WO2011052482A1 - Isopropyl alcohol-producing bacterium and method for producing isopropyl alcohol - Google Patents

Isopropyl alcohol-producing bacterium and method for producing isopropyl alcohol Download PDF

Info

Publication number
WO2011052482A1
WO2011052482A1 PCT/JP2010/068631 JP2010068631W WO2011052482A1 WO 2011052482 A1 WO2011052482 A1 WO 2011052482A1 JP 2010068631 W JP2010068631 W JP 2010068631W WO 2011052482 A1 WO2011052482 A1 WO 2011052482A1
Authority
WO
Grant status
Application
Patent type
Prior art keywords
isopropyl alcohol
escherichia coli
gene
activity
obtained
Prior art date
Application number
PCT/JP2010/068631
Other languages
French (fr)
Japanese (ja)
Inventor
智量 白井
森重 敬
高橋 均
仰 天野
淳一郎 平野
松本 佳子
のぞみ 竹林
光史 和田
Original Assignee
三井化学株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/22Processes using, or culture media containing, cellulose or hydrolysates thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)

Abstract

Disclosed is an isopropyl alcohol-producing Escherichia coli which comprises an isopropyl alcohol production system, while being inactivated with respect to the glucose-6-phosphate isomerase activity. Also disclosed is a method for producing isopropyl alcohol from a plant-derived material using the isopropyl alcohol-producing Escherichia coli.

Description

Isopropyl alcohol-producing bacteria and isopropyl alcohol production method

The present invention relates to isopropyl alcohol-producing method using isopropyl alcohol-producing bacteria and this.

Propylene is an important basic raw materials for synthetic resins and petrochemical products such as polypropylene, automotive bumpers and food containers, films, have been widely used, such as medical equipment.
Isopropyl alcohol produced from plant-derived raw material, since it can be converted to propylene through a dehydration step, is promising as a material for carbon-neutral propylene. Currently the Kyoto Protocol to reduce 5% of carbon dioxide emissions 1990 in industrialized countries between 2008 and 2012. are required, carbon-neutral propylene extremely important environmental from its versatility it is.

Bacteria that produce isopropyl alcohol and assimilating a plant-derived raw material is already known. For example, in International Publication 2009/008377 pamphlet is glucose and the modified bacteria is disclosed to high productivity of isopropyl alcohol as a raw material, it has been described as excellent as biocatalysts for the industrial production of isopropyl alcohol . However, since the product obtained by the E. coli contains acetone in addition to isopropyl alcohol, or separating and removing the acetone from the product for use as propylene as a starting material, the acetone in the product It had to be converted to isopropyl alcohol.

The process of converting by-product acetone to isopropyl alcohol, a method of obtaining isopropyl alcohol by reacting acetone and hydrogen with a Raney nickel catalyst or the like has been proposed (e.g., see Japanese Patent Laid-Open No. 2-174737). However, it is the amount of hydrogen used for the hydrogenation and is often acetone content is increased, was the cost problem.

Therefore, lowering the acetone content in the product obtained by the isopropyl alcohol-producing Escherichia coli, it has been strongly desired to improve the purity of the isopropyl alcohol.

On the other hand, as a method of increasing the yield of substance production by microorganisms, microorganisms a key enzyme constituting decomposing metabolic pathway (glycolysis) glucose there is known a method of inactivating. For example, JP-T-2007-510411, in addition to a gene encoding a quinone oxidoreductase and a soluble transhydrogenase, encoding a key enzyme in the glycolytic pathway of glucose-6-phosphate isomerase (phosphoglucose isomerase) the genes deleted, bacteria that produce ethyl 3-hydroxybutyrate is disclosed.
Further, JP-T-2003-520583, production and yeast having reduced activity of glucose-6-phosphate isomerase, by comparing the yeast completely deleted this enzyme gene, the polyol in yeast when to be, to maintain the activity of glucose-6-phosphate isomerase is required to increase productivity, it is described that the effect of improved productivity and to delete the enzyme activity is lost.
Furthermore, 2-deoxy - scyllo - to destroy inosose (DOI) glucose-6-phosphate isomerase gene DOI production Escherichia coli introduced with forming enzyme, DOI yield have been reported to increase (e.g., Journal of Biotechnology., 129, pp.502-509, (2007) see).

As described above, lowering the acetone content in the product obtained by the isopropyl alcohol-producing Escherichia coli, to improve the purity of isopropyl alcohol, it was a major problem to be solved.
The present invention aims at providing a useful isopropyl alcohol-producing Escherichia coli and isopropyl alcohol-producing method to produce isopropyl alcohol with high purity.

The present invention has been made in consideration of the above situation, isopropyl alcohol-producing Escherichia coli and isopropyl alcohol-producing method of the present invention is as follows.

[1] isopropyl alcohol-producing Escherichia coli glucose-6-phosphate isomerase activity is provided with isopropyl alcohol production system with inactivated.
[2] In addition, glucose-6-phosphate-1-dehydrogenase activity is enhanced [1], wherein the isopropyl alcohol-producing Escherichia coli.
[3] the isopropyl alcohol-producing Escherichia coli, acetoacetate decarboxylase activity, isopropyl alcohol dehydrogenase activity, isopropyl alcohol according to any one of an E. coli granted the CoA transferase activity and thiolase activity [1] or [2] production E. coli.
[4] The acetoacetate decarboxylase activity, isopropyl alcohol dehydrogenase activity, each CoA transferase activity and thiolase activity, Clostridium bacteria, each enzyme derived from at least one member selected from the group consisting of Bacillus bacteria and Escherichia bacteria code is obtained by introduction of a gene [3], wherein the isopropyl alcohol-producing Escherichia coli.
[5] The acetoacetate decarboxylase activity and isopropyl alcohol dehydrogenase activity, which was obtained by introduction of a gene encoding each enzyme derived from Clostridium bacteria, the CoA transferase activity and thiolase activity, derived from bacteria belonging to the genus Escherichia it is obtained by the introduction of a gene encoding each enzyme [3], wherein the isopropyl alcohol-producing Escherichia coli.
[6] are those wherein acetoacetate decarboxylase activity is obtained by introduction of a gene that encodes an enzyme derived from Clostridium acetobutylicum, obtained by introduction of a gene the isopropyl alcohol dehydrogenase activity encodes an enzyme derived from Clostridium beijerinckii are those obtained, the CoA transferase activity and thiolase activity, is obtained by the introduction of a gene encoding each enzyme derived from Escherichia coli [3], wherein the isopropyl alcohol-producing Escherichia coli.
[7] Additionally, isopropyl alcohol-producing Escherichia coli according to any one of at least a sucrose hydrolase gene of the sucrose non-PTS genes [1] to [6].
[8] [1] to isopropyl alcohol production method comprising producing isopropyl alcohol from a plant-derived material with isopropyl alcohol-producing Escherichia coli according to [7].

Isopropyl alcohol-producing Escherichia coli of the present invention is isopropyl alcohol-producing Escherichia coli glucose-6-phosphate isomerase activity is provided with isopropyl alcohol production system with inactivated.

Isopropyl alcohol-producing Escherichia coli of the present invention, the activity of glucose-6-phosphate isomerase inherent E. coli are inactivated, is reduced production of acetone by-product is, to produce isopropyl alcohol with high purity be able to.

That is, the present invention, among the metabolic pathway that converts into isopropyl alcohol to decompose the glucose, by inactivating the glucose-6-phosphate isomerase activity is one of the key enzymes of glucose degradation (glycolysis), in which the purity of the isopropyl alcohol product by the E. coli can be improved. Glucose-6-phosphate isomerase is a key enzyme in the glycolytic pathway, knowledge inactivating the gene encoding the enzyme was revealed to be involved in the production of isopropyl alcohol, all to date can not see. Furthermore, inactivation of glucose-6-phosphate isomerase activity, without any knowledge also that revealed the effect of reducing the accumulation amount of acetone by-product in the production of isopropyl alcohol. Therefore, it improves the isopropyl alcohol purity in the product by inactivation of glucose-6-phosphate isomerase activity was totally unexpected.

The term "inactivated" in the present invention refers to a condition of the enzyme activity measured by any existing measurement system is below the detection limit.
Wording as "by genetic recombination" in the present invention, insertion of another DNA to the nucleotide sequence of the native gene, or replacement of part of the gene, changes in the nucleotide sequence by deletion or a combination thereof occurs It encompasses all as long as, for example, may be one mutation was obtained as a result of occurring.

By "applying" or "strengthening" of the "active" or "capacity" in the present invention, the gene coding for the enzyme in addition of introducing the extracellular host bacterium in the cells, the host bacterium into the genome including those having enhanced expression of the enzyme gene by replacing it or other promoters to enhance promoter activity of the enzyme gene possessed.
In the present invention, "host", as a result of receiving the introduction of the extracellular of one or more genes, means the E. coli as the isopropyl alcohol-producing Escherichia coli of the present invention.
The following describes the present invention.

The glucose-6-phosphate isomerase in the present invention, the International Union of Biochemistry (I.U.B.) is classified into the enzyme number 5.3.1.9 conforming to the enzyme committee report, D- glucose -6 - it refers to generic name of an enzyme that catalyzes a reaction for generating a phosphate D- fructose-6-phosphate.

The E. coli enzyme activity was inactivated in the present invention, like the bacteria imparted with the above activity, some way from the extracellular to intracellular, refers to native activity is impaired bacteria. These bacteria can be produced by, for example, disrupting the gene encoding the enzyme and a protein (gene disruption).

The gene disruption of the present invention, in order to function of a gene can not be exhibited, put a mutation in the nucleotide sequence of the gene, to insert another DNA, or, that deleting some portion of the gene shows. Results of gene disruption, for example, can not be transferred the gene into mRNA, the structural gene is not translated, or because imperfect transcribed mRNA, mutation or deletion occurs in the amino acid sequence of the translated structural proteins, originally the exhibit features become impossible.

Preparation of gene-disrupted strain, any method as long resulting disrupted strain in which the enzyme or protein is not expressed is possible also be used. The method of gene disruption a variety of ways (natural breeding, mutation additives, ultraviolet irradiation, radiation, random mutations, transposon, site-specific gene disruption) have been reported, that can destroy only certain genes in, gene disruption by homologous recombination is preferred. Approach by homologous recombination J.Bacteriol., 161,1219-1221 (1985) and J.Bacteriol., 177,1511-1519 (1995) and Proc.Natl.Acad.Sci.USA, 97,6640-6645 ( are described in 2000), it can be easily implemented if peer technician by these methods and their applications.

Isopropyl alcohol-producing Escherichia coli in the present invention is a E. coli with an isopropyl alcohol-producing system, it refers to the E. coli harboring the introduced or modified isopropyl alcohol-producing ability by gene recombination. Such isopropyl alcohol-producing system may be any one as long as it can produce the isopropyl alcohol into E. coli as a target.
Preferably, mention may be made of the grant of enzyme activities involved in the production of isopropyl alcohol. Isopropyl alcohol-producing Escherichia coli according to the present invention, acetoacetate decarboxylase activity, be isopropyl alcohol dehydrogenase activity, are four types of enzymatic activity of the CoA transferase activity and thiolase activity have been granted more preferable.

The acetoacetate decarboxylase in the present invention, the International Union of Biochemistry (I.U.B.) is classified into the enzyme number 4.1.1.4 conforming to the enzyme committee report, to produce acetone from acetoacetic acid reaction the point to generic name of enzymes which catalyze.
These include, for example, Clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium beijerinckii (Clostridium beijerinckii) Clostridium bacteria such include those derived from Bacillus bacteria such as Bacillus Porimikusa (Bacillus polymyxa).

Genes of acetoacetate decarboxylase is introduced into the host bacterium of the present invention, on the basis of DNA or known base sequence having the nucleotide sequence of the gene encoding acetoacetic acid decarboxylase derived from the biological origin mentioned above synthesized it can utilize synthetic DNA sequences. Preferable examples there may be mentioned those derived from Clostridium bacteria or Bacillus bacteria, for example, C. acetobutylicum, a DNA having the nucleotide sequence of a gene derived from Bacillus Porimikusa are exemplified. Particularly preferred are DNA having the nucleotide sequence of the gene derived from Clostridium acetobutylicum.

The isopropyl alcohol dehydrogenase in the present invention, the International Union of Biochemistry (I.U.B.) is classified into the enzyme number 1.1.1.80 conforming to the enzyme committee report, the reaction to produce isopropyl alcohol from acetone It refers to a generic name of an enzyme that catalyzes.
These include, for example, those derived from Clostridium bacteria such as Clostridium beijerinckii (Clostridium beijerinckii).

