JP6006404B2 - Anti-BLyS antibody - Google Patents

Description

  The present invention is in the field of biopharmaceuticals and relates to anti-BLyS antibodies and uses thereof. Such an anti-BLyS antibody can bind to a B lymphocyte stimulating factor, and can inhibit the binding between the B lymphocyte stimulating factor and the receptor BR3-Fc. It further relates to a humanized anti-BLyS antibody having a low affinity with MHC II factor and to its use.

  Systemic lupus erythematosus (SLE), a type of autoimmune disease, involves multiple tissues and organs such as skin, joints, heart, lungs, kidneys, blood, and brain. Yes, it progresses diffusely and repeats remission and recurrence. Systemic lupus erythematosus occurs primarily in African Caribbeans, Asians, and Hispanics. On the other hand, it rarely occurs in Caucasian (white race). According to the Lupus Foundation of America, there are at most 300,000 people who have systemic lupus erythematosus in the United States. Data surveillance firm estimates that 2.2 million people suffer from systemic lupus erythematosus in China, India and Mexico alone. There are 1 million patients suffering from systemic lupus erythematosus in China, the most common in the world. Since the initial symptoms of systemic lupus erythematosus are not evident, the actual number of patients may be greater than current estimates. For this reason, there has been a strong need for diagnosis and treatment of SLE in the clinic.

The cause of SLE is complex and unclear. It is not caused by one factor, but is thought to be related to various factors such as heredity, environment, sex hormones and immunity.
According to many current scientists' views, the etiology of SLE is due to the fact that at the cellular level, autoreactive B cells remain in peripheral tissues very long. Such B cells produce human self antigens and cause autoimmunity. For this reason, if the growth and proliferation of the initial B cells can be inhibited, the treatment of SLE is also possible.

  B Lymphocyte Stimulator (BLyS) is a tumor necrosis factor (TNF) family belonging to Tall-1 (TNF and Apol related leukocyte expressed ligand 1), BAFF (B cell activating factor belonging to the TNF family), known as THANK (TNF homologues that activate apoptosis, NF-κB and JNK). BLyS is a new cytokine that was discovered and cloned by Scarlet soldiers in 1999. As a co-stimulator of B lymphocytes, BLyS activates B cell proliferation and differentiation exclusively in the presence of anti-IgM and IL-4 and plays a very important role in humoral immunity. Moreover, overexpression of BLyS in the body is closely related to autoimmune diseases.

According to in vitro experiments, when B cells are previously activated by IgM, ByS proliferates in large quantities and secretes IgM and IgA. However, in B cells in the subsequent period, no obvious effect by such stimulation is observed. Further research shows that BLyS acts primarily on pre-B, immature B and activated lymphoid cells and has no effect on plasma cells and lymphoid pluripotent stem cells It has been shown. Like most cytokines, BLyS stimulates downstream signaling through B cell surface receptors. Many research groups have confirmed the presence of receptors that bind to BLyS: B cell activator receptors (BR3, BLyS receptor 3 or BAFF-R), transmembrane activator-1 and There are calcium modulator and cyclophilin ligand-interactor (TACI) and B cell mature antigen (BCMA).
Because of this specificity, BLyS is very suitable as a target for autoimmune diseases and lymphomas caused by B cell antibodies.

  It has been shown in vivo and in vitro that therapeutic effects of SLE can be obtained by effectively inhibiting B cell growth and secretion of IgA and IgM with therapeutic anti-BLyS antibodies (Edwards BM et al. al, The remarkable flexibility of the human antibody repertoire; isolation of over one thousand different antibodies to a single protein, BLyS.J Mol Biol. 2003 Nov 14; 334 (1): 103-18; Baker KP et al, Generation and characterization of LymphoStat-B, a human monoclonal antibody that antagonizes the bioactivities of B lymphocyte stimulator. Arthritis Rheum. 2003 Nov; 48 (11): 3253-65). The anti-BLyS antibody valve Benlysta was developed by Human Genome Sciences, Inc., and is the first new drug for the treatment of SLE in 60 years. Since only B cells stimulated by Benlista BLyS are targeted, there are very few side effects during treatment compared to chemotherapeutic agents. For this reason, a safe and effective treatment can be performed for SLE patients. In recent years, research and clinical application of treatments targeting BLyS are rapidly progressing, and many companies other than Human Genome Science use fusion proteins modified based on BLyS or their receptors. Genentech of the United States developed BR3-FC, ZymoGenetics developed TACI-FC, and Amgen developed polypeptide-FC. Compared to Benlista, these drugs are less specific, have less binding power, are relatively less therapeutic, and are more toxic. All three drugs were discontinued or terminated in Phase II clinical trials. For this reason, it can be said that an anti-BLyS antibody drug is a correct and effective drug treatment for such a target.

