4-vinylpyridinium bromide)), modified acrylates such as pDMAEMA (poly (dimethylaminoethylmethyl acrylate)), modified amidoamines such as pAMAM (poly (amidoamine)), Modified poly β-amino ester (PBAE) such as diamine terminal-modified 1,4-butanediol diacrylate-co-5-amino-1-pentanol polymer, dendrimer such as polypropylamine dendrimer or pAMAM dendrimer, PEI (poly ( Silamines such as polyimines such as ethyleneimine) and poly (propyleneimine), polyallylamine, cyclodextrin polymers, dextran polymers and sugar skeleton polymers such as chitosan, PMOXA-PDMS copolymers, etc. A block polymer consisting of a combination of one or more cationic blocks (eg, selected from the above-mentioned cationic polymers), and a combination of one or more hydrophilic or hydrophobic blocks (eg, polyethylene glycol) And a cationic or polycationic polymer such as a block polymer.

  At least one mRNA of the vaccine of the present invention encoding at least one antigen may also be complexed with a polymeric carrier formed by a disulfide-bridged cationic moiety. The term “cationic component” typically has a pH value of about 1-9, preferably 9 or less, 8 or less, 7 or less, most preferably, for example, 7.3-7.4. Refers to a charged molecule (cation) having a positive charge of value. Accordingly, the cationic peptides, proteins or polymers according to the invention have a positive charge under physiological conditions, preferably under physiological conditions of cells in vivo in particular. The definition of “cationic” can also refer to a “polycationic” component.

  In this connection, the cationic component that forms the basis of the polymer carrier of the vaccine of the invention by disulfide bridges is typically any suitable cationic or polycationic peptide, protein for this purpose. Or a polymer, selected from any particular cationic or polycationic peptide, protein or polymer that can be complexed with a nucleic acid as defined in the present invention and thereby preferably condense the nucleic acid. The cationic or polycationic peptide, protein or polymer is preferably a linear molecule, but branched cationic or polycationic peptides, proteins or polymers may also be used.

  Each cationic or polycationic protein, peptide or polymer of the polymer carrier that can be used to complex at least one mRNA of the present invention has at least one -SH moiety, most preferably at least one A cysteine residue or a —SH moiety capable of forming a disulfide bond by condensation with at least one further cationic or polycationic protein, peptide or polymer as a cationic component of the polymer carrier referred to herein. Includes any additional chemical groups to present.

Each cationic or polycationic protein, peptide or polymer, or any other polymer carrier component that can be used to complex at least one mRNA of the vaccine of the present invention is preferably adjacent to it. Linked to the component (cationic protein, peptide, polymer or other component) via a disulfide bridge. Preferably, the disulfide bridge is at least one cationic or polycationic protein, peptide or polymer and at least one further cationic or polycationic protein, peptide or polymer, or other component of the polymer carrier. (Reversible) disulfide bond (—S—S—). The disulfide bridge is typically formed by condensation of the -SH moiety of the polymer carrier component, particularly the cationic component. Such -SH moieties may be part of the structure of a component of a cationic or polycationic protein, peptide or polymer, or any other polymer carrier prior to disulfide crosslinking, or disulfide crosslinking It may be added before by a modification defined below. In this context, the sulfur adjacent to one component of the polymer support necessary to provide the disulfide bond may be provided by the component itself, for example by the -SH moiety as defined herein, or the component May be provided by presenting a -SH moiety. These —SH groups are typically provided by each component via, for example, cysteine, or any additional (modified) amino acid of the component bearing the —SH moiety. Where the cationic component or any further component of the polymer carrier is a peptide or protein, the -SH moiety is preferably provided by at least one cysteine residue. Alternatively, the component of the polymer carrier is preferably by the -SH moiety via a chemical reaction with the compound bearing the -SH moiety, such that each polymer carrier component carries at least one such -SH moiety. It may be modified. Such a compound carrying a -SH moiety may be, for example, a compound of a component of a polymer carrier carrying a (additional) cysteine, or any further (modified) amino acid or -SH moiety. Such a compound may also be any non-amino compound or moiety that allows for the introduction of a -SH moiety to a moiety as defined herein. Such non-amino compounds can be obtained, for example, by the addition of 3-thiopropionic acid or 2-iminothiolane (Trout reagent), by amide formation (eg, carboxylic acid, sulfonic acid, amine, etc.), Michael addition (eg, maleimide). Moiety, α, β-unsaturated carbonyl, etc.), click chemistry (eg azide or alkyne), alkene / alkyne metathesis (eg alkene or alkyne), imine or hydrazone formation (aldehyde or ketone, hydrazine, hydroxylamine, Amines), complex formation reactions (avidin, biotin, protein G), or compounds that allow _Sn- type substitution reactions (eg, halogenated alkanes, thiols, alcohols, amines, hydrazides, sulfonate esters, oxyphosphonium salts) or Of further ingredients Through a chemical reaction or binding of the compounds according to other chemical moieties available for binding, may be connected to the components of the polymer support according to the present invention. In some cases, the —SH moiety may be covered by a protecting group during chemical bonding to the component. Such protecting groups are known in the art and may be removed after chemical coupling. In either case, for example, cysteine, or any further (modified) amino acid or -SH moiety of the compound may be present at the terminal or internal at any position of the component of the polymer carrier. As defined herein, each component of the polymer carrier typically presents at least one —SH group, but two, three, four, five, or more − SH portion may be included. In addition to the attachment of the cationic component, the -SH moiety may be a further component of a polymer carrier of the vaccine of the invention as defined herein, particularly an amino acid component such as an antigenic epitope, antigen, antibody, cell penetrating peptide (e.g. , TAT), and ligands and the like.

  As defined above, the polymeric carrier that can be used to complex at least one mRNA complex of the vaccine of the invention may be formed by a disulfide-bridged cationic (or polycationic) component.

  According to one first alternative, at least one cationic (or polycationic) component of the polymer carrier that can be used to complex at least one mRNA of the vaccine of the invention is cationic or It can be selected from polycationic peptides or proteins. Such cationic or polycationic peptides or proteins are preferably about 3-100 amino acids long, preferably about 3-50 amino acids long, more preferably about 3-25, such as about 3-10. , 5-15, 10-20, or 15-25 amino acids in length. Alternatively or additionally, such cationic or polycationic peptides or proteins have a molecular weight of about 0.5 kDa to about 100 kDa, preferably about 10 kDa to about 50 kDa, and even more preferably about 10 kDa to about 30 kDa. A molecular weight of about 0.01 kDa to 100 kDa may be presented.

  In certain cases, where the cationic component of the polymer carrier that can be used to complex at least one mRNA of the vaccine of the invention comprises a cationic or polycationic peptide or protein, the polymer carrier is completely If it consists of a cationic or polycationic peptide or protein, the cationic properties of the cationic or polycationic peptide or protein, or of all polymer carriers can be determined by the content of the cationic amino acid. Preferably, the cationic amino acid content in at least one of the cationic or polycationic peptide or protein and the polymer carrier is at least 10%, 20% or 30%, preferably at least 40%, more preferably At least 50%, 60% or 70%, but at least 80%, 90% or even 95%, 96%, 97%, 98%, 99% or 100% are also preferred, most preferably at least 30% 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or in the range of about 10% to 90% More preferably in the range of about 15% to 75%, even more preferably in the range of 20% to 50%, such as 20%, 30%, 40% or 50%, or , A range formed by any two of the aforementioned values, provided that all amino acids, such as cationic amino acids, lipophilic amino acids, in cationic or cationic peptides or proteins, or in all polymer carriers, The content of hydrophilic amino acids, aromatic amino acids and further amino acids is 100% when the polymer carrier is a cationic or polycationic peptide or protein).

  Preferably, such cationic or polycationic peptides or proteins of the polymer carrier that contain at least one -SH moiety or are additionally modified to contain at least one -SH moiety are limited to these Although not, a cationic peptide or protein such as protamine, nucleolin, spermine or spermidine, oligo- or poly-L-lysine (PLL), basic polypeptide, oligo or polyarginine, chimera such as transportan or MPG peptide CPP, HIV binding peptide, Tat, HIV-1 Tat (HIV), Tat-derived peptides such as penetratin, antennapedia-derived peptides (particularly from Drosophila antennapedia), penetratin family members such as pAntp and pIsl Bar, and for example, Buforin 2, Bac 715-24, SynB, SynB (1), pVEC, hCT-derived peptide, SAP, MAP, PpTG20, Lorigomer, FGF, lactoferrin, histone, VP22-derived or similar peptides, Ernes of plague virus HSV, VP22 (herpes simplex), MAP, KALA or protein transduction domain (PTD), PpT620, proline-rich peptide, arginine-rich peptide, lysine-rich peptide, Pep-1, L-oligomer, calcitonin peptide, etc. Selected from CPPs derived from these antibacterial agents.

  Alternatively or additionally, such cationic or polycationic peptides or proteins of a polymer carrier that contain at least one -SH group or are additionally modified to contain at least one -SH moiety Is selected from, but not limited to, the following cationic peptides having the following total formula (I):

{(Arg) _l ; (Lys) _m ; (His) _n ; (Orn) _o ; (Xaa) _x }

Here, l + m + n + o + x = 3 to 100, and l, m, n, or o are 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 independently of each other. 13, 14, 15, 16, 17, 18, 19, 20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, and 91-100 (Wherein the total content of Arg (arginine), Lys (lysine), His (histidine) and Orn (ornithine) occupies at least 10% of all amino acids of the oligopeptide), Xaa is Selected from native (natural) or non-native amino acids except Arg, Lys, His or Orn, x is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 6, 17, 18, 19, 20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, and 81-90 (however, Xaa The total content of the phospholipids does not exceed 90% of the total amino acids of the oligopeptide). Any amino acid of Arg, Lys, His, Orn and Xaa may be placed at any position of the peptide. In this connection, cationic peptides or proteins in the range of 7 to 30 amino acids are particularly preferred. Further preferred peptides of this formula are eg Arg ₇ , Arg ₈ , Arg ₉ , Arg ₁₂ , His ₃ Arg ₉ , Arg ₉ His ₃ , His ₃ Arg ₉ His ₃ , His ₆ Arg ₉ His ₆ , His ₃ Arg ₄ These are oligoarginines such as His ₃ , His ₆ Arg ₄ His ₆ , TyrSer ₂ Arg ₉ Ser ₂ Tyr, (ArgLysHis) ₄ and Tyr (ArgLysHis) ₂ Arg.

  According to certain preferred embodiments, the cationic or polycationic peptide or protein of the polymer carrier having the experimental summation formula (I) above is not limited to, but is at least a subgroup of the following formulas: Contains one.

_{Arg 7, Arg 8, Arg 9} , Arg 10, Arg 11, Arg 12, Arg 13, Arg 14, Arg 15-30, Lys 7, Lys 8, Lys 9, Lys 10, Lys 11, Lys 12, Lys 13, _{Lys 14, Lys 15-30, His 7} , His 8, His 9, His 10, His 11, His 12, His 13, His 14, His 15-30, Orn 7, Orn 8, Orn 9, Orn 10, Orn ₁₁ , Orn ₁₂ , Orn ₁₃ , Orn ₁₄ , Orn _15-30

In a further particularly preferred embodiment of a polymeric carrier having the experimental summation formula (I) above and comprising at least one -SH moiety or additionally modified to comprise at least one -SH moiety Cationic or polycationic peptides or proteins include, but are not limited to, at least one of the following subgroups of formulas. The following formula (similar to empirical formula (I)) does not prescribe any amino acid order, but by exclusively prescribing the (number of) amino acids as components of each peptide, Is intended to reflect. Thus, as an example, the empirical formula Arg _(7-29) Lys ₁ is intended to mean that a peptide corresponding to this formula contains 7 to 19 arginine residues and one Lys residue in any order. doing. If the peptide contains 7 Arg residues and 1 Lys residue, all variants with 7 Arg residues and 1 Lys residue are included. The Lys residue can therefore be located anywhere in an 8 amino acid long sequence consisting of, for example, 7 Arg and 1 Lys residue. The subgroup preferably includes:

Arg _(4-29) Lys ₁ , Arg _(4-29) His ₁ , Arg _(4-29 Orn ₁ , Lys _(4-29) His ₁ , Lys _(4-29) Orn ₁ , His _(4-29) Orn ₁ , Arg _(3-28) Lys ₂ , Arg _(3-28) His ₂ , Arg _(3-28) Orn ₂ , Lys _(3-28) His ₂ , Lys _(3-28) Orn ₂ , His _{( 3-28) Orn 2, Arg (2-27} ) Lys 3, Arg (2-27) His 3, Arg (2-27) Orn 3, Lys (2-27) His 3, Lys (2-27) Orn _{3, His (2-27) Orn 3} , Arg (1-26) Lys 4, Arg (1-26) His 4, Arg (1-26) Orn 4, Lys (1-26) Hi _{4, Lys (1-26) Orn 4} , His (1-26) Orn 4,

Arg _(3-28) Lys ₁ His ₁ , Arg _(3-28) Lys ₁ Orn ₁ , Arg _(3-28) His ₁ Orn ₁ , Arg ₁ Lys _(3-28) His ₁ , Arg ₁ Lys _{(3- 28)} Orn ₁ , Lys _(3-28) His ₁ Orn ₁ , Arg ₁ Lys ₁ His _(3-28) , Arg ₁ His _(3-28) Orn ₁ , Lys ₁ His _(3-28) Orn ₁ ,

Arg _(2-27) Lys ₂ His ₁ , Arg _(2-27) Lys ₁ His ₂ , Arg _(2-27) Lys ₂ Orn ₁ , Arg _(2-27) Lys ₁ Orn ₂ , Arg _(2-27) His ₂ Orn ₁ , Arg _(2-27) His ₁ Orn ₂ , Arg ₂ Lys _(2-27) His ₁ , Arg ₁ Lys _(2-27) His ₂ , Arg ₂ Lys _(2-27) Orn ₁ , Arg ₁ Lys _(2-27) Orn ₂ , Lys _(2-27) His ₂ Orn ₁ , Lys _(2-27) His ₁ Orn ₂ , Arg ₂ Lys ₁ His _(2-27) , Arg ₁ Lys ₂ His _{(2 -27), Arg 2 His (2-27} ) Orn 1, Arg 1 His (2-27) Orn 2, Lys 2 His (2-27 _{Orn 1, Lys 1 His (2-27} ) Orn 2,

Arg _(1-26) Lys ₃ His ₁ , Arg _(1-26) Lys ₂ His ₂ , Arg _(1-26) Lys ₁ His ₃ , Arg _(1-26) Lys ₃ Orn ₁ , Arg _(1-26) Lys ₂ Orn ₂ , Arg _(1-26) Lys ₁ Orn ₃ , Arg _(1-26) His ₃ Orn ₁ , Arg _(1-26) His ₂ Orn ₂ , Arg _(1-26) His ₁ Orn ₃ , Arg _{3 Lys (1-26) His 1,} Arg 2 Lys (1-26) His 2, Arg 1 Lys (1-26) His 3, Arg 3 Lys (1-26) Orn 1, Arg 2 Lys (1-26 _{) Orn 2, Arg 1 Lys (} 1-26) Orn 3, Lys (1-26) His 3 Orn 1, Lys (1-26) His _{Orn 2, Lys (1-26) His} 1 Orn 3, Arg 3 Lys 1 His (1-26), Arg 2 Lys 2 His (1-26), Arg 1 Lys 3 His (1-26), Arg 3 His _(1-26) Orn ₁ , Arg ₂ His _(1-26) Orn ₂ , Arg ₁ His _(1-26) Orn ₃ , Lys ₃ His _(1-26) Orn ₁ , Lys ₂ His _(1-26) Orn ₂ , Lys ₁ His _(1-26) Orn ₃ ,

Arg _(2-27) Lys ₁ His ₁ Orn ₁ , Arg ₁ Lys _(2-27) His ₁ Orn ₁ , Arg ₁ Lys ₁ His _(2-27) Orn ₁ , Arg ₁ Lys ₁ His ₁ Orn _{(2-27) )} ,

Arg _(1-26) Lys ₂ His ₁ Orn ₁ , Arg _(1-26) Lys ₁ His ₂ Orn ₁ , Arg _(1-26) Lys ₁ His ₁ Orn ₂ , Arg ₂ Lys _(1-26) His ₁ Orn ₁ , Arg ₁ Lys _(1-26) His ₂ Orn ₁ , Arg ₁ Lys _(1-26) His ₁ Orn ₂ , Arg ₂ Lys ₁ His _(1-26) Orn ₁ , Arg ₁ Lys ₂ His _{(1-26) )} Orn ₁ , Arg ₁ Lys ₁ His _(1-26) Orn ₂ , Arg ₂ Lys ₁ His ₁ Orn _(1-26) , Arg ₁ Lys ₂ His ₁ Orn _(1-26) , Arg ₁ Lys ₁ His ₂ Orn _(1-26)

In a further particular preferred embodiment, a polymeric carrier having the experimental summation formula (I) above and comprising at least one -SH moiety or additionally modified to comprise at least one -SH moiety Cationic or polycationic peptides or proteins of, but not limited to, from the general formulas Arg ₇ (also referred to as R ₇ ), Arg ₉ (also referred to as R ₉ ), and Arg ₁₂ (also referred to as R ₁₂ ) Is selected from the subgroup.

In one further particular preferred embodiment, the cationic or polycationic peptide or protein of the polymer carrier is of the formula {(Arg) ₁ ; (Lys) _m ; (His) _n ; (Orn) _o ; (Xaa) _x } (defined by formula (I)), including but not limited to, containing at least one -SH moiety or being further modified to include at least one -SH moiety Is selected from the following sub-formula (Ia):

{(Arg) _l ; (Lys) _m ; (His) _n ; (Orn) _o ; (Xaa ′) _x (Cys) _y } Formula (Ia)

Where (Arg) _l , (Lys) _m , (His) _n , (Orn) _o and x are as defined herein, and Xaa ′ is Arg, Lys, His, Orn or Cys. Selected from native (natural) or non-native amino acids except y is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, and 81-90 (provided that The total content of Arg (arginine), Lys (lysine), His (histidine) and Orn (ornithine) occupies at least 10% of the total amino acids of the oligopeptide).

This embodiment is for example the cation of the polymer support as defined according to the empirical formulas (Arg) _l ; (Lys) _m ; (His) _n ; (Orn) _o ; (Xaa) _x (formula (I)) above. A cationic or polycationic peptide or protein as described above such that the cationic or polycationic peptide as the cationic component carries at least one cysteine capable of forming a disulfide bond with other components of the polymer carrier. As a -SH moiety in the sense, it can be applied to situations characterized by containing or modified with at least one cysteine.

In another particular preferred embodiment, the cationic or polycationic peptide or protein of the polymer carrier is of the formula {(Arg) _l ; (Lys) _m ; (His) _n ; (Orn) _o ; ) _X } (when defined in accordance with formula (I)), but is not limited to these, it is selected from

Cys ¹ {(Arg) ₁ ; (Lys) _m ; (His) _n ; (Orn) _o ; (Xaa) _x } Cys ² formula (Ib)

Here, the empirical formula {(Arg) _l ; (Lys) _m ; (His) _n ; (Orn) _o ; (Xaa) _x } (formula (I)) is defined in this specification, and ( (Semi-empirical experiment) Forms the core of the amino acid sequence according to formula (I), Cys ¹ and Cys ² are (Arg) ₁ ; (Lys) _m ; (His) _n ; (Orn) _o ; Xaa) A cysteine proximal or terminal to _x . Illustrative examples can include any of the above sequences in which two Cys are placed adjacent to each other, and the following sequence:

CysArg ₇ Cys Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 1)
CysArg ₈ Cys Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 2)
CysArg ₉ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 3)
CysArg ₁₀ Cys Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 4)
CysArg ₁₁ Cys Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 5)
CysArg ₁₂ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 6)
CysArg ₁₃ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 7)
CysArg ₁₄ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 8)
CysArg ₁₅ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 9)
CysArg ₁₆ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 10)
CysArg ₁₇ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 11)
CysArg ₁₈ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 12)
CysArg ₁₉ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 13)
CysArg ₂₀ Cys: Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Cys (SEQ ID NO: 14)

This embodiment is defined, for example, according to the empirical formulas (Arg) ₁ ; (Lys) _m ; (His) _n ; (Orn) _o ; (Xaa) _x (formula (I)) above. The cationic or polycationic peptide or protein of the polymer carrier that can be used to complex at least one mRNA of the present invention is a cationic or polycationic peptide of the polymer carrier of the present invention, Applicable to situations characterized by being modified with at least two cysteines as -SH moieties in the above sense to carry at least two (terminal) cysteines capable of forming disulfide bonds with the component .