Genes of isopropyl alcohol dehydrogenase is introduced into a host bacterium of the present invention were synthesized on the basis of DNA or known base sequence having the nucleotide sequence of the gene coding for isopropyl alcohol dehydrogenases obtained from the biological origin mentioned above it can utilize synthetic DNA sequences. Preferable examples there may be mentioned those derived from Clostridium bacteria, such as DNA having the nucleotide sequence of the gene derived from Clostridium beijerinckii.

The CoA transferase in the present invention, the International Union of Biochemistry (I.U.B.) is classified into the enzyme number 2.8.3.8 conforming to the enzyme committee report, to produce acetoacetic acid from acetoacetyl-CoA reaction the point to generic name of enzymes which catalyze.
These include, for example, Clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium beijerinckii (Clostridium beijerinckii) Clostridium bacteria such as, Roseburia-tae steel NARIS (Roseburia intestinalis) Roseburia bacteria such as, file potassium Corynebacterium include: (E. coli Escherichia coli), such as those derived from bacteria belonging to the genus Escherichia Purausentsu (Faecalibacterium prausnitzii) such as file Cali genus bacteria, coprocessor Lactococcus (Coprococcus) bacteria, trypanosomes, such as Trypanosoma brucei (Trypanosoma brucei), Escherichia coli It is.

Genes of CoA transferase is introduced into the host bacterium of the present invention, synthetic DNA synthesized on the basis of DNA or known base sequence having the nucleotide sequence of the gene encoding the CoA transferase obtained from the biological origin mentioned above it is possible to use an array. Preferable examples, Clostridium bacteria such as Clostridium acetobutylicum, Roseburia bacteria such as Roseburia-tae steel Naris, file potash genus bacteria such files potassium Corynebacterium Purausentsu, coprocessor genus bacteria, Trypanosoma brucei, etc. Trypanosoma, DNA is exemplified having the nucleotide sequence of the Escherichia bacterium derived from genes such as Escherichia coli. The more suitable there may be mentioned those derived from Clostridium bacteria or Escherichia bacteria, especially preferably a DNA having the nucleotide sequence of the gene derived from Clostridium acetobutylicum or Escherichia coli.

The thiolase in the present invention, the International Union of Biochemistry (I.U.B.) is classified into the enzyme number 2.3.1.9 conforming to the enzyme committee report, the reaction for producing acetoacetyl-CoA from acetyl-CoA It refers to a generic name of an enzyme that catalyzes.
These include, for example, Clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium beijerinckii (Clostridium beijerinckii) Clostridium bacteria such as Escherichia coli (Escherichia coli) Escherichia bacteria such as, Halobacterium species (Halobacterium sp .) bacteria, Zuguroa-Ramigera (Zoogloea ramigera) Zuguroa bacteria belonging to the genus ,, Rhizobium species such as (Rhizobium sp.) bacteria, Bradyrhizobium japonicum (Bradyrhizobium japonicum) Bradyrhizobium bacteria such as ,, Candida tropicalis (Candida tropicalis) Candida bacteria such as, Caulobacter-Kuresentasu (Caulobacter crescentus) Caulobacter bacteria such as Streptomyces bacteria of the genus Streptomyces Colinas (Streptomyces collinus), etc. ,, Enterococcus Akarisu (Enterococcus faecalis) derived from Enterococcus bacteria, and the like.

The gene of thiolase is introduced into the host bacterium of the present invention, a synthetic DNA sequence synthesized based on DNA or known base sequence having the nucleotide sequence of the gene encoding the thiolase obtained from each biological origin mentioned above it can be used. Preferable examples, Clostridium acetobutylicum, Clostridium bacteria such as Clostridium beijerinckii, Escherichia bacteria such as Escherichia coli, Halobacterium species bacteria, Zuguroa bacteria such as Zuguroa-Ramigera, Rhizobium bacteria of the species, Brady Rhizobium japonicum such as Bradyrhizobium bacteria of the genus, Candida bacteria such as Candida tropicalis, Caulobacter bacteria such as Caulobacter-Kuresentasu, the genus Streptomyces bacteria such as Streptomyces Colinas, Enterococcus Fakarisu DNA is exemplified having the nucleotide sequence of Enterococcus bacteria from the gene and the like. The more suitable there may be mentioned those derived from Clostridium bacteria or Escherichia bacteria, especially preferably a DNA having the nucleotide sequence of the gene derived from Clostridium acetobutylicum or Escherichia coli.

Among these, preferred in view of the above 4 kinds of each enzyme is Clostridium bacteria, Bacillus bacteria and is the enzyme activity is derived from at least one member selected from the group consisting of Escherichia bacteria, among others, aceto acid decarboxylase and isopropyl alcohol dehydrogenase is derived from Clostridium bacteria, when CoA transferase activity and thiolase activity and if it is derived from bacteria belonging to the genus Escherichia, these four enzymes are both derived from clostripain gym bacterium is further preferable.

Each Of these four types of enzymes according to the present invention, Clostridium acetobutylicum, from the viewpoint of enzyme activity that is derived from one of Clostridium Beijurinki or Escherichia coli, acetoacetate decarboxylase from Clostridium acetobutylicum of an enzyme, CoA transferase and thiolase are each an enzyme derived from Clostridium acetobutylicum or Escherichia coli, isopropyl alcohol dehydrogenase, more preferably an enzyme derived from Clostridium beijerinckii, the four kinds of enzymes, from the viewpoint of enzyme activity, acetoacetate decarboxylase activity is derived from Clostridium acetobutylicum, the isopropyl alcohol dehydroepiandrosterone Nase activity is derived from Clostridium beijerinckii, and particularly preferably CoA transferase activity and thiolase activity is derived from Escherichia coli.

Enzyme activity is enhanced involved in the production of isopropyl alcohol in the present invention, examples of Escherichia coli to produce isopropyl alcohol can be exemplified by PIPA / B strain or pIaaa / B strain according to No. WO2009 / 008,377.

The promoter of the gene in the present invention, the as long as it can control the expression of any gene but constitutively in strong promoter functioning in microorganisms, and also subjected to inhibition of the expression in the presence of glucose it is hard to promoter, specifically there can be mentioned a promoter of the promoter and serine hydroxymethyl transferase of glyceraldehyde 3-phosphate dehydrogenase (sometimes hereinafter referred to as GAPDH).
The promoter in the present invention RNA polymerase binds with sigma factor, it means a site to initiate transcription. For example GAPDH promoter from Escherichia coli in the nucleotide sequence information of GenBank accession number X02662, it is marked by nucleotide numbers 397-440.

CoA transferase gene from E. coli (atoD and atoA) and thiolase gene (atoB) is, atoD, atoA, because it forms an operon on the E. coli genome in the order of atoB (Journal of Baceteriology Vol.169 pp 42-52 Lauren Sallus Jenkins et al.), by modifying the promoter of atoD, it is possible to simultaneously control the expression of the CoA transferase gene and the thiolase gene.
Therefore, when CoA transferase activity and thiolase activity is obtained from the genomic gene of the host E. coli, from the viewpoint of obtaining sufficient isopropyl alcohol production capacity, and other promoter promoter responsible for the expression of both gene it is preferable to enhance expression of both genes, such as by substitution. The promoter used to enhance the CoA transferase activity and thiolase activity include Escherichia coli GAPDH promoter described above.

In addition, the glucose-6-phosphate-1-dehydrogenase in the present invention (Zwf), the International Union of Biochemistry (I.U.B.) enzyme number 1.1.1.49 that conforms to the enzyme committee report classified refers to the generic name of an enzyme that catalyzes a reaction for generating a D- glucono-1,5-lactone-6-phosphate from D- glucose-6-phosphate.
These include, for example, Deinococcus spp such as Deinococcus radiophilus, Aspergillus niger, Aspergillus genus such as Aspergillus aculeatus, Acetobacter genus, such as Acetobacter hansenii, Thermotoga genus, such as Thermotoga maritima, Cryptococcus genus, such as Cryptococcus neoformans fungus, Dictyostelium genus such as Dictyostelium discoideum, Pseudomonas fluorescens, Pseudomonas species such as Pseudomonas aeruginosa, Saccharomyces ce Saccharomyces genus such evisiae, Bacillus genus, such as Bacillus megaterium, include those derived from Escherichia genus such as Escherichia coli.

The genes used in the present invention the glucose-6-phosphate-1-dehydrogenase (Zwf), based on DNA or known base sequence having the nucleotide sequence of the gene encoding the thiolase obtained from each biological origin mentioned above the synthetic DNA sequence synthesized Te can be used. Preferable examples, Deinococcus spp such as Deinococcus radiophilus, Aspergillus niger, Aspergillus genus such as Aspergillus aculeatus, Acetobacter genus, such as Acetobacter hansenii, Thermotoga genus, such as Thermotoga maritima, Cryptococcus genus, such as Cryptococcus neoformans, Dictyostelium Dictyostelium genus such as discoideum, Pseudomonas fluorescens, Pseudomonas species such as Pseudomonas aeruginosa, Saccharomyces cerevisi Saccharomyces genus such as e, Bacillus genus, such as Bacillus megaterium, DNA having the nucleotide sequence of the Escherichia genus derived from genes such as Escherichia coli can be exemplified. A more preferred are there may be mentioned those derived from Deinococcus spp, Aspergillus spp, Acetobacter spp, Thermotoga genus, Pseudomonas genus, Bacillus genus, prokaryotes such as Escherichia genus, particularly preferred, a DNA having the nucleotide sequence of the Escherichia coli-derived gene.

The present invention definitive activity of these enzymes, those introduced from extracellular to intracellular or a gene by a host bacterium is replaced with enhanced or other promoters promoter activity of the enzyme gene carried on the genome it can be those obtained by strongly expressed.

The sucrose non-PTS according to the present invention, refers to a mechanism that microorganisms assimilate sucrose. The mechanism by which microorganisms assimilate sucrose According to conventional wisdom, sucrose PTS: (see JP 2001-346578 JP) to (Phosphoenolpyruvate Carbohydrate Phosphotransferase System) and is divided into two sucrose non PTS. Sucrose non-PTS is cscB (performs sucrose uptake), (disassembly of sucrose within the microorganism) cscA, (performing phosphorylation of fructose) cscK, 4 of cscR (cscB, A, controls the expression of the K) One of it is known that is configured from the factor. The sucrose PTS is scrA (performs sucrose uptake), (performed phosphorylation of sucrose) scrY, (disassembly of sucrose within the microorganism) scrB, scrR (scrA, Y, controls the expression of B), scrK known to be composed of five factors (performing phosphorylation of fructose).

Isopropyl alcohol-producing Escherichia coli of the present invention, among the sucrose non-PTS gene group, it is preferable to have at least a sucrose hydrolase gene. Thus, the ability to assimilate sucrose E. coli that can not assimilate sucrose is given. As a result, it is possible to use a sugar cane or sugar beet as a raw material, it is possible to obtain isopropyl alcohol from cheap bulk supply capable sucrose.
In particular, isopropyl alcohol-producing Escherichia coli of the present invention is to substantially simultaneously assimilated glucose and fructose which is a degradation product of sucrose, is more efficient because it can produce isopropyl alcohol. As the E. coli do not include the inherently Sucrose ability can include K12 strain, B strain, C strain and from strain like.

The sucrose non-PTS genes in the present invention refers to a gene group involved in non-PTS system from among sucrose assimilation pathways of a microorganism. Specifically, the repressor protein (cscR), sucrose hydrolase (cscA), fructokinase (cscK), a gene group consisting of sucrose transmission enzyme (cscB). Among them, in order to utilize sucrose efficiently, has only genes encoding cscA, it preferably contains no other gene.

The sucrose hydrolase of the present invention (invertase, CscA), the International Union of Biochemistry (I.U.B.) are classified into the enzyme number 3.2.1.26 that conforms to the enzyme committee report, D from sucrose - it refers to generic name of an enzyme that catalyzes a reaction to produce glucose and D- fructose.
This enzyme is an enzyme that is not possessed originally in E. coli such as K12 strain and B strain, sucrose transmission enzymes, sucrose hydrolase, the enzyme of the non-PTS metabolic pathway involving fructokinase and sucrose-specific repressor which is one (Canadian Journal of Microbiology, (1991) vol.45, see pp418-422). By imparting this CscA in the present invention, particularly by applying only CscA, sucrose in extracellular possibly decomposed into glucose and fructose in the vicinity of the cell membrane to release into the extracellular, glucose PTS and fructose PTS via capture phosphorylated in the cytoplasm by. As a result, the fructose is supplied to the fructose metabolism in bacteria, it is possible to assimilate using glycolysis.

