JP6321645B2 - Method for producing 2-deoxy-siro-inosose - Google Patents

Description

  The present invention relates to a method for producing 2-deoxy-siro-inosose.

  2-deoxy-siro-inosose (hereinafter also referred to as “DOI”) is a useful substance used as a pharmaceutical raw material, chemical industrial resources, and the like. For example, according to Japanese Unexamined Patent Publication No. 2000-236881, 2-deoxy-siro-isonose is produced by using glucose-6-phosphate (G-6-6) using a recombinant DOI synthase obtained using E. coli. It is clear from P) that it can be produced in a short process. Furthermore, for example, according to International Publication No. 2006/109479, a method for producing DOI from D-glucose by fermentation using E. coli expressing DOI synthase has also been developed. Thereby, it became possible to produce DOI from D-glucose obtained from plant-derived resources.

  Journal of Biotechnology, Vol. 129, pp. According to 502-509 (2007), when DOI synthase is expressed in wild-type E. coli, the DOI productivity is only 1.5 g / L, and the high DOI productivity (29.5 g / L) To achieve this, the three enzyme genes possessed by E. coli, the phosphoglucose isomerase gene (pgi) and the glucose-6-phosphate dehydrogenase gene (zwf) and the phosphoglucomutase gene (pgm) are simultaneously destroyed, It has been shown that it is necessary to block metabolism. For this reason, it has been concluded that a sugar (for example, mannitol) that can be separately used for a glycolysis system is necessary for the growth / growth of bacterial cells. In addition, in order to obtain the same high DOI productivity, it is only necessary to destroy both pgi and zwf at the same time. In this case, too, if D-glucose is used as the sole carbon source, the cells cannot grow. It has been shown that D-mannitol is required as a carbon source for cell growth / growth.

  According to International Publication No. 2010/053052, two genes, pgi and zwf, of Escherichia coli (E. coli K12-derived strain and E. coli B-derived strain) that cannot originally metabolize sucrose are destroyed, DOI synthase gene (btrC) and sucrose By introducing a degrading enzyme gene (cscA), sucrose is hydrolyzed, and among D-fructose and D-glucose produced, D-fructose is used as a carbon source for cell growth / growth. It has been shown that DOI can be produced by fermentation using glucose as a carbon source for the DOI raw material.

  Fermentation includes the cultivation of microorganisms and the production of substances using the microorganisms grown by the cultivation as a catalyst. Nutrient sources are required for the cultivation and growth of microorganisms. Natural microorganism components such as yeast extract and corn steep liquor (hereinafter also referred to as “CSL”) are often used for ordinary microorganism culture media. CSL is a by-product obtained by immersing corn grains in a sulfite solution in the process of producing corn starch. Soluble proteins, peptides, amino acids, sugars, and vitamins eluted from corn grains are contained in CSL. In addition, CSL includes a unique component produced by lactic acid fermentation that occurs during the immersion of corn grains in a sulfite solution, and is therefore a highly nutritious natural medium component. CSL is widely used as an important medium component for microbial culture in the production of antibiotics, vitamins, amino acids, enzymes, and the like because it is less expensive than yeast extract and the like. Even in DOI fermentation production, good productivity can be obtained by adding 30 g / L of CSL (3 w / v%) to the medium.

  However, natural medium components also contain many organic substances that are not necessary for the growth and production of Escherichia coli. When DOI-producing Escherichia coli produces DOI, if such organic matter is contained in a large amount in the culture solution, the purification load of the culture solution increases, and the purification and recovery process for obtaining DOI becomes complicated. Therefore, it has become clear that it is necessary to limit the amount of natural medium components in the whole medium to, for example, 1 w / v% or less. However, if the amount of the natural medium component used is reduced in order to reduce the purification load of the culture solution, the nutrient source is reduced, and it can be expected that the growth of microorganisms is limited and the productivity deteriorates.

The problem to be solved by the present invention is that DOI-producing Escherichia coli can be cultured in a medium containing a natural medium component of 1 w / v% or less based on the total medium, and the DOI accumulated in the medium is recovered. DOI production method capable of suppressing the number of steps and maintaining the same DOI productivity as when DOI-producing Escherichia coli was cultured in a medium containing about 3 w / v% of a natural medium component with respect to the whole medium, and the production method Is to provide the DOI produced by.
In addition, as far as the present inventors know, a report showing that the DOI-producing E. coli of DOI-producing E. coli is improved by adding the phytic acid component to the medium is the same as the DOI-producing E. coli by adding gluconic acid to the medium. There are no reports showing production of DOI. Moreover, there is no report which shows that DOI productivity improves by adding a specific amount of pentoses separately from a growth carbon source.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have a group consisting of a specific amount of phytic acid component and a specific amount of pentose and / or gluconic acid even if the amount of CSL used is reduced. The present inventors have found a method capable of maintaining DOI productivity equivalent to the case where the amount of CSL used is not reduced by using a medium containing at least one selected from the above.

Aspects of the present invention are as follows.
[1] A natural medium component (a) of 1.0 w / v% or less based on the total medium;
At least one selected from the group consisting of the following component (b) and component (c);
Culturing E. coli producing 2-deoxy-siro-inosose in a medium containing, producing 2-deoxy-siro-inosose, and recovering the produced 2-deoxy-siro-inosose from the medium,
Method for producing 2-deoxy-siro-inosose containing:
(B) 0.05 w / v% to 0.27 w / v% phytic acid, 0.05% / 0.27 w / v% phytic acid, etc. to the whole medium, etc. Phytic acid component selected from the group consisting of a molar amount of phytic acid hydrolyzate and 0.05 w / v% or more and 0.27 w / v% or less of phytic acid and an equimolar amount of phytic acid salt based on the total medium. ;
(C) Equimolar amounts of 0.01 w / v% to 0.45 w / v% pentose with respect to the whole medium and 0.01 w / v% to 0.45 w / v% with respect to the whole medium A component selected from the group consisting of gluconic acid.
[2] The production method according to [1], wherein the medium has a pH of 5 to 6.
[3] The production method according to [1] or [2], wherein the pentose is pentose that can be metabolized by the pentose phosphate pathway of Escherichia coli.
[4] The 2-deoxy-siro-inosose-producing Escherichia coli is imparted or enhanced with 2-deoxy-siro-inosose production ability by introducing a gene encoding 2-deoxy-siro-inosose synthase (BtrC). The production method according to any one of [1] to [3].
[5] The activity of phosphoglucose isomerase (Pgi) and glucose-6-phosphate dehydrogenase (Zwf) inherent in the 2-deoxy-siro-inosose-producing Escherichia coli is inactivated or reduced [1] To [4]. The production method according to any one of [4].
[6] The production method according to any one of [1] to [5], wherein the 2-deoxy-siro-inosose-producing Escherichia coli has a gene encoding sucrose hydrolase (CscA).
[7] The production method according to any one of [1] to [6], wherein the 2-deoxy-siro-inosose-producing Escherichia coli has a gene encoding a glucose transport promoting protein (Glf).
[8] The production method according to any one of [1] to [7], wherein the natural medium component is corn steep liquor.
[9] 2-Deoxy-siro-inosose produced by the production method according to any one of [1] to [8].

  According to the present invention, DOI-producing Escherichia coli can be cultured in a medium containing a natural medium component of 1.0 w / v% or less based on the total medium, and the number of steps when collecting DOI accumulated in the medium. Of DOI production that can maintain the same DOI productivity as when DOI-producing Escherichia coli is cultured in a medium containing about 3 w / v% of a natural medium component with respect to the total medium. DOI can be provided.

The method for producing 2-deoxy-siro-inosose (DOI) of the present invention comprises 1.0% w / v or less natural medium component (a) based on the total medium,
At least one selected from the group consisting of the following component (b) and component (c);
2-deoxy-siro-inosose-producing Escherichia coli is cultured in a culture medium containing 2-deoxy-siro-inosose (hereinafter also referred to as “DOI production step”), and the 2-deoxy-shiro produced -Purifying and recovering inosource from the culture medium (hereinafter also referred to as "DOI purification and recovery step").
(B) 0.05 w / v% to 0.27 w / v% phytic acid, 0.05% / 0.27 w / v% phytic acid, etc. to the whole medium, etc. Phytic acid component selected from the group consisting of a molar amount of phytic acid hydrolyzate and 0.05 w / v% or more and 0.27 w / v% or less of phytic acid and an equimolar amount of phytic acid salt based on the total medium. .
(C) Equimolar amounts of 0.01 w / v% to 0.45 w / v% pentose with respect to the whole medium and 0.01 w / v% to 0.45 w / v% with respect to the whole medium A component selected from the group consisting of gluconic acid.

  In the DOI production method of the present invention, DOI-producing Escherichia coli can be cultured in a medium containing a natural medium component of 1.0 w / v% or less based on the total medium, and the DOI accumulated in the medium is purified. The number of steps at the time of recovery can be suppressed, and the productivity of DOI equivalent to that obtained when DOI-producing Escherichia coli is cultured in a medium containing about 3 w / v% of a natural medium component with respect to the entire medium can be maintained.