  According to a second alternative, the at least one cationic (or polycationic) component of the polymer carrier is, for example, any (non-peptidic) cationic or polycationic suitable in this regard. The (non-peptidic) cationic or polycationic polymer may be selected from a polymer, wherein the disulfide bond between the cationic or polycationic polymer and other components of the polymer carrier as defined herein Presents or has been modified to present at least one -SH moiety that provides Thus, as also defined herein, the polymer carrier may comprise the same or different cationic or polycationic polymers.

  In the specific case where the cationic component of the polymer carrier comprises a (non-peptidic) cationic or polycationic polymer, the cationic properties of the (non-peptidic) cationic or polycationic polymer are cationic. It can be determined by the amount of cationic charge compared to the overall charge of the polymer components. Preferably, the amount of cationic charge in the cationic polymer at (physiological) pH is at least 10%, 20% or 30%, preferably at least 40%, more preferably at least 50%, 60% or 70%. But also at least 80%, 90%, or even 95%, 96%, 97%, 98%, 99% or 100% are also preferred, most preferably at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or may range from about 10% to 90%, more preferably about 30 % To 100%, more preferably 50% to 100%, such as 50%, 60%, 70%, 80%, 90% or 100%, or any two of the aforementioned values The Range that (provided that all of the charge amount, for example, is defined herein throughout the cationic polymer (physiological) positive and negative charges at pH as 100%).

  Preferably, the (non-peptidic) cationic component of the polymer carrier typically has a molecular weight of 0.1 kDa or 0.5 kDa, preferably from about 1 kDa to about 75 kDa, more preferably from about 5 kDa to about 50 kDa, even more preferably. Represents a molecular weight of about 5 kDa to about 30 kDa, or a cationic or polycationic polymer exhibiting a molecular weight of about 10 kDa to about 50 kDa, and even more preferably about 10 kDa to about 0 kDa. In addition, (non-peptidic) cationic or polycationic polymers typically form disulfide bonds by condensation with other cationic or other components of the polymer carrier as defined herein. Present at least one possible -SH moiety.

  In connection with the above, the (non-peptidic) cationic component of the polymer carrier that can be used to complex at least one mRNA of the vaccine of the invention is an acrylate, pDMAEMA (poly (dimethylaminoethylmethyl acrylate) )) And other modified acrylates, chitosan, aziridine, or 2-ethyl-2-oxazoline (forms oligoethyleneimine or modified oligoethyleneimine), bisacrylate and amines that form oligo beta aminoesters or polyamidoamines Or other polymers such as polyesters and polycarbonates. Each molecule of these (non-peptidic) cationic or polycationic polymers may typically present at least one -SH moiety, where these at least -SH are for example , Iminothiolane, 3-thiopropionic acid, or the (non-peptidic) cationic or polycationic by chemical modification such as introduction of amino acids containing -SH moieties such as cysteine or any additional (modified) amino acid It may be introduced into the polymer. Such -SH moieties are preferably those already defined above.

  In relation to the polymer carrier, the cationic components that form the basis of the polymer carrier that can be used to complex at least one mRNA of the vaccine of the invention by disulfide bridges are the same or different from each other. Also good. The polymer carrier of the present invention comprises a mixture of a cationic peptide, protein or polymer and optionally further components as defined herein crosslinked by disulfide bonds as described herein. It is also particularly preferable.

  In this context, the polymer carrier of the invention that can be used to complex at least one mRNA of the vaccine of the invention is a different (short) cationic or polycationic peptide, protein or polymer, or Allows combining desired properties of other ingredients. Polymeric carriers can be used in different cell lines, particularly in vitro, for the purpose of efficient transfection of nucleic acids for adjuvant therapy, for gene therapy purposes for gene knockdown, or for other methods. In order to demonstrate not only efficient transfection of nucleic acids into but also in vivo transfection, it is allowed to efficiently condense nucleic acids without loss of activity. The polymer carrier is further non-toxic to cells, provides efficient release of its nucleic acid cargo, is stable during lyophilization, and is applicable as an immunostimulant or adjuvant. In this context, the components of the polymer carrier of the invention can be varied in such a way that the induced cytokine pattern can be determined.

  Specifically, a polymer carrier formed by a disulfide-bonded cationic component, for example, introduces the same or different cationic peptide or polymer as the cationic component into the polymer carrier, and optionally adds other components By doing so, it is possible to change the peptide or polymer content significantly and thereby to adjust its biophysical / biochemical properties, in particular the cationic properties of the polymer carrier, very simply and rapidly. Despite being composed of very small non-toxic monomer units, the polymer carrier forms a long cationic binding sequence that provides strong condensation of mRNA as the stability of the nucleic acid cargo and complex. Under cytosolic reducing conditions (eg, cytoplasmic GSH), the complex rapidly degrades into its (cationic) component, which is further degraded (eg, oligopeptide). This supports the controversy of the nucleic acid cargo in the cytosol. As is known for higher molecular oligopeptides or polymers, such as high molecular polyarginine, no toxicity is observed due to degradation into small oligopeptides or polymers in the cytosol.

  Accordingly, a polymeric carrier that can be used to complex at least one mRNA of the vaccine of the present invention is optionally a cationic or polycationic peptide, protein, as described above, with additional components as defined herein. Alternatively, it may comprise different (short) cationic or polycationic peptides, proteins or polymers selected from (non-peptidic) polymers.

  In addition, a polymeric carrier that can be used to complex at least one mRNA of the vaccine of the present invention, more preferably at least one different (short) cationic that forms the basis of the polymeric carrier via a disulfide bridge. Alternatively, the polycationic peptide or (non-peptidic) polymer may preferably be modified with at least one further component prior to disulfide crosslinking. Alternatively, such a polymeric carrier may be modified with at least one further component. It also typically optionally includes at least one additional component that forms the disulfide of the polymer carrier with other (short) cationic or polycationic peptides as defined above via disulfide bridges. You may go out.

In order to allow modification of the cationic or polycationic peptide or (non-peptidic) polymer as defined above, each component of the polymer carrier also contains at least one further (preferably already before disulfide crosslinking). Functional groups, which allow the linkage of further components as defined herein. Such functional groups can be click chemistry (eg, by amide formation (eg, carboxylic acid, sulfonic acid, amine, etc.), Michael addition (eg, maleimide moiety, α, β-unsaturated carbonyl, etc.) Azide or alkyne), alkene / alkyne metathesis (eg alkene or alkyne), imine or hydrazone formation (aldehyde or ketone, hydrazine, hydroxylamine, amine), complex formation reaction (avidin, biotin, protein G), or S _{By means of} compounds that allow _n- type substitution reactions (eg halogenated alkanes, thiols, alcohols, amines, hydrazides, sulfonate esters, oxyphosphonium salts) or other chemical moieties available for linking further components, eg Further development of functional groups, etc. It may be selected from the functional groups which permit the connection of.

  In a particularly preferred embodiment, it can be contained in a polymer carrier and can be used to conjugate at least one vaccine of the vaccine of the invention or a different (short) cationic or polycationic peptide or (non- A further component that forms the basis of a polymer carrier or the biophysical / biochemical properties of a polymer carrier as defined herein that can be used to modify a (peptidic) polymer is the amino acid component (AA) It is. According to the present invention, the amino acid component (AA) is preferably in the range of about 1-100, preferably in the range of about 1-50, more preferably 1, 2, 3, 4, 5, 6, 7, 8 , 9, 10, 11, 12, 13, 14, or 15-20, or may be selected from the range formed by any two of the aforementioned values. In this connection, the amino acids of the amino acid component (AA) can be selected independently of each other. For example, when two or more (AA) components are present in the polymer carrier, they may be the same as each other or different from each other.

  The amino acid component (AA) may comprise a —SH containing moiety, or a —SH containing moiety, which allows the introduction of this component (AA) via a disulfide bond into a polymer carrier as defined herein. May be placed adjacent (eg, at the ends). If the -SH containing moiety represents cysteine, the amino acid component (AA) may also be interpreted as -Cys- (AA) -Cys-, where Cys represents cysteine and for disulfide bonds Provide the necessary -SH moiety. The -SH containing moiety may also be introduced into the amino acid component (AA) using a cationic component as described above or any modification or reaction for any of that component.

  Further, for example, when the amino acid component (AA) is used as a linker between two additional components (eg, as a linker of two cationic polymers), the amino acid component (AA) is linked via a disulfide bond. May be provided by two -SH groups (or more) in the form represented by the formula HS- (AA) -SH, for example. In this case, one -SH moiety is preferably protected in the first step with a protecting group known in the art, leading to the amino acid component (AA) of the formula HS- (AA) -S-protecting group. The amino acid component (AA) may then be coupled to further components of the polymer carrier to form a first disulfide bond via the unprotected -SH moiety. The protected -SH moiety is then typically deprotected and attached to the additional free -SH moiety of an additional component of the polymer support to form a second disulfide bond.

  Alternatively, the amino acid component (AA) may be provided on other functional groups already described above for other components of the polymer carrier, which will bind the amino acid component (AA) to any component of the polymer carrier. Allow.

  Thus, according to the present invention, the amino acid component (AA) is a further component of the polymer carrier that can be used to complex at least one mRNA of the vaccine of the present invention with or without disulfide bonds. May be combined. Bonds that do not use disulfide bonds are obtained by linking the amino acid component (AA) to other components of the polymer carrier, preferably using amide chemistry as defined herein, by any of the reactions described above. It may be done. If desired or necessary, the other end of the amino acid component (AA), such as the N-terminus or C-terminus, may be used to link other components, such as ligand L. For this purpose, the other end of the amino acid component (AA) is preferably further functional groups such as eg alkyne species (see above) which can be used to add other components, eg via click chemistry. Or have been modified to include it. When the ligand is attached via an acid labile bond, the bond is preferably cleaved within the endosome and the polymer carrier presents an amino acid component (AA) on its surface.

  The amino acid component (AA) is, for example, one as a linker between the cationic components, preferably all as defined herein, for example as a linker between one cationic peptide and a further cationic peptide. As a linker between the cationic polymer and the further cationic polymer, it can also be present as a further component of a polymer carrier that can be used to complex at least one mRNA of the vaccine of the invention as defined above. Well, or addition of a polymer carrier, for example by attaching an amino acid component (AA) to the polymer carrier or its components, for example via a side chain or SH moiety, or via further moieties as defined herein Wherein the amino acid component (AA) is preferably modified accordingly.

  According to a further particularly preferred alternative, the amino acid component (AA) may be used to modify the content of the cationic component in the polymer carrier, in particular the polymer carrier as defined above.

  In this context, preferably the content of the cationic component in the polymer carrier is at least 10%, 20% or 30%, preferably at least 40%, more preferably at least 50%, 60% or 70%. But also at least 80%, 90%, or even 95%, 96%, 97%, 98%, 99% or 100% are also preferred, most preferably at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or may range from about 30% to 100%, more preferably about 50 % -100%, even more preferably 70% -100%, such as 70%, 80%, 90% or 100%, or a range formed by any two of the aforementioned values. (However, The content of total amino acids to 100%).

  In the context of the present invention, the amino acid component (AA) may be selected from the following options.

  According to a first alternative, the amino acid component (AA) may be an aromatic amino acid component (AA). Incorporation of an aromatic amino acid, or sequence of an amino acid as an aromatic acid component (AA), into the polymer carrier of the present invention is in contrast to its attachment to the phosphate backbone by the cationic charge sequence of the polymer carrier molecule. Allowing different (second) binding of the polymer carrier to the nucleic acid by the interaction of the aromatic amino acid with the nucleic acid cargo base. This interaction can occur, for example, by intercalation or by minor groove or major groove bonds. This type of interaction is not prone to deconsolidation by anionic complexing partners (eg, heparin, hyaluronic acid) found primarily in the extracellular matrix in vivo and is not susceptible to salt.

  For this purpose, the amino acids in the aromatic amino acid component (AA) may be selected from the same or different aromatic amino acids selected from, for example, Trp, Tyr, or Phe. Alternatively, the amino acid (or wholly aromatic amino acid component (AA)) is a combination of the following peptides: Trp-Tyr, Tyr-Trp, Trp-Trp, Tyr-Tyr, Trp-Tyr-Trp, Tyr-Trp-Tyr, Trp -Trp-Trp, Tyr-Tyr-Tyr, Trp-Tyr-Trp-Tyr, Tyr-Trp-Tyr-Trp, Trp-Trp-Trp-Trp, Phe-Tyr, Tyr-Phe, Phe-Phe, Phe-Tyr -Phe, Tyr-Phe-Tyr, Phe-Phe-Phe, Phe-Tyr-Phe-Tyr, Tyr-Phe-Tyr-Phe, Phe-Phe-Phe-Phe, Phe-Trp, Trp-Phe, Phe-Phe , Phe-Trp-Phe, Trp-Phe-Trp, Phe-Trp-Ph -Trp, Trp-Phe-Trp-Phe, or Tyr-Tyr-Tyr-Tyr and the like (SEQ ID NO: 15-42) may be selected from. Such peptide combinations may be repeated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more times. These peptide combinations may also be combined with each other as appropriate.

  In addition, the aromatic amino acid component (AA) may include a -SH containing moiety, or the -SH containing moiety may be placed adjacent, which is defined above via a disulfide bond. It is allowed to be introduced as a further part of the polymer carrier, for example as a linker. Such -SH containing moiety may be any moiety as defined herein suitable for linking one component as defined herein to a further moiety as defined herein. . As an example, such -SH containing moiety may be cysteine. And, for example, the aromatic amino acid component (AA) is, for example, a peptide combination Cys-Tyr-Cys, Cys-Trp-Cys, Cys-Trp-Tyr-Cys, Cys-Tyr-Trp-Cys, Cys-Trp-Trp. -Cys, Cys-Tyr-Tyr-Cys, Cys-Trp-Tyr-Trp-Cys, Cys-Tyr-Trp-Tyr-Cys, Cys-Trp-Trp-Trp-Cys, Cys-Tyr-Tyr-Tyr-Cys Cys-Trp-Tyr-Trp-Tyr-Cys, Cys-Tyr-Trp-Tyr-Trp-Cys, Cys-Trp-Trp-Trp-Trp-Cys, Cys-Tyr-Tyr-Tyr-Tyr-Cys, Cys -Phe-Cys, Cys-Phe-Tyr-Cys, Cys-Tyr Phe-Cys, Cys-Phe-Phe-Cys, Cys-Tyr-Tyr-Cys, Cys-Phe-Tyr-Phe-Cys, Cys-Tyr-Phe-Tyr-Cys, Cys-Phe-Phe-Pys Cys-Tyr-Tyr-Tyr-Cys, Cys-Phe-Tyr-Phe-Tyr-Cys, Cys-Tyr-Phe-Tyr-Phe-Cys, or Cys-Phe-Phe-Phe-Phe-Cys, CysP -Trp-Cys, Cys-Trp-Phe-Cys, Cys-Phe-Phe-Cys, Cys-Phe-Trp-Phe-Cys, Cys-Trp-Phe-Trp-Cys, Cys-Phe-Trp-Phe-Trp -From Cys, Cys-Trp-Phe-Trp-Phe-Cys, etc. It may be-option. Each of the Cys above may also be replaced by any modified peptide or compound carrying a free-SH moiety as defined herein (SEQ ID NOs: 43-75). Such peptide combinations may be repeated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more times. These peptide combinations may also be combined with each other as appropriate.

  In addition, the aromatic amino acid component (AA) has at least one proline, preferably two, three or more, which can function as a long sequence structural breaker of Trp, Tyr and Phe in the aromatic amino acid component (AA) More proline may be included or represented.

  According to a second alternative, the amino acid component (AA) may be a hydrophilic (and preferably uncharged polar) amino acid component (AA). Incorporation of sequences as hydrophilic (and preferably uncharged polar) amino acids, or amino hydrophilic (and preferably uncharged polar) acid components (AA) into the polymer carrier of the present invention is more flexible into nucleic acid cargo. Allows sexual coupling. This results in a more effective consolidation of the nucleic acid cargo and thus better protection against nucleases and unwanted deconsolidation. It also allows for the provision of (long) polymer carriers that exhibit a reduced cationic charge throughout the entire carrier, as desired or required, and in this connection improves the adjusted binding properties.

  For this purpose, the amino acids in the hydrophilic (and preferably uncharged polar) amino acid component (AA) are the same or different hydrophilic (and preferably uncharged polar) selected from eg Thr, Ser, Asn or Gln. ) May be selected from amino acids. Alternatively, the amino acid (or the total hydrophilic (and preferably uncharged polar) amino acid (AA)) is a combination of the following peptides: Ser-Thr, Thr-Ser, Ser-Ser, Thr-Thr, Ser-Thr-Ser, Thr-Ser-Thr, Ser-Ser-Ser, Thr-Thr-Thr, Ser-Thr-Ser-Thr, Thr-Ser-Thr-Ser, Ser-Ser-Ser-Ser, Thr-Thr-Thr-Thr, Gln-Asn, Asn-Gln, Gln-Gln, Asn-Asn, Gln-Asn-Gln, Asn-Gln-Asn, Gln-Gln-Gln, Asn-Asn-Asn, Gln-Asn-Gln-Asn, Gln-Asn-Gln, Gln-Gln-Gln-Gln, Asn-Asn-As Asn, Ser-Asn, Asn-Ser, Ser-Ser, Asn-Asn, Ser-Asn-Ser, Asn-Ser-Asn, Ser-Ser-Ser, Asn-Asn-Asn, Ser-Asn-Ser-Asn Asn-Ser-Asn-Ser, Ser-Ser-Ser-Ser, Asn-Asn-Asn-Asn, etc. (SEQ ID NOs: 76-111). Such peptide combinations may be repeated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more times. These peptide combinations may also be combined with each other as appropriate.

  In addition, the hydrophilic (and preferably uncharged polar) amino acid component (AA) may comprise a -SH containing moiety, or the -SH containing moiety may be located adjacent, via a disulfide bond. This component is then allowed to be introduced as a further part of the polymer carrier as defined above, for example as a linker. Such -SH containing moiety may be any moiety as defined herein suitable for linking one component as defined herein to a further moiety as defined herein. . As an example, such -SH containing moiety may be cysteine. And, for example, the hydrophilic (and preferably uncharged polar) amino acid component (AA) can be derived from, for example, peptide combinations Cys-Thr-Cys, Cys-Ser-Cys, Cys-Ser-Thr-Cys, Cys-Thr-Ser. -Cys, Cys-Ser-Ser-Cys, Cys-Thr-Thr-Cys, Cys-Ser-Thr-Ser-Cys, Cys-Thr-Ser-Thr-Cys, Cys-Ser-Ser-Ser-Cys, Cys -Thr-Thr-Thr-Cys, Cys-Ser-Thr-Ser-Thr-Cys, Cys-Thr-Ser-Thr-Ser-Cys, Cys-Ser-Ser-Ser-Ser-Cys, Cys-Thr-Thr -Thr-Thr-Cys, Cys-Asn-Cys, Cys-Gln-C s, Cys-Gln-Asn-Cys, Cys-Asn-Gln-Cys, Cys-Gln-Gln-Cys, Cys-Asn-Asn-Cys, Cys-Gln-Asn-Gln-Cys, Cys-Asn-Gls Asn-Cys, Cys-Gln-Gln-Gln-Cys, Cys-Asn-Asn-Asn-Cys, Cys-Gln-Asn-Gln-Asn-Cys, Cys-Asn-Gln-Asn-Gys-Cys-Cys Gln-Gln-Gln-Gln-Cys, Cys-Asn-Asn-Asn-Asn-Cys, Cys-Asn-Cys, Cys-Ser-Cys, Cys-Ser-Asn-Cys, Cys-Asn-Cys-Cys Cys-Ser-Ser-Cys, Cys-Asn-Asn-Cys, Cy -Ser-Asn-Ser-Cys, Cys-Asn-Ser-Asn-Cys, Cys-Ser-Ser-Ser-Cys, Cys-Asn-Asn-Asn-Cys, Cys-Ser-Asn-Ser-Asn-Cys , Cys-Asn-Ser-Asn-Ser-Cys, Cys-Ser-Ser-Ser-Ser-Cys, or Cys-Asn-Asn-Asn-Asn-Cys, and the like. Each Cys above may also be replaced by any modified peptide or compound carrying a free-SH moiety as defined herein. (SEQ ID NOs: 112-153) Such peptide combinations may be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15 or more times It may be repeated. These peptide combinations may also be combined with each other as appropriate.