As gene sucrose hydrolase is introduced into the host bacterium of the present invention (invertase, CscA) has a base sequence of the gene encoding sucrose hydrolase obtained from an organism harboring the enzyme (invertase, CscA) DNA, or it can utilize a synthetic DNA sequence synthesized based on the known base sequence. Preferable examples, Awinia genus (Erwinia), Poruteusu genus (Proteus), Vibrio (Vibrio), Agrobacterium (Agrobacterium), Rihizobiumu genus (Rhizobium), Staphylococcus genus (Staphylococcus ), Bifidobacterium (Bifidobacterium), there may be mentioned those derived from bacteria belonging to the genus Escherichia (Escherichia), for example, DNA having the nucleotide sequence of a gene derived from Escherichia coli O157 strain are exemplified. Particularly preferred are DNA having the nucleotide sequence of a gene derived from Escherichia coli O157 strains. Also the cscA, it is preferred that the signal sequence for shifting the cscA into the periplasm of the bacterial cell is added.

The gene for the repressor protein (CSCR) to be introduced into the host bacterium of the present invention, DNA having the nucleotide sequence of the gene encoding a repressor protein (CSCR) obtained from an organism harboring the enzyme, or known that it can utilize synthetic DNA sequence synthesized based on the nucleotide sequence. Preferable examples, Awinia genus (Erwinia), Poruteusu genus (Proteus), Vibrio (Vibrio), Agrobacterium (Agrobacterium), Rihizobiumu genus (Rhizobium), Staphylococcus genus (Staphylococcus ), Bifidobacterium (Bifidobacterium), there may be mentioned those derived from bacteria belonging to the genus Escherichia (Escherichia), for example, DNA having the nucleotide sequence of a gene derived from Escherichia coli O157 strain are exemplified. Particularly preferred are DNA having the nucleotide sequence of a gene derived from Escherichia coli O157 strains.

The gene for fructokinase (CSCK) to be introduced into the host bacterium of the present invention, DNA having the nucleotide sequence of the gene coding for fructokinase (CSCK) obtained from an organism harboring the enzyme, or known that it can utilize synthetic DNA sequence synthesized based on the nucleotide sequence. Preferable examples, Awinia genus (Erwinia), Poruteusu genus (Proteus), Vibrio (Vibrio), Agrobacterium (Agrobacterium), Rihizobiumu genus (Rhizobium), Staphylococcus genus (Staphylococcus ), Bifidobacterium (Bifidobacterium), there may be mentioned those derived from bacteria belonging to the genus Escherichia (Escherichia), for example, DNA having the nucleotide sequence of a gene derived from Escherichia coli O157 strain are exemplified. Particularly preferred are DNA having the nucleotide sequence of a gene derived from Escherichia coli O157 strains.

Is introduced into the host bacterium of the present invention, the gene for sucrose transmission enzymes (cscB), obtained from an organism harboring the enzyme, DNA having the nucleotide sequence of the gene encoding the sucrose permeability enzyme (cscB), or it can utilize synthetic DNA sequence synthesized based on a known nucleotide sequence. Preferable examples, Awinia genus (Erwinia), Poruteusu genus (Proteus), Vibrio (Vibrio), Agrobacterium (Agrobacterium), Rihizobiumu genus (Rhizobium), Staphylococcus genus (Staphylococcus ), Bifidobacterium (Bifidobacterium), there may be mentioned those derived from bacteria belonging to the genus Escherichia (Escherichia), for example, DNA having the nucleotide sequence of a gene derived from Escherichia coli O157 strain are exemplified. Particularly preferred are DNA having the nucleotide sequence of a gene derived from Escherichia coli O157 strains.

The Sucrose in the present invention, sucrose, as is, and low molecular weight or polymerization, preferably by low molecular weight refers to the ability to convert capability, or metabolically to a different material incorporated into the body. In the present invention, the assimilation includes a decomposition of lower molecular weight sucrose. For more information, including the decomposition of sucrose to D- glucose and D- fructose.

The introduction of enzyme activity can be carried out by introducing in the cells from extracellular host bacteria using gene recombinant technology which encode for example those four enzymes. In this case, gene to be introduced may be either homologous or heterologous to the host cell. Preparation of genomic DNA required to introduce a gene from extracellular to intracellular, cleavage and ligation of DNA, transformation, PCR (Polymerase Chain Reaction), design of oligonucleotides used as primers, synthetic methods such as, it can be carried out in a conventional manner well known to those skilled in the art. These methods, Sambrook, J., et al., "Molecular Cloning A Laboratory Manual, Second Edition", Cold Spring Harbor Laboratory Press, are described, for example, (1989).

The Escherichia coli imparted with activity of the enzyme in the present invention refers to E. coli given enzymatic activity in some way from the extracellular to intracellular. These E. coli, for example, a gene encoding the enzyme and protein, can be made using a method such as introduction in the cells from extracellular using similar recombinant techniques as those described above.

The E. coli with enhanced activity of the enzyme in the present invention refers to E. coli enzyme activity was enhanced in some way. These E. coli, for example, a gene encoding the enzyme and protein, is introduced with the plasmid in the cells from extracellular using similar recombinant techniques as described above or, host E. coli is on the genome is strongly expressed gene by replacing enhance or with other promoter promoter activity of the enzyme gene possessed, it can be made using the method and the like.

The E. coli in the present invention, originally, regardless of whether they have ability to produce isopropyl alcohol from a plant-derived material, the E. coli may have the ability to produce isopropyl alcohol from a plant-derived material by using some means means.

As here be introduced interest of each gene of the E. coli, may be those having no isopropyl alcohol-producing ability may be any E. coli if possible introduction and change of each gene of the .
More preferably, it is isopropyl alcohol-producing ability is given in advance E. coli, which makes it possible to produce more efficiently isopropyl alcohol.

Such isopropyl alcohol-producing Escherichia coli, for example, acetoacetate decarboxylase activity described in WO 2009/008377 pamphlet, isopropyl alcohol dehydrogenase activity, granted CoA transferase activity and thiolase activity, Isopropyl plant-derived material isopropyl alcohol production E. coli capable of producing the alcohol can be exemplified.

Isopropyl alcohol-producing method of the present invention contains a thereby producing isopropyl alcohol from a plant-derived material with the isopropyl alcohol-producing Escherichia coli, i.e., by contacting the above isopropyl alcohol-producing Escherichia coli and plant-derived material, it is intended to include a step of culturing, and a recovery step of recovering the isopropyl alcohol obtained by contact.

Plant-derived material used in the isopropyl alcohol-producing method is a carbon source derived from a plant is not particularly limited as long as it is a plant-derived material. In the present invention, roots, stems, trunks, branches, leaves, flowers, organs such as seeds, plants containing them refers to the degradation product thereof plant organs, further plants from plant organs or degradation products thereof, of the obtained carbon sources, even those microorganisms may be utilized as a carbon source in the culture, are encompassed by the plant-derived material.

Such carbon sources are included in the plant-derived raw material, starch as common ones, sucrose, glucose, fructose, xylose, sugars arabinose and the like, or plant protein degradation products, cellulose hydrolyzate rich in these components, etc. or it can be mentioned a combination of these, and even glycerol or fatty acids derived from vegetable oils, may be included in the carbon source in the present invention.

Exemplary plant-derived material in the present invention, agricultural crops such as corn, rice, wheat, soybean, sugarcane, beet, such as cotton, or can be preferably exemplified a combination thereof, the use form as the raw material, Unfinished, juice, ground, etc., are not particularly limited. Further, it may be in the form of only the carbon source described above.

Contact isopropyl alcohol-producing Escherichia coli and plant-derived material in the culturing step is generally performed by culturing the isopropyl alcohol-producing Escherichia coli in a medium containing a plant-derived material.

Contact density between plant-derived material and isopropyl alcohol-producing Escherichia coli varies by the activity of an isopropyl alcohol-producing Escherichia coli, in general, as the concentration of plant-derived material in the medium, relative to the total weight of the mixture sugar concentrations of initial in terms of glucose Te can be 20 mass% or less, preferably from the viewpoint of the glucose tolerance of E. coli, the sugar concentration of initial can be 15 mass% or less. Other components may if it is added in an amount that is usually added to the medium of the microorganism is not particularly limited.

The content of isopropyl alcohol-producing Escherichia coli in the medium also different generally depending E. coli type and activity, 0.1 wt% to 30 wt respect culture the amount of bacterial solution before incubation to be introduced at the initiation of the culture %, preferably to 1 mass% to 10 mass% from the viewpoint of culture conditions control.

As a medium used for culturing the isopropyl alcohol-producing Escherichia coli, a carbon source, a nitrogen source, usually used for organic trace elements microorganism requires nucleic acid, vitamins, etc. are included in order to produce inorganic ions, and isopropyl alcohol not particularly limited as long as it is a medium.

Upon culture of the present invention, the culture conditions are not particularly restricted, for example, pH 4 ~ 9 under aerobic conditions, preferably pH 6 ~ 8, temperature of 20 ° C. ~ 50 ° C., preferably at a pH in the range of 25 ° C. ~ 42 ° C. it can be cultured while appropriately controlling the temperature and.

Aeration rate of gas into the mixture is not particularly limited, in the case of using only air as a gas generally 0.02vvm ~ 2.0vvm (vvm; ventilation capacity [mL] / liquid volume [mL ] / is the time (minutes)), it is preferably performed from the viewpoint of suppressing the physical damage to E. coli in 0.1 vvm ~ 1.5 vvm.

Culturing step may be continued from the start of the culture until the plant-derived material in the mixture is consumed, or until the activity of the isopropyl alcohol-producing Escherichia coli is eliminated. Duration of the culturing step, the number of isopropyl alcohol-producing Escherichia coli in the mixture and the active and varies the amount of plant-derived material, generally 1 hour or more, preferably equal to or greater than 4 hours. On the other hand, by performing the re-introduction of a plant-derived material or isopropyl alcohol-producing Escherichia coli, although culture period can be continuously indefinitely, in view of processing efficiency, the following general 5 days, preferably be less 55 hours it can. Other conditions are the conditions used for conventional cultivation may be directly applied.

As a method for recovering isopropyl alcohol accumulated in the culture liquid is not particularly limited, for example, after removing the bacterial cells by centrifugation or the like from the culture medium, separating the isopropyl alcohol distillation or membrane separation and the like conventional separation methods how to can be adopted.

Note that the method of producing isopropyl alcohol of the present invention, prior to the culturing step for isopropyl alcohol production, include pre-incubation step for the isopropyl alcohol-producing Escherichia coli using a suitable cell number or moderately active state It can have. Before culturing step, it may be a culture with normal culture conditions used according to the type of isopropyl alcohol-producing bacteria.

The method of producing isopropyl alcohol of the present invention, preferably, while supplying a gas into the mixture containing the isopropyl alcohol-producing bacteria and plant-derived material, a culture step of culturing the isopropyl alcohol-producing Escherichia coli, were produced by the culture and a recovery step of separating the isopropyl alcohol from the mixture recovered.

According to this method, the production of E. coli is cultured while supplying the gas mixture (aeration). The aeration culture, isopropyl alcohol produced along with are released into the mixture, it evaporates from the mixture, as a result, it is possible to easily separate the generated isopropyl alcohol from the mixture. Further, since the isopropyl alcohol generated is continuously separated from the mixture, it is possible to suppress an increase in the concentration of isopropyl alcohol in the mixture. Thus, there is no particular need to consider the resistance to isopropyl alcohol isopropyl alcohol-producing Escherichia coli.
Note that the mixture in the method may be mainly composed of basal medium generally used for culture of E. coli. The culture conditions, the above-mentioned matter is directly applied.

In the recovery step it is produced in the culture process, to recover isopropyl alcohol which is separated from the mixture. The as recovery method, as long as it can collect the vaporized and gaseous or splash like isopropyl alcohol from the mixture by conventional culture. Such methods, there may be mentioned the like for accommodating the general collection member of the sealed container or the like used, inter alia, only isopropyl alcohol from the viewpoint of purity higher recovery, acquisition for capturing isopropyl alcohol a liquid, it is preferred that involves contacting the isopropyl alcohol was separated from the mixture.