In this specification, the term “process” is not limited to an independent process, and is included in the term if the intended purpose of the process is achieved even when it cannot be clearly distinguished from other processes. . In the present specification, a numerical range indicated by using “to” indicates a range including the numerical values described before and after “to” as the minimum value and the maximum value, respectively.
In the present invention, when referring to the amount of each component in the composition, when there are a plurality of substances corresponding to each component in the composition, the plurality of substances present in the composition unless otherwise specified. Means the total amount.
The “total medium” refers to a medium placed in a culture container in the case of batch culture, in the case of fed-batch culture, refers to a combination of the initial medium and fed-batch medium, and in the case of continuous culture. It refers to the medium in the culture tank.

In the present invention, “inactivation” means an enzyme measured by any existing measurement system (unless otherwise specified, “enzyme” in this specification includes “factor” which does not exhibit enzyme activity alone). When the activity in DOI-producing Escherichia coli before inactivation is defined as 100, the activity is 1/10 or less.
The “reduction” of the enzyme activity in the present invention refers to a state in which the activity of the enzyme is significantly reduced as compared with the state before the treatment by the gene recombination technique of the gene encoding the enzyme.

The term “enhancement” of “activity” in the present invention broadly means that various enzyme activities in DOI-producing Escherichia coli before the enhancement increase after the enhancement.
There are no particular limitations on the method of strengthening as long as the activity of various enzymes possessed by DOI-producing Escherichia coli is enhanced. The enhancement by enzyme genes introduced from outside the cells, the enhancement by enhancing the expression of enzyme genes in cells, and these Can be mentioned.

Specifically, the enhancement by an enzyme gene introduced from outside the cell is carried out by introducing a gene encoding an enzyme having a higher activity than the host-derived enzyme into the cell from outside the host microorganism by gene recombination technology. Adding the enzyme activity of the introduced enzyme gene, or replacing this enzyme activity with the enzyme activity inherent in the host, and further increasing the number of host-derived enzyme genes or enzyme genes from outside the cell to 2 or more Increasing and combinations thereof may be mentioned.
Specifically, the enhancement by enhancing the expression of the enzyme gene in the microorganism includes specifically introducing a base sequence that enhances the expression of the enzyme gene into the microorganism from outside the microorganism of the host microorganism, and the enzyme possessed by the host microorganism on the genome. Enhancing the expression of an enzyme gene by substituting the promoter of the gene with another promoter, and combinations thereof can be mentioned.

“Providing” “activity” in the present invention broadly means that an enzyme gene is introduced from the outside to give a target enzyme activity to a microorganism that cannot find the target enzyme gene. The method of impartation is not particularly limited as long as the activity of the target enzyme is given to the microorganism, and includes transformation with a plasmid carrying the enzyme gene, introduction of the enzyme gene into the genome, and combinations thereof. it can.
The promoter used for “enhancement” or “giving” of “activity” is not particularly limited as long as it can express a gene, but a constitutive promoter or an inducible promoter can be used.

  As a method for determining whether or not the microorganism has the target enzyme gene, for example, KEGG (Kyoto Encyclopedia of Genes and Genomes; http://www.genome.jp/kegg/) or NCBI ( National Center for Biotechnology Information; http://www.ncbi.nlm.nih.gov/gene/) etc., and judging by referring to the gene information of each strain. In the present invention, only the gene information of each strain registered in KEGG or NCBI is used.

  In the present invention, the enzyme activity can be imparted, for example, by introducing a gene encoding the enzyme into the cell from the outside of the host bacterium by gene recombination technology. At this time, the introduced enzyme gene may be derived from any of the same or different cells from the host cell.

  Preparation of genomic DNA necessary for introducing genes from outside the cell into cells, DNA cleavage and ligation, transformation, PCR (Polymerase Chain Reaction), design of oligonucleotides used as primers, synthesis, etc. It can be carried out in the usual way well known to the traders. These methods are described in Sambrook, J. et al. , Et al. "Molecular Cloning A Laboratory Manual, Second Edition", Cold Spring Harbor Laboratory Press, (1989).

  In the present invention, the phrase “by gene recombination technology” or the like means that a change in the nucleotide sequence is caused by the insertion of another DNA into the nucleotide sequence of the native gene, or the substitution, deletion or combination of a part of the gene. Any occurrences may be included, for example, may be obtained as a result of mutation.

  In the present invention, the microorganism in which the activity of the factor or enzyme is inactivated refers to a microorganism in which the native activity is impaired by some method from outside the cell to inside the cell. These microorganisms can be produced, for example, by destroying a gene encoding the protein or enzyme (gene disruption).

  In the present invention, the gene disruption includes a mutation in the base sequence of the gene, insertion of another DNA, and deletion of a certain part of the gene so that the function of the gene cannot be exhibited. Can be mentioned. As a result of gene disruption, for example, the gene cannot be transcribed into mRNA, and the structural gene is not translated. Or, since the transcribed mRNA is incomplete, the amino acid sequence of the translated structural protein is mutated or deleted, and the original function cannot be performed.

The gene-disrupted strain can be produced by any method as long as a disrupted strain that does not express the enzyme or protein is obtained. Various methods of gene disruption have been reported (natural breeding, addition of mutagen, ultraviolet irradiation, radiation irradiation, random mutation, transposon, site-specific gene disruption, etc.), but only certain specific genes can be disrupted. In this respect, gene disruption by homologous recombination is preferable. Homologous recombination techniques are described in J. Bacteriol. 161, 1219-1221 (1985) and J. MoI. Bacteriol. , 177, 1511-1519 (1995), Proc. Natl. Acad. Sci. U. S. A, 97, 6640-6645 (2000), etc., and those methods and applications thereof can be easily implemented by engineers in the same industry.
Hereinafter, the present invention will be described in more detail.

≪DOI generation process≫
The DOI production method of the present invention comprises a natural medium component (a) of 1.0 w / v% or less based on the total medium, and at least one selected from the group consisting of the following component (b) and component (c): Culturing DOI-producing Escherichia coli in a medium containing, and having a DOI production step of producing DOI:
(B) 0.05 w / v% to 0.27 w / v% phytic acid, 0.05% / 0.27 w / v% phytic acid, etc. to the whole medium, etc. Phytic acid component selected from the group consisting of a molar amount of phytic acid hydrolyzate and 0.05 w / v% or more and 0.27 w / v% or less of phytic acid and an equimolar amount of phytic acid salt based on the total medium. ;
(C) Equimolar amounts of 0.01 w / v% to 0.45 w / v% pentose with respect to the whole medium and 0.01 w / v% to 0.45 w / v% with respect to the whole medium A component selected from the group consisting of gluconic acid.

The method for culturing DOI-producing Escherichia coli is not particularly limited as long as it can produce DOI satisfactorily, and examples thereof include palindromic culture, continuous culture, and fed-batch culture.
Palindrical culture refers to a culture method in which a medium is inoculated into a medium and the medium is not added until the end of the culture.
Continuous culture refers to a culture method in which the medium is extracted from the culture container while continuously or intermittently feeding the medium to the culture container being cultured.
The fed-batch culture refers to a culture method in which a medium is fed continuously or intermittently to a culture container being cultured, and the medium is not extracted from the culture container until the end of the culture.
In the DOI production step in the present invention, fed-batch culture or continuous culture reduces osmotic stress on DOI-producing Escherichia coli by lowering the sugar concentration in the culture solution, and continues to provide a fresh medium. This is preferable from the viewpoint of improving production efficiency.

  The culture conditions can be appropriately set depending on the type, amount, culture apparatus, etc. of DOI-producing E. coli to be cultured. For example, the culture temperature is preferably 20 ° C. or higher and 40 ° C. or lower, and more preferably 25 ° C. or higher and 30 ° C. or lower.

  The pressure of the culture tank at the time of culture is preferably normal pressure (0.1 MPa) to 0.5 MPa, and more preferably normal pressure (0.1 MPa) to 0.2 MPa.

The pH of the medium during culture can be adjusted to, for example, pH 4-7. By adjusting the pH of the medium within this range, the DOI production efficiency of DOI-producing E. coli can be improved. More preferably, the pH of the medium is adjusted so that the pH is 5-6.
Although the measurement of pH is not specifically limited, For example, it can be performed with a pH meter (model number: HM-30V, manufactured by Toa DKK Corporation).

  In culturing, it is common to use a culture tank that can control temperature, pH, aeration conditions, stirring speed, etc., but in the DOI production method of the present invention, a culture tank is used for culturing. It is not limited. When culturing using a culture tank, if necessary, seed culture may be performed in advance as a preculture, and this may be inoculated into a medium in a culture tank prepared in advance.

  In culturing, it is not necessary to perform aeration at all, but it is better to perform aeration in order to improve the DOI production efficiency of DOI-producing Escherichia coli. Ventilation does not necessarily require air to pass through the culture medium, and depending on the shape of the culture tank, it also includes upper surface ventilation that allows the air layer above the culture liquid to be ventilated while appropriately stirring the culture liquid. Any gas may be used as long as oxygen-containing gas can flow into it.

When aerated in the culture solution, the dissolved oxygen concentration changes depending on the combination of internal pressure, stirring blade position, stirring blade shape, stirring speed, etc., so the following is an index based on the productivity of DOI and the amount of organic acids other than DOI. The optimum condition can be obtained.
For example, when culturing in a relatively small culture tank such as the culture device BMJ-01 manufactured by ABLE, when using 350 g of the initial culture medium, the air is 0.005 L / min to 2 L / min at normal pressure, the stirring speed Preferred results can be obtained under aeration conditions that can be achieved at 50 rpm to 2000 rpm, more preferably 0.05 L / min to 1 L / min at normal pressure and a stirring speed of 100 rpm to 1000 rpm. However, the ventilation conditions are not limited to this. Further, it is not necessary to keep the above-described aeration conditions constant from the beginning of culture to the end, and aeration may be performed as part of the culture process.