  In addition, the hydrophilic (and preferably uncharged polar) amino acid component (AA) functions as a structural breaker for long sequences of Ser, Thr and Asn in the hydrophilic (and preferably uncharged polar) amino acid component (AA). It may contain at least one proline, preferably two, three or more prolines.

  According to a third alternative, the amino acid component (AA) may be a lipophilic amino acid component (AA). Incorporation of a sequence as a lipophilic amino acid or amino lipophilic acid component (AA) into the polymer carrier of the present invention is at least one of a nucleic acid cargo and a polymer carrier in forming a complex, and the nucleic acid cargo. Enables stronger consolidation. This is due in particular to the interaction of one or more polymer chains of the polymer carrier, in particular the lipophilic amino acid component (AA) and the lipophilic part of the nucleic acid cargo. This interaction preferably adds additional stability to the complex between the polymer carrier and its nucleic acid cargo. This stabilization can be compared in some way to a kind of non-covalent bond between different polymer chains. This interaction is typically strong and provides a significant effect, especially in aqueous environments.

  For this purpose, the amino acids in the lipophilic amino acid component (AA) may be selected from the same or different lipophilic amino acids selected from, for example, Leu, Val, Ile, Ala, and Met. Alternatively, the amino acid (or all lipophilic amino acid component (AA)) can be obtained from the following peptide combinations: Leu-Val, Val-Leu, Leu-Leu, Val-Val, Leu-Val-Leu, Val-Leu-Val, Leu -Leu-Leu, Val-Val-Val, Leu-Val-Leu-Val, Val-Leu-Val-Leu, Leu-Leu-Leu-Leu, Val-Val-Val-Val, Ile-Ala, Ala-Ile , Ile-Ile, Ala-Ala, Ile-Ala-Ile, Ala-Ile-Ala, Ile-Ile-Ile, Ala-Ala-Ala, Ile-Ala-Ile-Ala, Ala-Ile-Ala-Ile, Ile -Ile-Ile-Ile, Ala-Ala-Ala-Ala, Met-Al Ala-Met, Met-Met, Ala-Ala, Met-Ala-Met, Ala-Met-Ala, Met-Met-Met, Ala-Ala-Ala, Met-Ala-Met-Ala, Ala-Met-Ala -Met, or Met-Met-Met-Met etc. (SEQ ID NO: 154-188). Such peptide combinations may be repeated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15 or more times. These peptide combinations may also be combined with each other as appropriate.

  In addition, the lipophilic amino acid component (AA) may include a -SH containing moiety or may be placed adjacent to a -SH containing moiety, which defines this component as defined above via a disulfide bond. It is allowed to be introduced as a further part of the polymer carrier, for example as a linker. Such -SH containing moiety may be any moiety as defined herein suitable for linking one component as defined herein to a further moiety as defined herein. . As an example, such -SH containing moiety may be cysteine. And, for example, the lipophilic amino acid component (AA) can be derived from, for example, peptide combinations Cys-Val-Cys, Cys-Leu-Cys, Cys-Leu-Val-Cys, Cys-Val-Leu-Cys, Cys-Leu-Leu -Cys, Cys-Val-Val-Cys, Cys-Leu-Val-Leu-Cys, Cys-Val-Leu-Val-Cys, Cys-Leu-Leu-Leu-Cys, Cys-Val-Val-Val-Cys Cys-Leu-Val-Leu-Val-Cys, Cys-Val-Leu-Val-Leu-Cys, Cys-Leu-Leu-Leu-Leu-Cys, Cys-Val-Val-Val-Val-Cys, Cys -Ala-Cys, Cys-Ile-Cys, Cys-Ile-Ala Cys, Cys-Ala-Ile-Cys, Cys-Ile-Ile-Cys, Cys-Ala-Ala-Cys, Cys-Ile-Ala-Ile-Cys, Cys-Ala-Ile-Ala-Cys, Cys-Ile- Ile-Ile-Cys, Cys-Ala-Ala-Ala-Cys, Cys-Ile-Ala-Ile-Ala-Cys, Cys-Ala-Ile-Ala-Ile-Cys, Cys-Ile-Ile-Ile-Ile- Cys, or Cys-Ala-Ala-Ala-Ala-Cys, Cys-Met-Cys, Cys-Met-Ala-Cys, Cys-Ala-Met-Cys, Cys-Met-Met-Cys, Cys-Ala-Ala -Cys, Cys-Met-Ala-Met-Cys, Cys-Al -Met-Ala-Cys, Cys-Met-Met-Met-Cys, Cys-Ala-Ala-Ala-Cys, Cys-Met-Ala-Met-Ala-Cys, Cys-Ala-Met-Ala-Met-Cys , Cys-Met-Met-Met-Met-Cys, or Cys-Ala-Ala-Ala-Ala-Cys and the like. Each of the Cys above may also be replaced by any modified peptide or compound carrying a free-SH moiety as defined herein (SEQ ID NOs: 189-229). Such peptide combinations may be repeated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15 or more times. These peptide combinations may also be combined with each other as appropriate.

  In addition, the lipophilic amino acid component (AA) has at least one proline, preferably two, which can function as a long sequence structural breaker of Leu, Val, Ile, Ala and Met in the lipophilic amino acid component (AA). Three or more prolines may be included.

  Finally, according to a fourth alternative, the amino acid component (AA) may be a weakly basic amino acid component (AA). Incorporation of a weakly basic amino acid, or sequence as a weakly basic amino acid component (AA), into the polymer carrier of the present invention can function as a proton sponge and promote endosome escape (also called endosome release) (proton sponge. effect). Such incorporation of the weakly basic amino acid component (AA) preferably improves transfection efficiency.

  For this purpose, the amino acids in the weakly basic amino acid component (AA) can be selected from the same or different weak amino acids selected, for example, from histidine or aspartate (aspartic acid). Alternatively, the weakly basic amino acid (or all weakly basic amino acid components (AA)) can be obtained from the following peptide combinations: Asp-His, His-Asp, Asp-Asp, His-His, Asp-His-Asp, His-Asp -His, Asp-Asp-Asp, His-His-His, Asp-His-Asp-His, His-Asp-His-Asp, Asp-Asp-Asp-Asp, or His-His-His-His, etc. Number: 230-241). Such peptide combinations may be repeated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15 or more times. These peptide combinations may also be combined with each other as appropriate.

  In addition, the weakly basic amino acid component (AA) may include a -SH containing moiety, or the -SH containing moiety may be placed adjacent to, and this may be the above described component via a disulfide bond. It is allowed to be introduced as a further part of the defined polymer carrier, for example as a linker. Such -SH containing moiety may be any moiety as defined herein suitable for linking one component as defined herein to a further moiety as defined herein. . As an example, such -SH containing moiety may be cysteine. And, for example, the weakly basic amino acid component (AA) may be, for example, a peptide combination Cys-His-Cys, Cys-Asp-Cys, Cys-Asp-His-Cys, Cys-His-Asp-Cys, Cys-Asp- Asp-Cys, Cys-His-His-Cys, Cys-Asp-His-Asp-Cys, Cys-His-Asp-His-Cys, Cys-Asp-Asp-Asp-Cys, Cys-His-His-His- Cys, Cys-Asp-His-Asp-His-Cys, Cys-His-Asp-His-Asp-Cys, Cys-Asp-Asp-Asp-Asp-Cys, or Cys-His-His-His-His-Cys Etc. may be selected. Each of the above Cys may also be replaced by any modified peptide or compound carrying a free-SH moiety as defined herein (SEQ ID NO: 242-255). Such peptide combinations may be repeated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15 or more times. These peptide combinations may also be combined with each other as appropriate.

  In addition, the weakly basic amino acid component (AA) has at least one proline, preferably at least one proline capable of functioning as a long sequence structural breaker of histidine or aspartate (aspartic acid) in the weakly basic amino acid component (AA) Two, three or more prolines may be included.

According to a fifth alternative, the amino acid component (AA) is a signal peptide or signal sequence, a localization signal or localization sequence, a nuclear localization signal or nuclear localization sequence (NLS), an antibody, a cell It may be a permeable peptide (for example, TAT) or the like. Preferably, such an amino acid component (AA) is linked to the polymer carrier or another component of the polymer carrier via a (reversible) disulfide bond. In this context, signal peptides or signal sequences, localization signals or localization sequences, nuclear localization signals or nuclear localization sequences (NLS), antibodies, cell penetrating peptides (eg TAT) etc. In addition, at least one -SH moiety. In this regard, the signal peptide, localization signal or localization sequence, or nuclear localization signal or nuclear localization sequence (NLS) can be used to direct the polymer carrier cargo complex of the present invention to a specific target cell (eg, Mitochondria that allow transport localization of the polymer carrier to a specific target, for example to a cell, to the nucleus, to an endosomal compartment, preferably to the stem cell or antigen-presenting cell) Sequence to the matrix, localization sequence to the cell membrane, localization sequence to the Golgi apparatus, nucleus, cytoplasm, cytoskeleton, and the like. Such a signal peptide, localization signal or localization sequence, or nuclear localization signal may be any nucleic acid as defined herein, preferably RNA or DNA, more preferably shRNA or pDNA, eg to the nucleus. Can be used for transportation. Without being limited thereto, such a signal peptide, localization signal or localization sequence, or nuclear localization signal may comprise, for example, a localization sequence to the endoplasmic reticulum. Specific localization signals or localization sequences or nucleic acid localization signals include, for example, KDEL (SEQ ID NO: 256), DDEL (SEQ ID NO: 257), DEEL (SEQ ID NO: 258), QEDL (sequence No. 259), RDEL (SEQ ID NO: 260) and GQNLSTSN (SEQ ID NO: 261), PKKKRKV (SEQ ID NO: 262), PQKKIKS (SEQ ID NO: 263), QPKKP (SEQ ID NO: 264), RKKR (SEQ ID NO: 265), RKKRRQRRRAHQ (SEQ ID NO: 266), RQARNRRRRRWRERRQR (SEQ ID NO: 267), MPLTRRRPAASQALAPPTP (SEQ ID NO: 268), GAALTILV (SEQ ID NO: 269) and GAALITLLG (SEQ ID NO: 270) MDDQR Localization sequence to the endosomal compartment containing LISNNEQLP (SEQ ID NO: 271), localization sequence to the mitochondrial matrix including MLFNNLXXLNNAAFRHNFMVRNFRCGQPLX (SEQ ID NO: 272), GCVCSSNP (SEQ ID NO: 273), GQTVTTPL (SEQ ID NO: 274), GQELSQHE (SEQ ID NO: 275), GNSPSYNP (SEQ ID NO: 276), GVSGSKGQ (SEQ ID NO: 277), GQTITTPL (SEQ ID NO: 278), GQTLTTPL (SEQ ID NO: 279), GQIFSRSA (SEQ ID NO: 280) , GQIHGLSP (SEQ ID NO: 281), GARASVLS (SEQ ID NO: 282) and GCTLSAEE (SEQ ID NO: 283) and other localized sequences on the cell membrane, GAQVS Endoplasmic reticulum and nuclear localization sequence including QK (SEQ ID NO: 284) and GAQ LSRNT (SEQ ID NO: 285), Golgi apparatus including GNAAAAKKK (SEQ ID NO: 286), localization to nucleus, cytoplasm and cytoskeleton And a localization sequence to cytoplasm and cytoskeleton including GNEASYPL (SEQ ID NO: 287), a localization sequence to cell membrane and cytoskeleton including GSSKSKPK (SEQ ID NO: 288), and the like. Examples of secretory signal peptide sequences as defined herein include, but are not limited to, classical MHC molecules or non-classical MHC molecules (eg, signal sequences of MHC I and MHC II molecules, eg, MHC class I molecules HLA -A ^* 0201 signal sequence), a cytokine or immunoglobulin signal sequence as defined herein, an immunoglobulin or antibody invariant chain signal sequence as defined herein, Lamp1, Tapasin, Erp57, Carle Signal sequences for ticulin, calnexin, and additional membrane-bound proteins, or signal sequences for proteins associated with the endoplasmic reticulum (ER) or endosome-lysosome compartment. Particularly preferably, the signal sequence of the MHC class I molecule HLA-A ^* 0201 can be used according to the invention. Such additional components may be bound to, for example, any other component of the cationic polymer or polymer carrier as defined herein. Preferably, the signal peptide, localization signal or localization sequence, or nuclear localization signal or nuclear localization sequence (NLS) has a (reversible) disulfide bond to the polymer carrier or other component of the polymer carrier. Connected through. For this purpose, the (AA) component additionally comprises at least one -SH moiety as defined herein. Binding to any component of the polymer carrier also uses acid labile bonds, preferably cleaving or releasing additional components at low pH values, such as physiological pH values as defined herein. May be carried out via any side chain of the component of the polymer carrier that allows

  In addition, according to another alternative, the amino acid component (AA) may be a functional peptide or protein that can modulate the function of the polymer carrier accordingly. Such a functional peptide or functional protein as an amino acid component (AA) preferably comprises any peptide or protein as defined herein, eg as defined below as a therapeutically effective protein. Also good. According to one alternative, such further functional peptides or functional proteins may comprise so-called cell penetrating peptides (CPP) or cationic peptides for transport. Particularly preferred are CPPs that induce pH-mediated structural changes within the endosome and result in improved release of the polymeric carrier (complex with nucleic acid) from the endosome by insertion into the lipid layer of the liposome. These cell penetrating peptides (CPP) or cationic peptides for transport include, but are not limited to, protamine, nucleolin, spermine or spermidine, oligo- or poly-L-lysine (PLL), basic poly Peptide, oligo or polyarginine, chimeric CPP such as transportan or MPG peptide, HIV binding peptide, Tat, HIV-1 Tat (HIV), Tat derived peptide such as penetratin, antennapedia derived peptide (particularly from Drosophila antennapedia), penetratin family members such as pAntp and pIsl, and for example, buforin 2, Bac715-24, SynB, SynB (1), pVEC, hCT-derived peptides, SAP, MAP, PpTG20, Rich in ligomer, FGF, lactoferrin, histone, VP22-derived or similar peptides, plague virus Erns, HSV, VP22 (herpes simplex), MAP, KALA or protein transduction domain (PTD), PpT620, proline-rich peptide, arginine Mention may be made of CPPs derived from antibacterial agents such as peptides, peptides rich in lysine, Pep-1, L-oligomers, and calcitonin peptides. Such an amino acid component (AA) may also be bound to any polymer carrier as defined herein. Preferably it is bound to the polymer carrier or another component of the polymer carrier via a (reversible) disulfide bond. For the above purposes, the amino acid component (AA) preferably comprises at least one -SH moiety as defined herein. Conjugation to any component of the polymer carrier may also be accomplished using SH moieties or acid labile linkages, preferably with additional components at low pH values, such as physiological pH values as defined herein. It may take place via any side chain of the component of the polymer carrier that allows it to be cleaved or released.

  According to the last alternative, the amino acid component (AA) may consist of any peptide or protein capable of performing any beneficial function in the cell. Particularly preferred are, for example, tumor antigens, pathogenic antigens (animal antigens, viral antigens, protozoan antigens, bacterial antigens, allergic antigens), autoimmune antigens, or allergen derived, antibody derived, immunostimulatory proteins or peptides Therapeutic effects derived from antigens, such as further antigens derived from antigens, antigen-specific T cell receptors, or any other protein or peptide suitable for the specific (therapeutic) application defined below for the encoding nucleic acid It is a peptide or protein selected from a certain protein or peptide. Particularly preferred are peptide epitopes derived from an antigen as defined herein.

  The polymer carrier that can be used to complex at least one mRNA of the vaccine of the invention is at least one of the above-mentioned cationic or polycationic peptides, proteins or polymers, or further components such as (AA) Where any of the above alternatives may be combined with each other and may be formed by polymerizing them in a polycondensation reaction via their -SH moieties. .

  In another aspect, the cationic or polycationic peptides, proteins or further components described above, such as those described above, which can be used to complex at least one mRNA of the vaccine of the invention or a single component thereof, such as The polymer carrier of (AA) may be further modified with a ligand, preferably a carbohydrate, more preferably a sugar, even more preferably mannose. Preferably, the ligand is bound to the polymer carrier or a component of the polymer carrier via a (reversible) disulfide bond or via Michael addition. If the ligand is linked by a disulfide bond, the ligand further comprises at least one -SH- moiety. These ligands can be used to direct the polymer carrier cargo complexes of the present invention to specific target cells (eg, hepatocytes or antigen presenting cells). In this context, mannose is particularly preferred as a ligand, especially when dendritic cells are targets for vaccination or adjuvant purposes.

  According to one particular embodiment, the entire polymer carrier according to the invention is in the first stage (at least one) a cationic or polycationic peptide, protein or polymer as described above, or a further component, for example (AA ), Via their -SH moieties, and complexation of nucleic acids to such polymer carriers in the second step. The polymer carrier thus comprises a number of at least one or more of the same or different cationic or polycationic peptides, proteins or polymers as defined above, or further components such as (AA). The number is preferably determined in the above range.

  In one alternative specific embodiment, the polymeric carrier of the present invention that can be used to complex at least one mRNA of the vaccine of the present invention comprises at least one of the aforementioned cations via their -SH moiety. Or polycationic peptides, proteins or polymers, or additional components, such as (AA), at the same time at least one mRNA encoding at least one antigen on a polymer carrier (made in situ) It is formed by complexing. Similarly, the polymeric carrier is thus at least one or more of the same or different cationic or polycationic peptides, proteins or polymers as defined above or further components such as (AA) The number is preferably determined in the above range.