In this method, the isopropyl alcohol, can be recovered as an aspect dissolved in capture liquid or mixture. As such a recovering method, a method, and the like that are described, for example, in International Publication 2009/008377 pamphlet. Recovered isopropyl alcohol can be confirmed using conventional detecting means such as HPLC. Recovered isopropyl alcohol can be further purified if desired. Such purification methods can be mentioned distillation.
If recovered isopropyl alcohol is in a state of aqueous solution, the method of producing the isopropyl alcohol, in addition to the recovery step, may further comprise a dewatering step. Dehydration of isopropyl alcohol can be carried out by a conventional method.

[Correction under Rule 91 16.02.2011]
The applicable devices in the method of producing recoverable isopropyl alcohol as aspects dissolved in capture liquid or mixture, for example, a production apparatus shown in Figure 1 of WO 2009/008377 pamphlet.
In this production apparatus, the culture tank medium is housed containing isopropyl alcohol-producing bacteria and plant-derived material, is connected the injection tube for injecting a gas from outside the device, making it possible to aeration to a medium there.
Further, in the culture tank via a connecting pipe, a trap tank trap fluid is accommodated as the capture liquid is connected. At this time, bubbling occurs moved gas or liquid to the trap vessel in contact with the trap solution.
Thus, isopropyl alcohol produced by aeration culture in a culture tank, both are easily separated from the culture medium evaporates by aeration, is captured in the trap liquid in the trap tank. As a result, the isopropyl alcohol, can be continuously and conveniently produced in a more purified form.

In the method of producing isopropyl alcohol present invention, it is possible to generate the isopropyl alcohol with high purity, the same method in the usual resulting products, for example, the content of acetone is lower as compared with the case of not applying the present invention . In varies depending on the state of the condition or isopropyl alcohol-producing Escherichia coli used in the production process, the total products released into the extracellular from intracellular with a metabolic pathway of E. coli in the culture step is completed (except for the gas and water) the proportion of isopropyl alcohol, 65 wt% to 100 wt%, preferably be 80 mass% to 100 mass%. Or the ratio of the amount of by-product acetone and isopropyl alcohol in the culture step is completed, the production amount of isopropyl alcohol produced amount of by-product acetone when (g / L) was as 1 (g / L) 0 ~ 0.4, preferably to 0 to 0.2.

Isopropyl alcohol-producing product obtained by the method of the present invention as described above, since a low percentage for byproduct isopropyl alcohol, such as acetone, for example, in the presence of a solid acid substance and the hydrogenation catalyst, from plant-derived material when produced propylene from isopropyl alcohol containing acetone produced by isopropyl alcohol-producing bacteria, it is possible to reduce the amount of hydrogen used in the hydrogenation of acetone.

The following will be described an embodiment of the present invention, the present invention is not intended to be limited by these. Incidentally, "%" in the description unless otherwise specified, are by weight.
[Example 1]
<Preparation of Escherichia coli B strain Δpgi Ltd.>
Entire base sequence of the genomic DNA of Escherichia coli is known (GenBank accession number U00096), has also been reported nucleotide sequence of the gene encoding (there is hereafter referred to as pgi) phosphoglucose isomerase of Escherichia coli ( GenBank accession number X15196). To clone the nucleotide sequence region near the gene (1,650Bp) encoding pgi, caggaattcgctatatctggctctgcacg (SEQ ID NO: 1), cagtctagagcaatactcttctgattttgag (SEQ ID NO: 2), oligo shown in Shieijitictagatcatcgtcgatatgtaggcc (SEQ ID NO: 3) and Jieishishitgcagatcatccgtcagctgtacgc (SEQ ID NO: 4) It was four synthetic nucleotide primers. 'The EcoRI recognition site at the terminal side, the primers of SEQ ID NO: 2 and 3 are 5' primer 5 of SEQ ID NO: 1 an XbaI recognition site at the end side, of SEQ ID NO: 4 primers 5 'end side PstI recognition sites, respectively It has.

[Correction under Rule 91 16.02.2011]
To prepare the genomic DNA of Escherichia coli MG1655 strain (ATCC700926), resulting genomic DNA as a template, the primer pair SEQ ID NO: 1 and SEQ ID NO: 2, amplify a DNA fragment of about 1.0kb by PCR and (sometimes hereinafter referred to as pgi-L fragment). Further, the primer pair SEQ ID NO: 3 and SEQ ID NO: 4, (sometimes hereinafter referred to as pgi-R fragment) amplified a DNA fragment of about 1.0kb by performing PCR. Separate these DNA fragments by agarose electrophoresis, recovered, the pgi-L fragment with EcoRI and XbaI, was digested respectively pgi-R fragment with XbaI and PstI. And the digested fragments two were mixed with EcoRI and PstI digests of temperature-sensitive plasmid pTH18cs1 (GenBank accession number AB019610), it was reacted with T4DNA ligase, transformed into Escherichia coli DH5α competent cells (Toyobo Co., Ltd.) conversion to obtain a transformant that grew at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml. The resulting plasmid was recovered from the transformants was confirmed that the two fragments of 5 'upstream adjacent fragment and the 3'-downstream adjacent fragment of the gene encoding pgi is correctly inserted into pTH18cs1. The resulting plasmid was digested with XbaI, it was blunt-ended by T4DNA polymerase. Coupled with the DNA fragment, and pUC4K plasmid (GenBank accession number X06404) (Pharmacia) DNA fragment was blunt-ended by further T4DNA polymerase kanamycin resistance gene obtained by by digestion with EcoRI using T4DNA ligase did. Then, it transformed into Escherichia coli DH5α competent cell to obtain a transformant that grew at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml kanamycin 50 [mu] g / ml. The resulting plasmid was recovered from the transformants was confirmed that the kanamycin resistance gene is properly inserted between the 5 'upstream adjacent fragment and the 3'-downstream adjacent fragment of the gene encoding pgi.

The thus obtained plasmid was transformed into Escherichia coli B strain (ATCC11303), and cultured overnight at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml kanamycin 50 [mu] g / ml, to obtain a transformant It was. The obtained transformant was inoculated into LB liquid medium containing kanamycin 50 [mu] g / ml, and cultured overnight at 30 ° C.. Then applying a portion of the culture on LB agar plates containing kanamycin 50 [mu] g / ml, to obtain colonies grown at 42 ° C.. The obtained colonies LB liquid medium containing kanamycin 50 [mu] g / ml, and cultured for 24 hours at 30 ° C., to give an additional colonies growing in the coating to 42 ° C. in LB agar plates containing kanamycin 50 [mu] g / ml.

To pick up 100 colonies were randomly from the emerged colonies, respectively LB agar plates containing kanamycin 50 [mu] g / ml and grown on LB agar plates containing chloramphenicol 10 [mu] g / ml, LB agar containing kanamycin I chose a clone of chloramphenicol sensitivity to growth only to the plate. Further by PCR from the chromosome DNA of these clones of interest, to select a strain which amplification will be obtained about 3.3kbp fragment by pgi gene is replaced with the kanamycin resistance gene, the resulting strain B strain pgi gene deletion Shitsukabu was designated (hereinafter △ sometimes abbreviated as pgi strain) and.

The Escherichia coli MG1655 strain and Escherichia coli B strains can be obtained from the American Type Culture Collection.

[Example 2]
<Escherichia coli thiolase gene, Escherichia coli CoA transferase gene, Clostridial bacterium derived acetoacetate decarboxylase gene, construction of Clostridial bacterium from isopropyl alcohol dehydrogenase gene expression vector and the expression vector transformant>
Escherichia coli thiolase and Escherichia amino acid sequence and the gene of the nucleotide sequence of CoA transferase coli has already been reported. That is, the gene encoding the thiolase is described in GenBank accession number U00096 2324131 ~ 2325315 of Escherichia coli MG1655 strain genome sequence described. The gene encoding the CoA transferase is described in 2321469-2322781 of the Escherichia coli MG1655 strain genomic sequence. With these, it is possible to produce isopropyl alcohol to express Clostridial bacterium derived from acetoacetic acid decarboxylase gene described later, the isopropyl alcohol dehydrogenase genes. The nucleotide sequence of a promoter necessary for expressing the above genes, GenBank in the nucleotide sequence information of the accession number X02662, glyceraldehyde 3-phosphate dehydrogenase from Escherichia coli are described in 397-440 (hereinafter can be used promoter sequences may be referred to as GAPDH).

Genomic DNA of Escherichia coli MG1655 strain to obtain the GAPDH promoter used in the template Shijieijishitieishiatatgcaatgattgacacgattccg (SEQ ID NO: 5), and amplified by PCR method by Shijishijishijishiatgctatttgttagtgaataaaagg (SEQ ID NO: 6), limits the resulting DNA fragments enzyme NdeI, to obtain a DNA fragment corresponding to approximately 110bp of the GAPDH promoter by digestion with SphI. The resulting DNA fragment and plasmid pBR322 fragment obtained by digestion with restriction enzymes NdeI and SphI a (GenBank accession number J01749) were mixed, after ligated using a ligase, Escherichia coli DH5α strain competent cell (manufactured by Toyo It transformed into spinning Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, was recovered plasmid pBRgapP from the obtained bacterial cells.

To obtain the isopropyl alcohol dehydrogenase gene using genomic DNA of Clostridium beijerinckii NRRL B-593 in the template, Eieitieitijishieitijishitijijitijijieieishiatatgaaaggttttgcaatgctagg (SEQ ID NO: 7), and amplified by PCR method by Jishijijieitishishijijitieishishititieitieiatataactactgctttaattaagtc (SEQ ID NO: 8), the resulting DNA restriction fragment enzyme SphI, to give the isopropyl alcohol dehydrogenase fragment of approximately 1.1kbp by digestion with BamHI. The resulting plasmid pBRgapP created in DNA fragments with the previous mixture of fragments obtained by digestion with restriction enzymes SphI and BamHI, was ligated using ligase, Escherichia coli DH5α strain competent cell (TOYOBO stock It was transformed into the company DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, was recovered the plasmid pGAP-IPAdh from the resultant bacterial cells.

atggatccgctggtggaacatatgaaaaattgtgtcatcgtcag using the template genomic DNA of Escherichia coli MG1655 strain to get the thiolase gene derived from Escherichia coli (SEQ ID NO: 9), and was amplified by PCR by Jishieijieieijishititijitishitieijieittaattcaaccgttcaatcaccatc (SEQ ID NO: 10), resulting DNA fragments the yield restriction enzyme BamHI, and thiolase fragment of approximately 1.2kbp by digestion with HindIII. The resulting plasmid pGAP-IPAdh created in DNA fragments with the previous mixture of fragments obtained by digestion with restriction enzymes BamHI and HindIII, after ligated using a ligase, Escherichia coli DH5α strain competent cell (manufactured by Toyo It transformed into spinning Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, was recovered the plasmid pGAP-IPAdh-atoB from the resultant bacterial cells.

gctctagagctggtggaacatatgaaaacaaaattgatgacattacaagac using the template genomic DNA of Escherichia coli MG1655 strain to obtain a CoA transferase gene derived from Escherichia coli (SEQ ID NO: 11), and amplified by PCR method by Tieijishieieijishititishitieishitishigagttatttgctctcctgtgaaacg (SEQ ID NO: 12), the resulting DNA restriction fragment enzyme XbaI, to obtain a CoA transferase α subunit fragment of approximately 600bp by digestion with HindIII. The resulting plasmid pGAP-IPAdh-atoB created in DNA fragments with the previous mixture of fragments obtained by digestion with restriction enzymes XbaI and HindIII, after ligated using a ligase, Escherichia coli DH5α strain competent cell transformed into (Toyobo Co., Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, was recovered the plasmid pGAP-IPAdh-atoB-atoD from the resultant bacterial cells.

Further using genomic DNA of Escherichia coli MG1655 strain as a template Eieijitishitishijieijishitijijitijijieieicatatggatgcgaaacaacgtattg (SEQ ID NO: 13), and amplified by PCR method by Jijishicaagcttcataaatcaccccgttgc (SEQ ID NO: 14), limits the resulting DNA fragments enzyme XhoI, digestion with HindIII in to obtain a CoA transferase β subunit fragment of approximately 600 bp. The resulting plasmid pGAP-IPAdh-atoB-atoD created in DNA fragments with the previous mixture of restriction enzymes XhoI and fragments obtained by digestion with HindIII, after ligated using a ligase, Escherichia coli DH5α strain competent transformed into Tentoseru (Toyobo Co., Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, was recovered the plasmid pGAP-IPAdh-atoB-atoD-atoA from the resultant bacterial cells.