When continuous culture or fed-batch culture is employed as the culture method, a fed-batch medium may be added to the initial medium.
The initial culture medium refers to a medium that is present in the culture vessel when inoculating bacteria and starting culture.
A fed-batch medium refers to a medium fed to a culture vessel or the like during culture. Conditions such as the timing, amount, flow acceleration and the like of adding the fed-batch medium are not particularly limited. For example, when the precultured bacteria are transferred to the initial medium and the main culture is started, a fed-batch medium of 1 w / w% to 300 w / w% with respect to the weight of the initial medium is changed to the weight of the initial medium every hour. Of 0.1 w / w% to 10 w / w%.

In the DOI production method of the present invention, the medium is
1.0% w / v or less natural medium component (a) with respect to the total medium;
At least one selected from the group consisting of the following component (b) and component (c);
Containing.
(B) 0.05 w / v% to 0.27 w / v% phytic acid, 0.05% / 0.27 w / v% phytic acid, etc. to the whole medium, etc. Phytic acid component selected from the group consisting of a molar amount of phytic acid hydrolyzate and 0.05 w / v% or more and 0.27 w / v% or less of phytic acid and an equimolar amount of phytic acid salt based on the total medium. ;
(C) Equimolar amounts of 0.01 w / v% to 0.45 w / v% pentose with respect to the whole medium and 0.01 w / v% to 0.45 w / v% with respect to the whole medium A component selected from the group consisting of gluconic acid.
In addition to these components, the medium may contain an aqueous medium such as water necessary for growth of DOI-producing Escherichia coli, a carbon source, a nitrogen source, inorganic salts, and the like.

  The medium is preferably sterilized and used for culture. The method for sterilizing the medium is not limited as long as the medium can be sterilized without microorganisms having growth ability. Examples of the sterilization method include sterilization methods such as autoclaving (autoclave; for example, heat sterilization at 121 ° C. for 20 minutes) or filtration sterilization (for example, filtration with a filter having a pore diameter of 0.45 μm or 0.2 μm). When there is a concern about the reaction between medium components during heat sterilization, one or more medium components may be sterilized separately from the other medium components, and each may be mixed after sterilization.

<Natural medium component (a)>
The medium in the present invention contains 1.0 w / v% or less of the natural medium component (a) with respect to the total medium.
The natural medium component (a) refers to a component used when preparing a natural medium. Specifically, peptone (derived from milk, animal meat, fish meat, soy protein, etc.), yeast extract, meat extract, malt extract, corn steep liquor, tomato juice, oatmeal, fruit juice, vegetable juice, soy milk, animal milk, skim milk, cereal Ingredients derived from natural products such as enzyme digests of potatoes, beans, seaweed or mushrooms, and molasses. Above all, by using corn steep liquor as a natural medium component, growth of E. coli and DOI productivity culture can be performed efficiently.

It is preferable from the viewpoint that the natural medium component (a) contained in the medium is 1.0 w / v% or less with respect to the total medium, because the number of steps in the DOI purification and recovery process can be suppressed. Moreover, it is more preferable that the natural medium component is 0.6 w / v% or less based on the total medium.
Moreover, it is preferable from a viewpoint of favorable DOI productivity that the natural culture medium component contained in a culture medium is 0.1 w / v% or more with respect to the whole culture medium. In addition, the natural medium component is more preferably 0.3 w / v% or more based on the total medium.
About the range of the content rate of the natural culture medium component contained in a culture medium, it can set suitably combining an upper limit and a lower limit.

Further, the amount of the natural medium component (a) contained in the medium (at the start of main culture) is preferably 0 to 2.2 w / v%, more preferably 0 to 1.8 w / v%. 0 to 1.0 w / v% is more preferable.
When the medium is an initial medium in particular, the amount of the natural medium component (a) contained in the medium (at the start of main culture) is 0.5 w / v% to 1.8 w / v%. Is more preferable.
The amount of the natural medium component (a) in the whole medium is preferably 22 g / L or less because a culture solution with a reduced purification load can be obtained.
In continuous culture or fed-batch culture, the natural medium component (a) can be added to one or both of the initial medium and the fed-batch medium.

Moreover, the culture medium in this invention contains at least 1 sort (s) chosen from the group which consists of the following phytic acid component (b) and component (c) other than a specific amount of natural culture medium component (a).
Phytic acid component (b): 0.05 w / v% or more and 0.27 w / v% or less of phytic acid relative to the whole medium, 0.05 w / v% or more and 0.27 w / v% or less of the whole medium Selected from the group consisting of phytic acid equimolar amounts of phytic acid hydrolyzate and 0.05 w / v% or more and 0.27 w / v% or less of phytic acid to equimolar amounts of phytic acid salt Phytic acid component.
Component (c): 0.01 to 0.45 w / v% pentose with respect to the whole medium, 0.01 to 0.45 w / v% pentose with respect to the whole medium, etc. A component selected from the group consisting of molar amounts of gluconic acid.

<Phytic acid component (b)>
The medium in the present invention is 0.05 w / v% or more and 0.27 w / v% or less of phytic acid relative to the whole medium, and 0.05 w / v% or more and 0.27 w / v% or less of phytin relative to the entire medium It is selected from the group consisting of an equimolar amount of phytic acid hydrolyzate in acid and 0.05 w / v% or more and 0.27 w / v% or less of phytic acid in an equimolar amount of phytic acid salt based on the total medium A phytic acid component (b) can be contained.
Examples of the phytic acid component include phytic acid, a hydrolyzate of phytic acid, and a salt of phytic acid.
Phytic acid is a hexaphosphate ester of myo-inositol and is also called inositol hexakisphosphate. In addition, the mixed salt of magnesium and calcium phytate is extremely insoluble in water and is called phytin. It is abundant in plant seeds and seedlings such as cereals and is known to be the main storage form of phosphate. ing. Phytic acid is hydrolyzed by a kind of phosphatase, phytase, to produce myo-inositol and inorganic phosphate through a six-step reaction in which six phosphates are released one by one.

The hydrolyzate of phytic acid is not particularly limited as long as it is a hydrolyzate of phytic acid, but myo-inositol produced by hydrolyzing phytic acid and free phosphoric acid from the viewpoint of improving the productivity of DOI And a mixture thereof. Moreover, the partial hydrolyzate of the phytic acid which 1-5 phosphoric acid has couple | bonded may be sufficient. In addition, if myo-inositol is a phosphate ester of myo-inositol in which 1 to 5 phosphoric acids are bound to myo-inositol, these are not actually obtained by hydrolysis, but are chemically synthesized or cereals, beans, fruits It may be obtained from an extract from meat, fish or the like.
In the present specification, the hydrolyzate of phytic acid in an equimolar amount to phytic acid means that the number of moles of myo-inositol or its phosphate ester in the hydrolyzate of phytic acid is equal to the number of moles of phytic acid.

The salt of phytic acid refers to phytic acid bound with calcium, magnesium, potassium, sodium, or the like, and a mixed salt of two or more thereof. A salt of phytic acid with a partial hydrolyzate is also included in the phytic acid salt in the present invention.
As the phytic acid component (b), phytic acid, a hydrolyzate of phytic acid, or a salt of phytic acid may be used alone, or two or more thereof may be used in combination.
The phytic acid component (b) is preferably one kind selected from the group consisting of phytic acid, a hydrolyzate of phytic acid, and a salt of phytic acid.
When two or more phytic acid components (b) are used, the total content of the phytic acid component (b) is 0.05 w / v% or more and 0.27 w / v% or less or 0.05 w with respect to the whole medium. It is preferable that the molar amount of phytic acid is not less than / v% and not more than 0.27 w / v%.

The content of phytic acid is preferably 0.02 w / v% or more and 0.30 w / v% or less, and 0.03 w / v% or more and 0.20 w / v% or less with respect to the whole medium. Is more preferably 0.05 w / v% or more and 0.10 w / v% or less.
The content of the hydrolyzate of phytic acid is preferably equimolar to 0.02 w / v% or more and 0.30 w / v% or less of phytic acid, and is 0.03 w / v% with respect to the whole medium. More preferably, it is equimolar to 0.20 w / v% or less of phytic acid, and even more preferably equimolar to 0.05 w / v% or more of 0.10 w / v% or less of phytic acid.
The content of phytic acid salt is preferably equimolar to 0.02 w / v% or more and 0.30 w / v% or less of phytic acid, and is 0.03 w / v% or more and 0 to 0%. More preferably, it is equimolar to 20 w / v% or less of phytic acid, more preferably equimolar to 0.05 w / v% or more and 0.10 w / v% or less of phytic acid.

The content of the phytic acid component is preferably 0.4 mmol / L or more and 5.0 mmol / L or less, more preferably 0.5 mmol / L or more and 3.0 mmol / L or less, and 0.74 mmol / L. More preferably, it is 1.5 mmol / L or less.
The content of the phytic acid component means the total amount of phytic acid, phytic acid hydrolyzate and phytic acid salt contained in the whole medium.
If the content of the phytic acid component is 0.74 mmol / L or more with respect to the whole medium, it is preferable because there is an effect of improving DOI productivity, and if it is 1.5 mmol / L or less, the production cost becomes too high. It is preferable because it is not. In addition, the content of the phytic acid component of 0.74 mmol / L or more and 1.5 mmol / L or less with respect to the whole medium is 0.05 w / v% or more and 0 with respect to the whole medium when converted to the phytic acid content. It falls under 27w / v%.