  According to a further alternative embodiment, the polymer carrier of the present invention may be selected from polymer carrier molecules of the general formula (VI):

_{^{L-P 1 -S- [S-}} P 2 -S] n -S-P 3 -L formula (VI)
Where P ¹ and P ³ are different or identical to each other and represent a linear or branched hydrophilic polymer chain, each P ¹ and P ³ being condensed with component P ² , Or (AA), (AA) _x or [(AA) _x ] _z (if such a component is used as a linker between P ¹ and P ² or P ³ and P ² ), and further components Presenting at least one -SH moiety capable of forming a disulfide bond by condensation with at least one of (eg (AA), (AA) _x , [(AA) _x ] _z or L), Alternatively, the branched hydrophilic polymer chains are independently of each other polyethylene glycol (PEG), poly-N- (2-hydroxypropyl) methacrylamide, poly-2- (methacryloyloxy) ethyl phosphorylcholine, poly ( Hydroxyalkyl L-asparagine), poly (2- (methacryloyloxy) ethyl phosphorylcholine), hydroxyethyl starch, or poly (hydroxyalkyl L-glutamine), wherein the hydrophilic polymer chain is from about 1 kDa to about Exhibits a molecular weight of 100 kDa, preferably from about 2 kDa to about 25 kDa, more preferably from about 2 kDa to about 10 kDa, such as from about 5 kDa to about 25 kDa or from 5 kDa to about 10 kDa,
P ² is, for example, a cationic or polycationic peptide or protein as defined herein, preferably having a length of about 3 to 100 amino acids, more preferably about 3 to about 50 amino acids. Even more preferably from about 3 to about 25 amino acids, such as from about 3 to 10 amino acids, from 5 to 15 amino acids, from 10 to 20 amino acids or from 15 to 25 amino acids, more preferably from about 5 to 20 amino acids, and Even more preferably it has a length of about 10 to about 20 amino acids, or
P ² typically has a molecular weight of about 0.5 kDa to about 30 kDa, including a molecular weight of about 1 kDa to about 20 kDa, more preferably about 1.5 kDa to about 10 kDa, or about 10 kDa to about 50 kDa, More preferably a cationic or polycationic polymer as defined herein having a molecular weight of about 0.5 kDa to about 100 kDa, including a molecular weight of about 10 kDa to about 30 kDa, wherein each P ² is a further component Disulfide bonds by condensation with P ² or at least one of component P ¹ and component P ³ or alternatively with further components (eg (AA), (AA) _x , or [(AA) _x ] _z ) Present at least two -SH moieties capable of forming
-S-S- is a (reversible) disulfide bond (the parentheses are omitted for readability), where S preferably forms a sulfur or (reversible) disulfide bond. -Represents the SH carrying part. Said (reversible) disulfide bonds are preferably components P ¹ and P ² , P ² and P ² , or P ² and P ³ , or optionally further components as defined herein (eg L, (AA), (AA) _x , [(AA) _x ] _z, etc.), wherein the —SH moiety is part of the structure of these components, or May be added by the modifications defined below,
L is an optional ligand that may or may not be present and, independently of each other, RGD, transferrin, folic acid, signal peptide or signal sequence, localization signal or localization sequence, nucleic acid localization signal Or nucleic acid localization sequences (NLS), antibodies, cell penetrating peptides (eg, TAT or KALA), receptor ligands (eg, cytokines, hormones, growth factors, etc.), small molecules (eg, mannose, galactose, Or carbohydrates such as synthetic ligands), small molecule agonists, receptor inhibitors or antagonists (eg RGD peptidomimetic analogs), or any additional protein as defined herein,
n is typically in the range of, for example, about 4-9, 4-10, 3-20, 4-20, 5-20 or 10-20, about 3-15, 4-15 or 10-15. A range, or a range of about 1-50, including a range of about 6-11 or 7-10, preferably about 1, 2, or 3-30, more preferably about 1, 2, 3, 4 or 5. Range of about 25, about 1, 2, 3, 4 or 5-20, about 1, 2, 3, 4 or 5-15, or about 1, 2, 3, 4 or 5-10 Is an integer selected from Most preferably, n is in the range of about 1, 2, 3, 4 or 5-10, more preferably in the range of about 1, 2, 3 or 4-9, in the range of about 1, 2, 3 or 4-8. Or in the range of about 1, 2 or 3-7.

As defined above, the ligand (L) is present in the polymer carrier molecule of the invention of general formula (VI), for example the carrier polymer of the invention and all its “cargo” (adjuvant components and antigens of the invention). It may optionally be used for directing at least any or vaccine composition) to specific cells. They are independent of each other: RGD, transferrin, folic acid, signal peptide or signal sequence, localization signal or localization sequence, nucleic acid localization signal or nucleic acid localization sequence (NLS), antibody, cell permeability Peptides (CPP) (eg, TAT, KALA), receptor ligands (eg, cytokines, hormones, growth factors, etc.), small molecules (eg, carbohydrates such as mannose, galactose, or synthetic ligands), small molecule agonists, receptors May be selected from body inhibitors or antagonists (eg, RGD peptidomimetic analogs) or molecules as further defined below. Particularly preferred is cell permeability that induces pH-mediated structural changes in the endosome and results in improved release of the polymer carrier of the invention (complex with nucleic acid) from the endosome by insertion into the lipid layer of the liposome. It is a peptide (CPP). So-called CPP or cationic peptides for transport include, but are not limited to, protamine, nucleolin, spermine or spermidine, poly-L-lysine (PLL), basic polypeptide, polyarginine, transportan or MPG peptide Such as chimeric CPP, HIV binding peptide, Tat, HIV-1 Tat (HIV), Tat-derived peptide, oligoarginine such as penetratin, antennapedia-derived peptide (especially from Drosophila antennapedia), penetratin family such as pAntp and pIsl Members, as well as, for example, buforin 2, Bac715-24, SynB, SynB (1), pVEC, hCT-derived peptides, SAP, MAP, PpTG20, proline rich peptides, loligomers Arginine-rich peptide, calcitonin peptide, FGF, lactoferrin, poly-L-lysine, polyarginine, histone, VP22-derived or similar peptide, plague virus Erns, HSV, VP22 (herpes simplex), MAP, KALA or protein trait CPPs derived from antimicrobial agents such as transduction domains (PTDs), PpT620, proline rich peptides, arginine rich peptides, lysine rich peptides, Pep-1, L-oligomers, and calcitonin peptides may be mentioned. Particularly preferred in this regard is mannose as a ligand that targets antigen presenting cells that carry the mannose receptor on their cell membrane. In a further preferred aspect of the first embodiment of the present invention, galactose as an optional ligand can be used to target hepatocytes. Such ligands can be modified by reversible disulfide bonds as defined below, or by other possible chemical additions such as amide formation (eg carboxylic acid, sulfonic acid, amine, etc.) Imide moiety, α, β unsaturated carbonyl, etc.), click chemistry (eg azide or alkyne), imine or hydrazone formation (aldehyde or ketone, hydrazine, hydroxylamine, amine), complex formation reaction (avidin, biotin, Protein G), or compounds that allow _Sn- type substitution reactions (eg, halogenated alkanes, thiols, alcohols, amines, hydrazides, sulfonate esters, oxyphosphonium salts) or other chemicals available for linking further components Part at least of component P ¹ and component P ³ It may be attached to either.

In connection with formula (VI) of the present invention, P ¹ and P ³ represent a linear or branched hydrophilic polymer chain comprising at least one —SH moiety, each P ¹ and P ³ being Independently of each other, for example, polyethylene glycol (PEG), poly-N- (2-hydroxypropyl) methacrylamide, poly-2- (methacryloyloxy) ethyl phosphorylcholine, poly (hydroxyalkyl L-asparagine), or poly ( Hydroxyalkyl L-glutamine). P ¹ and P ³ may be the same or different from each other. Preferably, each hydrophilic polymer P ¹ and P ² has a molecular weight of about 1 kDa to about 100 kDa, preferably about 1 kDa to about 75 kDa, more preferably about 5 kDa to about 50 kDa, and even more preferably about 5 kDa to about 25 kDa. Show. In addition, each hydrophilic polymer P ¹ and P ³ typically includes at least one —SH moiety, where optionally, eg, L and / or (AA) or (AA) _x When used as a linker between P ¹ and P ² , or P ³ and P ² as defined below, with additional components such as, for example, two or more —SH moieties are included. If it has, the at least one -SH moiety is capable of forming a disulfide bond by reaction with component ^{P 2,} or component (AA) or component _{(AA) x.} Any ^{one of} S, P ¹ and P ³ is as defined herein, and the following sub-formulas “P ¹ -S—S—P ² ” and “P ² -S” in the general formula (VI). —S—P ³ ”(the parentheses are omitted for ease of reading) typically means that one —SH moiety of the hydrophilic polymers P ¹ and P ³ is a component of the general formula (VI) above. It represents the case where it condenses with one -SH moiety of P ² and the sulfur of both -SH moieties forms the disulfide bond -SS- as defined in formula (VI). These -SH moiety is typically, for example, internal cysteine, or any further carrying the -SH moiety (modified) via an amino acid or amino compounds, by each of the hydrophilic polymer P ¹ and P ² Provided. Thus, the sub-formulas “P ¹ -S-S-P ² ” and “P ² -S-S-P ³ ” also represent “P ¹ -Cys-Cys” when the —SH moiety is provided by cysteine. -P ² "and" it may be described as ^P 2 ^{-Cys-Cys-P 3} ', wherein, expression of Cys-Cys represents two cysteines are linked via a disulfide bond rather than a peptide bond . In this case, the expression “—S—S—” in these formulas may also be described as “—S-Cys”, “—Cys-S” or “-Cys-Cys-”. In this context, the expression "-Cys-Cys-" represents a bond between two cysteines that form a disulfide bond through their -SH moiety, rather than a peptide bond. Thus, the expression "-Cys-Cys-" may also be generally understood as "-(Cys-S)-(S-Cys)-", where, in certain cases, S is Refers to the sulfur of the -SH moiety of cysteine. Similarly, the expressions "-S-Cys" and "-Cys-S" refer to the disulfide bond between the -SH containing moiety and cysteine, which are "-S- (S-Cys)" and " -(Cys-S) -S ". Alternatively, the hydrophilic polymer P ¹ and P ^3, so that each of the hydrophilic polymer P ¹ and P ³ are carrying at least one such -SH moieties, preferably, the compounds bearing -SH moiety It may be modified with a -SH moiety through a chemical reaction. Such a compound bearing a —SH moiety may be, for example, (additional) cysteine, or any additional (modified) amino acid bearing a —SH moiety. Such compounds may also be non-amino compounds or non-amino moieties that contain or allow the introduction of —SH moieties to the hydrophilic polymers P ¹ and P ^{3 as} defined herein. Such non-amino compounds can be synthesized by, for example, Michael addition (eg, maleimide moieties, α, , Β-unsaturated carbonyl, etc.), click chemistry (eg azide or alkyne), alkene / alkyne metathesis (eg alkene or alkyne), imine or hydrazone formation (aldehyde or ketone, hydrazine, hydroxylamine, amine), complex forming reaction (avidin, biotin, protein G), or a compound which allows the S _n-type substitution reaction (e.g., halogenated alkanes, thiols, alcohols, amines, hydrazides, sulfonic acid esters, oxy phosphonium salt) or a further component Through a chemical reaction or binding of the compounds according to another chemical moiety which can be used in connection, it may be linked to a hydrophilic polymer P ¹ and P ³ of the formula (VI) of the polymer support according to the present invention. A particularly preferred PEG derivative in this connection is α-methoxy-ω-mercaptopoly (ethylene glycol). In each case, for example the cysteine or any further (modified) amino acid or the SH moiety of the compound may be present at the end or inside any position of the hydrophilic polymers P ¹ and P ³ . As defined herein, each hydrophilic polymer P ¹ and P ³ typically presents at least one —SH moiety, preferably at one terminus, but two or more − SH moieties may be included, which are further components as defined herein, preferably further functional peptides or proteins such as ligands, amino acid components (AA) or (AA) _x , antibodies, cells Permeability peptides or enhancer peptides (eg, TAT, KALA) etc. may be used to add additional.

  According to one preferred alternative, such further functional peptides or functional proteins may comprise so-called cell penetrating peptides (CPP) or cationic peptides for transport. Particularly preferred is a CPP that induces pH-mediated structural changes within the endosome and results in improved release of the polymer carrier of the invention (complex with nucleic acid) from the endosome by insertion into the lipid layer of the liposome. . So-called cell penetrating peptides (CPP) or cationic peptides for transport include, but are not limited to, protamine, nucleolin, spermine or spermidine, poly-L-lysine (PLL), basic polypeptide, polyarginine , Chimeric CPP such as transportan or MPG peptide, HIV binding peptide, Tat, HIV-1 Tat (HIV), Tat-derived peptide, oligoarginine such as penetratin, antennapedia-derived peptide (particularly from Drosophila antennapedia), pAntp and pIsl Such as buforin 2, Bac715-24, SynB, SynB (1), pVEC, hCT-derived peptide, SAP, MAP, PpTG20, proline Peptide, lorigomer, arginine-rich peptide, calcitonin peptide, FGF, lactoferrin, poly-L-lysine, polyarginine, histone, VP22-derived or similar peptide, plague virus Erns, HSV, VP22 (herpes simplex), MAP, CPPs derived from antibacterial agents such as KALA or protein transduction domain (PTD), PpT620, proline rich peptides, arginine rich peptides, lysine rich peptides, Pep-1, L-oligomers, and calcitonin peptides.

According to a further preferred aspect of the first embodiment of the present invention, each hydrophilic polymer P ¹ and P ³ of formula (VI) of the polymer support used in accordance with the present invention is defined, for example, herein. Michael addition (eg maleimide moiety, α, β unsaturation) from at least one further functional group allowing the linkage of further components such as, for example, amide formation (eg carboxylic acid, sulfonic acid, amine, etc.) Carbonyl etc.), click chemistry (eg azide or alkyne), imine or hydrazone formation (aldehyde or ketone, hydrazine, hydroxylamine, amine), complex formation reaction (avidin, biotin, protein G), or _Sn type Compounds that permit substitution reactions (eg, halogenated alkanes, thiols, alcohols, amines, hydrazides, It may contain a ligand or functional group as defined above which allows the linkage of further components by sulfonic acid esters, oxyphosphonium salts) or other chemical moieties available for the linkage of further components. The further functional moiety may comprise an amino acid component (AA) or (AA) _x as defined herein, where (AA) is preferably an amino acid component as defined above. In connection with the above, x is preferably in the range of about 1-100, preferably in the range of about 1-50, more preferably 1-30, even more preferably 1, 2, 3, 4, 5, 6 , 7, 8, 9, 10, 11, 12, 13, 14, or 15-30, such as from the range of about 1-30, from the range of about 1-15, or 1, 2, 3, 4 May be selected from numbers including 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 or selected from a range formed by any two of the aforementioned values . More preferably, x is 1. Such an amino acid component (AA) or (AA) _x may be contained in any part of the inventive polymer carrier according to formula (VI) above, and therefore the inventive polymer according to formula (VI). It may be linked to all the components of the carrier. It is particularly preferred that the amino acid component (AA) or (AA) _x is present as part of the ligand or repeating component [SP ² -S] _n in formula (VI) of the polymer carrier of the present invention.

  In relation to the overall formula (VI) of the polymer carrier of the present invention, it can preferably be defined as follows:

^{L-P 1 -S- [Cys-} P 2 -Cys] n -S-P 3 -L formula (VI)

Where L, P ¹ , P ² , P ³ and n are as defined herein, S is sulfur and each Cys provides a —SH moiety for disulfide bonds. .

According to a particular embodiment, the inventive polymer carrier according to formula (VI) as defined above may comprise at least one amino acid component (AA) or (AA) _x as defined above. Such an amino acid component (AA) or (AA) _x may be contained in all parts of the polymer carrier according to the invention according to formula (VI) above and therefore according to the invention according to formula (VI) It may be linked to all the components of the polymer carrier. It is particularly preferred that the amino acid component (AA) or (AA) _x is present as part of the ligand or repeating component [SP ² -S] _n in formula (VI) of the polymer carrier of the present invention. Amino acid component (AA) or (AA) _x is preferably introduced via a disulfide bond into component (AA) or (AA) _x into a polymer carrier according to formula (VI) as defined herein. Contains at least one -SH containing moiety, or allows -SH containing moieties to be placed adjacent (eg, at the ends); Such -SH containing moieties are any -SH containing moieties (or, of course, one sulfur of a disulfide bond), for example a cysteine residue. In the specific case where the -SH containing moiety represents cysteine, the amino acid component (AA) _x is also -Cys- (AA) _x -or -Cys- (AA) _x -Cys-, where Cys represents cysteine and provides the -SH moiety necessary for disulfide bonds. The —SH containing moiety may also be introduced into the amino acid component (AA) _x using any of the modifications or reactions as indicated above for component P1, P2 or P3. In the specific case where the amino acid component (AA) _x is linked to two components of the inventive polymer carrier according to formula (VI), (AA) or (AA) _x is preferably at least at its end It preferably contains two -SH moieties, such as at least two cysteines. It is particularly preferred that (AA) or (AA) _x is part of each component [SP ² -S] _n . Alternatively, (AA) or (AA) _x is introduced into the inventive polymer carrier according to formula (VI) as defined herein by any possible chemical addition reaction. Thus, an amino acid component (AA) or (AA) _x is a further component as defined herein, for example component P1 or P3, P2, L, or a further amino acid component (AA) or (AA) _x Including at least one additional functional group that allows attachment to the like. Such functional groups can be selected, for example, from amide formation (eg, carboxylic acid, sulfonic acid, amine, etc.), by Michael addition (eg, maleimide moiety, α, β unsaturated carbonyl, etc.), click chemistry (eg, azide). Or an alkyne) to allow imine or hydrazone formation (aldehyde or ketone, hydrazine, hydroxylamine, amine), complex formation reaction (avidin, biotin, protein G), or _Sn type substitution reaction (eg, halogenated) (Alkanes, thiols, alcohols, amines, hydrazides, sulfonate esters, oxyphosphonium salts) or other chemical moieties available for linking further components, for example linking further components such as functional groups as defined herein. Can be selected from functional groups that allow

The amino acid component (AA) or (AA) _{x in} the polymer carrier of formula (VI) may also be present as a mixed repeating amino acid component [(AA) _x ] _z , where the amino acid component (AA) Or (AA) The number of _x is further defined by an integer z. In this context, z may be selected from the range of about 1-30, preferably in the range of about 1-15, more preferably in the range of 1-10 or 1-5, even more preferably 1 Selected from a number selected from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, or by any two of the aforementioned values It can be selected from the range to be formed.

According to certain particularly preferred alternatives, the amino acid component (AA) or (AA) _x is preferably described as S- (AA) _x -S or [S- (AA) _x -S] and the component P ² In particular, it can be used to modify the contents of the component S—P ² —S in the repeating component [S—P ² —S] _n of the polymer carrier of formula (VI) above. In relation to the entire polymer carrier according to formula (VI), this can be represented, for example, by the following formula (VIa):

_{^{L-P 1 -S - {[}} S-P 2 -S] a [S- (AA) x -S] b} -S-P 3 -L formula (VIa)

Here, x, S, L, AA, P ¹ , P ² and P ³ are preferably as defined herein. In the above formula (VIa), any one of the single components [S—P ² —S] and [S— (AA) _x —S] is a sub-formula {[S—P ² —S] _a [S— (AA ) _X -S] _b } may be present in any order. The number of single components [S-P ² -S] and [S- (AA) _x -S] in the sub-formula {[S-P ² -S] _a [S- (AA) _x -S] _b } is , Integers a and b, where a + b = n. n is an integer and is defined as above for formula (VI).

  a is an integer, typically, independently of the integer b, from the range of about 1-50, preferably from the range of about 1, 2 or 3-30, more preferably about 1, 2, 3 4 or 5 to 25, or about 1, 2, 3, 4 or 5 to 20, or about 1, 2, 3, 4 or 5 to 15 or about 1, 2, 3, 4 Or selected from the range of 5-10, for example, in the range of about 3-20, 4-20, 5-20 or 10-20, or about 3-15, 4-15, 5-15 or 10-15. Range, or about 6-11 or 7-10. Most preferably, a is in the range of about 1, 2, 3, 4 or 5-10, more preferably in the range of about 1, 2, 3 or 4-9, in the range of about 1, 2, 3 or 4-8. Or in the range of about 1, 2 or 3-7.

  b is an integer, typically, independently of the integer a, from the range of about 0-50 or 1-50, preferably from the range of about 1, 2 or 3-30, more preferably about 1 2, 3, 4 or 5-25 range, or about 1, 2, 3, 4 or 5-20 range, or about 1, 2, 3, 4 or 5-15 range, or about 1, 2 Selected from the range of 3, 4, or 5-10, for example, in the range of about 3-20, 4-20, 5-20 or 10-20, or about 3-15, 4-15, 5-15 or It includes the range of 10-15, or the range of about 6-11 or 7-10. Most preferably, b is in the range of about 1, 2, 3, 4 or 5-10, more preferably in the range of about 1, 2, 3 or 4-9, in the range of about 1, 2, 3 or 4-8. Or in the range of about 1, 2 or 3-7.

  According to a preferred embodiment, the mRNA of the vaccine of the invention encoding at least one antigen as defined above is preferably at least one of a cationic or polycationic compound and a polymer carrier as defined herein. It may be formulated together.

  According to a further preferred embodiment, the mRNA of the vaccine of the invention encoding at least one antigen as defined above may be formulated with an (adjuvant) component. According to a particularly preferred embodiment, the mRNA of the vaccine according to the invention encoding at least one antigen as defined above comprises: a) at least one of a cationic or polycationic compound and a polymer carrier as defined herein An (adjuvant) component comprising or consisting of at least one immunostimulatory nucleic acid complexed with heel, and b) preferably encoding an antigen as defined herein for a vaccine of the invention, Formulated to contain one free mRNA.