To obtain the acetoacetate decarboxylase gene using genomic DNA of Clostridium acetobutylicum ATCC824 the template, Shieijijitieishishijishitijijitijijieieishieitieitijititieieieiggatgaagtaattaaacaaattagc (SEQ ID NO: 15), and amplified by PCR method by Jishijijieitishishititieishititaagataatcatatataacttcagc (SEQ ID NO: 16), the resulting DNA fragments restriction enzyme KpnI, to give the acetoacetate decarboxylase fragment of approximately 700bp was digested with BamHI. The resulting mixture of the resulting fragments by digesting the plasmid pGAP-IPAdh-atoB-atoD-atoA created with restriction enzymes KpnI and BamHI to DNA fragments before, after ligated using a ligase, Escherichia coli DH5α strain competent and transformed into cells (Toyobo Co., Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, was recovered the plasmid pGAP-Iaaa from the resultant bacterial cells.

Was transformed with this plasmid pGAP-Iaaa the △ pgi strain competent cells prepared in Example 1, LB Broth containing ampicillin 50 [mu] g / mL, by culturing overnight at 37 ° C. in Miller agar plate, Escherichia coli pGAP It was obtained -Iaaa / B △ pgi strain.
Similarly, transformed the pGAP-Iaaa in Escherichia coli B strain (ATCC11303) competent cell, LB Broth containing ampicillin 50 [mu] g / mL, by culturing overnight at 37 ° C. in Miller agar plate, Escherichia coli pGAP It was obtained -Iaaa / B strain.
The Escherichia coli MG1655 strain, Clostridium acetobutylicum ATCC824, Escherichia coli B strains can be obtained from American Type Culture Collection is a cell, microorganism, gene bank.

<Production of B :: atoDAB Ltd.>
Entire base sequence of the genomic DNA of Escherichia coli MG1655 strain is known (GenBank accession number U00096), the gene encoding the CoA transferase α subunit of Escherichia coli MG1655 strain (hereinafter, sometimes abbreviated as atoD) also nucleotide sequence has been reported. That atoD are described in 2321469 to 2322131 of the Escherichia coli MG1655 strain genome sequence described in GenBank accession number U00096.
The nucleotide sequence of a promoter necessary for expressing the above gene, GenBank accession in the nucleotide sequence information of the number X02662, glyceraldehyde 3-phosphate dehydrogenase from Escherichia coli are described in 397-440 (hereinafter GAPDH can be used promoter sequence of a) may be referred to as a. cgctcaattgcaatgattgacacgattccg using genomic DNA of Escherichia coli MG1655 strain as a template to obtain the GAPDH promoter (SEQ ID NO: 44), and amplified by PCR method by Eishieijieieititcgctatttgttagtgaataaaagg (SEQ ID NO: 45), limits the resulting DNA fragments enzymes MfeI and to obtain a DNA fragment encoding the GAPDH promoter about 100bp by digestion with EcoRI. The resulting DNA fragment and plasmid pUC19 to (GenBank accession number X02514) was digested with restriction enzymes EcoRI, mixed with and further the alkaline phosphatase treatment after binding by using a ligase, Escherichia coli DH5α strain competent cells ( transformed into Toyobo Co., Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. Resulting colonies 10 was cultured overnight at each 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, plasmids were recovered, when digested with restriction enzymes EcoRI and KpnI, clone having an GAPDH promoter is not cut and, further, it was pUCgapP those GAPDH promoter Ensure DNA sequence has been inserted correctly. The resulting pUCgapP was digested with restriction enzymes EcoRI and KpnI.
To obtain further atoD, cgaattcgctggtggaacatatgaaaacaaaattgatgacattacaagac (SEQ ID NO: 46) using genomic DNA of Escherichia coli MG1655 strain as a template, and amplified by PCR method by Jishijijitiaccttatttgctctcctgtgaaacg (SEQ ID NO: 47), limits the resulting DNA fragments enzyme It was obtained atoD fragment of approximately 690bp by digestion with EcoRI and KpnI. This DNA fragment was mixed with pUCgapP digested with previously restriction enzymes EcoRI and KpnI, then ligated using a ligase, and transformed into Escherichia coli DH5α strain competent cell (Toyobo Co., Ltd. DNA-903), ampicillin to obtain a transformant growing on an LB agar plate containing 50 [mu] g / mL. The resulting plasmid was recovered from the cells, to confirm that the atoD is properly inserted, the plasmid was named PGAPatoD.
The Escherichia coli MG1655 strain can be obtained from the American Type Culture Collection.

As described above, it has also been reported atoD nucleotide sequence in genomic DNA of Escherichia coli MG1655 strain. It was created on the basis of the Escherichia coli MG1655 strain 5 'genetic information region near atoD of using Jishitishitieigatgctgaaatccactagtcttgtc (SEQ ID NO: 48) and Tieishitigcagcgttccagcaccttatcaacc (SEQ ID NO: 49), the genomic DNA of Escherichia coli MG1655 strain as a template PCR amplified a DNA fragment of about 1.1kbp by performing.
Furthermore, using primers of SEQ ID NO: 4, which was produced based on the Escherichia coli MG1655 strain Jijitishitagagcaatgattgacacgattccg (SEQ ID NO: 50) prepared based on the sequence information of the GAPDH promoter and atoD sequence information of the Escherichia coli MG1655 strain , PCR was carried out with the expression vector pGAPatoD prepared above as a template to obtain a DNA fragment of about 790bp consisting GAPDH promoter and atoD.
Each fragment obtained by the above restriction enzymes PstI and XbaI, was digested with XbaI and KpnI, the fragments temperature sensitive plasmid pTH18cs1 (GenBank accession number AB019610) [Hashimoto-Gotoh, T., Gene, 241, 185-191 (2000)] it was mixed with a fragment obtained by digesting with PstI and KpnI, and was ligated using ligase, and transformed into DH5α strain, at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml to obtain a growth for transformants. The resulting colonies of chloramphenicol 10 [mu] g / ml and incubated overnight at 30 ° C. in LB liquid medium containing, was recovered the plasmid from the obtained bacterial cells. This plasmid was transformed into Escherichia coli B strain (ATCC11303), and cultured overnight at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml, to obtain a transformant. The obtained transformant was inoculated into LB liquid medium containing chloramphenicol 10 [mu] g / ml, and cultured overnight at 30 ° C.. The resulting culture cells were spread on LB agar plates containing chloramphenicol 10 [mu] g / ml, to obtain colonies were cultured at 42 ° C.. The resulting colonies 2 hours and incubated at 30 ° C. in LB liquid medium without antibiotics, to obtain colonies grown in the coating to 42 ° C. in LB agar plates without antibiotics.
Each pick up 100 colonies were randomly from the emerged colonies, grown on an LB agar plate containing LB agar plate and chloramphenicol 10 [mu] g / ml without antibiotics, chloramphenicol-sensitive clones the chosen. Furthermore amplify the approximately 790bp fragment containing the GAPDH promoter and atoD by PCR from the chromosome DNA of these clones, were selected strains atoD promoter region is substituted with the GAPDH promoter, the E. clones satisfying the above coli, It was designated as B :: atoDAB.
In addition, Escherichia coli strain B (ATCC11303) can be obtained from the American Type Culture Collection is a cell, microorganism, gene bank.

<Preparation of plasmid pIaz>
Acetoacetate decarboxylase Clostridial bacterium in GenBank accession number M55392, isopropyl alcohol dehydrogenase is described in GenBank accession number AF157307.
The nucleotide sequence of a promoter necessary for expressing the above genes, GenBank in the nucleotide sequence information of the accession number X02662, glyceraldehyde 3-phosphate dehydrogenase from Escherichia coli are described in 397-440 (hereinafter can be used promoter sequences may be referred to as GAPDH).
Genomic DNA of Escherichia coli MG1655 strain to obtain the GAPDH promoter used in the template Shijieijishitieishiatatgcaatgattgacacgattccg (SEQ ID NO: 5), and amplified by PCR method by Shijishijishijishiatgctatttgttagtgaataaaagg (SEQ ID NO: 6), limits the resulting DNA fragments enzyme NdeI, to obtain a DNA fragment corresponding to approximately 110bp of the GAPDH promoter by digestion with SphI. The resulting DNA fragment and plasmid pBR322 fragment obtained by digestion with restriction enzymes NdeI and SphI a (GenBank accession number J01749) were mixed, after ligated using a ligase, Escherichia coli DH5α strain competent cell (manufactured by Toyo It transformed into spinning Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, was recovered plasmid pBRgapP from the obtained bacterial cells.
To obtain the isopropyl alcohol dehydrogenase gene using genomic DNA of Clostridium beijerinckii NRRL B-593 in the template, Eieitieitijishieitijishitijijitijijieieishiatatgaaaggttttgcaatgctagg (SEQ ID NO: 51), and amplified by PCR method by Jishijijieitishishititieitieiatataactactgctttaattaagtc (SEQ ID NO: 52), the resulting DNA restriction fragment enzyme SphI, to give the isopropyl alcohol dehydrogenase fragment of approximately 1.1kbp by digestion with BamHI. The resulting mixture of the resulting fragments by digesting the DNA fragment and plasmid pBRgapP with restriction enzymes SphI and BamHI, was ligated using ligase, Escherichia coli DH5α strain competent cell (Toyobo Co., Ltd. DNA-903 ) the transformed to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, sure the resulting plasmid was recovered from the cells IPAdh is properly inserted, the plasmid pGAP- It was named IPAdh.
To obtain the acetoacetate decarboxylase gene using genomic DNA of Clostridium acetobutylicum ATCC824 the template, Shieijijieitishishijishitijijitijijieieishieitieitijititieieieiggatgaagtaattaaacaaattagc (SEQ ID NO: 53), and amplified by PCR method by Jijieieititishijijitieishishititieishititaagataatcatatataacttcagc (SEQ ID NO: 54), the resulting DNA fragments restriction enzyme BamHI, and give acetoacetate decarboxylase fragment of approximately 700bp was digested with EcoRI. The resulting plasmid pGAP-IPAdh created in DNA fragments with the previous mixture of fragments obtained by digestion with restriction enzymes BamHI and EcoRI, then ligated using a ligase, Escherichia coli DH5α strain competent cell (manufactured by Toyo It transformed into spinning Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, plasmid was recovered from the obtained microbial cells to confirm that the adc is properly inserted, pIa this plasmid It was named.
To obtain the glucose 6-phosphate-1-dehydrogenase gene (zwf) using genomic DNA of Escherichia coli B strain (GenBank accession No.CP000819) the template Shieijijieitishishishijijieijieieieijitishititiatggcggtaacgcaaacagcccagg (SEQ ID NO: 55), and Shijitishitieijieishijijieijieieieijitishititatgaagcaaacagtttatatcgcc (SEQ ID NO: 56 ) was amplified by PCR using the restriction resulting DNA fragments enzyme BamHI, and give glucose 6-phosphate 1-dehydrogenase fragment of approximately 1500bp by digestion with XbaI. The resulting plasmid pGAP-Ia that was created DNA fragment previously mixed with restriction enzymes BamHI and XbaI digested fragment obtained by, after binding by using a ligase, Escherichia coli DH5α strain competent cells (Toyobo transformed into Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, obtained plasmid was designated as pGAP-Iaz.
Was transformed with this plasmid pIaz Escherichia coli B :: atoDAB competent cells prepared above, LB Broth containing ampicillin 50 [mu] g / mL, in Miller agar plates by overnight culture at 37 ° C., Escherichia coli was obtained pGAP-Iaz / B :: atoDAB.

[Example 3]
<Isopropyl alcohol production from glucose by E. coli pGAP-Iaaa / B strain and pGAP-Iaaa / B △ pgi strain and pGAP-Iaz / B :: atoDAB △ pgi strain using 3L fermenter>
In this example, was the production of isopropyl alcohol by using the production apparatus shown in WO2009 / 008 377 pamphlet Figure 1. The culture tank using a three liter, the trap vessel were from 10L volume. Culture tank, a trap tank, an injection tube, connecting pipe, the discharge pipe, was made of glass all. The trap tank, and injected with water (trap water) as the trap liquid in an amount of 9 L. Incidentally, the culture tank by installing the waste liquid tube, was discharged culture medium was increased by the flow pressure of the sugars and neutralizing agent out appropriate culture vessel.