  In actual production, it is easier and less expensive to procure one kind of raw material than to procure a plurality of raw materials. Therefore, as a phytic acid component, 0.05 w / v% or more and 0.27 w / v% or less of phytic acid with respect to the whole medium, or 0.05 w / v% or more and 0.27 w / v% or less with respect to the whole medium. Either an equimolar amount of phytic acid hydrolyzate in phytic acid, or 0.05 w / v% to 0.27 w / v% of phytic acid in an equimolar amount of phytic acid It is more preferable to contain 1 type.

  When fed-batch culture or continuous culture, the phytic acid component may be added to one or both of the initial culture medium and the feed culture medium. In fed-batch culture, phytic acid may be added to one or both of the initial culture medium and the feed culture medium, but it is more preferable to add to the initial culture medium.

For yeast, phytic acid is known to be a fermentation promoter.
Yeast utilizes myo-inositol produced by hydrolyzing phytic acid with phytase. For yeast, myo-inositol is an indispensable substance that constitutes a major phospholipid as phosphatidylinositol.
J. et al. Biosci. Bioeng. Vol. 98, no. 2,107-113, 2004 shows that the accumulation of myo-inositol in cells increases the phosphatidylinositol content of the cell membrane and makes it ethanol resistant. However, the membrane of E. coli does not contain phosphatidylinositol. Bacteriol. Vol. 177, no. 10, 2926-2928, 1995 shows that wild-type Escherichia coli cannot synthesize phosphatidylinositol even if myo-inositol is added to the medium, and the effect that phytic acid has on yeast is shown. Is not expected to be obtained.

<Pentose and / or gluconic acid>
The medium in the present invention is a pentose of 0.01 w / v% or more and 0.45 w / v% or less of the whole medium and a pentose of 0.01 w / v% or more and 0.45 w / v% or less of the whole medium. A component (c) selected from the group consisting of equimolar amounts of gluconic acid can be contained.
The pentose that can be used in the DOI production method of the present invention is not particularly limited as long as it can be metabolized by the pentose phosphate pathway of Escherichia coli. Specific examples include D-xylose, L-arabinose, D-ribose and the like.

The content of pentose in the whole medium is preferably 0.01 w / v% or more and 0.45 w / v% or less, and 0.02 w / v% or more and 0.10 w / v% or less with respect to the whole medium. More preferably, it is 0.02 w / v% or more and 0.05 w / v% or less.
In addition, the content rate of pentose means the total amount of D-xylose, L-arabinose, D-ribose, etc. which are contained in the whole culture medium.

The content of gluconic acid in the entire medium is preferably equimolar to the pentose of 0.01 w / v% or more and 0.45 w / v% or less, and 0.02 w / v% or more and 0 More preferably, it is equimolar to a pentose of 10 w / v% or less, and more preferably equimolar to a pentose of 0.02 w / v% or more and 0.05 w / v% or less.
In the present invention, “gluconic acid” includes gluconate such as sodium gluconate, potassium gluconate and calcium gluconate in addition to gluconic acid.
In addition, the content rate of gluconic acid means the total amount of gluconic acid, sodium gluconate, potassium gluconate, calcium gluconate, etc. which are contained in the whole culture medium.
Any one type of pentose and / or gluconic acid may be used alone, or two or more types may be used in combination.
When pentose and gluconic acid are used in combination, the total content of pentose and gluconic acid is preferably 0.01 w / v% or more and 0.45 w / v% or less with respect to the entire medium, and 0.02 w / v % Or more and 0.10 w / v% or less is more preferable, and 0.02 w / v% or more and 0.05 w / v% or less is more preferable.

In fed-batch culture or continuous culture, pentose and / or gluconic acid may be added to one or both of the initial medium and the fed-batch medium. When fed-batch culture is performed, pentose and / or gluconic acid may be added to one or both of the initial medium and the fed-batch medium, but more preferably added to the fed-batch medium. As the pentose used in the present invention, those metabolized by the pentose phosphate pathway of Escherichia coli such as D-xylose and L-arabinose can be used.
The concentration of pentose and / or gluconic acid in the fed-batch medium is preferably 0.02 w / v% or more, more preferably in the range of 0.03 w / v% to 1.00 w / v%, in terms of pentose concentration. The range of 0.04 w / v% to 0.10 w / v% is more preferable.

  DOI-producing E. coli has reduced or inactivated activity of Zwf and cannot send glucose to the pentose phosphate pathway, but Metabolic Engineering Vol. 6, pp 164-174, 2004 reveals that zwf-disrupted E. coli can grow in the same manner as the original E. coli even in a minimal medium by activating the tricarboxylic acid cycle. However, surprisingly, in DOI-producing E. coli, DOI productivity is greatly increased by adding D-xylose, L-arabinose or gluconic acid to a fed-batch medium at a low concentration of 0.05 w / v%. Improved.

  The medium in the present invention comprises a specific amount of a natural medium component (a), 0.05 w / v% or more and 0.27 w / v% or less of phytic acid relative to the whole medium, 0.05 w / v relative to the whole medium. % To 0.27 w / v% phytic acid in equimolar amounts of phytic acid hydrolyzate and 0.05 w / v% to 0.27 w / v% phytic acid in equimolar amounts with respect to the whole medium A phytic acid component (b) selected from the group consisting of salts of phytic acid, pentose of 0.01 w / v% or more and 0.45 w / v% or less of the whole medium and 0.01 w / v of the whole medium It is preferable from a viewpoint of DOI productivity improvement to contain the component (c) chosen from the group which consists of equimolar amounts of gluconic acid in pentose of v% or more and 0.45 w / v% or less.

  When combining the phytic acid component and the pentose, the content ratio of the phytic acid component and the pentose in the whole medium (phytic acid component: pentose) is 0.9: 1 to 6.8: 1 on a mass basis. Is preferable from the viewpoint of DOI productivity. The content ratio of the phytic acid component and the pentose in the whole medium (phytic acid component: pentose) is more preferably 1: 1 to 4: 1 on a mass basis, and 1.2: 1 to 3.5. More preferably, the ratio is 1.

  When combining a phytic acid component with pentose and / or gluconic acid, the content ratio of the phytic acid component and pentose and / or gluconic acid in the whole medium (phytic acid component: pentose and / or gluconic acid) is based on a substance amount. In view of DOI productivity, 0.2: 1 to 1.8: 1 is preferable. In addition, the content ratio of the phytic acid component and the pentose and / or gluconic acid in the whole medium (phytic acid component: pentose and / or gluconic acid) is 0.3: 1 to 1.6: 1 based on the amount of substance. More preferably, it is more preferably 0.4: 1 to 0.9: 1.

<Other carbon sources>
Normally, a carbon source other than pentose or gluconic acid (hereinafter also referred to as “other carbon source”) is required for DOI raw materials, growth of E. coli, and the like. The medium used in the production method of the present invention can contain other carbon sources in addition to the above-mentioned natural medium component (a) and phytic acid component (b) and / or component (c).
Other carbon sources include sucrose, starch, D-glucose, D-fructose and the like. Among these, glucose is preferable as the other carbon source from the viewpoint of sugar as a raw material for DOI. When a bacterium having a sucrose hydrolase gene (cscA) is used, sucrose can also be preferably used.

<Other ingredients>
The medium in the present invention is an aqueous medium such as water necessary for the growth of DOI-producing Escherichia coli in addition to the above-mentioned natural medium component (a) and phytic acid component (b) and / or pentose or gluconic acid (component (c)). You may contain an antifoamer etc. for preventing foaming of the culture medium during culture, such as a medium, a nitrogen source, inorganic salts, and vitamins. Inorganic salts, vitamins, and the like may be included as necessary as long as they are suitable for the growth of E. coli. Examples of the medium containing inorganic salts and vitamins include, but are not limited to, a composition such as a known M9 medium.

When DOI-producing Escherichia coli is fed-batch culture or continuous culture, the sugar as a carbon source may be added to the initial medium or may be added to the feed medium.
When adding sugar to the initial medium, it is preferable to add it at a concentration that does not cause osmotic stress on E. coli. Alternatively, without adding to the initial medium, sugar is added to the fed-batch medium to a concentration of 25 w / v% to 50 w / v% of the fed-batch medium, and fed-batch is started simultaneously with the start of the main culture. It is preferable to do. By adding sugar to the feed medium, osmotic stress applied to the DOI-producing Escherichia coli is reduced, and good productivity can be obtained.

Nitrogen sources include nitrogen atom-containing components, ammonium chloride, ammonium sulfate, ammonium acetate, phosphoric acid derived from natural products (microorganisms, plants, animal milk, animal meat, etc.) that are 1.0 w / v% or less based on the total medium. Inorganic acids such as ammonium or ammonium salts of organic acids, ammonia, other amino acids, nitrogen compounds and the like can be mentioned.
A person skilled in the art can appropriately set the type and amount of the nitrogen source.
As the inorganic salts, phosphates, magnesium salts, calcium salts, iron salts, manganese salts, sulfates and the like are used. For example, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, zinc sulfate, cobalt sulfate, sodium molybdate, boric acid, copper sulfate, potassium iodide, or carbonic acid Examples include calcium. These inorganic salts may be used alone or in a combination of two or more. The concentration of inorganic salts in the medium is usually about 0.001 to 1.0% (wt), although it varies depending on the inorganic salt used.
Furthermore, vitamins can also be included as needed. Examples of vitamins include biotin, thiamine (vitamin B1), pyridoxine (vitamin B6), pantothenic acid, nicotinic acid and the like.