  Benlista is provided by a phage display library. The disadvantages of the phage display library are as follows: heavy chain and light chain pairing is considered artificial (Greg Winter, et al., Making Antibodies by Phage Display Technology). Annual Review of Immunology Vol. 12: 433-455); the affinity of candidate antibodies is low because the library is constructed from immature human PBMC (Edwards BM, et al., The remarkable flexibility of The human antibody repertoire; isolation of over one thousand different antibodies to a single protein, BLyS. J Mol Biol. 2003 Nov 14; 334 (1): 103-18); Polesel D, et al., High affinity, developability and functional size: the holy grail of combinatorial antibody library generation. Molecules. 2011 May 3 ; 16 (5): 3675-700)

  In this technical field, anti-BLyS antibodies still require the following characteristics: to be produced using, for example, humanized mouse antibody technology, etc., without using a phage display library; Inhibiting the binding of B lymphocyte stimulating factor to its receptor BR3-Fc3 by binding to the factor and having high affinity; low antigenicity; and / or with MHC-II receptor Minimizing immune response while increasing affinity (with B lymphocyte stimulator) by having weak affinity.

  In one aspect, the present invention provides anti-BLyS antibodies or functional variants thereof. As a light chain CDR1, CDR2, and CDR3 of the anti-BLyS antibody, as well as a heavy chain CDR1, CDR2, and CDR3, one set is selected from the following sets.

In one aspect, the amino acid sequence of the light chain variable region and the amino acid sequence of the heavy chain variable region of the anti-BLyS antibody are selected from the following sets:
a: the amino acid sequence represented by SEQ ID NO. 31 (SEQ ID NO: 31) and SEQ ID NO. 32, or a functional variant thereof;
b: the amino acid sequence represented by SEQ ID NO. 33 and SEQ ID NO. 34, or a functional variant thereof;
c: the amino acid sequence represented by SEQ ID NO. 35 and SEQ ID NO. 36, or a functional variant thereof;
d: an amino acid sequence represented by SEQ ID NO. 37 and SEQ ID NO. 38, or a functional variant thereof;
e: Amino acid sequence represented by SEQ ID NO. 39 and SEQ ID NO. 40 or a functional variant thereof.

  In a preferred embodiment, the anti-BLyS antibody of the invention is humanized.

In one embodiment, the amino acid sequence of the light chain variable region and the amino acid sequence of the heavy chain variable region of the anti-BLyS antibody are selected from the following groups:
I: amino acid sequences represented by SEQ ID NO. 41 and SEQ ID NO. 42, or functional variants thereof;
II: The amino acid sequence represented by SEQ ID NO. 43 and SEQ ID NO. 44, or a functional variant thereof;
III: amino acid sequences represented by SEQ ID NO. 45 and SEQ ID NO. 46 or functional variants thereof;
IV: An amino acid sequence represented by SEQ ID NO. 47 and SEQ ID NO. 48, or a functional variant thereof.

  In a preferred embodiment, the BLyS antibody further comprises a human light chain constant region and a heavy chain constant region, and a light chain variable region and a heavy chain variable region that bind to the light chain constant region and the heavy chain constant region, respectively. In one embodiment, the human light chain constant region is a human light chain kappa constant region. In one embodiment, the human heavy chain constant region is a human heavy chain Fc fragment.

  The present invention further provides a DNA molecule encoding the anti-BLyS antibody according to the present invention. The DNA molecule preferably has a nucleic acid sequence selected from SEQ ID NOs. 49-58.

  The present invention provides a recombinant DNA vector comprising the DNA molecule of the anti-BLyS antibody according to the present invention.

  The present invention further provides a host cell comprising the recombinant DNA vector according to the present invention.

  In other embodiments, the present invention provides methods for preventing and / or treating diseases caused by excessive proliferation of B cells. Such a method comprises administering an effective amount of an anti-BLyS antibody according to any one of claims 1 to 7. In some embodiments, the disease caused by excessive proliferation of B cells is SLE, rheumatoid arthritis, ankylosing arthritis, or B cell lymphoma.

  The present invention further provides a pharmaceutical composition. Such a pharmaceutical composition comprises an effective amount of an antibody according to the invention and a pharmaceutically acceptable carrier.

  The present invention further provides methods for preparing anti-BLyS antibodies. In such a method, the antibody is obtained by culturing the host cell according to the present invention.