The pGAP-Iaaa / B strain and pGAP-Iaaa / B △ pgi strain obtained in Example 2, LB Broth containing ampicillin 50 [mu] g / mL in the pre-culture, 500 mL Erlenmeyer flasks containing Miller culture liquid (Difco244620) 100mL was inoculated overnight, culture temperature 30 ° C., the mixture was stirred culture at 120 rpm. The preculture 45 mL, transferred to a culture tank of 3L flasks containing the medium 855g having the following composition (ABLE Co. culture apparatus BMS-PI), and culture was performed. Atmospheric pressure culturing, aeration rate 0.9 L / min, stirring rate 550 rpm, a culture temperature 30 ° C., was performed at pH 7.0 (NH 3 adjusted with water). For up to 8 hours after initiation of culture, a 45 wt / wt% aqueous glucose solution was added at a flow rate of 7.5 g / L / hour. Then was added 45 wt / wt% aqueous glucose solution at a flow rate of 15 g / L / hour. Sampling the bacterial cell cultures to 120 hours after the start of culture, after removal of cells by centrifugation, the accumulation of the product in the resulting culture supernatant was measured according to a conventional method by HPLC. The measurement value is the sum of the culture medium and the trap water (9 L) in after culturing. The density of the product after the culture, showed a purity of isopropyl alcohol in Tables 1.

<Medium composition>
Corn steep liquor (manufactured by Nihon Shokuhin Kako): 20g / L
Fe 2 SO 4 · 7H 2 O : 0.1g / L
K 2 HPO 4: 2g / L
KH 2 PO 4: 2g / L
MgSO 4 · 7H 2 O: 2g / L
(NH 4) 2 SO4: 2g / L
ADEKANOL LG126 (Asahi Denka) 0.1g / L
(Balance: water)

Figure JPOXMLDOC01-appb-T000001

As a result of the trap water of the resulting pGAP-Iaaa / B strain and pGAP-Iaaa / B △ pgi strain GC analysis, pGAP-Iaaa / 2.6 wt% acetone to trap water B strains, isopropanol 4.6 was found to be contained by weight%. Further, pGAP-Iaaa / B △ pgi strain acetone trap water of 0.24 wt%, isopropanol 2.8 wt%, the trap water pGAP-Iaz / B :: atoDAB △ pgi strain acetone 0 .24 wt%, isopropanol was found to be contained 2.6 wt%.

These results, by disrupting the gene (pgi) encoding glucose-6-phosphate isomerase inherent E. coli, the activity of glucose-6-phosphate isomerase was completely inactivated, the purity of isopropyl alcohol it was confirmed to be improved. Further, by enhancing the expression of glucose-6-phosphate-1-dehydrogenase gene (zwf) with destroying pgi, it was found to further improve the purity of isopropyl alcohol.
By performing these genetic modifications, it is possible to reduce the acetone content in the product, also by-produced acetone as converted into isopropyl alcohol, substances required for the conversion, for example, reduce the amount of hydrogen it can.

[Comparative Example 1]
<Preparation of Escherichia coli B strain ΔpfkAΔpfkB Ltd.>
Entire base sequence of the genomic DNA of Escherichia coli is known (GenBank accession number U00096), also reported the nucleotide sequence of a gene encoding a phosphonate of Escherichia coli fructokinase 2 (sometimes hereinafter referred to as pfkB) and that (GenBank accession number K02500). To clone the nucleotide sequence region near the gene (930 bp) encoding the pfkB, ttggtacctttacatgctgtagcccagc (SEQ ID NO: 17), cgtctagataggctgatttcagtctgg (SEQ ID NO: 18) oligonucleotide primers shown in Eittctagaatcatcaccaacctgtcg (SEQ ID NO: 19) and Gatattgccgaaagcgatcc (SEQ ID NO: 20) was four synthesis. 'The KpnI recognition site at the end side, the primer 5 of SEQ ID NO: 18 and 19' primer 5 of SEQ ID NO: 17 an XbaI recognition site at the end side, of SEQ ID NO: 20 primer 5 'end side PstI recognition sites, respectively It has.

To prepare the genomic DNA of Escherichia coli MG1655 strain (ATCC700926), resulting genomic DNA as a template, the primer pair SEQ ID NO: 17 and SEQ ID NO: 18, amplified a DNA fragment of about 1.0kb by PCR and (sometimes hereinafter referred to as pfkB-L fragment). Moreover, the primer pairs SEQ ID NO: 19 and SEQ ID NO: 20, (sometimes hereinafter referred to as pfkB-R fragment) about DNA fragment 1.0kb was amplified by performing PCR. Separate these DNA fragments by agarose electrophoresis, recovered, the pfkB-L fragment with KpnI and XbaI, was digested respectively pfkB-R fragment with XbaI and PstI. And the digested fragments two were mixed with KpnI and PstI digests of temperature-sensitive plasmid pTH18cs1 (GenBank accession number AB019610), it was reacted with T4DNA ligase, transformed into Escherichia coli DH5α competent cells (Toyobo Co., Ltd.) conversion to obtain a transformant that grew at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml. The resulting plasmid was recovered from the transformants was confirmed that the two fragments of 5 'upstream adjacent fragment and the 3'-downstream adjacent fragment of the gene encoding the pfkB is correctly inserted into pTH18cs1. The resulting plasmid was digested with XbaI, it was blunt-ended by T4DNA polymerase. And the DNA fragment, transposon Tn10 the (GenBank accession number J01830) as a template, to give the tetracycline resistance gene PCR was performed using oligonucleotides Shiagctgactcgacatcttggttaccg (SEQ ID NO: 21) and Shieigctgcaagagggtcattatatttcg (SEQ ID NO: 22), the DNA fragment T4DNA polynucleotide kinased and ligated with the preceding blunt-ended plasmid. Then, it transformed into Escherichia coli DH5α competent cell to obtain a transformant that grew at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml and tetracycline 20 [mu] g / ml. The resulting plasmid was recovered from the transformants was confirmed that the tetracycline resistance gene is properly inserted between the 5 'upstream adjacent fragment and the 3'-downstream adjacent fragment of the gene encoding the pfkB.

The thus obtained plasmid was transformed into Escherichia coli B strain (ATCC11303), and cultured overnight at 30 ° C. in LB agar plates containing chloramphenicol at a concentration of 10 [mu] g / ml, to obtain a transformant. The obtained transformant was inoculated into LB liquid medium containing tetracycline 20 [mu] g / ml, and cultured overnight at 30 ° C.. Then applying a portion of the culture on LB agar plates containing tetracycline 20 [mu] g / ml, to obtain colonies grown at 42 ° C.. The obtained colonies LB liquid medium containing tetracycline 20 [mu] g / ml, and cultured for 24 hours at 30 ° C., to give an additional colonies growing in the coating to 42 ° C. on an LB agar plate containing tetracycline 20 [mu] g / ml.

To pick up 100 colonies were randomly from the emerged colonies, respectively LB agar plates containing tetracycline 20 [mu] g / ml and grown on LB agar plates containing chloramphenicol 10 [mu] g / ml, LB agar containing tetracycline I chose a clone of chloramphenicol sensitivity to growth only to the plate. Further using chromosomal DNA of these clones, PCR was carried out using the primer pair SEQ ID NO: 17 and SEQ ID NO: 20 to amplify the about 3.0kbp fragment pfkB gene neighboring region including the pfkB gene in the wild strain B strain, pfkB gene were selected strain amplification will be obtained about 3.2kbp fragment is substituted with the tetracycline resistance gene. The resulting strains B strain pfkB gene deletion strain was designated (hereinafter △ sometimes abbreviated as pfkB Ltd.) and.

Entire base sequence of the genomic DNA of Escherichia coli is known (GenBank accession number U00096), also reported the nucleotide sequence of a gene encoding a phosphonate of Escherichia coli fructokinase -1 (sometimes hereinafter referred to as pfkA) and that (GenBank accession number U00096 4105575-4106537). To clone the nucleotide sequence region near the gene (963bp) encoding pfkA, atctgcagtactagcgtcagttgatagc (SEQ ID NO: 23) oligonucleotide primers shown in Shijitictagatcctgctgaattgattcagg (SEQ ID NO: 24), tctctagactgaaaccgatgacagaagc (SEQ ID NO: 25) and Aaggtaccaggcaatcagtacatcg (SEQ ID NO: 26) was four synthesis. 'The PstI recognition site at the end side, the primer 5 of SEQ ID NO: 24 and 25' primer 5 of SEQ ID NO: 23 an XbaI recognition site at the end side, the primer of SEQ ID NO: 26 5 'end side KpnI recognition sites, respectively It has.

To prepare the genomic DNA of Escherichia coli MG1655 strain (ATCC700926), resulting genomic DNA as a template, the primer pair SEQ ID NO: 23 and SEQ ID NO: 24, amplified a DNA fragment of about 1.0kb by PCR and (sometimes hereinafter referred to as pfkA-L fragment). Moreover, the primer pairs SEQ ID NO: 25 and SEQ ID NO: 26, (sometimes hereinafter referred to as pfkA-R fragment) amplified a DNA fragment of about 1.0kb by performing PCR. Separate these DNA fragments by agarose electrophoresis, recovered, the pfkA-L fragment with PstI and XbaI, was digested respectively pfkA-R fragment with XbaI and KpnI. And the digested fragments two were mixed with KpnI and PstI digests of temperature-sensitive plasmid pTH18cs1 (GenBank accession number AB019610), it was reacted with T4DNA ligase, transformed into Escherichia coli DH5α competent cells (Toyobo Co., Ltd.) conversion to obtain a transformant that grew at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml. The resulting plasmid was recovered from the transformants was confirmed that the two fragments of 5 'upstream adjacent fragment and the 3'-downstream adjacent fragment of the gene encoding pfkA is correctly inserted into pTH18cs1. The resulting plasmid was digested with XbaI, it was blunt-ended by T4DNA polymerase. Coupled with the DNA fragment, and pUC4K plasmid (GenBank accession number X06404) (Pharmacia) DNA fragment was blunt-ended by further T4DNA polymerase kanamycin resistance gene obtained by by digestion with EcoRI using T4DNA ligase did. Then, it transformed into Escherichia coli DH5α competent cell to obtain a transformant that grew at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml kanamycin 50 [mu] g / ml. The resulting plasmid was recovered from the transformants was confirmed that the kanamycin resistance gene is properly inserted between the 5 'upstream adjacent fragment and the 3'-downstream adjacent fragment of the gene encoding the pfkA.

The thus obtained plasmid was transformed into Escherichia coli ΔpfkB strain, were cultured overnight at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml kanamycin 50 [mu] g / ml, to obtain a transformant. The obtained transformant was inoculated into LB liquid medium containing kanamycin 50 [mu] g / ml, and cultured overnight at 30 ° C.. Then applying a portion of the culture on LB agar plates containing kanamycin 50 [mu] g / ml, to obtain colonies grown at 42 ° C.. The obtained colonies LB liquid medium containing kanamycin 50 [mu] g / ml, and cultured for 24 hours at 30 ° C., to give an additional colonies growing in the coating to 42 ° C. in LB agar plates containing kanamycin 50 [mu] g / ml.

To pick up 100 colonies were randomly from the emerged colonies, respectively LB agar plates containing kanamycin 50 [mu] g / ml and grown on LB agar plates containing chloramphenicol 10 [mu] g / ml, LB agar containing kanamycin I chose a clone of chloramphenicol sensitivity to growth only to the plate. Further using chromosomal DNA of these clones, PCR was carried out using the primer pair SEQ ID NO: 7 and SEQ ID NO: 10 to amplify the about 3.0kbp fragment of pfkA gene neighboring region containing pfkA gene in the wild strain B strain, pfkA gene were selected strain amplification will be obtained about 3.1kbp fragment is substituted with the kanamycin resistance gene. The resulting strain B strain pfkA, was named pfkB gene deletion strain (sometimes hereinafter abbreviated as △ PfkAderutapfkB Ltd.).
The Escherichia coli MG1655 strain and Escherichia coli B strains can be obtained from the American Type Culture Collection.

<△ in pfkApfkB strain, Escherichia coli thiolase gene, Escherichia coli CoA transferase gene, Clostridial bacterium derived acetoacetate decarboxylase gene, construction of a transformant transformed with a Clostridium bacteria from isopropyl alcohol dehydrogenase gene expression vector>
Transforming plasmid pGAP-Iaaa prepared in Example 2 to △ PfkAderutapfkB strain competent cells, LB Broth containing ampicillin 50 [mu] g / mL, by culturing overnight at 37 ° C. in Miller agar plate, Escherichia coli pGAP- It was obtained Iaaa / B △ pfkAΔpfkB strain.