  A person skilled in the art can also appropriately set the type and amount of other components added to the medium. In addition, it is preferable to add a small amount of a few components because the purification load at the time of DOI recovery is expected to be small.

<2-deoxy-siro-inosose (DOI) producing E. coli>
In the present invention, examples of the DOI-producing Escherichia coli include Escherichia coli provided with the ability to fermentatively produce DOI from a carbon source. Here, the carbon source is preferably sugar. Further, as the DOI-producing E. coli, a recombinant E. coli having improved DOI production activity by enhancing, inactivating, reducing or combining these enzyme activities involved in the DOI production activity of E. coli by genetic recombination is used. It is preferable.

  Examples of the recombinant Escherichia coli having improved DOI production activity include the recombinant Escherichia coli described in International Publication No. 2010/053052.

  Specifically, as the DOI-producing E. coli, a recombinant E. coli comprising the following gene recombination (i) and one or more gene recombination selected from the following (ii) to (iii) is preferable. In addition, recombinant E. coli further comprising the following gene recombination (iv) is more preferable because DOI can be produced from sucrose. Furthermore, recombinant Escherichia coli further comprising the gene recombination of (v) below is more preferable because it can promote glucose uptake and improve DOI productivity.

(I) Genetic recombination that imparts or enhances DOI synthase (BtrC) activity.
(Ii) Genetic recombination that inactivates or reduces the phosphoglucose isomerase (Pgi) activity originally possessed by E. coli.
(Iii) Genetic recombination that inactivates or reduces the glucose-6-phosphate dehydrogenase (Zwf) activity originally possessed by E. coli.
(Iv) Genetic recombination imparted with sucrose hydrolase (CscA) activity.
(V) Genetic recombination imparted with glucose transport promoting protein (Glf) activity.

BtrC in (i) means a general term for enzymes that catalyze a reaction for producing DOI from glucose-6-phosphate. In the DOI-producing Escherichia coli according to the present invention, BtrC is preferably derived from a genus Bacillus, a bacterium belonging to the genus Streptomyces, or derived from Paenibacillus, from the viewpoint of high enzyme activity.
Pii of (ii) is classified into enzyme number 5.3.1.9 based on the report of the International Biochemical Union (I.B.) Enzyme Committee, and glucose-6-phosphate to fructose-6--6. A generic term for enzymes that reversibly catalyze isomerization to phosphoric acid.
Zwf in (iii) is classified into enzyme number 1.1.1.149 according to the report of the International Biochemical Union (I.U.B) Enzyme Committee, and glucose-6--6 using NADP ⁺ as a coenzyme. A generic term for enzymes that catalyze the dehydrogenation of phosphoric acid to 6-phosphoglucono-1,5-lactone.
(Iv) CscA is classified into enzyme number 3.2.1.26 according to the report of the International Biochemical Union (I.U.B) Enzyme Committee, and produces D-glucose and D-fructose from sucrose. It is a generic term for enzymes that catalyze hydrolysis reactions.
Glf in (v) refers to a glucose transport protein derived from Zymomonas bacteria that transports extracellular D-glucose into the cell.

  Specifically, the gene recombination that imparts or enhances DOI synthase (BtrC) activity may be any gene recombination that introduces a gene encoding 2-deoxy-siro-inosose synthase (BtrC) into E. coli. Thereby, the DOI production capability of Escherichia coli is imparted or enhanced.

The gene recombination imparted with sucrose hydrolase (CscA) activity may be a gene recombination that specifically introduces a gene encoding CscA into Escherichia coli. Thereby, since the kind of raw material which gene-recombinant Escherichia coli can utilize is increased, it is estimated that the DOI production capability of Escherichia coli is strengthened.
Specifically, the genetic recombination imparted with the glucose transport promoting protein (Glf) activity may be any genetic recombination that introduces a gene encoding Glf into E. coli. This enhances the DOI production capacity of E. coli.

DOI synthase is an enzyme that produces DOI using glucose-6-phosphate as a substrate. Therefore, DOI-producing Escherichia coli uses DOI-producing Escherichia coli that has been genetically modified to inactivate or reduce the activities of phosphoglucose isomerase (Pgi) and glucose-6-phosphate dehydrogenase (Zwf). This is preferable because DOI can be efficiently produced from glucose.
In this case, the DOI-producing Escherichia coli cannot use D-glucose as an energy source. Therefore, DOI can be satisfactorily produced by adding sugar as an energy source in addition to D-glucose to the medium. Examples of sugars that serve as an energy source other than D-glucose include D-fructose and D-mannose.
In addition, by introducing a gene encoding sucrose hydrolase (CscA) by gene recombination, DOI-producing Escherichia coli can hydrolyze sucrose, which is preferable. Specifically, DOI-producing Escherichia coli having a gene encoding sucrose hydrolase (CscA) may convert D-glucose, which is a hydrolysis product of sucrose, into DOI, and use D-fructose as an energy source. This is preferable because it becomes possible.
Sucrose is a sugar obtained from sugarcane, sugar beet, etc., and crude sugar or waste molasses containing sucrose is an important biomass material such as a raw material for bioethanol. Escherichia coli K12-derived strains, B-derived strains, etc. cannot originally hydrolyze sucrose, but genetically modified Escherichia coli introduced with a gene encoding sucrose hydrolase (CscA) produces DOI using raw sugar and molasses as raw materials. This is preferable because it becomes possible.

Furthermore, the DOI-producing Escherichia coli according to the present invention has an inherent phosphoglucose isomerase (Pgi) from the viewpoint of improving DOI productivity and improving DOI productivity that enables production from raw materials containing sucrose such as crude sugar and molasses. ) And glucose-6-phosphate dehydrogenase (Zwf) are inactivated or reduced, and more preferably a DOI-producing E. coli having a gene encoding sucrose hydrolase (CscA).
Further, by incorporating a gene encoding a glucose transport promoting protein (Glf) into DOI-producing Escherichia coli by genetic recombination, phosphoenolpyruvate is no longer required when glucose is taken into cells, and glucose uptake is promoted. It is preferable because productivity is improved.
In addition, the inoculation amount, the inoculation method, and the like of the DOI-producing E. coli medium are not particularly limited.

≪DOI purification and recovery process≫
The DOI production method of the present invention has a DOI purification and recovery step of purifying and recovering the produced 2-deoxy-siro-inosose from the medium.

The purification and recovery step recovers the DOI obtained in the DOI production step, and is generally performed by purifying and recovering the DOI accumulated in the culture from the culture.
The culture in the present invention is a product obtained by culture, and specifically includes a culture medium, cultured DOI-producing E. coli, DOI produced by DOI-producing E. coli, and the like.
Moreover, a culture solution etc. are mentioned as an example of a culture.

As a method for purifying and recovering DOI from a culture, for example, a conventionally known method can be used from a culture solution. For example, after microbial cells are removed by centrifugation or the like, the culture supernatant is treated with activated carbon to remove proteins, polymer components, etc., and the treatment solution is added to an ion exchange resin and eluted with distilled water. Further, fractions not containing impurities can be collected while measuring refractive index, pH, conductivity, etc., and the aqueous solution can be removed to recover DOI.
According to the present invention, the amount of activated carbon or the amount of ion exchange resin used in the DOI purification and recovery step can be reduced by reducing the purification load.

<2-deoxy-shiro-inosose>
The DOI of the present invention comprises 1.0% w / v or less natural medium component (a) relative to the whole medium, 0.05% w / v to 0.27w / v% phytic acid relative to the total medium, Equal molar amount of phytic acid hydrolyzate to 0.05 w / v% or more and 0.27 w / v% or less of phytic acid and 0.05 w / v% to 0.27 w / A phytic acid component (b) selected from the group consisting of equimolar amounts of a phytic acid salt to v% or less of phytic acid, and 0.01 w / v% or more and 0.45 w / v% or less of the whole medium At least one selected from the group consisting of component (c) selected from the group consisting of pentose of 0.01 w / v% or more and 0.45 w / v% or less of pentose and equimolar amounts of gluconic acid with respect to the whole medium. , 2-deoxy-shiro-inosose It is obtained by a method for producing 2-deoxy-siro-inosose, which comprises culturing production Escherichia coli to produce 2-deoxy-siro-inosose and recovering the produced 2-deoxy-siro-inosose from the medium. .
For each DOI production process, the description of each process described in the above-described DOI production method is cited.

  Hereinafter, the present invention will be described in detail with reference to examples. However, the present invention is not limited to them. Unless otherwise specified, “%” means w / v%.

(Production example)
A DOI-producing E. coli strain, BΔpgiΔzwf / pGAP-btrC-cscA-glf strain was prepared in the same manner as described in the pamphlet of International Publication No. 2010/053052.