2 is a detection photograph of SDS-PAGE according to Example 1. 4 is a graph of flow cytometry according to Example 2. 6 is a graph of flow cytometry according to Example 3. 6 is a graph of flow cytometry according to Example 4. 6 is a graph of flow cytometry according to Example 4. 6 is a graph of flow cytometry according to Example 4. It is the result of ELISA which concerns on Example 4. FIG. It is a result of the in vitro B cell proliferation suppression which concerns on Example 9. FIG. It is the inhibitory effect of antibody molecules on lymph node hyperplasia. It is the inhibitory effect of antibody molecules on the increase in serum IgA.

  Unless defined otherwise, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art. With regard to definitions and technical terms, the person skilled in the art may in particular refer to Current Protocols in Molecular Biology (by Ausubel). The amino acid residue is represented by a three-letter and / or one-letter abbreviation indicating one of the 20 L-amino acids commonly used in the art.

  One object of the present invention is to provide anti-BLyS antibodies. Such antibodies bind to B lymphocyte stimulating factors and inhibit their binding to the BR3-Fc receptor.

  The object of the present invention can be achieved by adapting the present invention to the following technical solutions. Human BLyS cDNA is obtained by extracting RNA from human peripheral blood and further performing reverse transcription by genetic engineering using the RNA of human peripheral blood as a template. Thereafter, the gene region of human BLyS is obtained by amplifying each of the cDNAs of human BLyS as a template. Further, the human BLyS gene region is cloned into a eukaryotic expression system, introduced into a host cell, and then expressed and purified to obtain a purified protein of human BLyS.

  By using the purified protein of human BLyS as an antigen for immunizing mice, 2000 different monoclonal hybridoma cells are obtained. Among these, 211 lines of clones secreting antibodies capable of binding to the BLyS protein in total are selected by enzyme labeling reaction. By examining the binding properties of the 211 hybridoma cells to the BLyS receptor on BJAB cells, the antibody secretes an antibody capable of inhibiting the binding of biotin-labeled BLyS to the BLyS receptor on BJAB cells, and Five lines of monoclonal hybridoma cells with different characteristics are obtained. These are referred to as 1D12, 2B10, 2G3, 5A5 and 13G8, respectively.

  An ELISA is used to identify the immune properties of antibodies secreted from the resulting 5 monoclonal hybridoma cell lines. The results show that the antibodies secreted from the monoclonal hybridoma cell line selected according to the present invention are specific for BLyS and do not react with other antigens of the TNF family such as TNF-α and TNF-β. Show.

  Furthermore, RNA of each monoclonal hybridoma cell is extracted and further reverse transcribed to obtain cDNA. Thereafter, using the cDNA as a template, the DNA sequence of the variable region of each monoclonal hybridoma cell is amplified. After sequencing, SAGE method (serial analysis) is performed on the obtained sequence according to www.expasy.ch. Furthermore, the analysis based on Kabat classification is performed on the amino acid sequence which depends on this. Thus, the FR region and CDR region of the light and heavy chains of the antibody secreted from the monoclonal hybridoma cells are determined.

  Since BLyS has the effect of activating B cell growth and maintaining survival, the antibody is thought to inhibit B cell growth, particularly by neutralizing the effect on BLyS. In addition, since B cells are a special type of cells that produce antibodies, they are difficult to produce antibodies that impair their own growth (Thomas Schirrmann, et al., Phage display for the generation of antibodies for proteome research, diagnostics and therapy, Molecules, 2011, 16, 412-426). For this reason, it is relatively difficult to produce anti-BLyS antibodies by immunizing mice. However, in the present invention, since an anti-BLyS antibody can be obtained by an immunized mouse, it has an advantage as a mouse antibody.

  In one aspect, the present invention relates to anti-BLyS antibodies or functional variants thereof. The light chain CDR1, CDR2, and CDR3 of the anti-BLyS antibody, as well as the amino acid sequences of the heavy chain CDR1, CDR2, and CDR3 are each selected from the following groups.

  In one embodiment, the anti-BLyS antibody secreted from monoclonal hybridoma cell 1D12 comprises a light chain variable region consisting of the amino acid sequence represented by SEQ ID NO. 31 and a heavy chain variable consisting of the amino acid sequence represented by SEQ ID NO. 32. Has a region. Such an antibody is referred to as monoclonal antibody 1D12.

  In one embodiment, the anti-BLyS antibody secreted from monoclonal hybridoma cell 2B10 comprises a light chain variable region consisting of the amino acid sequence represented by SEQ ID NO. 33 and a heavy chain variable consisting of the amino acid sequence represented by SEQ ID NO. 34. Has a region. Such an antibody is referred to as monoclonal antibody 2B10.