<Isopropyl alcohol production from glucose by E. coli pGAP-Iaaa / B △ pfkAΔpfkB strains using 3L fermenter>
It was produced isopropyl alcohol in the same manner as in Example 3. However, bacterial cell with pGAP-Iaaa / B △ pfkAΔpfkB strain. Sampling the bacterial cell cultures to 120 hours after the start of culture, after removal of cells by centrifugation, the accumulation of the product in the resulting culture supernatant was measured according to a conventional method by HPLC. The measurement value is the sum of the culture medium and the trap water (9 L) in after culturing. The concentration and purity isopropyl alcohol product after cultivation are shown in Table 2.

Figure JPOXMLDOC01-appb-T000002

The results of this result as in Example 3, when E. coli was disrupted gene (pgi) encoding glucose-6-phosphate isomerase which is one of enzymes of the glycolytic pathway having originally improved purity isopropyl alcohol to contrary to the purity it was confirmed to be reduced in the case of disrupting a gene (pfkA and pfkB) encoding phosphofructokinase is an enzyme similar glycolysis.

[Example 4]
<Isopropyl alcohol production from sucrose by Escherichia coli pGAP-Ia-cscA / GAPpatoD genome-inserted variant pgi disruption strain using 3L fermenter>
(Substitution of GAPDH promoter of the Escherichia coli B strain genome on atoD promoter)
Entire base sequence of the genomic DNA of Escherichia coli MG1655 strain is known (GenBank accession number U00096), the gene encoding the CoA transferase α subunit of Escherichia coli MG1655 strain (hereinafter, sometimes abbreviated as atoD) also nucleotide sequence has been reported. That atoD are described in 2321469 to 2322131 of the Escherichia coli MG1655 strain genome sequence described in GenBank accession number U00096.

The nucleotide sequence of a promoter necessary for expressing the above gene, GenBank accession in the nucleotide sequence information of the number X02662, glyceraldehyde 3-phosphate dehydrogenase from Escherichia coli are described in 397-440 (hereinafter GAPDH can be used promoter sequence of a) may be referred to as a. cgctcaattgcaatgattgacacgattccg using genomic DNA of Escherichia coli MG1655 strain as a template to obtain the GAPDH promoter (SEQ ID NO: 27), and amplified by PCR method by Eishieijieieititcgctatttgttagtgaataaaagg (SEQ ID NO: 28), limits the resulting DNA fragments enzymes MfeI and to obtain a DNA fragment encoding the GAPDH promoter about 100bp by digestion with EcoRI. The resulting DNA fragment and plasmid pUC19 to (GenBank accession number X02514) was digested with restriction enzymes EcoRI, mixed with and further the alkaline phosphatase treatment after binding by using a ligase, Escherichia coli DH5α strain competent cells ( transformed into Toyobo Co., Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. Resulting colonies 10 was cultured overnight at each 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, plasmids were recovered, when digested with restriction enzymes EcoRI and KpnI, clone having an GAPDH promoter is not cut and, further, it was pUCgapP those GAPDH promoter Ensure DNA sequence has been inserted correctly. The resulting pUCgapP was digested with restriction enzymes EcoRI and KpnI.

To obtain further atoD, Shijieieititishijishitijijitijijieieishieitieitijieieiaacaaaattgatgacattacaagac using genomic DNA of Escherichia coli MG1655 strain as a template (SEQ ID NO: 29), and amplified by PCR method by Jishijijitiaccttatttgctctcctgtgaaacg (SEQ ID NO: 30), limits the resulting DNA fragments enzyme It was obtained atoD fragment of approximately 690bp by digestion with EcoRI and KpnI. This DNA fragment was mixed with pUCgapP digested with previously restriction enzymes EcoRI and KpnI, then ligated using a ligase, and transformed into Escherichia coli DH5α strain competent cell (Toyobo Co., Ltd. DNA-903), ampicillin to obtain a transformant growing on an LB agar plate containing 50 [mu] g / mL. The resulting plasmid was recovered from the cells, to confirm that the atoD is properly inserted, the plasmid was named PGAPatoD.
The Escherichia coli MG1655 strain can be obtained from the American Type Culture Collection.

As described above, it has also been reported atoD nucleotide sequence in genomic DNA of Escherichia coli MG1655 strain. It was created on the basis of the Escherichia coli MG1655 strain 5 'genetic information region near atoD of using Jishitishitieigatgctgaaatccactagtcttgtc (SEQ ID NO: 31) and Tieishitigcagcgttccagcaccttatcaacc (SEQ ID NO: 32), the genomic DNA of Escherichia coli MG1655 strain as a template PCR amplified a DNA fragment of about 1.1kbp by performing.

Furthermore, using primers of SEQ ID NO: 30 prepared based on the Escherichia coli MG1655 strain GAPDH promoter sequence was prepared based on the information Jijitishitagagcaatgattgacacgattccg (SEQ ID NO: 33) and atoD sequence information of the Escherichia coli MG1655 strain , PCR was carried out with the expression vector pGAPatoD prepared above as a template to obtain a DNA fragment of about 790bp consisting GAPDH promoter and atoD.

Each fragment obtained by the above restriction enzymes PstI and XbaI, was digested with XbaI and KpnI, the fragments temperature sensitive plasmid pTH18cs1 (GenBank accession number AB019610) [Hashimoto-Gotoh, T., Gene, 241, 185-191 (2000)] it was mixed with a fragment obtained by digesting with PstI and KpnI, and was ligated using ligase, and transformed into DH5α strain, at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml to obtain a growth for transformants. The resulting colonies of chloramphenicol 10 [mu] g / ml and incubated overnight at 30 ° C. in LB liquid medium containing, was recovered the plasmid from the obtained bacterial cells. This plasmid was transformed into Escherichia coli B strain (ATCC11303), and cultured overnight at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml, to obtain a transformant. The obtained transformant was inoculated into LB liquid medium containing chloramphenicol 10 [mu] g / ml, and cultured overnight at 30 ° C.. The resulting culture cells were spread on LB agar plates containing chloramphenicol 10 [mu] g / ml, to obtain colonies were cultured at 42 ° C.. The resulting colonies 2 hours and incubated at 30 ° C. in LB liquid medium without antibiotics, to obtain colonies grown in the coating to 42 ° C. in LB agar plates without antibiotics.

Each pick up 100 colonies were randomly from the emerged colonies, grown on an LB agar plate containing LB agar plate and chloramphenicol 10 [mu] g / ml without antibiotics, chloramphenicol-sensitive clones the chosen. Furthermore amplify the approximately 790bp fragment containing the GAPDH promoter and atoD by PCR from the chromosome DNA of these clones, were selected strains atoD promoter region is substituted with the GAPDH promoter, cloned Escherichia coli B that satisfies the above It was designated as stock atoD deletion GAPpatoD genome-inserted strain.
In addition, Escherichia coli strain B (ATCC11303) can be obtained from the American Type Culture Collection is a cell, microorganism, gene bank.

(Preparation of Escherichia coli GAPpatoD genome-inserted variant pgi disrupted strain)
Entire base sequence of the genomic DNA of Escherichia coli is known (GenBank accession number U00096), has also been reported nucleotide sequence of the gene encoding (there is hereafter referred to as pgi) phosphoglucose isomerase of Escherichia coli ( GenBank accession number X15196). To clone the nucleotide sequence region near the gene (1,650Bp) encoding pgi, caggaattcgctatatctggctctgcacg (SEQ ID NO: 34), cagtctagagcaatactcttctgattttga g (SEQ ID NO: 35), shown in Shieijitictagatcatcgtcgatatgtaggcc (SEQ ID NO: 36) and Jieishishitgcagatcatccgtcagctgtacgc (SEQ ID NO: 37) It was four synthetic oligonucleotide primers. 'The EcoRI recognition site at the terminal side, the primers of SEQ ID NO: 2 and 3 are 5' primer 5 of SEQ ID NO: 1 an XbaI recognition site at the end side, of SEQ ID NO: 4 primers 5 'end side PstI recognition sites, respectively It has.

To prepare the genomic DNA of Escherichia coli MG1655 strain (ATCC700926), resulting genomic DNA as a template, the primer pair SEQ ID NO: 34 and SEQ ID NO: 35, amplified a DNA fragment of about 1.0kb by PCR and (sometimes hereinafter referred to as pgi-L fragment). Moreover, the primer pairs SEQ ID NO: 37 and SEQ ID NO: 36, (sometimes hereinafter referred to as pgi-R fragment) about DNA fragment 1.0kb was amplified by performing PCR. Separate these DNA fragments by agarose electrophoresis, recovered, the pgi-L fragment with EcoRI and XbaI, was digested respectively pgi-R fragment with XbaI and PstI. And the digested fragments two were mixed with EcoRI and PstI digests of temperature-sensitive plasmid pTH18cs1 (GenBank accession number AB019610), it was reacted with T4DNA ligase, transformed into Escherichia coli DH5α competent cells (Toyobo Co., Ltd.) conversion to obtain a transformant that grew at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml. The resulting plasmid was recovered from the transformants was confirmed that the two fragments of 5 'upstream adjacent fragment and the 3'-downstream adjacent fragment of the gene encoding pgi is correctly inserted into pTH18cs1. The resulting plasmid was digested with XbaI, it was blunt-ended by T4DNA polymerase. Coupled with the DNA fragment, and pUC4K plasmid (GenBank accession number X06404) (Pharmacia) DNA fragment was blunt-ended by further T4DNA polymerase kanamycin resistance gene obtained by by digestion with EcoRI using T4DNA ligase did. Then, it transformed into Escherichia coli DH5α competent cell to obtain a transformant that grew at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml kanamycin 50 [mu] g / ml. The resulting plasmid was recovered from the transformants was confirmed that the kanamycin somatic gene is properly inserted between the 5 'upstream adjacent fragment and the 3'-downstream adjacent fragment of the gene encoding pgi.

Was transformed thus obtained plasmid into Escherichia coli B strain atoD deletion GAPpatoD genome-inserted strain described above was cultured overnight at 30 ° C. on an LB agar plate containing chloramphenicol 10 [mu] g / ml kanamycin 50 [mu] g / ml , to obtain a transformant. The obtained transformant was inoculated into LB liquid medium containing kanamycin 50 [mu] g / ml, and cultured overnight at 30 ° C.. Then applying a portion of the culture on LB agar plates containing kanamycin 50 [mu] g / ml, to obtain colonies grown at 42 ° C.. The obtained colonies LB liquid medium containing kanamycin 50 [mu] g / ml, and cultured for 24 hours at 30 ° C., to give an additional colonies growing in the coating to 42 ° C. in LB agar plates containing kanamycin 50 [mu] g / ml.

To pick up 100 colonies were randomly from the emerged colonies, respectively LB agar plates containing kanamycin 50 [mu] g / ml and grown on LB agar plates containing chloramphenicol 10 [mu] g / ml, LB agar containing kanamycin I chose a clone of chloramphenicol sensitivity to growth only to the plate. Further by PCR from the chromosome DNA of these clones of interest was amplified about 3.7kbp fragment of pgi gene neighboring region containing the pgi gene in Escherichia coli B strain atoD deletion GAPpatoD genome-inserted strain, pgi gene to a kanamycin resistance gene the strain amplification will be obtained about 3.3kbp fragment by substituted and selected, (sometimes hereinafter abbreviated as GAPpatoD genomic insert △ pgi Ltd.) inserted GAPpatoD the resulting strain genomic strain pgi gene deletion strain It was named.
The Escherichia coli MG1655 strain can be obtained from the American Type Culture Collection.

(Construction of Clostridial bacterium derived acetoacetate decarboxylase gene, Clostridial bacterium from isopropyl alcohol dehydrogenase gene, Escherichia coli O157-derived invertase gene expression vector and the expression vector transformants)
Acetoacetate decarboxylase Clostridial bacterium in GenBank accession number M55392, isopropyl alcohol dehydrogenase is described in GenBank accession number AF157307.
To obtain the isopropyl alcohol dehydrogenase gene using genomic DNA of Clostridium beijerinckii NRRL B-593 in the template, Eieitieitijishieitijishitijijitijijieieishiatatgaaaggttttgcaatgctagg (SEQ ID NO: 38), and amplified by PCR method by Jishijijieitishishititieitieiatataactactgctttaattaagtc (SEQ ID NO: 39), the resulting DNA restriction fragment enzyme SphI, to give the isopropyl alcohol dehydrogenase fragment of approximately 1.1kbp by digestion with BamHI. The resulting plasmid pBRgapP created in DNA fragments with the previous mixture of fragments obtained by digestion with restriction enzymes SphI and BamHI, was ligated using ligase, Escherichia coli DH5α strain competent cell (TOYOBO stock It was transformed into the company DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, sure the resulting plasmid was recovered from the cells IPAdh is properly inserted, the plasmid pGAP- It was named IPAdh.