[Production Example 1]
<Cloning of the vicinity of Escherichia coli pgi gene>
The entire base sequence of the genomic DNA of Escherichia coli B strain is known (GenBank accession number CP000819), and the base sequence of a gene encoding phosphoglucose isomerase of Escherichia coli (hereinafter sometimes referred to as pgi) has also been reported. Yes. In order to clone the region near the base sequence of pgi (1,650 bp), CAGGAATTCG CTATATCTGGG CTCTGCACG (SEQ ID NO: 1), CAGTCTAGAG CAATACTCTT CTGATTGCGA (SEQ ID NO: 2), CAGTCTAGCATCGTGTC Four types of oligonucleotide primers having the base sequence of 4) were synthesized. The primer of SEQ ID NO: 1 has an EcoRI recognition site on the 5 ′ end side, the primers of SEQ ID NOS: 2 and 3 have an XbaI recognition site on the 5 ′ end side, and the primer of SEQ ID NO: 4 has a PstI recognition site on the 5 ′ end side. Have.

  Genomic DNA of Escherichia coli B strain was prepared by the method described in Current Protocols in Molecular Biology (JohnWiley & Sons). Using the obtained genomic DNA as a template, a combination of a primer having the base sequence of SEQ ID NO: 1 and a primer having the base sequence of SEQ ID NO: 2, and a primer having the base sequence of SEQ ID NO: 3 and the base sequence of SEQ ID NO: 4 A DNA fragment of about 1.0 kb (hereinafter sometimes referred to as a pgi-L fragment and a pgi-R fragment) was amplified by performing PCR under normal conditions in combination with the primers. These DNA fragments were separated and collected by agarose electrophoresis. The pgi-L fragment was digested with EcoRI and XbaI and the pgi-R fragment was digested with XbaI and PstI, respectively. The two digested fragments were mixed with EcoRI and PstI digests of the temperature sensitive plasmid pTH18cs1 (GenBank accession number AB019610), reacted with T4 DNA ligase, and transformed into Escherichia coli DH5α competent cell (manufactured by Takara Bio Inc.). After conversion, a plasmid containing two fragments, the 5 ′ upstream vicinity fragment and the 3 ′ downstream vicinity fragment of pgi, was obtained. The resulting plasmid was named pTHΔpgi.

[Production Example 2]
<Preparation of Escherichia coli BΔpgi strain>
The plasmid pTHΔpgi obtained in Production Example 1 was transformed into Escherichia coli B strain, and cultured overnight on an LB agar plate containing 10 μg / ml chloramphenicol at 30 ° C. where the cells can hold a temperature-sensitive plasmid. A conversion was obtained. The obtained transformant was cultured in LB medium at 30 ° C. for 3 hours to overnight. Then, it diluted with the LB liquid culture medium or the physiological saline, and apply | coated on the LB agar plate containing chloramphenicol 10microgram / ml. This LB agar plate was cultured at 42 ° C. where a temperature-sensitive plasmid could not be maintained, and the grown transformant was obtained as a strain in which the entire length of the plasmid was integrated into the Escherichia coli chromosome by extrachromosomal-chromosomal homologous recombination.

Genomic DNA was obtained from this strain, PCR was performed using this as a template, and the presence of the chloramphenicol resistance gene of pTH18cs1 on the chromosome, as well as the 5 ′ upstream vicinity region of pgi, and 3 ′ downstream The presence of a region homologous to each of the neighboring regions on the chromosome confirmed that the entire plasmid was a strain integrated into the Escherichia coli chromosome.
A strain in which the entire length of the plasmid was incorporated into the Escherichia coli chromosome was planted in a 100 ml baffled flask containing 20 ml of LB liquid medium not containing chloramphenicol, and this was cultured with shaking at 30 ° C. for 4 hours. This culture solution was diluted with an LB liquid medium not containing chloramphenicol and spread on an LB agar medium not containing chloramphenicol. 96 colonies grown at 42 ° C. were randomly selected and grown on LB agar medium containing no chloramphenicol or LB agar medium containing chloramphenicol, Chloramphenicol sensitive strains were selected.
Furthermore, genomic DNA was obtained from the selected strain, PCR was performed using this as a template, a strain lacking pgi was selected, and this was designated as a BΔpgi strain.

[Production Example 3]
<Cloning of the vicinity region of the Escherichia coli zwf gene>
The base sequence of a gene encoding glucose-6-phosphate dehydrogenase of Escherichia coli (hereinafter sometimes referred to as zwf) has also been reported. In order to clone the region near the base sequence of zwf (1,476 bp), CAGGAATTCA TGCGTTGCAG CACGATATC (SEQ ID NO: 5), CAGTCTAGAT AACCCCGGTAC TTAAGCCAG (SEQ ID NO: 6), CAGTCTAGGCTGTACTGTCTGTCTGTCTGTCTGTCTGTCTGTCTG Four kinds of oligonucleotide primers having the base sequence of) were synthesized. The primer of SEQ ID NO: 5 has an EcoRI recognition site on the 5 ′ end side, the primers of SEQ ID NOS: 6 and 7 have an XbaI recognition site on the 5 ′ end side, and the primer of SEQ ID NO: 8 has a PstI recognition site on the 5 ′ end side. Have.

  A combination of a primer having the base sequence of SEQ ID NO: 5 and a primer having the base sequence of SEQ ID NO: 6, and a primer having the base sequence of SEQ ID NO: 7 and SEQ ID NO: 8 using the genomic DNA of Escherichia coli B strain as a template By performing PCR under normal conditions in combination with a primer having a base sequence, a DNA fragment of about 0.85 kb (hereinafter sometimes referred to as zwf-L fragment) and about 1.0 kb (hereinafter referred to as zwf-R) are obtained. The DNA fragment (sometimes referred to as a fragment) was amplified. These DNA fragments were separated and collected by agarose electrophoresis. The zwf-L fragment was digested with EcoRI and XbaI and the zwf-R fragment was digested with XbaI and PstI, respectively. The two digested fragments were mixed with EcoRI and PstI digests of the temperature sensitive plasmid pTH18cs1, reacted with T4 DNA ligase, transformed into Escherichia coli DH5α competent cell (manufactured by Takara Bio Inc.), and zwf A plasmid containing two fragments, a 5 ′ upstream vicinity fragment and a 3 ′ downstream vicinity fragment, was obtained. The resulting plasmid was named pTHΔzwf.

[Production Example 4]
<Preparation of Escherichia coli BΔpgiΔzwf strain>
The plasmid pTHΔzwf obtained in Production Example 3 is transformed into the Escherichia coli BΔpgi strain obtained in Production Example 2, and an LB agar plate containing 10 μg / ml of chloramphenicol at 30 ° C. where the cells can hold a temperature-sensitive plasmid. The above was cultured overnight to obtain a transformant. The obtained transformant was cultured at 30 ° C. from LB medium for 3 hours to overnight, diluted with LB liquid medium or physiological saline, and coated on an LB agar plate containing 10 μg / ml of chloramphenicol. This LB agar plate was cultured at 42 ° C. where a temperature-sensitive plasmid could not be maintained, and the grown transformant was obtained as a strain in which the entire length of the plasmid was integrated into the Escherichia coli chromosome by extrachromosomal-chromosomal homologous recombination.

Genomic DNA was obtained from this strain, PCR was performed using this as a template, and the chloramphenicol resistance gene of pTH18cs1 was present on the chromosome, and the region near the 5 ′ upstream of zwf and 3 ′ downstream The presence of a region homologous to each of the neighboring regions on the genome confirmed that the entire plasmid length was integrated into the Escherichia coli chromosome.
A strain in which the entire length of the plasmid was incorporated into the Escherichia coli chromosome was planted in a 100 ml baffled flask containing 20 ml of LB liquid medium not containing chloramphenicol, and this was cultured with shaking at 30 ° C. for 4 hours. This culture solution was diluted with an LB liquid medium not containing chloramphenicol and spread on an LB agar medium not containing chloramphenicol. 96 colonies grown at 42 ° C. were randomly selected and grown on LB agar medium containing no chloramphenicol or LB agar medium containing chloramphenicol, Chloramphenicol sensitive strains were selected.
Further, genomic DNA was obtained from the selected strain, PCR was performed using this as a template, a strain lacking zwf was selected, and this was designated as BΔpgiΔzwf strain.

[Production Example 5]
<Construction of DOI synthase gene (btrC) expression vector under GAPDH promoter control>
The base sequence of the GAPDH gene of Escherichia coli has already been reported. To obtain the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter, CGAGCTACAT ATGCAATGAT TGACACGATT CCG (SEQ ID NO: 9) and CCAAGCTTTCT CGAGGTCGAC GGATCCGAGC TCAGCTATTTT GTTAGGAGA Primer nucleotide sequence AAAAGG did. The primer of SEQ ID NO: 9 has an NdeI recognition site on the 5 ′ end side, and the primer of SEQ ID NO: 10 has a HindIII, XhoI, SalI, BamHI, and SacI recognition site in this order from the 5 ′ end side.
Using the genomic DNA of the Escherichia coli B strain as a template together with the above two types of primers, PCR was performed under normal conditions to amplify the DNA fragment. The obtained DNA fragment was digested with restriction enzymes NdeI and HindIII to obtain a fragment encoding the GAPDH promoter of about 100 bp. Next, the above DNA fragment was mixed with the Escherichia coli DH5α competent cell (manufactured by Takara Bio Inc.) after mixing with the above-mentioned DNA fragment and the cloning vector pBR322 (GenBank accession number J01749) digested with NdeI and HindIII and using ligase. To obtain transformants that grow on LB agar plates containing 50 μg / mL of ampicillin. The obtained colony was cultured overnight at 30 ° C. in an LB liquid medium containing 50 μg / mL of ampicillin, and the plasmid was recovered from the obtained cells. This plasmid was named pGAP.