  In one embodiment, the anti-BLyS antibody secreted from monoclonal hybridoma cell 2B10 comprises a light chain variable region consisting of the amino acid sequence represented by SEQ ID NO. 35 and a heavy chain variable consisting of the amino acid sequence represented by SEQ ID NO. 36. Has a region. Such an antibody is referred to as monoclonal antibody 2G3.

  In one embodiment, the anti-BLyS antibody secreted from monoclonal hybridoma cell 2B10 comprises a light chain variable region consisting of the amino acid sequence represented by SEQ ID NO. 37 and a heavy chain variable consisting of the amino acid sequence represented by SEQ ID NO. 38. Has a region. Such an antibody is referred to as monoclonal antibody 5A5.

  In one embodiment, the anti-BLyS antibody secreted from monoclonal hybridoma cell 2B10 comprises a light chain variable region consisting of the amino acid sequence represented by SEQ ID NO. 39 and a heavy chain variable consisting of the amino acid sequence represented by SEQ ID NO. 40. Has a region. Such an antibody is referred to as monoclonal antibody 13G8.

  As long as the basic activity of the antibody is not affected, one or more than one (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more) amino acid substitutions, insertions and / or deletions may be made. Thereby, an amino acid sequence having an equivalent function, that is, a functional variant of such an amino acid sequence may be obtained. All of these are included within the scope of the present invention. For example, amino acids in the variable region can be substituted with those having equivalent properties.

  The functional variants of the amino acid sequences according to the invention may be at least 95%, 96%, 97%, 98% or 99% identical to their original sequence. Sequence matches according to the present invention can be measured with sequence analysis software. For example, BLAST, which is a computer program, may be used with predetermined variable values, and in particular BLASTP or TBBLASTN may be used.

  In order to further reduce the antigenicity, the produced mouse antibody may be humanized to obtain a humanized anti-BLyS antibody. Methods for producing humanized antibodies may be well known to those skilled in the art. For example, the humanized anti-BLyS antibody according to the present invention may be generated by transferring the CDR sequence according to the present invention to the variable region of a human antibody. Humanized antibodies are thought not to produce anti-antibody responses (AAR) and human anti-mouse antibody responses (HAMA). Also, humanized antibodies are not neutralized by antibodies or removed quickly. For this reason, it has immune functions such as ADCC action and CDC action.

In one embodiment, the amino acid sequence of the light chain variable region and the amino acid sequence of the heavy chain variable region of the humanized anti-BLyS antibody according to the present invention are selected from the following groups:
I: amino acid sequences represented by SEQ ID NO. 41 and SEQ ID NO. 42, or functional variants thereof;
II: The amino acid sequence represented by SEQ ID NO. 43 and SEQ ID NO. 44, or a functional variant thereof;
III: amino acid sequences represented by SEQ ID NO. 45 and SEQ ID NO. 46 or functional variants thereof;
IV: An amino acid sequence represented by SEQ ID NO. 47 and SEQ ID NO. 48, or a functional variant thereof.

  The humanized anti-BLyS antibody according to the present invention not only binds to B lymphocyte stimulating factor and inhibits its binding to BR3-Fc receptor, but also has affinity by having weak affinity with MHC II factor. The immune response can be minimized while maintaining.

In another preferred embodiment,
In a preferred embodiment, the BLyS antibody of the present invention further comprises a human light chain constant region and a heavy chain constant region, and a light chain variable region and a heavy chain variable region that bind to the light chain constant region and the heavy chain constant region, respectively. In one embodiment, such a humanized anti-BLyS antibody has a full length light chain and a full length heavy chain. Such a full-length light chain is formed by binding a light chain variable region contained in an anti-BLyS antibody to a human light chain constant region. Such a full-length heavy chain is formed by binding a heavy chain variable region contained in an anti-BLyS antibody to a human heavy chain constant region.

  Such a human light chain constant region is preferably a human light chain kappa constant region.

  Such a human heavy chain constant region is preferably a human heavy chain Fc fragment.

  In one embodiment, the human light chain kappa constant region and the human heavy chain Fc fragment are obtained from healthy human B lymphocytes. By genetic engineering techniques, such variable and constant regions are joined by overlap extension PCR to obtain the full length light and heavy chains of a humanized anti-BLyS antibody.

  The present invention further provides DNA molecules encoding the anti-BLyS antibody or humanized anti-BLyS antibody according to the present invention. Due to the degeneracy of codons, there are many DNA molecules that encode the antibodies of the present invention.