  In connection with the above, at least one of a cationic or polycationic compound and a polymer carrier used to complex at least one immunostimulatory nucleic acid in the adjuvant component is the cationic or It may be selected from at least one of a polycationic compound and a polymer carrier.

  Furthermore, the immunostimulatory nucleic acids as defined above for the adjuvant component may preferably be selected from the mRNAs defined herein for the vaccines of the invention which encode at least one antigen. Alternatively, such immunostimulatory nucleic acids can be selected from immunostimulatory nucleic acids as defined herein, preferably immunostimulatory RNAs (isRNAs) as defined herein.

  In this context, the immunostimulatory nucleic acid used herein is preferably selected from immunostimulatory nucleic acids known to bind to the TLR receptor. Such immunostimulatory nucleic acids can preferably be in the form of CpG nucleic acids that induce an innate immune response (immunostimulatory), in particular CpG-RNA or CpG-DNA. CpG-RNA or CpG-DNA used in connection with the present invention includes single-stranded CpG-DNA (ssCpG-DNA), double-stranded CpG-DNA (dsDNA), and single-stranded CpG-RNA (ssCpG-DNA). RNA), or double-stranded CpG-RNA (dsCpG-RNA). The CpG nucleic acid used in connection with the present invention is preferably in the form of CpG-RNA, more preferably in the form of single-stranded CpG-RNA (ssCpG-RNA). Also preferably, such CpG nucleic acids have the lengths described above. Preferably, the CpG motif is not methylated.

  Furthermore, the immunostimulatory nucleic acid used herein is preferably selected from immunostimulatory RNA (isRNA), which preferably causes an innate immune response. Preferably, the immunostimulatory RNA is single-stranded, double-stranded or partially double-stranded RNA, more preferably at least one of single-stranded RNA and circular or linear RNA. More preferably, it is linear RNA. More preferably, the immunostimulatory RNA may be a (linear) single-stranded RNA. Even more preferably, the immunostimulatory RNA may be a (long) (linear) (single stranded) non-coding RNA. In this connection, it is particularly preferred that the isRNA carry a triphosphate at its 5 'end in the case of RNA transcribed in vivo. Immunostimulatory RNA may exist as short RNA oligonucleotides as defined herein. As used herein, an immunostimulatory RNA may further be selected from any class of RNA molecules found in nature or made synthetically, which can induce an innate immune response, It can support the adaptive immune response induced by the antigen. In this connection, the immune response can occur in various ways. A substantial factor for proper (adaptive) immune response is stimulation of different T cell subpopulations. T lymphocytes are typically T helper 1 (Th1) cells and T helper 2 (in which the immune system can destroy intracellular (Th1) and extracellular (Th2) pathogens (eg, antigens). Th2) Divided into two subpopulations of cells. The two Th cell populations differ in the pattern of effector proteins (cytokines) produced by them. Thus, Th cells support a cellular immune response through activation of macrophages and cytotoxic T cells. Th2 cells, on the other hand, promote a humoral immune response by stimulating the conversion of B cells to plasma cells and forming antibodies (eg, against an antigen). The Th1 / Th2 ratio is therefore very important in the induction and maintenance of an adaptive immune response. In the context of the present invention, the Th1 / Th2 ratio of the (adaptive) immune response is preferably changed in a direction towards a cellular response (Th1 response), whereby a cellular immune response is induced. According to one example, an innate immune system that can support an adaptive immune response can be activated by a ligand for a Toll-like receptor (TLR). TLRs are a family of highly conserved pattern recognition receptor (PRR) polypeptides that recognize pathogen-associated molecular patterns (PAMPs) and play an important role in innate immunity in mammals. At least 13 family members currently designated as TLR1-TL13 (Toll-like receptors: TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR13) have been identified Yes. In addition, a number of specific TLR ligands have been identified. For example, unmethylated bacterial DNA and its synthetic analogues (CpG DNA) have been found to be ligands for TLR9 (Hemmi H et al. (2000) Nature 408: 740-5; Bauer S et al. (2001). Proc Natl. Acad. Sci. USA 98, 9237-42). Furthermore, ligands for specific TLRs include specific nucleic acid molecules, and specific types of RNA have been reported to be sequence-independent or sequence-dependent immunostimulatory, where Such immunostimulatory RNA may stimulate intracellular receptors such as TLR3, TLR7 or TLR8, or RIG-I and MDA-5.

  Preferably, the immunostimulatory nucleic acid, preferably the immunostimulatory RNA (isRNA) used herein is known to be immunostimulatory, but preferably is not limited to human family A TLR ligand, RNA selected from members TLR1 to TLR10 of TLR10, or from members TLR1 to TLR10 of the mouse family, more preferably selected from members TLR1 to TLR10 of the (human) family, and even more preferably selected from TLR7 and TLR8 Any RNA (eg, Meylan, E., Tschop) that contains an RNA sequence that represents and / or encodes a ligand for an intracellular receptor (such as RIG-I or MDA-5) , J. (2006) Toll-like receptor and RNA helicase: Referring to two parallel ways Mol. Cell 22,561-569 causing pulse response), or may include any other immunostimulatory RNA sequences. Furthermore, the immunostimulatory RNA molecule (class) used as a further compound of the vaccine of the invention may comprise any other RNA capable of eliciting an immune response. Such immunostimulatory RNAs can include, but are not limited to, ribosomal RNA (rRNA), transfer RNA (tRNA), messenger RNA (mRNA), and viral RNA (vRNA). Such immunostimulatory RNA has an amino acid length of 1000-5000, 500-5000, 5-5000, or 5-1000, 5-500, 5-250, 5-100, 5-50, or 5-30. May be included.

  In a particularly preferred embodiment, the immunostimulatory nucleic acid sequence, particularly the isRNA used herein, may consist of or comprise the following amino acids of formula (I) or formula (II):

G _l X _m G _n Formula (I)
Wherein G is guanosine, uracil, or an analog of guanosine or an analog of uracil, X is guanosine, uracil, adenosine, thymidine, cytosine, or an analog of the above nucleotide, and l is 1 to 1 An integer of 40,
here,
when l = 1, G is guanosine or an analogue thereof;
if l> 1, at least 50% of the nucleotides are guanosine or an analogue thereof;
here,
when m = 3, X is uracil or an analogue thereof;
If m> 3, at least 3 consecutive uracils or analogs of uracil are produced,
n is an integer of 1 to 40,
here,
when n = 1, G is guanosine or an analogue thereof;
When n> 1, at least 50% of the nucleotides are guanosine or analogs thereof.

C _l X _m C _n Formula (II)
here,
C is cytosine, uracil, or an analog of cytosine or an analog of uracil, X is guanosine, uracil, adenosine, thymidine, cytosine or an analog of said nucleotide, l is an integer from 1 to 40 Yes,
here,
when l = 1, C is cytosine or an analogue thereof;
if l> 1, at least 50% of the nucleotides are cytosine or analogs thereof;
m is an integer, at least 3,
here,
when m = 3, X is uracil or an analogue thereof;
If m> 3, at least 3 consecutive uracils or analogs of uracil are produced,
n is an integer of 1 to 40,
here,
when n = 1, C is cytosine or an analogue thereof;
When n> 1, at least 50% of the nucleotides are cytosine or analogs thereof.

The nucleic acid of formula (I) or formula (II), in particular isRNA, which can be used as an immunostimulatory nucleic acid sequence, is about 5 to 100 (but in certain embodiments, for example 200 nucleotides, such as 200 nucleotides or longer). Good) 5 to 90 nucleotides, or 5 to 80 nucleotides in typical length, preferably about 5 to 70 nucleotides in length, more preferably about 8 to 60 nucleotides in length, more preferably It may be a relatively short nucleic acid molecule of about 15-60 nucleotides, more preferably 20-60 nucleotides, most preferably 30-60 nucleotides in length. If the nucleic acid of formula (I) or formula (II) has a maximum length of for example 100 nucleotides, m will typically be 98 or less. The number G of nucleotides in the nucleic acid of formula (I) is defined by l or n. l or n are each independently an integer of 1 to 40, wherein when l or n is 1, G is guanosine or an analog thereof, and l or n is greater than 1 In some cases, at least 50% of the nucleotides are guanosine or analogs thereof. For example, without any limitation, when l or n is 4, G _l or G _n is, for example, GUGU, GGUU, UGUG, UUGG, GUUG, GGGU, GGUG, GUGG, UGGG, or GGGG, etc. When l or n is 5, G ₁ or G _n is, for example, GGGUU, GGGUGU, GUGGU, UGGGU, UGGUUG, UGUGGG, UUGGG, GUUGUG, GGGUGU, GGGUG, GGUG, GUGG, It can be GGGGG or the like. Nucleotides adjacent to X _m in the nucleic acid of formula (I) according to the present invention is preferably not a uracil. Similarly, the number C of nucleotides in the nucleic acid of formula (II) according to the invention is defined by l or n. l and n are each independently an integer of 1 to 40, where when l or n is 1, C is cytosine or an analog thereof, and l or n is greater than 1 In some cases, at least 50% of the nucleotides are cytosine or an analog thereof. For example, without any limitation, when l or n is 4, C _l or C _n is, for example, CUCU, CCUU, UCUC, UUCC, CUUC, CCCU, CCUC, CUCC, UCCC, CCCC, or the like. Where l or n is 5, C _l or C _n is, for example, CCCUU, CCUCU, CUCCU, UCCCU, UCCUC, UUCCC, UUCCC, CUUC, CCCCU, CCCUC, CCUCC, CUCCC, UCCCC, or CCCCC Etc. Nucleotides adjacent to X _m in the nucleic acid of formula (II) according to the present invention is preferably not a uracil. Preferably, for formula (I), when l or n is greater than 1, at least 60%, 70%, 80%, 90% or even 100% nucleotides are guanosine as defined above or analogs thereof. Up to 100% of the remaining nucleotides (if guanosine comprises less than 100% of the nucleotides) in at least _{one of the} flanking sequences G ₁ and G _n is uracil or an analog thereof as defined herein. Preferably, l and n are each independently an integer of 2 to 30, more preferably an integer of 2 to 20, and still more preferably an integer of 2 to 15. The lower limit of l or n can be varied as required and is at least 1, preferably at least 2, more preferably at least 3, 4, 5, 6, 7, 8, 9 or 10. This definition applies to formula (II) as well.

  In a particularly preferred embodiment, the nucleic acid according to any of the above formulas (I) or (II), which can be used as an immunostimulatory nucleic acid sequence, in particular an isRNA,

GGUUUUUUUUUUUUUUGGG (SEQ ID NO: 289),
GGGGGUUUUUUUUUGGGGG (SEQ ID NO: 290),
GGGGGUUUUUUUUUUUUUUUUUUUUUUUUUUGGGGG (SEQ ID NO: 291),
GUGUGUGUGUGUGUUUUUUUUUUUUUUUGUGUGUGUGGUGU (SEQ ID NO: 292),
GGUUGGUUGGUUUUUUUUUUUUUUUGUGUUGGUUGGUU (SEQ ID NO: 293),
GGGGGGGGGUUUGGGGGGGGG (SEQ ID NO: 294),
GGGGGGGGUUUGGGGGGGGG (SEQ ID NO: 295),
GGGGGGGUUUUUGGGGGGG (SEQ ID NO: 296),
GGGGGGGUUUUUUGGGGGGG (SEQ ID NO: 297),
GGGGGGUUUUUUUGGGGGGG (SEQ ID NO: 298),
GGGGGGGUUUUUUUUGGGGG (SEQ ID NO: 299),
GGGGGGGUUUUUUUUUGGGGG (SEQ ID NO: 300),
GGGGGUUUUUUUUUUGGGGG (SEQ ID NO: 301),
GGGGGUUUUUUUUUUUGGG (SEQ ID NO: 302),
GGGGUUUUUUUUUUUUGGG (SEQ ID NO: 303),
GGGGUUUUUUUUUUUUUGG (SEQ ID NO: 304),
GGUUUUUUUUUUUUUUUGGG (SEQ ID NO: 305),
GUUUUUUUUUUUUUUUUUG (SEQ ID NO: 306),
GGGGGGGGGGUUUGGGGGGGGG (SEQ ID NO: 307),
GGGGGGGGGUUUUGGGGGGGGGGG (SEQ ID NO: 308),
GGGGGGGGUUUUUGGGGGGGGG (SEQ ID NO: 309),
GGGGGGGGUUUUUUGGGGGGG (SEQ ID NO: 310),
GGGGGGGUUUUUUUGGGGGGGGG (SEQ ID NO: 311),
GGGGGGGUUUUUUUUGGGGGGG (SEQ ID NO: 312),
GGGGGGGUUUUUUUUUGGGGG (SEQ ID NO: 313),
GGGGGGGUUUUUUUUUUGGGGG (SEQ ID NO: 314),
GGGGGGGUUUUUUUUUUUGGGGG (SEQ ID NO: 315),
GGGGGUUUUUUUUUUUUGGGGG (SEQ ID NO: 316),
GGGGGUUUUUUUUUUUUUGGG (SEQ ID NO: 317),
GGGUUUUUUUUUUUUUUUGGG (SEQ ID NO: 318),
GGUUUUUUUUUUUUUUUUUGG (SEQ ID NO: 319),
GGGGGGGGGGGUUUGGGGGGGGGGG (SEQ ID NO: 320),
GGGGGGGGGGUUUGGGGGGGGGGG (SEQ ID NO: 321),
GGGGGGGGGUUUUUUGGGGGGGGG (SEQ ID NO: 322),
GGGGGGGGGUUUUUUUGGGGGGGGG (SEQ ID NO: 323),
GGGGGGGGUUUUUUUGGGGGGGGG (SEQ ID NO: 324),
GGGGGGGGUUUUUUUUGGGGGGG (SEQ ID NO: 325),
GGGGGGGGGUUUUUUUUUGGGGGGG (SEQ ID NO: 326),
GGGGGGGUUUUUUUUUUGGGGGGG (SEQ ID NO: 327),
GGGGGGGUUUUUUUUUUGGGGG (SEQ ID NO: 328),
GGGGGGGUUUUUUUUUUUGGGGG (SEQ ID NO: 329),
GGGGGGGUUUUUUUUUUUUGGGGG (SEQ ID NO: 330),
GGGGUUUUUUUUUUUUUUGGGGG (SEQ ID NO: 331),
GGGUUUUUUUUUUUUUUUUGGG (SEQ ID NO: 332),
GUUUUUUUUUUUUUUUUUUUUUUUUUUUUG (SEQ ID NO: 333),
GGUUUUUUUUUUUUUUUUUUUUUUUUUUUGGG (SEQ ID NO: 334),
GGGUUUUUUUUUUUUUUUUUUUUUUUUUUUGGG (SEQ ID NO: 335),
GGGGUUUUUUUUUUUUUUUUUUUUUUUUUUUGGG (SEQ ID NO: 336),
GGGGGUUUUUUUUUUUUUUUUUUUUUUUUUUGGGGG (SEQ ID NO: 337),
GGGGGGUUUUUUUUUUUUUUUUUUUUUUUUUUGGGGG (SEQ ID NO: 338),
GGGGGGGUUUUUUUUUUUUUUUUUUUUUUUUUUGGGGGGG (SEQ ID NO: 339),
GGGGGGGGUUUUUUUUUUUUUUUUUUUUUUUUUUGGGGGGG (SEQ ID NO: 340),
GGGGGGGGGUUUUUUUUUUUUUUUUUUUUUUUUUUUGGGGGGGGG (SEQ ID NO: 341),
GGUUUGG (SEQ ID NO: 342),
GGUUUUGG (SEQ ID NO: 343),
GGUUUUUGG (SEQ ID NO: 344),
GGUUUUUUGG (SEQ ID NO: 345),
GGUUUUUUUGG (SEQ ID NO: 346),
GGUUUUUUUUGG (SEQ ID NO: 347),
GGUUUUUUUUUGG (SEQ ID NO: 348),
GGUUUUUUUUUUGG (SEQ ID NO: 349),
GGUUUUUUUUUUGG (SEQ ID NO: 350),
GGUUUUUUUUUUUUGG (SEQ ID NO: 351),
GGUUUUUUUUUUUUUGG (SEQ ID NO: 352),
GGUUUUUUUUUUUUUGGG (SEQ ID NO: 353),
GGUUUUUUUUUUUUUUGGG (SEQ ID NO: 354),
GGGUUUGGG (SEQ ID NO: 355),
GGGUUUUGGG (SEQ ID NO: 356),
GGGUUUUUGGG (SEQ ID NO: 357),
GGGUUUUUUGGG (SEQ ID NO: 358),
GGGUUUUUUUGGG (SEQ ID NO: 359),
GGGUUUUUUUGGG (SEQ ID NO: 360),
GGGUUUUUUUUGGG (SEQ ID NO: 361),
GGGUUUUUUUUUGGG (SEQ ID NO: 362),
GGGUUUUUUUUUUUGGG (SEQ ID NO: 363),
GGGUUUUUUUUUUUGGG (SEQ ID NO: 364),
GGGUUUUUUUUUUUUGGGGG (SEQ ID NO: 365),
GGGUUUUUUUUUUUUUUGGGUUUUUUUUUUUUUGGGUUUUUUUUUUUUUUGGG (SEQ ID NO: 366),
GGGUUUUUUUUUUUUUUGGGGGGGUUUUUUUUUUUUUGGG (SEQ ID NO: 367),
GGGUUUGGGUUGGGGUUUGGGUUUGGGUUGGGUUUGGGUUUGGGUUUGGG (SEQ ID NO: 368),
GGUUUUUUUUUUUUUUGGG (short GU rich, SEQ ID NO: 369), or

CCCUUUUUUUUUUUUUUCCCUUUUUUUUUUUUUCCCCUUUUUUUUUUUUUCCC (SEQ ID NO: 370),
CCCUUUCCCUUUCCCUUUCCCUUUCCCUUUCCCUUUCCCUUUCCCUUUCCC (SEQ ID NO: 371),
CCCUUUUUUUUUUUUUCCCCCCUUUUUUUUUUUUUCCC (SEQ ID NO: 372),
Selected from sequences comprising or including any of these sequences,

Alternatively, it may be selected from sequences having at least 60%, 70%, 80%, 90% or even 95% sequence identity with any of these sequences.

  In a further particularly preferred embodiment, the immunostimulatory nucleic acid sequence, in particular the isRNA used herein, may consist of a nucleic acid of formula (III) or formula (IV), or of formula (III) or It may contain a nucleic acid of formula (IV).

_{(N u G l X m G} n N v) a formula (III)

here,
G is guanosine (guanine), uridine (uracil), or an analog of guanosine (guanine) or an analog of uridine (uracil), preferably guanosine (guanine) or an analog thereof,
X is guanosine (guanine), uridine (uracil), adenosine (adenine), thymidine (thymine), cytidine (cytosine), or analogs of these nucleotides (nucleosides), preferably uridine (uracil) or an analog thereof. Yes,
N is a nucleic acid sequence having a length of about 4-50, preferably about 4-40 nucleic acids, more preferably about 4-30 nucleic acids or 4-20 nucleic acids, and each N is independently a guanosine ( Guanine), uridine (uracil), adenosine (adenine), thymidine (thymine), cytidine (cytosine), or analogs of these nucleotides (nucleosides);
a is an integer of 1-20, preferably 1-15, most preferably 1-10,
l is an integer of 1 to 40,
here,
when l = 1, G is guanosine (guanine) or an analogue thereof;
if l> 1, at least 50% of these nucleotides (nucleosides) are guanosine (guanine) or analogs thereof;
m is an integer, at least 3,
here,
when m = 3, X is uridine (uracil) or an analogue thereof;
If m> 3, there are at least 3 consecutive uridine (uracil) or uridine (uracil) analogs;
n is an integer of 1 to 40,
here,
when n = 1, G is guanosine (guanine) or an analogue thereof;
if n> 1, at least 50% of these nucleotides (nucleosides) are guanosine (guanine) or analogs thereof;
u and v are each independently an integer of 0 to 50;
Preferably, where u = 0 and v ≧ 1, or v = 0 and u ≧ 1
Here, the nucleic acid molecule of formula (III) has a length of at least 50 nucleotides, preferably at least 100 nucleotides, more preferably at least 150 nucleotides, even more preferably 200 nucleotides, and most preferably at least 250 nucleotides.