To obtain the acetoacetate decarboxylase gene using genomic DNA of Clostridium acetobutylicum ATCC824 the template, Shieijijieitishishijishitijijitijijieieishieitieitijititieieieiggatgaagtaattaaacaaattagc (SEQ ID NO: 40), and amplified by PCR method by Jijieieititishijijitieishishititieishititaagataatcatatataacttcagc (SEQ ID NO: 41), the resulting DNA fragments restriction enzyme BamHI, and give acetoacetate decarboxylase fragment of approximately 700bp was digested with EcoRI. The resulting plasmid pGAP-IPAdh created in DNA fragments with the previous mixture of fragments obtained by digestion with restriction enzymes BamHI and EcoRI, then ligated using a ligase, Escherichia coli DH5α strain competent cell (manufactured by Toyo It transformed into spinning Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The obtained colony was cultured overnight at 37 ° C. in LB liquid medium containing ampicillin 50 [mu] g / mL, plasmid was recovered from the obtained microbial cells to confirm that the adc is properly inserted, pGAP this plasmid It was named -Ia.

Entire base sequence of the genomic DNA of Escherichia coli O157 strain is known (GenBank accession number AE005174), the gene encoding the invertase of Escherichia coli O157 strains reported nucleotide sequence (hereinafter, may be abbreviated as cscA) It is. That cscA are described in 3274383 to 3275816 of Escherichia coli O157 strain genome sequence described in GenBank accession number AE005174.

To obtain the cscA, atggtaccgctggtggaacatatgacgcaatctcgattgcatg (SEQ ID NO: 42) using genomic DNA of Escherichia coli O157 strain template, and amplified by PCR method by Shijieiattcttaacccagttgccagagtgc (SEQ ID NO: 43), limits the resulting DNA fragments enzyme KpnI and it was obtained cscA fragment of approximately 1470bp by digestion with EcoRI. pGAP-Ia (Clostridial bacterium derived acetoacetate decarboxylase gene, Clostridial bacterium from isopropyl alcohol dehydrogenase gene expression vectors) of the foregoing and the DNA fragment was mixed with that was digested with restriction enzymes KpnI and EcoRI, using a ligase after binding, transformed into Escherichia coli DH5α strain competent cell (Toyobo Co., Ltd. DNA-903), to obtain a transformant growing on an LB agar plate containing ampicillin 50 [mu] g / mL. The resulting plasmid was recovered from the cells, to confirm that the cscA is properly inserted, the plasmid was named pGAP-Ia-cscA.

(Construction of pGAP-Ia-cscA / GAPpatoD genome insertion △ pgi Ltd.)
Transforming the aforementioned plasmid pGAP-Ia-cscA into competent cells of B strain GAPpatoD genomic insert △ pgi strain by culturing overnight at 37 ° C. in LB agar plates containing ampicillin 50 [mu] g / mL, Escherichia coli pGAP -Ia-cscA / GAPpatoD genomic insert △ pgi strain (sometimes hereinafter abbreviated as pGAP-Ia-cscA / BGAPpatoD △ pgi strain) was obtained.

(Isopropyl alcohol production from sucrose by pGAP-Ia-cscA / GAPpatoD genomic insert △ pgi strain)
It produced isopropyl alcohol in the same manner as in Example 3. However, a sugar source was used 50% (w / w) sucrose instead of glucose. Sampling the bacterial cell cultures to 120 hours after the start of culture, after removal of cells by centrifugation, the accumulation of the product in the resulting culture supernatant was measured according to a conventional method by HPLC. The measurement value is the sum of the culture medium and the trap water (9 L) in after culturing. The density of the product after the culture, showed a purity of isopropyl alcohol in Tables 3.

Figure JPOXMLDOC01-appb-T000003

These results, isopropyl alcohol-producing Escherichia coli further comprising a sucrose hydrolase gene, even when the raw material sucrose, disrupting the gene (pgi) encoding glucose-6-phosphate isomerase inherent E. coli purity isopropyl alcohol that were improved by. Further, it was confirmed that also increases the amount of isopropyl alcohol produced.

That is, according to the present invention can provide a useful isopropyl alcohol-producing Escherichia coli and isopropyl alcohol-producing method to produce isopropyl alcohol with high purity.

Disclosure of 2009 filed October 29, Japanese Patent Application No. 2009-249418 its entirety is incorporated herein by reference.
All documents described herein, patent applications, and technical standards, each individual publication, patent application, and that the technical specification is incorporated by reference to the same extent as if marked specifically and individually, It incorporated by reference herein.

Claims (8)

  1. Isopropyl alcohol-producing Escherichia coli glucose-6-phosphate isomerase activity is provided with isopropyl alcohol production system with inactivated.
  2. Further, isopropyl alcohol-producing Escherichia coli according to claim 1, wherein the glucose-6-phosphate-1-dehydrogenase activity is enhanced.
  3. The isopropyl alcohol-producing Escherichia coli, acetoacetate decarboxylase activity, isopropyl alcohol dehydrogenase activity, CoA transferase activity, and isopropyl alcohol-producing Escherichia coli according to claim 1 or claim 2 thiolase is active E. coli that has been granted.
  4. The acetoacetate decarboxylase activity, isopropyl alcohol dehydrogenase activity, the CoA transferase activity and thiolase activity, respectively, encoding each enzyme derived from at least one member selected from the group consisting of Clostridium bacteria, Bacillus bacteria and Escherichia bacteria claim 3, wherein the isopropyl alcohol-producing Escherichia coli is obtained by introduction of a gene.
  5. The acetoacetate decarboxylase activity and isopropyl alcohol dehydrogenase activity, which was obtained by introduction of a gene encoding each enzyme derived from Clostridium bacteria, the CoA transferase activity and thiolase activity, the enzyme derived from Escherichia bacteria isopropyl alcohol-producing Escherichia coli according to claim 3, wherein those obtained by introduction of a gene encoding a.
  6. The acetoacetate decarboxylase activity, which is obtained by the introduction of a gene that encodes an enzyme derived from Clostridium acetobutylicum, the isopropyl alcohol dehydrogenase activity is obtained by introduction of a gene that encodes an enzyme derived from Clostridium beijerinckii ones, and the said CoA transferase activity and thiolase activity, according to claim 3, wherein the isopropyl alcohol-producing Escherichia coli is obtained by introduction of a gene encoding each enzyme derived from Escherichia coli.
  7. Further, according to claim 1 any one of claims isopropyl alcohol-producing Escherichia coli according to claim 6 wherein at least having a sucrose hydrolase gene of the sucrose non-PTS gene group.
  8. Isopropyl alcohol production method comprising producing isopropyl alcohol from a plant-derived material with isopropyl alcohol-producing Escherichia coli according to any one of claims 1 to 7.
PCT/JP2010/068631 2009-10-29 2010-10-21 Isopropyl alcohol-producing bacterium and method for producing isopropyl alcohol WO2011052482A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2009249418 2009-10-29
JP2009-249418 2009-10-29

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
JP2011538386A JPWO2011052482A1 (en) 2009-10-29 2010-10-21 Isopropyl alcohol-producing bacteria and isopropyl alcohol production method

Publications (1)

Publication Number Publication Date
WO2011052482A1 true true WO2011052482A1 (en) 2011-05-05

Family

ID=43921905

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2010/068631 WO2011052482A1 (en) 2009-10-29 2010-10-21 Isopropyl alcohol-producing bacterium and method for producing isopropyl alcohol

Country Status (2)

Country Link
JP (1) JPWO2011052482A1 (en)
WO (1) WO2011052482A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013022070A1 (en) * 2011-08-11 2013-02-14 三井化学株式会社 Method for producing isopropyl alcohol by continuous culture

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001346578A (en) * 2000-04-26 2001-12-18 Ajinomoto Co Inc Amino acid producing bacterium and method for producing amino acid
WO2007041269A2 (en) * 2005-09-29 2007-04-12 E. I. Du Pont De Nemours And Company Fermentive production of four carbon alcohols
JP2007510411A (en) * 2003-11-06 2007-04-26 メタボリック エクスプローラ Optimized microbial strains for Nadph consumption biosynthetic pathway
WO2009008377A1 (en) * 2007-07-11 2009-01-15 Mitsui Chemicals, Inc. Isopropyl alcohol-producing bacterium and method of producing isopropyl alcohol using the same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001346578A (en) * 2000-04-26 2001-12-18 Ajinomoto Co Inc Amino acid producing bacterium and method for producing amino acid
JP2007510411A (en) * 2003-11-06 2007-04-26 メタボリック エクスプローラ Optimized microbial strains for Nadph consumption biosynthetic pathway
WO2007041269A2 (en) * 2005-09-29 2007-04-12 E. I. Du Pont De Nemours And Company Fermentive production of four carbon alcohols
WO2009008377A1 (en) * 2007-07-11 2009-01-15 Mitsui Chemicals, Inc. Isopropyl alcohol-producing bacterium and method of producing isopropyl alcohol using the same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HANAI T. ET AL.: "Engineered synthetic pathway for isopropanol production in esherichia coli.", APPL. ENVIRON. MICROB., vol. 73, no. 24, 2007, pages 7814 - 7818 *
JOJIMA T. ET AL.: "Production of isopropanol by metabolically engineered Escherichia coli.", APPL. MICROBIOL. BIOTECHNOL., vol. 77, 2008, pages 1219 - 1224, XP019586231, DOI: doi:10.1007/s00253-007-1246-8 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013022070A1 (en) * 2011-08-11 2013-02-14 三井化学株式会社 Method for producing isopropyl alcohol by continuous culture
JPWO2013022070A1 (en) * 2011-08-11 2015-03-05 三井化学株式会社 Isopropyl alcohol production method by continuous culture
US9150885B2 (en) 2011-08-11 2015-10-06 Mitsui Chemicals, Inc. Method for producing isopropyl alcohol by continuous culture

Also Published As

Publication number Publication date Type
JPWO2011052482A1 (en) 2013-03-21 application

Similar Documents

Publication Publication Date Title
US20070072279A1 (en) Evolved micro-organisms for the production of 1,2-propanediol
US20100330635A1 (en) Organisms for the production of 1,3-butanediol
WO2005106005A1 (en) Process for producing hydroxycarboxylic acid
WO2001012833A2 (en) Process for the biological production of 1,3-propanediol
US20130210090A1 (en) Methods of making nylon intermediates from glycerol
US20110014669A1 (en) Production of 1,4 Butanediol in a Microorganism
WO2005113745A1 (en) Succinic acid-producing bacterium and process for producing succinic acid
WO2012053905A1 (en) Production of butanol from carbon monoxide by a recombinant microorganism
WO2010076324A1 (en) Method for the preparation of diols
WO2005113744A1 (en) Succinic acid-producing bacterium and process for producing succinic acid
WO2010141920A2 (en) Microorganisms for the production of 1,4-butanediol and related methods
WO2010030711A2 (en) Microorganisms for the production of 1,4-butanediol
US20100261239A1 (en) Metabolically engineered microorganism useful for the production of 1,2-propanediol
WO2008116852A1 (en) New micro-organisms for the production of 1,2-propanediol obtained by a combination of evolution and rational design.
WO2011047101A1 (en) Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-coa, putrescine and related compounds, and methods related thereto
WO2008116853A1 (en) Microorganisms and methods for production of 1,2-propanediol and acetol
WO2013007786A1 (en) Recombinant microorganism for the production of useful metabolites
JP2010207094A (en) Method for producing protocatechuic acid
Tseng et al. Biosynthesis of chiral 3-hydroxyvalerate from single propionate-unrelated carbon sources in metabolically engineered E. coli
WO2005033324A1 (en) Biocatalyst for producing d-lactic acid
US20110039323A1 (en) Isoprene Production
WO2012115527A2 (en) Recombinant microorganisms and uses therefor
US20100159543A1 (en) Bacterial cells having a glyoxylate shunt for the manufacture of succinic acid
Wang et al. Glycerol dehydrogenase plays a dual role in glycerol metabolism and 2, 3-butanediol formation in Klebsiella pneumoniae
WO2013018734A1 (en) Microorganism having carbon dioxide fixation pathway introduced thereinto

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10826614

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2011538386

Country of ref document: JP

ENP Entry into the national phase in:

Ref document number: 2011538386

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10826614

Country of ref document: EP

Kind code of ref document: A1