  In one embodiment, the present invention provides a DNA molecule encoding a light chain variable region having the amino acid sequence shown in SEQ ID NO. 31, wherein the base sequence is represented by SEQ ID NO.

  In one embodiment, the present invention provides a DNA molecule encoding a heavy chain variable region having the amino acid sequence shown in SEQ ID NO. 32, wherein the base sequence is represented by SEQ ID NO.

  In one embodiment, the present invention provides a DNA molecule encoding a light chain variable region having the amino acid sequence shown in SEQ ID NO. 33, wherein the base sequence is represented by SEQ ID NO.

  In one embodiment, the present invention provides a DNA molecule encoding a heavy chain variable region having the amino acid sequence shown in SEQ ID NO. 34, wherein the base sequence is represented by SEQ ID NO.

  In one embodiment, the present invention provides a DNA molecule encoding a light chain variable region having the amino acid sequence shown in SEQ ID NO. 35, wherein the base sequence is represented by SEQ ID NO.

  In one embodiment, the present invention provides a DNA molecule encoding a heavy chain variable region having the amino acid sequence shown in SEQ ID NO. 36, wherein the base sequence is represented by SEQ ID NO.

  In one embodiment, the present invention provides a DNA molecule encoding a light chain variable region having the amino acid sequence shown in SEQ ID NO. 37, wherein the base sequence is represented by SEQ ID NO.

  In one embodiment, the present invention provides a DNA molecule encoding a heavy chain variable region having the amino acid sequence shown in SEQ ID NO. 38, wherein the base sequence is represented by SEQ ID NO.

  In one embodiment, the present invention provides a DNA molecule encoding a light chain variable region having the amino acid sequence shown in SEQ ID NO. 39, wherein the base sequence is represented by SEQ ID NO. 57.

  In one embodiment, the present invention provides a DNA molecule encoding a heavy chain variable region having the amino acid sequence shown in SEQ ID NO. 40, wherein the base sequence is represented by SEQ ID NO.

  As used herein, the term “anti-BLyS antibody” includes an equivalent antibody or equivalent immunoglobulin, or an antigen-binding fragment having a specific binding ability to an antigen. Such terms include Fv, scFv (sc represents single chain), Fab, F (ab ′) 2, Fab ′, scFv-Fc fragment, bispecific antibody, chimeric antibody, single chain antibody, and antibody A fusion protein having an antigen binding portion and a non-antibody protein. For example, the antibody may be labeled and further detected with a radioisotope, an enzyme that produces a detectable substance, a fluorescent protein, biotin, or the like. The antibody may be bound to a solid support. Examples of the solid phase carrier include, but are not limited to, a polystyrene flat plate or beads.

  A DNA molecule encoding the anti-BLyS antibody according to the present invention may be further cloned into a vector by a person skilled in the art to transform a host cell. Thus, the present invention further provides a recombinant DNA vector. The DNA vector has a DNA molecule encoding the anti-BLyS antibody according to the present invention.

  The recombinant DNA vector is preferably an expression vector. The DNA molecule of such an antibody is cloned into an expression vector by a person skilled in the art. When host cells are transformed with an expression vector, single chain antibodies can be obtained by inducing expression.

  In one embodiment, the recombinant DNA vector of the invention comprises a DNA molecule encoding a humanized anti-BLyS antibody according to the invention. The DNA molecule of the humanized anti-BLyS antibody may be recombined to construct a vector for transcription and expression in mammals. The expression vector of the invention has the heavy and light chain variable and constant region DNA sequences of the encoded humanized anti-BLyS monoclonal antibody. However, two expression vectors may be constructed respectively. That is, one may have a heavy chain variable region and a constant region, and the other may have a light chain variable region and a constant region. These are all transferred together into mammals.

  In a preferred embodiment, the expression vector further has a DNA sequence encoding a promoter and a secretion signal peptide. Furthermore, the expression vector has at least one screening drug resistance gene. Methods used include DNA synthesis techniques and in vitro recombination techniques.

  The present invention further provides a host cell comprising the recombinant DNA vector according to the present invention. The host cell according to the present invention may be a prokaryotic host cell, a eukaryotic host cell or a bacteriophage.

  In particular, the prokaryotic host cell may be E. coli, Bacillus subtilis, Streptomyces or Proteus mirabilis. Eukaryotic host cells are fungi such as Pichia pastoris, budding yeast, fission yeast, Trichoderma, etc .; insect cells such as weevil; plant cells such as tobacco; and BHK cells, CHO cells, COS cells, bone marrow It may be a mammalian cell such as a tumor cell.

  In certain embodiments, the host cell of the present invention is preferably a mammalian cell, more preferably a BHK cell, CHO cell, NSO cell or COS cell.