_{(N u C l X m C} n N v) a formula (IV)

here,
C is cytidine (cytosine), uridine (uracil), or an analog of cytidine (cytosine) or an analog of uridine (uracil), preferably cytidine (cytosine) or an analog thereof,
X is guanosine (guanine), uridine (uracil), adenosine (adenine), thymidine (thymine), cytidine (cytosine), or an analog of the above nucleotide (nucleoside), preferably uridine (uracil) or an analog thereof. Yes,
Each N, independently of each other, is a nucleic acid sequence having a length of about 4-50, preferably about 4-40 nucleic acids, more preferably about 4-30 nucleic acids or 4-20 nucleic acids, each N being Independently selected from guanosine (guanine), uridine (uracil), adenosine (adenine), thymidine (thymine), cytidine (cytosine), or analogs of these nucleotides (nucleosides);
a is an integer of 1-20, preferably 1-15, most preferably 1-10,
l is an integer of 1 to 40,
here,
when l = 1, C is cytidine (cytosine) or an analogue thereof;
if l> 1, at least 50% of these nucleotides (nucleosides) are cytidine (cytosine) or analogs thereof;
m is an integer, at least 3,
here,
when m = 3, X is uridine (uracil) or an analogue thereof;
If m> 3, there are at least 3 consecutive uridine (uracil) or uridine (uracil) analogs;
n is an integer of 1 to 40,
here,
when n = 1, C is cytidine (cytosine) or an analogue thereof;
if n> 1, at least 50% of these nucleotides (nucleosides) are cytidine (cytosine) or analogs thereof;
u and v are each independently an integer of 0 to 50;
Preferably, where u = 0 and v ≧ 1, or v = 0 and u ≧ 1
Here, the nucleic acid molecule of formula (IV) according to the present invention is at least 50 nucleotides, preferably at least 100 nucleotides, more preferably at least 150 nucleotides, even more preferably 200 nucleotides, and most preferably at least 250 nucleotides in length. Have

Any of the above definitions in formulas (I) and (II), such as elements N (ie, N _u and N _v ) and X (X _m ), in particular the core structure as defined above, as well as integers The definitions for a, l, m, n, u and v apply correspondingly to the elements of formula (III) and formula (IV) as well. The definitions of adjacent elements N _u and N _v in formula (IV) are the same as those defined above for N _u and N _{v in} formula (IV).

  According to a very particularly preferred embodiment, the nucleic acid molecule of the invention according to formula (IV) which can be used as an immunostimulatory nucleic acid sequence, in particular an isRNA, may be selected, for example, from any of the following sequences:

UAGCGAAGCUCUUGGACCCUAGGUUUUUUUUUUUUUGGGGUCGGUUCCUAGAAGUCACG (SEQ ID NO: 373)

UAGCGAAGCUCUUGUGACCUCAGGUUUUUUUUUUUUUGGGGUCGGUUCCUAGAAGUACACG AUCCGUCUGGA GAACCUGGAUCCAAAAAAAAAAAAAAAAAACCACCUGCAAGGAUCUCUCAU

GGGAGAAAGCUCAAGCUUGGAGCAAUGCCCGCACAUUGAGGAAACCGAGUUGCAUAUCUCAGAGUAUUGGCCCCCGUGUAGGUUAUUCUUGACAGACAGUGGAGCUUAUUCACUCCCAGGAUCCGAGUCGCAUACUACGGUACUGGUGACAGACCUAGGUCGUCAGUUGACCAGUCCGCCACUAGACGUGAGUCCGUCAAAGCAGUUAGAUGUUACACUCUAUUAGAUC (SEQ ID NO: 375)

GGGAGAAAGCUCAAGCUUGGAGCAAUGCCCGCACAUUGAGGAAACCGAGUUGCAUAUCUCAGAGUAUUGGCCCCCGUGUAGGUUAUUCUUGACAGACAGUGGAGCUUAUUCACUCCCAGGAUCCGAGUCGCAUACUACGGUACUGGUGACAGACCUAGGUCGUCAGUUGACCAGUCCGCCACUAGACGUGAGUCCGUCAAAGCAGUUAGAUGUUACACUCUAUUAGAUCUCGGAUUACAGCUGGAAGGAGCAGGAGUAGUGUUCUUGCUCUAAGUACCGAGUGUGCCCAAUACCCGAUCAGCUUAUUAACGAACGGCUCCUCCUCUUAGACUG AGCGUAAGUGCGGAAUCUGGGGAUCAAAUUACUGACUGCCUGGAUUACCCUCGGACAUAUAACCUUGUAGCACGCUGUUGCUGUAUAGGUGACCAACGCCCACUCGAGUAGACCAGCUCUCUUAGUCCGGACAAUGAUAGGAGGCGCGGUCAAUCUACUUCUGGCUAGUUAAGAAUAGGCUGCACCGACCUCUAUAAGUAGCGUGUCCUCUAG (SEQ ID NO: 376)

GGGAGAAAGCUCAAGCUUGGAGCAAUGCCCGCACAUUGAGGAAACCGAGUUGCAUAUCUCAGAGUAUUGGCCCCCGUGUAGGUUAUUCUUGACAGACAGUGGAGCUUAUUCACUCCCAGGAUCCGAGUCGCAUACUACGGUACUGGUGACAGACCUAGGUCGUCAGUUGACCAGUCCGCCACUAGACGUGAGUCCGUCAAAGCAGUUAGAUGUUACACUCUAUUAGAUCUCGGAUUACAGCUGGAAGGAGCAGGAGUAGUGUUCUUGCUCUAAGUACCGAGUGUGCCCAAUACCCGAUCAGCUUAUUAACGAACGGCUCCUCCUCUUAGACUG AGCGUAAGUGCGGAAUCUGGGGAUCAAAUUACUGACUGCCUGGAUUACCCUCGGACAUAUAACCUUGUAGCACGCUGUUGCUGUAUAGGUGACCAACGCCCACUCGAGUAGACCAGCUCUCUUAGUCCGGACAAUGAUAGGAGGCGCGGUCAAUCUACUUCUGGCUAGUUAAGAAUAGGCUGCACCGACCUCUAUAAGUAGCGUGUCCUCUAGAGCUACGCAGGUUCGCAAUAAAAGCGUUGAUUAGUGUGCAUAGAACAGACCUCUUAUUCGGUGAAACGCCAGAAUGCUAAAUUCCAAUAACUCUUCCCAAAACGCGUACGGCCGAAGAC CGCGCUUAUCUUGUGUACGUUCUCGCACAUGGAAGAAUCAGCGGGCAUGGUGGUAGGGCAAUAGGGGAGCUGGGUAGCAGCGAAAAAGGGCCCCUGCGCACGUAGCUUCGCUGUUCGUCUGAAACAACCCGGCAUCCGUUGUAGCGAUCCCGUUAUCAGUGUUAUUCUUGUGCGCACUAAGAUUCAUGGUGUAGUCGACAAUAACAGCGUCUUGGCAGAUUCUGGUCACGUGCCCUAUGCCCGGGCUUGUGCCUCUCAGGUGCACAGCGAUACUUAAAGCCUUCAAGGUACUCGACGUGGGUACCGAUUCGUGACACUUCCUAAGAUUAUUCC ACUGUGUUAGCCCCGCACCCGCCGACCUAAAACUGGUCCAAUGAUAUACGCAUUCGCUGAGCGGAUCGAUAAUAAAAAGCUUGAAUU (SEQ ID NO: 377)

GGGAGAAAGCUCAAGCUUAUCCAAGUAGGCUGGUCACCUGUACAACGUAGCCGGUAUUUUUUUUUUUUUUUUUUUUUUGACCGUCUCAAGGUCCAAGUUAGUCUGCCUAUAAAGGUGCGGAUCCACAGCUGAUGAAAGACUUGUGCGGUACGGUUAAUCUCCCCUUUUUUUUUUUUUUUUUUUUUAGUAAAUGCGUCUACUGAAUCCAGCGAUGAUGCUGGCCCAGAUC (SEQ ID NO: 378)

GGGAGAAAGCUCAAGCUUAUCCAAGUAGGCUGGUCACCUGUACAACGUAGCCGGUAUUUUUUUUUUUUUUUUUUUUUUGACCGUCUCAAGGUCCAAGUUAGUCUGCCUAUAAAGGUGCGGAUCCACAGCUGAUGAAAGACUUGUGCGGUACGGUUAAUCUCCCCUUUUUUUUUUUUUUUUUUUUUAGUAAAUGCGUCUACUGAAUCCAGCGAUGAUGCUGGCCCAGAUCUUCGACCACAAGUGCAUAUAGUAGUCAUCGAGGGUCGCCUUUUUUUUUUUUUUUUUUUUUUUGGCCCAGUUCUGAGACUUCGCUAGAGACUACAGUUACAGCUG AGUAGUAACCACUGCGGCUAUUGCAGGAAAUCCCGUUCAGGUUUUUUUUUUUUUUUUUUUUUCCGCUCACUAUGAUUAAGAACCAGGUGGAGUGUCACUGCUCUCGAGGUCUCACGAGAGCGCUCGAUACAGUCCUUGGAAGAAUCUUUUUUUUUUUUUUUUUUUUUUGUGCGACGAUCACAGAGAACUUCUAUUCAUGCAGGUCUGCUCUA (R 722 SEQ ID NO: 379)

GGGAGAAAGCUCAAGCUUAUCCAAGUAGGCUGGUCACCUGUACAACGUAGCCGGUAUUUUUUUUUUUUUUUUUUUUUUGACCGUCUCAAGGUCCAAGUUAGUCUGCCUAUAAAGGUGCGGAUCCACAGCUGAUGAAAGACUUGUGCGGUACGGUUAAUCUCCCCUUUUUUUUUUUUUUUUUUUUUAGUAAAUGCGUCUACUGAAUCCAGCGAUGAUGCUGGCCCAGAUCUUCGACCACAAGUGCAUAUAGUAGUCAUCGAGGGUCGCCUUUUUUUUUUUUUUUUUUUUUUUGGCCCAGUUCUGAGACUUCGCUAGAGACUACAGUUACAGCUG AGUAGUAACCACUGCGGCUAUUGCAGGAAAUCCCGUUCAGGUUUUUUUUUUUUUUUUUUUUUCCGCUCACUAUGAUUAAGAACCAGGUGGAGUGUCACUGCUCUCGAGGUCUCACGAGAGCGCUCGAUACAGUCCUUGGAAGAAUCUUUUUUUUUUUUUUUUUUUUUUGUGCGACGAUCACAGAGAACUUCUAUUCAUGCAGGUCUGCUCUAGAACGAACUGACCUGACGCCUGAACUUAUGAGCGUGCGUAUUUUUUUUUUUUUUUUUUUUUUUCCUCCCAACAAAUGUCGAUCAAUAGCUGGGCUGUUGGAGACGCGUCAGCAAAUGCCG GGCUCCAUAGGACGUGUAGACUUCUAUUUUUUUUUUUUUUUUUUUUUCCCGGGACCACAAAUAAUAUUCUUGCUUGGUUGGGCGCAAGGGCCCCGUAUCAGGUCAUAAACGGGUACAUGUUGCACAGGCUCCUUUUUUUUUUUUUUUUUUUUUUUCGCUGAGUUAUUCCGGUCUCAAAAGACGGCAGACGUCAGUCGACAACACGGUCUAAAGCAGUGCUACAAUCUGCCGUGUUCGUGUUUUUUUUUUUUUUUUUUUUGUGAACCUACACGGCGUGCACUGUAGUUCGCAAUUCAUAGGGUACCGGCUCAGAGUUAUGCCUUGGUUGAAAAC UGCCCAGCAAUACUUUUUUUUUUUUUUUUUCAUAUUCCCAUGCUAAGCAAGGGGAUGCCGCGAUGUCAUGUUAAGCUUGAAUU (SEQ ID NO: 380)

  According to another very particularly preferred embodiment, the nucleic acid molecule according to formula (V) may be selected, for example, from any of the following sequences:

UAGCGAAGCUCUUGGACCCUACCUUUUUUUUUUUCCCCUGCGUUCCUGAGAAGUACACG (SEQ ID NO: 381), or

UAGCGAAGCUCUUGUGACCUCACCUUUUUUUUUUUUCCCCUGCGUUCCUUA GAAGUAACACGAUCGCUUCGAGAACCUGGAUGGAAAAAAAAAAAAAAAGAGGACGCAGUGUUCUGUUG

  Alternatively, it may be selected from sequences having at least 60%, 70%, 80%, 90%, or even 95% sequence identity with any of these sequences.

  Finally, the so-called “(adjuvant) component” that can be used with the mRNA in the vaccine of the present invention is preferably at least one (m) RNA of the (adjuvant) component, preferably cationic as defined herein. Alternatively, it is prepared by the first step by complexing with a specific ratio with at least one of a polycationic compound and a polymer carrier to form a stable complex. In this context, (m) there is no free or negligible free cationic or polycationic compound or polymer carrier in the (adjuvant) component after complexing the RNA. It is very preferable to remain in a small amount. Accordingly, the ratio of (m) RNA in the (adjuvant) component to at least one of a cationic or polycationic compound and a polymer carrier is typically such that (m) RNA is fully complexed. The composition is selected so that no free cationic or polycationic compound or polymer carrier remains in the composition or remains in negligibly small amounts. Preferably, the ratio of (adjuvant) component, i.e. the ratio of (m) RNA to preferably at least one of a cationic or polycationic compound and polymer carrier as defined herein is about 6: 1 ( w / w) to about 0.25: 1 (w / w), more preferably about 5: 1 (w / w) to about 0.5: 1 (w / w), even more preferably about 4: 1. (W / w) to about 1: 1 (w / w), or about 3: 1 (w / w) to about 1: 1 (w / w), most preferably about 3: 1 ( w / w) to about 2: 1 (w / w). Alternatively, the ratio of (m) RNA to (adjuvant) component, preferably to at least one of a cationic or polycationic compound and polymer carrier as defined herein is also a complex of (adjuvant) component It can be calculated based on the overall nitrogen / phosphate ratio (N / P ratio). In the context of the present invention, preferably the cationic or polycationic compound in the complex is cationic or polycationic, or is a cationic or polycationic protein or peptide, and a polymer carrier N / P ratio is preferably (m) a cationic or polycationic compound and polymer as defined herein in a complex, wherein at least one of With respect to at least any ratio of carriers ((m) RNA: preferably a cationic or polycationic compound and / or polymeric carrier as defined herein in a complex), preferably about 0.1 -10, preferably about 0.3-4, most preferably about 0.5-2 or 0.7-2, most preferably , It is in the range of about 0.7 to 1.5. Such a ratio, in particular a weight ratio and / or an N / P ratio, is sufficient to complex said at least one mRNA of at least one mRNA encoding at least one antigen as defined herein. It can also be applied to the ratio used to the cationic or polycationic polymer or polymer carrier as defined herein.

  According to a further preferred embodiment, the mRNA of the vaccine according to the invention encoding at least one antigen as defined above may be formulated with the (adjuvant) component as defined above, wherein the vaccine according to the invention comprises At least one (m) RNA complexed with at least one of a cationic or polycationic compound and a polymeric carrier, preferably as defined herein, and b) preferably as defined herein. As defined, it may comprise at least one free mRNA encoding the antigen. This formulation is preferably defined above. Furthermore, the entire formulation of a) and b) may additionally be packaged with a carrier molecule to allow for the combined packaging of the (adjuvant) component and the antigen. Such carrier molecules may be selected from any polymer suitable for packaging the entire formulation of a) and b) and preferably transporting it to the patient's cells, tissues, etc. as defined herein. Well, for example, it may be selected from a cationic or polycationic polymer as defined herein, or from any further polymer suitable for this purpose, such as the polymer carriers described above.

  Complexed with all components of the whole vaccine composition of the invention as defined above, preferably a cationic or polycationic compound, at least one mRNA encoding at least one antigen, and / or a carrier molecule The ratio of adjuvants comprising or consisting of at least one immunostimulatory nucleic acid sequence formulated into the vaccine of the present invention is the nitrogen / phosphate ratio (N / P ratio) of all these components Can be calculated based on In the context of the present invention, the N / P ratio is the ratio of nucleic acid to the cationic or polycationic peptide contained in the vaccine of the invention (nucleic acid: cationic or polycationic contained in the vaccine of the invention). Peptide) is preferably in the range of about 0.01-4, 0.01-2, 0.1-2 or 0.1-1.5, most preferably in the range of about 0.1-1. . Such an N / P ratio preferably provides good transfection properties in vivo and is designed to be transported and passed through the cell membrane. Preferably, for this purpose, at least one of the cationic or polycationic compound and the polymer carrier used herein is based on a peptide sequence.

  In a further preferred embodiment of the present invention, the vaccine of the present invention may contain at least one of a pharmaceutically acceptable carrier and excipient. In the context of the present invention, a pharmaceutically acceptable carrier typically comprises a liquid or non-liquid basis of a composition comprising the components of the vaccine of the present invention. When the composition is provided in liquid form, the carrier is typically buffered with pyrogen-free water, isotonic saline, or a buffered (aqueous) solution such as phosphate or citrate. Solution. The injection buffer may be hypertonic, isotonic, or hypotonic with respect to a particular reference medium, for example, the buffer may be higher, identical or lower salted with respect to the reference medium. Content, where preferably such concentrations of the aforementioned salts may be used and this does not lead to cell damage due to permeability or other concentration effects . The reference medium is a liquid generated in an “in vivo” method, such as blood, lymph, cytoplasmic fluid, or other body fluid, or a reference medium in an “in vitro” method, such as a general buffer or liquid It can be used as a liquid. Such common buffers or liquids are known to those skilled in the art. Lactated Ringer's solution is particularly suitable as a liquid basis.

  However, one or more compatible solid or liquid fillers or diluents or encapsulated compounds suitable for administration to the patient being treated may be used in the vaccines of the invention as well. As used herein, the term “compatible” refers to an interaction that substantially reduces the drug efficacy of the vaccine of the invention under typical use conditions. This means that these components of the vaccine of the present invention can be mixed with the components of the vaccine of the present invention.

  According to a particular embodiment, the vaccine of the present invention may comprise an adjuvant. In this context, an adjuvant may be understood as any compound suitable for initiating or increasing the immune response of the innate immune system, ie a non-specific immune response. In other words, when administered, the vaccine preferably elicits an innate immune response, optionally due to the adjuvant contained therein. Preferably, such adjuvants are known to those skilled in the art and are suitable for the present invention, ie, adjuvants that help induce innate immune responses in mammals, such as adjuvant proteins as defined above or defined below. Can be selected from adjuvants.

  According to one aspect, such an adjuvant may be selected from the (adjuvant) component as defined above.