The base sequence of the DOI synthase gene (btrC) possessed by Bacillus circulans has already been reported (GenBank accession number AB097196). In order to obtain the btrC gene, oligonucleotide primers having the base sequences of CACTGGAGCT CCGTGGGTGGA ATATAGACG ACTAAAACAA TTTG (SEQ ID NO: 11) and CAGGATCCTT ACAGCCCTTC (SEQ ID NO: 12) were respectively synthesized. The primer of SEQ ID NO: 11 has a SacI recognition site and a 13-base GAPDH gene ribosome binding sequence in this order from the 5 ′ end. The primer of SEQ ID NO: 12 has a BamHI recognition site on the 5 ′ end side.
A PCR method was performed under normal conditions using the Bacillus circulans genomic DNA as a template together with the above two types of primers, and the obtained DNA fragment was digested with restriction enzymes SacI and BamHI to obtain an about 1.1 kbp DOI synthase gene (btrC). ) Fragment was obtained. This DNA fragment was mixed with a fragment obtained by digesting plasmid pGAP with restriction enzymes SacI and BamHI, ligated with ligase, and then transformed into Escherichia coli DH5α competent cell (manufactured by Takara Bio Inc.). A transformant that grew on an LB agar plate containing 50 μg / mL of ampicillin was obtained. The obtained colony was cultured overnight at 30 ° C. in an LB liquid medium containing 50 μg / mL of ampicillin, and the plasmid pGAP-btrC was recovered from the obtained bacterial cells to construct a DOI synthase gene (btrC) expression vector. .

[Production Example 6]
<Construction of DOI synthase gene (btrC) and sucrose hydrolase gene (cscA) expression vectors under the control of the GAPDH promoter>
The base sequence of the sucrose hydrolase gene (cscA) possessed by Escherichia coli O-157 has already been reported. That is, it is described in the Escherichia coli O-157 strain genome sequence described in GenBank accession number AE005174, 3274383-3275816. In order to obtain the cscA gene, oligonucleotide primers having the base sequences of GCGGATCGCC TGGTGGAATA TATGACGCAA TCTCGATTGC (SEQ ID NO: 13) and GACGCGTCGA CTTAACCCAG TTGCCAGAGT GC (SEQ ID NO: 14) were synthesized. The primer of SEQ ID NO: 13 has a BamHI recognition site and a 13-base GAPDH gene ribosome binding sequence in this order from the 5 ′ end. The primer of SEQ ID NO: 14 has a SalI recognition site on the 5 ′ end side.

  A PCR method is performed under normal conditions using the above two primers together with the genomic DNA of Escherichia coli O-157 strain (SIGMA-ALDRICH: IRMM449) as a template, and the resulting DNA fragment is digested with restriction enzymes BamHI and SalI. The sucrose hydrolase gene (cscA) fragment of about 1.4 kbp was obtained. This DNA fragment and the fragment obtained by digesting plasmid pGAP-btrC with restriction enzymes BamHI and SalI were mixed, ligated with ligase, and transformed into Escherichia coli DH5α competent cell (manufactured by Takara Bio Inc.). Thus, a transformant that grew on an LB agar plate containing 50 μg / mL of ampicillin was obtained. The obtained colony was cultured overnight at 30 ° C. in an LB liquid medium containing 50 μg / mL of ampicillin, and the plasmid pGAP-btrC-cscA was recovered from the obtained bacterial cells to obtain DOI synthase gene (btrC) and sucrose hydrolysate. A degrading enzyme gene (cscA) expression vector was constructed.

[Production Example 7]
<Construction of DOI synthase gene (btrC), sucrose hydrolase gene (cscA) and glucose transport promoting protein gene (glf) expression vectors under the control of GAPDH promoter>
The nucleotide sequence of the glucose transport promoting protein gene (glf) possessed by Zymomonas mobilis has already been reported (GenBank accession number M60615). In order to obtain the glf gene, oligonucleotide primers having the base sequences of CCTGTCGACG CTGGTGGAAT ATATGAGTTC TGAAAGTAGT CAGG (SEQ ID NO: 15) and CTACTCGAGC TACTTCTGGG (AGCGCCCACA (SEQ ID NO: 16)) were synthesized. The primer of SEQ ID NO: 15 has a SalI recognition site and a 13-base GAPDH gene ribosome binding sequence in this order from the 5 ′ end. The primer of SEQ ID NO: 16 has an XhoI recognition site on the 5 ′ end side.

  A PCR method was performed under normal conditions using Zymomonas mobilis genomic DNA as a template together with the above two primers, and the obtained DNA fragment was digested with restriction enzymes SalI and XhoI to give a glucose transport-promoting protein gene of about 1.4 kbp ( glf) fragment was obtained. This DNA fragment was mixed with a fragment obtained by digesting plasmid pGAP-btrC-cscA with restriction enzymes SalI and XhoI, ligated with ligase, and then transferred to Escherichia coli DH5α competent cell (manufactured by Takara Bio Inc.). The transformant was obtained by transforming and growing on an LB agar plate containing 50 μg / mL of ampicillin. The obtained colony was cultured overnight at 30 ° C. in an LB liquid medium containing 50 μg / mL of ampicillin, and the plasmid pGAP-btrC-cscA-glf was recovered from the obtained bacterial cells to obtain a DOI synthase gene (btrC), Sucrose hydrolase gene (cscA) and glucose transport promoting protein gene (glf) expression vectors were constructed.

[Production Example 8]
<Introduction of pGAP-btrC-cscA-glf into BΔpgiΔzwf strain>
The plasmid pGAP-btrC-cscA-glf was transformed into the BΔpgiΔzwf strain and cultured overnight on an LB agar plate containing 50 μg / mL of ampicillin at 37 ° C. to obtain a BΔpgiΔzwf / pGAP-btrC-cscA-glf strain.

[Comparative Example 1] DOI production under the conditions that the CSL concentration of the initial culture medium is 1% and the CSL concentration of the fed-batch medium is 0%. LB Broth, Miller culture solution (Difco 244620) in a 500 mL baffled Erlenmeyer flask as a pre-culture The BΔpgiΔzwf / pGAP-btrC-cscA-glf strain was inoculated and stirred and cultured at 28 ° C. and 120 rpm for 16 hours.
A 1-L culture tank (culture device BMJ-01 manufactured by ABLE) containing 350 g of the initial medium (CSL-reducing medium) having the composition shown in Table 1 is sterilized, and 20 mL of the preculture solution is transferred to the culture medium (main culture). Started. With the start of culture, a fed-batch medium having the composition shown in Table 2 was fed at a rate of 0.1 g / min. The fed-batch medium was prepared by separately sterilizing a glucose solution, a fructose solution, a solution containing potassium dihydrogen phosphate, ammonium sulfate, and sodium chloride, a magnesium sulfate solution, a calcium chloride solution, and a thiamine hydrochloride solution, respectively. It was prepared by mixing so as to have a composition. Cultivation was performed at atmospheric pressure for 48 hours at an aeration rate of 0.5 L / min, a stirring speed of 800 rpm, a culture temperature of 28 ° C., and a pH of 5.0 (adjusted with a 12.5 v / v% ammonia solution).
After completion of the culture, the amount of DOI accumulated in the obtained culture broth was measured by HPLC according to a standard method (column: ULTRON PS-80H (Shinwa Kako), eluent: perchloric acid aqueous solution (pH = 2.1), flow rate 1 0.0 mL / min). The DOI accumulation concentration at 48 hours was 46 g / L.

[Example 1] DOI production by adding phytic acid to the initial medium Comparative Example except that phytic acid was added to the initial medium having the composition shown in Table 1 so that the concentration was 0.14 w / v% (2.11 mmol / L). The culture and the DOI accumulation amount were measured in the same manner as in 1. The accumulated DOI concentration at 48 hours was 66 g / L.

[Example 2] D-xylose added to fed-batch medium to produce DOI As in Comparative Example 1, except that D-xylose was added to the fed-batch medium having the composition shown in Table 2 at 0.05 w / v%. Culture and DOI accumulation were measured. The DOI accumulation concentration at 48 hours was 58 g / L.

[Example 3] Production of DOI by adding phytic acid to the initial culture medium and D-xylose to the fed-batch medium. Addition of phytic acid to the initial culture medium having the composition shown in Table 1 to 0.14 w / v%, The culture and the DOI accumulation amount were measured in the same manner as in Comparative Example 1 except that D-xylose was added to the fed-batch medium having the composition of 2 so that the concentration was 0.05 w / v%. The accumulated DOI concentration at 48 hours was 72 g / L.

[Reference Example 1] Production of DOI under conditions where the CSL concentration of the initial medium and fed-batch medium is 3 w / v% The initial medium having the composition shown in Table 3 and the fed-batch medium having the composition shown in Table 4 were used, and the culture was carried out at pH 5.4. The culture and the amount of DOI accumulation were measured in the same manner as in Comparative Example 1 except that the measurement was performed. The accumulated DOI concentration at 48 hours was 68 g / L.