  The immunogenic neutralizing activity of the humanized anti-BLyS antibody according to the present invention can be measured by in vitro cell experiments. The results show that the humanized anti-BLyS antibody according to the present invention suppresses B cell proliferation to different degrees. The present invention thus provides a method for preventing and / or treating diseases caused by excessive proliferation of B cells. Such a method comprises administering an effective amount of an anti-BLyS antibody according to any one of claims 1 to 7. The present invention further relates to the use of the above anti-BLyS antibody or humanized anti-BLyS antibody in the preparation of a medicament for preventing and / or treating a disease caused by excessive proliferation of B cells. Diseases caused by excessive proliferation of B cells include, but are not limited to, SLE, rheumatoid arthritis, ankylosing arthritis, or B cell lymphoma.

  The present invention further provides a pharmaceutical composition. An effective amount of an anti-BLyS antibody or humanized anti-BLyS antibody according to the present invention and a pharmaceutically acceptable carrier are contained. The pharmaceutical composition may be prepared by mixing any one of the anti-BLyS antibody or humanized anti-BLyS antibody according to the present invention and one or more pharmaceutically acceptable carriers by a usual method. Moreover, it is good also as a pharmaceutical. The term “pharmaceutically acceptable carrier” refers to one or more organic or inorganic, natural or synthetic carriers well known to those skilled in the art. In addition, it may be used in combination with an antibody to assist antibody stabilization and clinical application. Suitable carriers include pharmaceutically acceptable sterile saline and aqueous or anhydrous isotonic sterile solutions and sterile suspensions known to those skilled in the art. The effective amount and method of administration according to the present invention will depend on a number of factors. Such factors include the patient's age, weight, sex, original health and nutritional status, intensity of compound activity, administration time, metabolic rate, disease severity, and physician judgment. In accordance with the above factors, those skilled in the art may appropriately determine the effective amount and method of administration.

  The pharmaceutical composition according to the present invention may be prepared using suitable carriers, excipients and other reagents. Portability, deliverability, tolerance, etc. may be enhanced by such a reagent. The dosage form may be, for example, a tablet, powder, pasta, ointment, gel, wax, oil, lipid, oil in a vesicle, DNA complex, or the like. The pharmaceutical composition according to the present invention may be administered by any suitable route. For example, oral administration, nasal administration, intradermal administration, subcutaneous administration, intramuscular administration, and intravenous administration may be used.

  Description of drawings

  FIG. 1 shows an SDS-PAGE detection photograph according to Example 1. Lane A is a protein expressed by the recombinant plasmid according to the present invention. Lane B is a plasmid with a recombinant empty vector. Lane C is a molecular weight marker for proteins;

  FIG. 2 shows a flow cytometry graph relating to the binding of biotin-labeled his-hBLyS recombinant protein and BJAB cells at different concentrations in Example 2. Here, the black line is a group of his-hBLyS recombinant proteins labeled with 200 ng / mL biotin. The red line is a group of his-hBLyS recombinant proteins labeled with 100 ng / mL biotin. The blue line is a group of his-hBLyS recombinant proteins labeled with 50 ng / mL biotin. The purple line is a group of his-hBLyS recombinant proteins labeled with 25 ng / mL biotin. The green line is a group that contains biotin-labeled his-hBLyS recombinant protein but only SA-APC;

  FIG. 3 shows a flow cytometry graph relating to the binding of immunized mouse serum and BJAB cells in Example 3.

  FIG. 4 shows a graph of flow cytometry relating to the binding of the antibody secreted from the monoclonal hybridoma cell in Example 4 to the BLyS receptor on the BJAB cell. Here, the black line is a group of IgG negative controls. The red line is a group containing only SA-APC without biotin-labeled his-hBLyS recombinant protein. The purple line is a group of hybridoma cells 3H9. The blue line is a group of hybridoma cells 13G8;

  FIG. 5 shows a graph of flow cytometry relating to the binding between the antibody secreted from the monoclonal hybridoma cell in Example 4 and the BLyS receptor on the BJAB cell. Here, the black line is a group of IgG negative controls. The red line is the group of hybridoma cells 1D12. The blue line is a group of hybridoma cells 2G3;

  FIG. 6 shows a flow cytometry graph relating to the binding between the antibody secreted from the monoclonal hybridoma cell in Example 4 and the BLyS receptor on the BJAB cell. Here, the black line is a group of IgG negative controls. The red line is the group of hybridoma cells 5A5. The purple line is a group of hybridoma cells 1D7. The blue line is a group of hybridoma cells 4D3;

  FIG. 7 shows ELISA (enzyme linked immunosorbent assay) of antibodies secreted from monoclonal hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8 in Example 4 and his-hBLyS recombinant proteins and tumor necrosis factor (TNF) family proteins. It shows by the result.