  According to one further aspect, such adjuvants are known to those skilled in the art and are suitable for the present invention, ie, adjuvants that help induce innate immune responses in mammals, and vaccines of the present invention. It can be selected from at least one of the adjuvants suitable for storing and transporting the components. Suitable for storage and delivery as adjuvants are cationic or polycationic compounds as defined above. Similarly, adjuvants include, but are not limited to, cationic or polycationic compounds as defined above, chitosan, TDM, MDP, muramyl dipeptide, pluronic, alum solution, aluminum hydroxide, ADJUMER® (Polyphosphazene), aluminum phosphate gel, algae-derived glucan, argamulin, aluminum hydroxide gel (alum), high protein adsorptive aluminum hydroxide gel, low viscosity aluminum hydroxide gel, AF or SPT (squalene ( 5%), Tween 80 (0.2%), Pluronic L121 (1.25%), and pH 7.4 phosphate buffered saline emulsion), AVRIDINE® (propanediamine), BAY R1005 (Registered trademark) ((N- (2-deoxy-2-L-leucylamino-bD-glucopyranosyl) -N-octadecyldodecanoylamide hydroacetate), CALCITRIOL® (1α, 25-dihydroxyvitamin D3) Calcium phosphate gel, CAP® (calcium phosphate nanoparticles), cholera holotoxin, cholera toxin A1-protein AD fragment fusion protein, B subunit of cholera toxin, CRL 1005 (block copolymer P1205), cytokine-containing liposome, DDA (dimethyldioctadecyl ammonium bromide), DHEA (dehydroepiandrosterone), DMPC (dimyristoyl phosphatidylcholine), DMPG (dimyristoyl phosphatidylglycerol), DOC / Alum complex (deoxycholate sodium salt), Freund's complete adjuvant, Freund's incomplete adjuvant, gamma inulin, Gerbu adjuvant (mixtures below: i) N-acetylglucosaminyl- (Pl-4) -N- Acetylmuramyl-L-alanyl-D35 glutamine (GMDP), ii) dimethyldioctadecyl ammonium chloride (DDA), iii) zinc L-proline salt complex (ZnPro-8)), GM-CSF, GMDP (N-acetyl) Glucosaminyl- (b1-4) -N-acetylmuramyl-L47 alanyl-D-isoglutamine), imiquimod (1- (2-methylpropyl) -1H-imidazo [4,5-c] quinoline- 4-amine), ImmTher (registered trademark) (N- Acetylglucosaminyl-N-acetylmuramyl-L-Ala-D-isoGlu-L-Ala-glycerol dipalmitate), DRVs (immunoliposomes prepared from dehydrated-rehydrated vesicles), interferon-γ , Interleukin-1β, interleukin-2, interleukin-7, interleukin-12, ISCOMS (registered trademark), ISCOPREP 7.0.3. ®, liposomes, LOXORIBINE ® (7-allyl-8-oxoguanosine), LT5 oral adjuvant (E. coli unstable endotoxin protoxin), microspheres and microspheres of any composition Particles, MF59 (registered), (squalene water emulsion), MONTANIDE ISA 51 (registered trademark) (purified incomplete Freund's adjuvant), MONTANIDE ISA 720 (registered trademark), MPL (registered trademark) (3 -Q-desacyl-4'-monophosphoryl lipid A), MTP-PE and MTP-PE liposomes ((N-acetyl-L-alanyl-D-isoglutaminyl-L-alanine-2- (1,2-dipalmitoyl- sn-glycero-3- (hydroxyphosphoryloxy ))-Ethylamide, monosodium salt), MURAMETIDE (R) (Nac-Mur-L-Ala-D-Gln-OCH3), MURAPALMITINE (R) and DMURAPALMITINE (R) (Nac-Mur-L-Thr) -D-isoGln-sn-glycerol dipalmitoyl), NAGO (neuraminidase-galactose oxidase), nanospheres or nanoparticles of any composition, NISVs (nonionic surfactant vesicles), PLEURAN (R) ( β-glucan), PLGA, PGA and PLA (homopolymers and copolymers of lactic acid and glycolic acid, microspheres / nanospheres), PLURONIC L121 (registered trademark), PMMA (polymethyl methacrylate), PODDS ( (Registered trademark) (proteinoid microspheres), polyethylene carbamate derivatives, poly rA: poly rU (polyadenylic acid-polyuridylic acid complex), polysorbate 80 (Tween 80), spiral protein (Avanti Polar Lipids, Inc.). Alabaster, Alabama), STIMULON® (QS-21), Quil-A (Quil-A saponin), S-28463 (4-Amino-Otec-dimethyl-2-ethoxymethyl-lH-imidazo [4 , 5-c] quinoline-1-ethanol), SAF-1® (Syntex adjuvant formulation), Sendai proteoliposome and Sendai-containing lipid matrix, Span-85 (triolein) Sorbitan), Specol (emulsions of Marcol 52, Span 85 and Tween 85), squalene or Robane (2,6,10,15,19,23-hexamethyltetracosane and 2,6,10,15, 19,23-hexamethyl-2,6,10,14,18,22 tetracosahexane), stearyltyrosine (octadecyltyrosine hydrochloride), Theramid (registered trademark) (N-acetylglucosaminyl-N-acetylmuramyl- L-Ala-D-isoGlu-L-Ala-dipalmitoxypropylamide), threonyl-MDP (Termurtide (registered trademark) or [thr1] -MDP, N-acetylmuramyl-L-threonyl-D-isoglutamine ), Ty particles (Ty-VLP Or virus-like particles), Walter-Reed liposomes containing Pam3Cys (liposomes containing lipid A adsorbed on aluminum hydroxide), in particular aluminum salts such as Adju-phos, Alhydrogel and Rehydrogel, CFA, SAF, IFA, MF59 Emulsions, Provax, TiterMax, Montanide and Vaxfectin, Optivax (CRL1005), Copolymers including L121 and Poloxamer 4010, Liposomes including Stealth, Swirl type including BIORAL, QS21, Quil A, IscomatMix Adjuvant, adjuvant suitable for co-stimulation including Tomatine, PLG, PMM and Biopolymers containing ullin, Romurtide, DETOX, MPL, CWS, mannose, CpG nucleic acid sequence, CpG7909, ligand of human TLR1-10, ligand of mouse TLR1-13, ISS-1018, 35 IC31, imidazoquinolines, Ampligen, Ribi529 , IMOxine, IRIVs, VLPs, cholera toxin, heat-labile toxin, Pam3Cys, Flagellin, GPI anchor, LNFPIII / Lewis X, antimicrobial peptide, UC-1V150, peptides derived from microorganisms including RSV fusion protein and cdiGMP, and CGRP neurons It may be selected from the group consisting of adjuvants suitable as antagonists comprising peptides.

  Particularly preferably, the adjuvant is a Th1-type immune response of naive T cells, such as GM-CSF, IL-12, IFNg, any RNA as defined herein, preferably immunostimulatory RNA, and CpG DNA or It may be selected from adjuvants that help induce maturation.

  The vaccine of the present invention may further contain an additional immunotherapeutic agent selected from immunoglobulins, preferably IgG, monoclonal or polyclonal antibodies, polyclonal serum or serum. Preferably, such further immunotherapeutic agent can be provided as a peptide / protein or can be encoded by a nucleic acid, preferably DNA or RNA, more preferably mRNA. Such immunostimulatory agents allow the provision of inactive vaccines in addition to active vaccination caused by the mRNA-encoded antigens of the compositions or vaccine compositions of the present invention.

  The vaccine of the present invention can further contain one or more auxiliary substances as necessary in order to enhance its immunogenicity or immunostimulatory capacity. The interaction of the vaccine of the present invention and auxiliary substances that can optionally be included in the vaccine or formulated with an inhibitor is preferably achieved thereby. Depending on the different types of auxiliary substances, different mechanisms can be considered in this respect. For example, compounds that permit dendritic cell (DC) maturation, such as lipopolysaccharide, TNF-α, or CD40 ligand, form a first class of suitable auxiliary substances. In general, any drug that affects the immune system in the form of cytokines such as “danger signals” (LPS, GP96, etc.) or GM-CFS can be used as an adjunct, which is targeted Allows the immune response to be enhanced and affected in a form. Particularly preferred auxiliary substances are IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL- 25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IFN alpha, IFN beta, IFN gamma, GM-CSF, G-CSF , Cytokines such as monokines, lymphokines, interleukins or chemokines, and growth factors such as hGH, which further promote the innate immune response, such as M-CSF, LT-β or TNF-α.

  The vaccines of the invention also result from binding affinity (as a ligand) to the human toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10 or mouse toll Known to be immunostimulatory due to binding affinity (as a ligand) to TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR13 It may further comprise any additional compounds that have been identified, ligands for NOD-like receptors, or ligands for RIG-I-like receptors.

  In this context, the vaccine according to the invention may also further comprise an immunostimulatory nucleic acid, preferably an immunostimulatory RNA (isRNA) as defined above.

  The vaccine of the present invention as defined in relation to the first embodiment of the present invention may further comprise further additives or additional compounds. Further additives that can be included in the vaccine of the present invention include, for example, emulsifiers such as Tween®, wetting agents such as sodium lauryl sulfate, colorants, pharmaceutical carriers, taste-imparting agents, pharmaceutical carriers, tablet-forming agents, Stabilizers, antioxidants, and preservatives.

  One further additive that may be included in the vaccines of the present invention may be an antimicrobial agent. In this regard, any antibacterial agent known to those skilled in the art may be used in combination with the components of the vaccine of the invention as defined herein. Non-limiting examples of antibacterial agents include amikacin, amoxicillin, amoxicillin-clavulanic acid, amphotericin B, ampicillin, ampicillin-sulbactam, apramycin, azithromycin, aztreonam, bacitracin, benzylpenicillin, caspofungin, cefadroxyl, cefaxilil, cefaxilil, Cephalotin, cefazolin, cefdinir, cefepime, cefixime, cefmenoxime, cefoperazone, cefoperazone-sulbactam, cefotaxime, cefoxitin, cefvirome (Cefbirome), cefpodoxime, cefpodoxime-cefpoxime-cefpodum Cefthioful, Theft Prolol, ceftriaxone, cefuroxime, chloramphenicol, florfenicol, ciprofloxacin, clarithromycin, clinafloxacin, clindamycin, cloxacillin, colistin, cotrimoxazole (trimethoprim / sulfamethoxax Zol), dalbavancin, darfopristin / quinopristin, daptomycin, dibekacin, dicloxacillin, doripenem, doxycycline, enrofloxacin, ertapenem, erythromycin, flucloxacillin, fluconazole, flucytosine, fosfomycin, fusidic acid, galefloxacin, gatifloxacin, gatifloxacin Gemifloxacin, gentamicin, imipenem, itraconazole, kanamycin, ketoconazole Levofloxacin, lincomycin, linezolid, loracarbef, mecilnam (amzinocillin), meropenem, metronidazole, mediocillin, mezlocillin-sulbactam, minocycline, moxifloxacin, mupirocin, naridixine, neomycin, neomycin , Oxacillin, pefloxacin, penicillin V, piperacillin, piperacillin-sulbactam, piperacillin-tazobactam, rifampicin, roxithromycin, sparfloxacin, spectinomycin, spiramycin, streptomycin, sulbactam, sulfamethoxazole, teicoplanin, teravansin Terithromycin, Temocillin, Tetracycline Phosphorus, ticarcillin, ticarcillin-clavulanic acid, tigecycline, tobramycin, trimethoprim, trovafloxacin, tylosin, vancomycin, virginiamycin, and voriconazole.

  Another additive that may be included in the vaccines of the invention may be an antiviral agent, but preferably, but is not limited to, a nucleoside analog (eg zidovudine, acyclovir, ganciclovir, vidarabine, idox Uridine, trifluridine, and ribavirin), foscarnet, amantadine, peramivir, rimantadine, saquinavir, indinavir, ritonavir, α-interferon and other interferons, AZT, t-705, zanamivir (Relenza®), and oseltamivir (Tamiflu (registered trademark)). Other antiviral agents include influenza virus vaccines such as Fluarix® (GlaxoSmithKline), FluMist® (Medlmune Vaccines), Fluvirin® (Chiron Corporation), Fllaval® (GlaxoSmithKline), Afluria (R) (CSL Biotherapies Inc.), Agriflu (R) (Novartis) or Fluzone (R) (Aventis Pasteur).

  A vaccine of the invention typically comprises a “safe and effective amount” of a component of a vaccine of the invention as defined herein. As used herein, a “safe and effective amount” is preferably an ingredient sufficient to significantly induce a positive modification of a disease or disorder as defined herein, preferably It means the amount of at least one mRNA. At the same time, however, the “safe and effective amount” is small enough to avoid significant side effects and allow a reasonable relationship between benefits and risks. The determination of these limits is typically within reasonable medical judgment.

  As defined in connection with the first embodiment, a vaccine of the invention comprising at least one mRNA encoding at least one antigen is at least 50 years old, more preferably at least 55 years old, 60 years old, 65 years old, 70 years old Or may be used for the prevention and treatment of disease in elderly patients who are older. Here, the elderly patient is preferably a mammal, more preferably a human, and even more preferably a human adult, as well as at least 50, 55, 60, 65, 70 More preferably, the patient is an elderly (adult) human patient who is aged or older. The elderly patient may be male or female.

  As further defined in the first embodiment of the invention, the treatment includes vaccination of the patient and elicits an immune response in said patient. In this context, vaccination is typically performed via administration of the vaccine of the present invention. Administration can be parenteral, oral, nasal, pulmonary, inhalation (eg, via aerosol or spray), topically, rectally, buccally, vaginally or implanted. It may be performed via a container. The term parenteral as used herein is subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, intracranial, transdermal, intradermal, lung Includes internal, intraperitoneal, intracardiac, intraarterial, and sublingual injection or infusion techniques. Preferably, the vaccine of the present invention may be administered intradermally to reach APC in the dermis. Also preferably, the vaccines of the invention as defined herein are administered orally in any orally acceptable dosage form including, but not limited to, capsules, tablets, aqueous suspensions or solutions. May be. Equally preferably, the vaccine of the present invention comprises a topical, especially when the therapeutic target comprises a region or organ that is easily accessible by topical application, including for example diseases of the skin or other accessible epithelial tissue. May be administered. Suitable topical formulations are readily prepared for each of these areas or organs. For topical application, the vaccine of the invention is in a suitable ointment comprising the vaccine of the invention and optionally further ingredients as defined herein suspended or dissolved in one or more carriers. May be formulated. Transpulmonary administration can also be employed, for example, by use of an inhaler or nebulizer and formulation with an aerosolizing agent for use as a spray.

  The vaccines of the present invention may be used in combination with other therapies, preferably those for the diseases defined herein, or other therapies. As defined herein, the term “in combination” refers to more than one therapy, preferably two or more, in connection with the administration of two or more therapies to an elderly patient as defined herein. Refers to the use of further treatment. Use of the term “in combination” does not limit the order in which therapies are administered to elderly patients as defined herein. For example, the first treatment (eg, the first prophylactic or therapeutic agent) is performed before the second treatment (eg, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour before). 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 Before 5 weeks, 6 weeks, 8 weeks, or 12 weeks), simultaneously with the second treatment, or after the second treatment (eg, 5 minutes, 15 minutes, 30 Minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week 2 weeks later, 3 weeks later, 4 weeks later, 5 weeks later, 6 weeks later, 8 weeks later, or 12 weeks later) at any time for elderly patients as defined herein It can be. In some aspects, one or more other therapies include conventional tumor treatment, surgery, chemotherapy, immunotherapy, gene therapy, pain treatment, antipyretic treatment, treatments that relieve or assist breathing, etc. Including prophylactic use for (active or passive) vaccination / immunization, antiviral therapy, antibacterial therapy, antifungal therapy, antiparasitic therapy, and antiallergic therapy.

  In certain embodiments, the treatment is separated by less than 5 minutes, separated by less than 30 minutes, separated by 1 hour, separated by about 1 hour, separated by about 1 hour to about 2 hours, separated by about 2 hours to about 3 hours. About 3 hours to about 4 hours, about 4 hours to about 5 hours, about 5 hours to about 6 hours, about 6 hours to about 7 hours, about 7 hours to about 8 hours About 8 hours to about 9 hours, about 9 hours to about 10 hours, about 10 hours to about 11 hours, about 11 hours to about 12 hours, about 12 hours to about 18 hours 18 hours to 24 hours apart, 24 hours to 36 hours apart, 36 hours to 48 hours apart, 48 hours to 52 hours apart, 52 hours to 60 hours apart, 60 hours to 72 hours apart, 72 Even if it is given at an interval of 84 hours to 84 hours, 84 hours to 96 hours, or 96 hours to 120 hours. There. In certain embodiments, more than one therapy is administered during the same visit of the patient.

  Exemplary doses of mRNA encoding at least one antigen as defined herein include, but are not limited to, about 10 ng to 1 g, 100 ng to 100 mg, 1 μg to 10 μg, or 30 μg to 300 μg mRNA per patient. It is good also as the range. Preferably, the vaccines of the invention are formulated accordingly to include one dose, two doses, three doses or even more doses.

  According to a particular embodiment, the vaccine of the invention may be administered to elderly patients as a single dose. In certain embodiments, the vaccines of the invention may be administered to elderly patients as a single dose followed by a second administration, optionally further a third, fourth (or more) administration. . According to this aspect, the booster immunization of the vaccine of the present invention is administered to the elderly patient after the second (or third, fourth, etc.) inoculation, preferably at specific time intervals as defined below. Also good. In certain embodiments, such boosting of a vaccine of the invention may utilize additional compounds or components defined for the vaccine of the invention as defined herein. In some embodiments, the same vaccine administration and booster administration of the same invention may be repeated, such administration comprising at least 1 day, 2 days, 3 days, 4 days, 5 days, 10 days, 15 days, 30 days, 45 days, 2 months, 75 days, for example, 1 day to 5 days, 1 day to 10 days, 5 days to 15 days, 10 days to 20 days, 15 days to 25 days 20 days to 30 days, 25 days to 35 days, 30 days to 50 days, 40 days to 60 days, 50 days to 70 days, 1 day to 75 days, or 1 month, 2 months, 3 months, 4 months, 5 months, or at least 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, 30 months, 36 months, 1 year, 2 years, 3 years 5 years, 10 years, 15 years, 20 years, 30 years, 40 years, 50 years, 60 years, or more may be separated. In certain embodiments, the vaccines of the invention may be administered to a subject as a single dose once a year.

  In certain embodiments, the vaccines of the invention may be administered to elderly patients in the fall or winter, ie, before or during each hemispheric influenza season. In one aspect, an elderly patient may have his / her at the beginning of the season, such as late September or early October, so that a second dose (if necessary) can be given before the peak of the influenza season. Of the first dose.

  In a particular embodiment, the vaccine of the present invention is preferably at least 1 day, 2 days, 3 days, 4 days, 5 days, 10 days, 15 days, 30 days before, 45 days before the treatment of the disease as defined herein. 25 days ago, 2 months ago, 75 days ago, for example, 1 day to 5 days ago, 1 day to 10 days ago, 5 days to 15 days ago, 10 days to 20 days ago, 15 days to 25 days ago, 20 days to 30 days ago 35 days, 30 days to 50 days, 40 days to 60 days, 50 days to 70 days, 1 day to 75 days, or 1 month, 2 months, 3 months, 4 months, 5 months, or At least 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 12 months prior to treatment of the disease as defined herein at least for elderly patients It may be administered once, preferably twice or more. The second or further dose may then be administered directly before the treatment, simultaneously with the treatment or after the treatment.

  Furthermore, the disease defined according to the first embodiment of the invention is an infectious disease, preferably a (viral, bacterial or protozoan) infectious disease, autoimmune disease, allergy, allergic disease, or cancer or tumor disease Is any disease selected from.

  Such diseases include cancer or tumor diseases, preferably melanoma, malignant melanoma, colon cancer, lymphoma, sarcoma, blastoma, renal cancer, gastrointestinal tumor, glioma, prostate tumor, bladder cancer, Rectal tumor, stomach cancer, esophageal cancer, pancreatic cancer, liver cancer, breast cancer (= breast cancer), uterine cancer, cervical cancer, acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), Chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), liver cancer, various virus-induced tumors, eg, papillomavirus-induced cancer (eg, cervical cancer = cervical cancer) Adenocarcinoma, herpesvirus-induced tumors (eg Burkitt's lymphoma, EBV-induced B-cell lymphoma), B Hepatitis-induced tumor (hepatocellular carcinoma), HTLV-1-induced lymphoma and HTLV-2-induced lymphoma, acoustic neuroma, lung cancer (= lung cancer = bronchial cancer), small cell lung cancer, pharyngeal cancer, anal cancer , Glioblastoma, rectal cancer, astrocytoma, brain tumor, retinoblastoma, basal cell tumor, brain metastasis, medulloblastoma, vaginal cancer, pancreatic cancer, testicular cancer, Hodgkin syndrome, meningioma, Schneeberger disease Pituitary tumor, mycosis fungoides, carcinoid, neurofibromatosis, spinal cell carcinoma, Burkitt lymphoma, laryngeal cancer, renal cancer, thymoma, endometrial cancer, bone cancer, non-Hodgkin lymphoma, urethral cancer, CUP syndrome, head / neck tumor, oligodendroglioma, vulvar cancer, intestinal cancer, colon cancer, esophageal cancer (= esophageal cancer) )), Vaginal lesion, small intestine tumor, craniopharyngioma, ovarian cancer, genital tumor, ovarian cancer (= ovarian cancer), pancreatic cancer (= pancreatic cancer) ), Endometrial cancer, liver metastasis, penile cancer, tongue cancer, gallbladder cancer, leukemia, plasmacytoma, eyelid tumor, and prostate cancer (= prostate tumor).