The results of Comparative Example 1, Examples 1 to 3 and Reference Example 1 are shown in Table 5.
When DOI-producing Escherichia coli was fed and cultured in an initial culture medium having a CSL concentration of 1 w / v% and a fed-batch medium that does not use CSL, the DOI productivity decreased, but phytic acid was fed into the initial medium or D-xylose was fed. It was confirmed that by adding to the medium, productivity equivalent to that produced when the CSL concentration of the initial medium and the fed-batch medium was 3 w / v% was obtained.

[Example 4] Production of DOI by adding phytic acid to fed-batch medium Cultured in the same manner as Comparative Example 1 except that phytic acid was added to the fed-batch medium having the composition shown in Table 2 so that the concentration was 0.14 w / v%. And the DOI accumulation amount was measured. The DOI accumulation concentration at 48 hours was 55 g / L.
It was confirmed that phytic acid can obtain a greater effect when added to the initial culture medium than when added to the feed medium.

[Example 5] Phytic acid and D-xylose are added to the initial medium to produce DOI. The initial medium having the composition shown in Table 1 has phytic acid and 0.05 w / v% so as to be 0.14 w / v%. Thus, culture | cultivation and the measurement of DOI accumulation amount were performed like the comparative example 1 except having added D-xylose. The accumulated DOI concentration at 48 hours was 68 g / L.
It was confirmed that D-xylose had a greater effect when added to the feed medium.

[Example 6] DOI production by adding L-arabinose to fed-batch medium The same as Comparative Example 1 except that L-arabinose was added to the fed-batch medium having the composition shown in Table 2 at 0.05 w / v%. The culture and the amount of accumulated DOI were measured. The DOI accumulation concentration at 48 hours was 50 g / L.
Similar to D-xylose, L-arabinose was confirmed to improve the productivity. From this result, it is considered that the same effect can be obtained even when pentose metabolized through the pentose phosphate pathway such as D-ribose and D-ribulose is added.

[Example 7] Phytic acid was added to the initial culture medium, D-xylose was added to the feed medium, and DOI production. D-xylose was added to the feed medium having the composition shown in Table 2 to 0.025 w / v%. Except for the addition, the culture and the DOI accumulation amount were measured in the same manner as in Example 1. The accumulated DOI concentration at 48 hours was 66 g / L.
In order to obtain higher productivity, it was confirmed that the D-xylose concentration of the feed medium is preferably higher than 0.025 w / v%.

[Example 8] Phytic acid is added to the initial medium, D-xylose is added to the fed-batch medium, and DOI production is 0.09 w / v% (1.35 mmol / L) in the initial medium having the composition shown in Table 1. Thus, culture and measurement of DOI accumulation amount were performed in the same manner as in Example 2 except that phytic acid was added. The accumulated DOI concentration at 48 hours was 65 g / L.
In order to obtain higher productivity, it was confirmed that the concentration of phytic acid in the initial medium is preferably higher than 0.09 w / v%.

[Example 9] Myo-inositol and phosphate were added to the initial medium to produce DOI. Phytine added to the initial medium having the composition shown in Table 1 at 0.14 w / v% (2.11 mmol / L). Measurement of culture and DOI accumulation amount in the same manner as in Comparative Example 1 except that myo-inositol, potassium dihydrogen phosphate, or a combination of myo-inositol and potassium dihydrogen phosphate was added so as to have an equimolar concentration with the acid. Went. The DOI accumulation concentrations at 48 hours were 47 g / L, 54 g / L, and 68 g / L, respectively.
It was confirmed that when both myo-inositol and potassium dihydrogen phosphate were added, the same effects as when phytic acid was added were obtained.

[Example 10] Calcium phytate was added to the initial medium, D-xylose was added to the feed medium, and DOI production was added to the initial medium having the composition shown in Table 1 at an equimolar concentration with 0.14 w / v% phytic acid. Except that calcium phytate was added, culture and measurement of DOI accumulation amount were performed in the same manner as in Example 2. The DO accumulation concentration at 48 hours was 70 g / L.
It was confirmed that calcium phytate can achieve the same effect as phytic acid.

[Example 11] Calcium phytate was added to the initial medium to produce DOI. To the initial medium having the composition shown in Table 1, 0.19 w / v% (2.84 mmol / L), or 0.48 w / v% phytic acid and It carried out similarly to the comparative example 1 except having added calcium phytate so that it might become equimolar concentration (7.35 mmol / L). The DO accumulation concentrations at 48 hours were 62 g / L and 57 g / L, respectively.

[Example 12] D-xylose was added to a fed-batch medium to produce DOI. D-- was added to the fed-batch medium having the composition shown in Table 2 so that the concentration was 0.5 w / v% or 1.0 w / v%. Culture and measurement of DOI accumulation were performed in the same manner as in Comparative Example 1 except that xylose was added. The DO accumulation concentrations at 48 hours were 66 g / L and 58 g / L, respectively.

[Example 13] DOI production by adding gluconic acid to fed-batch medium Except for adding gluconic acid to the fed-batch medium shown in Table 2 so as to have an equimolar concentration with 0.05 w / v% D-xylose. In the same manner as in Comparative Example 1, the culture and the DOI accumulation amount were measured. The DOI accumulation concentration at 48 hours was 63 g / L.
Similar to D-xylose and L-arabinose, the effect of improving productivity was confirmed when gluconic acid was used.

[Example 14] Phytic acid was added to the initial medium, D-xylose was added to the feed medium, and DOI was produced from sucrose. A feed medium having the composition shown in Table 6 was used, and 0.05 w / v% was used as the feed medium. In the same manner as in Example 1 except that D-xylose was added so that the pH of the culture was 5.5, and the amount of accumulated DOI was measured. The accumulated DOI concentration at 48 hours was 52 g / L.
Even when sucrose was used as a raw material, it was confirmed that DOI could be produced satisfactorily in a CSL-reducing medium supplemented with phytic acid and D-xylose.

[Example 15] Crude purification of DOI In order to stabilize DOI, sulfuric acid was added to the culture solution obtained in Example 3 or the culture solution obtained in Reference Example 1 to adjust the pH to 3.0. Centrifugation was performed at 8000 × g for 20 minutes in order to remove the cells. For decolorization and crude purification, 0.5 w / w% activated carbon of the centrifugation supernatant was added and stirred. In order to remove the activated carbon, it was filtered using a filter paper and a 0.45 μm membrane filter. When the transmittance at a wavelength of 400 nm of pure water in the spectrophotometer is 100%, the transmittance at a wavelength of 400 nm of the filtrate after removal of activated carbon is 40% in the filtrate of the culture solution obtained in Example 3. The filtrate of the culture solution obtained in Reference Example 1 was 8%.
It was confirmed that the culture solution obtained by the DOI production method according to the present invention has a small purification load.

The entire disclosure of Japanese Patent Application No. 2013-146832 is incorporated herein by reference.
All documents, patent applications, and technical standards mentioned in this specification are the same as if each individual document, patent application, and technical standard were specifically and individually stated to be incorporated by reference. , Incorporated herein by reference.

Claims (8)

Natural medium component (a) of 0.3 w / v% or more and 1.0 w / v% or less with respect to the whole medium;
At least one selected from the group consisting of the following component (b) and component (c);
Culturing 2-deoxy-siro-inosose-producing Escherichia coli in a medium containing, producing 2-deoxy-siro-inosose, and recovering the generated 2-deoxy-siro-inosose from the medium,
Method for producing 2-deoxy-siro-inosose containing:
(B) 0.05 w / v% to 0.27 w / v% phytic acid, 0.05% / 0.27 w / v% phytic acid, etc. to the whole medium, etc. Phytic acid component selected from the group consisting of a molar amount of phytic acid hydrolyzate and 0.05 w / v% or more and 0.27 w / v% or less of phytic acid and an equimolar amount of phytic acid salt based on the total medium. ;
(C) 0.01 to 0.45 w / v% pentose with respect to the whole medium;
Enzymatic digestion of peptone, yeast extract, meat extract, malt extract, corn steep liquor, tomato juice, oatmeal, fruit juice, vegetable juice, soy milk, animal milk, skim milk, cereal, potato, bean, seaweed or mushroom And at least one selected from the group consisting of molasses and molasses,
The hydrolyzate of phytic acid is a mixture of myo-inositol and free phosphoric acid.   The production method according to claim 1, wherein the medium has a pH of 5-6.   The production method according to claim 1 or 2, wherein the pentose is pentose that can be metabolized by the pentose phosphate pathway of Escherichia coli.   Claims in which the 2-deoxy-siro-inosose producing Escherichia coli is imparted or enhanced with the ability to produce 2-deoxy-siro-inosose by introducing a gene encoding 2-deoxy-siro-inosose synthase (BtrC). The production method according to any one of claims 1 to 3.   2. The activity of phosphoglucose isomerase (Pgi) and glucose-6-phosphate dehydrogenase (Zwf) inherent in the 2-deoxy-siro-inosose producing Escherichia coli is inactivated or reduced. 5. The production method according to any one of 4 above.   The production method according to any one of claims 1 to 5, wherein the 2-deoxy-siro-inosose-producing Escherichia coli has a gene encoding sucrose hydrolase (CscA).   The production method according to any one of claims 1 to 6, wherein the 2-deoxy-siro-inosose-producing Escherichia coli has a gene encoding a glucose transport promoting protein (Glf).   The production method according to any one of claims 1 to 7, wherein the natural medium component is corn steep liquor.