  FIG. 8 shows the results of in vitro suppression of B cell proliferation by humanized anti-BLyS antibody in Example 9. Here, the horizontal axis represents the concentration of the humanized anti-BLyS antibody, and the vertical axis represents the fluorescence intensity.

  FIG. 9 shows the inhibitory effect of candidate antibody molecules on lymph node hyperplasia induced by BLyS.

  FIG. 10 shows the inhibitory effect of candidate antibody molecules on the increase in serum IgA induced by BLyS.

  Examples of the present invention disclose anti-BLyS antibodies and uses thereof. These can be implemented by those skilled in the art by appropriately adjusting the process parameters with reference to such contents. In particular, replacement by any equivalent element or modification to any equivalent element will be obvious to those skilled in the art and are within the scope of the present invention. The products according to the invention are described as preferred examples. As long as the concept, idea, and scope of the present invention are not exceeded, those skilled in the art may modify or change them and combine them appropriately in accordance with the method described herein. This may also achieve and apply the techniques of the present invention.

  For a better understanding of the present invention, details of the present invention are introduced with the following examples.

Example 1: Cloning and expression of the human BLyS gene

  After isolating healthy human peripheral blood, total RNA was extracted and purified using a commercially available RNA kit (Qiagen). The primary strand of cDNA was synthesized by reverse transcription using purified total RNA as a template. The cDNA reaction system was as follows:

RNase free dH ₂ O 9.5μL
5xRT buffer (with 25mM Mg2 +) 4μL
dNTP (10 mM each) 2μL
RNase Inhibitor (10 U / μL) 0.5μL
Oligo (dT) 20 (10 μmol / L) 1 μL
Template total RNA 2μL
ReverTra Ace 1μL

  Sterile distilled water was added to the system to make a total volume of 20 μL.

  The reaction conditions are: 30 ° C for 10 minutes, 42 ° C for 30 minutes, 99 ° C for 5 minutes, 4 ° C for 5 minutes.

  After completion of the reaction, the system was ice-cooled for 5 minutes.

  Primers P1 and P2 for secretory BLyS cloning were designed and synthesized based on the full-length DNA sequence of human BLyS. PCR amplification was performed using the upstream primer P1 and the downstream primer P2 using cDNA synthesized by reverse transcription as a template. The nucleic acid sequences of P1 and P2 are as follows.

  P1: 5'tacgaagctt gcatcatcat catcatcatg gcggcggctc cggcggcggc tccccgttca gggtccagaa gaa;

  P2: 5'cgacgtcgac tcacagcagt ttcaatgcac caaaaaatgt gacatc.

  The PCR amplification reaction system was as follows:

10xtaq buffer (with 1.5 mM Mg2 +) 5μL
dNTP (5 mM) 4 μL
Upstream primer (100 ng / μL) 1 μL
Downstream primer (100 ng / μL) 1 μL
Template (5-50 ng / μL) 1μL
Taq enzyme (2 U / μL) 0.5 μL

  Sterile distilled water was added to the system to bring the volume to a total of 50 μL.

  The PCR reaction procedure was as follows:

94 ° C 300 seconds pre-denaturation
Denaturation at 94 ° C for 45 seconds
Annealing at 55 ° C for 45 seconds
72 ° C 45 seconds extension 32 cycles of denaturation, annealing and extension
Elongation at 72 ° C for 200 seconds

  PCR amplification products were collected by gel electrophoresis, double digested with Sal I and Hind III, and cloned into the pCDNA3.1 eukaryotic expression plasmid system. Using a plasmid transformed with an empty vector as a control, the gene was introduced into 293T cells (China Traditional Culture Preservation Center). After 3 days, the culture supernatant was recovered and purified by His affinity chromatography to obtain a purified protein of his-hBLyS. Evaluation was performed by SDS-PAGE. The results are shown in FIG.

  As shown in the results of FIG. 1, the protein was expressed by the recombinant plasmid of the present invention. On the other hand, a clear band indicating protein expression was not seen in the recombinant plasmid for the empty vector. The protein of the recombinant plasmid according to the present invention was about 23 Kb. This is close to the molecular weight of 23 Kb deduced from the human BLyS amino acid sequence.