  According to one further particular embodiment, the disease as defined herein comprises an infection, preferably a (viral, bacterial or protozoan) infection. Such an infection, preferably a viral, bacterial or protozoal infection, is typically an influenza, preferably an influenza A, influenza B, influenza C or togotovirus, more preferably hemagglutinin, for example. Subtypes H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14 or H15, and neuraminidase subtypes N1, N2, N3, N4, N5, N6, N7, At least one of N8 or N9, or preferably influenza A subtype H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N3, H5N1, H5N2, H7N7 or H9N2, etc., or combinations thereof, malaria, severe acute respiratory Syndrome (SARS), yellow fever, d , Lyme borreliosis, leishmaniasis, anthrax, meningitis, warts, hollow warts, dengue fever, three-day fever, Ebola virus, cold, early summer meningoencephalitis (FSME), shingles, Hepatitis, herpes simplex type I, herpes simplex type II, herpes zoster, herpes virus 8 (HHV-8; Kaposi's sarcoma herpes virus (KSHV)); human papillomavirus infection, Japanese encephalitis, arenavirus related diseases (Lassa Fever infection), Marburg virus, measles, foot-and-mouth disease, infectious mononucleosis, (Peifer gland fever), epidemic parotitis, norwalk virus infection, smallpox, polio (pediatric lameness), pseudocroup, infection Erythema (fifth disease), rabies, warts, West Nile fever, chickenpox, cytomegalovirus (CMV), etc. Viral infections, miscarriage (prostatitis), anthrax, appendicitis, borreliosis, botulism, campylobacter, chlamydia trachomatis (urethral inflammation, conjunctivitis), cholera, diphtheria, inguinal granulomas (donavanosis), epiglottis, Rash typhoid, gas gangrene, gonorrhea, mania, Helicobacter pylori, whooping cough, climatic recumbency, osteomyelitis, Legionella disease, leprosy, listeriosis, pneumonia, meningitis, bacterial meningitis, anthrax, otitis media, mycoplasma Hominis, neonatal sepsis (chorionic amniitis), fever, paratyphoid, plague, reiter syndrome, rocky mountain spotted fever, salmonella paratyphoid, salmonella fever, scarlet fever, syphilis, tetanus, trippel, tsutsugamushi disease, tuberculosis, typhoid, vaginitis ) (Colpitis), and soft Bacterial infections such as lower armpits, as well as amebiasis, schistosomiasis, Chagas disease, Echinococcus, ciliate crustacean, fish poisoning (Sigatera poisoning), foxtail worms, athlete's foot, dogworm, candidiasis, yeast fungus, Scabies, cutaneous leishmaniasis, rumble flagellate disease (Giardia), lice, malaria, microscopy, onchocercosis (river blindness), fungal disease, caterpillar, schistosomiasis, swine worm, toxoplasmosis , Trichomoniasis, trypanosomiasis (sleeping disease), visceral leishmaniasis, diaper / diaper dermatitis or infections caused by parasites such as small tapeworms, protozoa or fungi.

  According to another particular embodiment, the disease as defined herein comprises an autoimmune disease as defined below. Autoimmune diseases can be broadly classified into systemic and organ-specific or local autoimmune diseases, depending on the main clinicopathological features of each disease. Autoimmune diseases include systemic lupus erythematosus (SLE), Sjögren's syndrome, scleroderma, rheumatoid arthritis and polymyositis, or endocrinology (type I diabetes (type 1 diabetes), Hashimoto's thyroiditis, Addison) Disease, etc.), cutaneous (pemphigus vulgaris), hematology (autoimmune hemolytic anemia) and nervous system (multiple sclerosis) may be divided into categories of local syndromes Alternatively, it can include a localized mass of virtually any body tissue. Autoimmune diseases to be treated include, for example, multiple sclerosis (MS), rheumatoid arthritis, diabetes, type I diabetes (type 1 diabetes), chronic polyarthritis, Graves' disease, chronic hepatitis, ulcerative colitis, type I Allergic disease, type II allergic disease, type III allergic disease, type IV allergic disease, fibromyalgia, hair loss, Bechteref's disease, Crohn's disease, myasthenia gravis, neurodermatitis, rheumatic polymyalgia, generalized progressive sclerosis Disease (PSS), Reiter syndrome, rheumatoid arthritis, autoimmune forms such as psoriasis and vasculitis, or type II autoimmune diseases such as type II diabetes, type II autoimmune diseases type III autoimmune diseases, or type IV self It can be selected from the group consisting of immune diseases. The exact manner in which the immune system elicits an immune response to self antigens has not been elucidated so far, but there are several findings regarding the etiology. Thus, autoreaction can be attributed to T cell bypass. The normal immune system requires activation of B cells by T cells before the former produces large amounts of antibody. Infection by organisms producing superantigens capable of initiating polyclonal activation of B cells, or even T cells, by directly binding to the β-subunit of the T cell receptor in a non-specific manner, etc. This requirement of T cells can be bypassed in unusual cases. In another explanation, a foreign antigen may share structural similarity with a particular host antigen, and thus any antibody produced against this antigen (which mimics a self-antigen) will also Theoretically, an autoimmune disease is presumed from “molecular mimicry”, which binds to a host antigen and amplifies the immune response. Autoimmune diseases based on molecular mimicry are known to those skilled in the art involving various viral and bacterial antigens. The most prominent form of molecular mimicry is observed in group A β-type hemolytic streptococci, sharing antigens with human myocardium and causing the heart of rheumatic fever.

  Thus, according to one further particular embodiment, the diseases as defined herein include allergies or allergic diseases, i.e. diseases associated with allergies. An allergy is typically a condition with abnormal acquired immune hypersensitivity to a particular foreign antigen or allergen, such as an allergic antigen as defined herein. Such allergic antigens or allergens may be selected from allergic antigens as defined herein which are antigens derived from different sources such as animals, plants, fungi, bacteria, etc. Allergens related to this include, for example, scales, grass, pollen, molds, drugs, or many environmental factors. Allergies usually cause local or systemic inflammatory responses to these antigens or allergens, resulting in internal immunity against these allergens. Without being bound by theory, several different disease mechanisms are believed to be involved in the development of allergies. P. Gell and R.W. According to the classification system by Coombs, the word “allergy” is limited to type I hypersensitivity caused by the classic IgE mechanism. Type I hypersensitivity is characterized by excessive activation of mast cells and basophils by IgE antibodies that cause a life-threatening anaphylactic shock and death-causing systemic inflammatory response from benign symptoms as a runny nose. Well-known types of allergies include, but are not limited to, asthma, allergic asthma (which causes swelling of the nasal mucosa), allergic conjunctivitis (which causes redness and itching of the conjunctiva), allergic rhinitis (" Hay fever "), anaphylaxis, angioedema, atopy, atopic dermatitis (eczema), urticaria (urticaria), eosinophilia, respiratory allergy, allergy to insect bites, skin allergy (Educes, causes or includes various rashes such as eczema, hives (urticaria) and (contact) dermatitis), food allergies, and allergies to drugs. Treatment of such allergic disorders or diseases can occur, preferably by desensitizing the immune response that causes a specific immune response. Such desensitization, when formulated as a pharmaceutical composition, preferably induces a slight immune response by administering an effective amount of an allergen or allergen encoded by a nucleic acid as defined herein. Can be done. The amount of allergen or allergen may be increased in stages with subsequent administrations until the patient's immune system being treated tolerates a certain amount of allergen or allergen.

  Diseases related to the present invention also include type II hypersensitivity reactions (cytotoxicity) including, for example, autoimmune hemolytic anemia, thrombocytopenia, fetal erythroblastosis, Goodpasture syndrome, Graves' disease, and myasthenia gravis. Sex, antibody dependence); type III hypersensitivity reactions (immunocomplex diseases) including, for example, serum sickness, Arthus reaction, systemic lupus erythematosus (SLE), etc .; eg, contact dermatitis, tuberculin reaction, chronic graft rejection And type IV hypersensitivity reactions including multiple sclerosis (delayed type hypersensitivity (DTH), cellular immune memory response, antibody independent); and, for example, type V including Graves' disease, myasthenia gravis, etc. Includes hypersensitivity reactions (receptor-mediated autoimmune diseases).

  In a further preferred embodiment, the vaccine of the present invention may be formulated as a kit, preferably as a kit of parts. Accordingly, the present invention also includes a kit comprising technical instructions, alone or in combination with other components as defined above, and optionally with information regarding the administration and dosage of the vaccine of the present invention. In particular, provide a kit of parts. The components of the vaccine of the invention, alone or in combination with further components as defined above, for example each at least one mRNA encoding at least one antigen as defined above in the part of the kit, and preferably In the kit as part of the kit or as a different part of the kit, such as further components mixed in each at least one mRNA encoding at least one antigen as defined above or separated into further parts of the kit May be included. Such a kit, preferably a kit of parts, can be applied, for example, to any of the applications or uses described above.

  In the present invention, unless otherwise specified, different features of alternatives and embodiments may be combined with each other where appropriate. Further, unless specifically stated, the term “comprising” is not to be construed as meaning “consisting of”. However, in the context of the present invention, the term “comprising” may be replaced by the term “consisting of” where appropriate.

  All publications, patents, and patent applications cited herein are hereby incorporated by reference as if each individual publication, or patent application, was specifically and individually incorporated by reference. This is incorporated herein. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, certain changes and modifications may be made without departing from the spirit or scope of the appended claims. However, it will be readily apparent to those skilled in the art in light of the teachings of the present invention.

  The following drawings are intended to further illustrate the present invention. They are not intended to limit the subject of the invention to them.

FIG. 1A is a diagram showing the results of vaccination of 18-month-old or 8-week-old mice. Mice were inoculated intradermally twice with 80 μg of mRNA encoding PR8 H1 HA (hemagglutinin of influenza virus A / Puerto Rico / 8/1934), or mRNA encoding chicken ovalbumin (control group mRNA) as a control group. Injections were made at 7 day intervals. Five weeks after the last vaccination, mice were exposed to a 10-fold lethal dose of PR8 virus (10 LD50). Mice were controlled for 2 weeks and were sacrificed when more than 25% of their original weight was lost. FIG. 1A shows the overall survival rate of mice. FIG. 1B shows the results of vaccination of 18 month or 8 week old mice. Mice were inoculated intradermally twice with 80 μg of mRNA encoding PR8 H1 HA (hemagglutinin of influenza virus A / Puerto Rico / 8/1934), or mRNA encoding chicken ovalbumin (control group mRNA) as a control group. Injections were made at 7 day intervals. Five weeks after the last vaccination, mice were exposed to a 10-fold lethal dose of PR8 virus (10 LD50). Mice were controlled for 2 weeks and were sacrificed when more than 25% of their original weight was lost. FIG. 1B shows the weight of the mouse. FIG. 1C shows PR8 H1 HA (influenza virus A / Puerto Rico / 8/1934 hemagglutinin) (SEQ ID NO: 384) used for vaccination of 18 month or 8 week old mice (see FIGS. 1A, B). FIG. 2C shows the coding sequence of mRNA encoding FIG. 2C). FIG. 1D shows chicken ovalbumin (control group mRNA) (SEQ ID NO: 385) (SEQ ID NO: 385) (FIG. 2D) used as a control group for vaccination of mice aged 18 months or 8 weeks (see FIGS. 1A and B). It is a figure which shows the coding sequence of mRNA which codes. FIG. 2A shows the results of vaccination of 32 patients with histologically confirmed diagnosis of prostate adenocarcinoma between 52 and 74 years old. These patients were inoculated intradermally with a total of 1,280 μg (per treatment) of mRNA encoding tumor antigens PSA, PSCA, PSMA, and STEAP-1. For injection, the third, fourth, and fifth vaccinated blood samples were collected from patients and analyzed for the presence of antigen-specific immune responses to tumor antigens PSA, PSCA, PSMA, and STEAP-1 for one week. 3 weeks, 7 weeks, 15 weeks, and 23.2 weeks. As can be seen, patients older than 70 years are at least as efficient as those under 70 years in generating antigen-specific immune responses. FIG. 2B shows the antigens for which specific immune responses were detected by ELISPOT, tetramer staining, intracellular cytokine staining (ICS) or ELISA for each patient in this study. FIG. 2C shows tumor antigens among the coding sequences of mRNA used for vaccination (see FIGS. 2A and 2B) of 32 patients with 52-74 year old prostate adenocarcinoma and histologically confirmed diagnosis. The sequence encoding PSA (SEQ ID NO: 386) is shown. FIG. 2D shows tumor antigens among the coding sequences of mRNA used for vaccination (see FIGS. 2A and B) of 32 patients with histologically confirmed diagnosis of prostate adenocarcinoma aged 52 to 74 years. The sequence encoding PSMA (SEQ ID NO: 387) is shown. FIG. 2E shows tumor antigens among the coding sequences of mRNA used for vaccination (see FIGS. 2A and B) of 32 patients with 52-74 years old prostate adenocarcinoma and histologically confirmed diagnosis. The sequence encoding PSCA (SEQ ID NO: 388) is shown. FIG. 2F shows tumor antigens among the coding sequences of mRNA used for vaccination (see FIGS. 2A and B) of 32 patients with prostate adenocarcinoma aged 52 to 74 years and diagnosed histologically. The sequence encoding STEAP-1 (SEQ ID NO: 389) is shown.

  The following examples are intended to further illustrate the present invention. They are not intended to limit the subject of the invention to them.

Example 1-Preparation of mRNA constructs For this example, PR8 H1 HA (influenza virus A / Puerto Rico / 8/1934 hemagglutinin) (SEQ ID NO: 384), and chicken ovalbumin (control group) as a control group. mRNA sequences (SEQ ID NO: 385) were prepared and used for subsequent in vivo transcription reactions.

  In the first preparation, the DNA sequence designated PR8 H1 HA (hemagglutinin of influenza virus A / Puerto Rico / 8/1934) (SEQ ID NO: 384) (see FIG. 1C) is used for better codon usage and stabilization. Prepared by modifying wild-type hemagglutinin encoding the DNA sequence by introducing a GC-optimized sequence into. In SEQ ID NO: 384 (see FIG. 1C), the corresponding mRNA sequence is shown. The sequence was further introduced into the pCV19 vector and a stabilizing sequence derived from α-globin-3′-UTR (muag (mutated α-globin-3′-UTR)), a stretch of 70 × adenosine at the 3 ′ end ( Poly A tail) and a stretch of 30 × cytosine (poly C-tail) at the 3 ′ end. The sequence of the final DNA construct was designated “PR8 HA H1”.

  In the second preparation, a DNA sequence called chicken ovalbumin (control mRNA) (SEQ ID NO: 385) (see FIG. 1D) as a control group was added to GC- for better codon usage and stabilization. Prepared by modifying wild-type chicken ovalbumin encoding the DNA sequence by introducing an optimized sequence. SEQ ID NO: 385 (see FIG. 1D) shows the corresponding mRNA sequence. The sequence was further introduced into the pCV19 vector and a stabilizing sequence derived from α-globin-3′-UTR (muag (mutated α-globin-3′-UTR)), a stretch of 70 × adenosine at the 3 ′ end ( Poly A tail) and a stretch of 30 × cytosine (poly C-tail) at the 3 ′ end. The sequence of the final DNA construct was called “chicken ovalbumin”.

  Similarly, DNA plasmids encoding tumor antigens PSA, PSMA, PSCA, and STEAP-1 were prepared. The sequences of mRNA corresponding to SEQ ID NOs: 386, 387, 388, and 389 are shown (see also FIGS. 2C-F).

  In a further step, each DNA plasmid prepared above was transcribed into mRNA in vitro using T7-polymerase. The resulting mRNA was then purified using PureMessenger® (CureVac, Tubingen, Germany).

  All of the resulting mRNA used herein further formed a complex with protamine prior to use. The RNA complex consists of a mixture of 50% of free mRNA and 50% of mRNA formed from the complex with protamine (mRNA: protamine = 2: 1 (weight ratio)). First, mRNA was complexed with protamine by slowly adding a protamine-lactate Ringer solution to the mRNA. As soon as the complex formed stably, free mRNA was added, stirred briefly and the final concentration of the vaccine was adjusted with lactated Ringer's solution.

Example 2-Vaccination of 18 month or 8 week old mice In this experiment, 18 month or 8 week old mice encode PR8 H1 HA (influenza virus A / Puerto Rico / 8/1934 hemagglutinin, FIG. 1C). Inoculated twice intradermally with 80 μg of mRNA or mRNA encoding chicken ovalbumin (control group mRNA, FIG. 1D) as a control group. Injections were made at 7 day intervals. Five weeks after the last vaccination, mice were exposed to a 10-fold lethal dose of PR8 virus (10 LD50). Mice were controlled for 2 weeks and were sacrificed when more than 25% of their original weight was lost. The results are shown in FIGS. 1A and 1B. FIG. 1A shows the overall survival rate of mice. FIG. 1B shows the weight of the mouse. As can be seen in FIG. 1A, mice vaccinated with mRNA encoding PR8 H1 hemagglutinin were infected with influenza only with control mRNA (all mice received control mRNA encoding chicken ovalbumin for 8 weeks). Died about 7 days after vaccination with the control group mRNA, and about 9 days after vaccination with the control group mRNA. The survival rate was significantly better (all mice survived).

Reference Example 3-Vaccination of Human Prostate Cancer Patients In this experiment, 32 patients with a 52-74 year old prostate adenocarcinoma and a histologically confirmed diagnosis were treated with tumor antigens PSA, PSCA, PSMA. And a total of 1,280 μg of mRNA encoding STEAP-1 (per treatment) were inoculated intradermally. For injection, the third, fourth, and fifth vaccinated blood samples were collected from patients and analyzed for the presence of antigen-specific immune responses to tumor antigens PSA, PSCA, PSMA, and STEAP-1 for one week. 3 weeks, 7 weeks, 15 weeks, and 23.22 weeks. The results are shown in FIGS. 2A and 2B. As can be seen from FIG. 2A, patients older than 70 years are at least as efficient as those younger than 70 years in generating an antigen-specific immune response. FIG. 2B shows the antigens for which specific immune responses were detected by ELISPOT, tetramer staining, intracellular cytokine staining (ICS) or ELISA for each patient in this study.

Claims (6)

A vaccine comprising at least one mRNA encoding at least one antigen for use in the prevention of infection in elderly patients exhibiting an age of at least 60 years ,
The prevention includes vaccination of the elderly patient, eliciting an immune response in the elderly patient;
The G / C content of the coding region of the at least one mRNA is increased by at least 15% compared to the G / C of the coding region of the wild-type mRNA;
A vaccine wherein the at least one mRNA is complexed with protamine .   2. A vaccine for use according to claim 1 wherein eliciting an immune response in an elderly patient comprises eliciting a Th1 immune response. Elderly patients, 1) is a male or female, and, 2) at least 65 years old, 70 years old, or a vaccine for use according to older to indicate to claim 1 or 2.   4. A vaccine for use according to any one of claims 1 to 3, wherein the infection is selected from viral infections, bacterial infections and protozoal infections.   The vaccine for use according to any of claims 1 to 4, wherein the antigen is selected from protein and peptide antigens, pathogenic antigens, viral antigens, bacterial antigens, fungal antigens, protist antigens, and animal antigens. A vaccine is formulated to comprise a) an adjuvant component comprising or consisting of at least one mRNA complexed with protamine, and b) at least one free mRNA encoding the antigen. A vaccine for use according to any of 1 to 5.