Example 2: Evaluation of binding ability of BJAB cells to receptors

  1. Biotin labeling of his-hBLyS recombinant protein

  The purified his-hBLyS recombinant protein obtained in Example 1 was mixed with biotin-xx-NHS dissolved in DMSO at a weight / volume ratio of 1: 4 ng / mL and allowed to incubate at room temperature for 1 hour. The reaction mixture was passed through a gel column and chromatographed to isolate biotin-labeled his-hBLyS and free biotin.

  2. Binding of biotin-labeled his-hBLyS recombinant protein to BJAB cells

The isolated biotin-labeled his-hBLyS recombinant proteins were divided into four groups with different concentrations of 25 ng / mL, 50 ng / mL, 100 ng / mL and 200 ng / mL. Each was mixed with 1 × 10 ⁶ human Burkitt lymphoma cells (BJAB) and incubated at 4 ° C. for 15 minutes. After washing 3 times with PBS, streptavidin-allophycocyanin (SA-APC) was added to a final concentration of 0.2 μg / mL. Incubated at 4 ° C for 20 minutes. The plate was washed 3 times with PBS and evaluated with a flow cytometer. The results are shown in FIG.

  The results in FIG. 2 indicate that biotin-labeled recombinant human BLyS protein can bind to BJAB cells at various concentrations.

Example 3: Immunized mouse

  The His-hBLyS recombinant protein obtained in Example 1 was used as an antigen to mix with the same amount of immune adjuvant (Freund's adjuvant). Four females of 6-week-old FVB mice were tested. Three animals were immunized and the remaining one was used for a control mock experiment. Immunization was performed once a week after the first immunization. Blood was collected from the tail vein of immunized mice before the last immunization. Serum was mixed with biotin-labeled his-hBLyS recombinant protein (at a concentration of 50 ng / mL) and incubated at room temperature for 20 minutes. Thereafter, the mixture was incubated with BJAB cells at 4 ° C. for 15 minutes. After washing 3 times with normal physiological saline, 0.2 μg / mL streptavidin-allophycocyanin was added and left at 4 ° C. for 15 minutes. After washing 3 times with normal saline, the samples were evaluated with a flow cytometer. The sera of immunized mice were then tested to see if BLyS could inhibit binding to its BR3-Fc receptor. The results are shown in FIG.

  The results of FIG. 3 showed that the serum obtained from mouse 1 of three immunized mice effectively inhibited the binding of biotin-labeled his-hBLyS recombinant protein to BJAB cells. As described above, mouse 1 was selected as an individual for the follow-up test for performing the next fusion test.

Example 4: Screening of cell fusion and monoclonal hybridoma cells

After the final immunization, the lymph nodes at the base of the thighs of mice were collected and pulverized in normal saline. Supernatants rich in B cells were taken and electroporated in the usual manner to fuse with myeloma cells SP2 / 0. The fused cells were distributed into 96 well plates. The cells were cultured in a complete medium RPMI-1640 containing HAT under conditions of 5% CO ₂ and 37 ° C. Each monoclonal hybridoma cell was screened by the enzyme labeling method to obtain 211 clones that secrete antibodies capable of binding to the BLyS protein.

  Antibodies produced from the 211 clone are those capable of binding to the BLyS protein. Each of these antibodies was mixed with a biotin-labeled his-hBLyS recombinant protein and allowed to stand at room temperature for 20 minutes. Thereafter, the mixture was incubated with BJAB cells at 4 ° C. for 15 minutes. After washing 3 times with normal physiological saline, 0.2 μg / mL streptavidin-allophycocyanin was added and left at 4 ° C. for 15 minutes. The sample was washed 3 times with normal physiological saline, and the sample was evaluated with a flow cytometer. Thereby, monoclonal hybridoma cells capable of inhibiting the binding of biotin-labeled his-hBLyS recombinant protein to BJAB cells were screened. As shown in Table 3, the results showed that antibodies secreted from 11 monoclonal hybridoma cells inhibit the binding of biotin-labeled his-hBLyS recombinant protein to BLyS receptors on BJAB cells to different degrees. The inhibitory ability of antibodies secreted from monoclonal hybridoma cells designated 1D12, 2B10, 2G3, 5A5 and 13G8 was stronger than antibodies secreted from monoclonal hybridoma cells designated 3H9, 1D7 and 4D3. The evaluation results of 1D12, 2B10, 2G3, 5A5 and 13G8 are shown in FIGS.

  Table 3. Antibody subtypes secreted from cells that inhibit the binding of biotin-labeled his-hBLyS recombinant protein to the BLyS receptor on BJAB

Example 5: Binding test to other protein, tumor necrosis factor (TNF) family

  To further test the binding specificity of candidate antibodies, 1 μg / mL his-hBLyS recombinant protein, tumor necrosis factor-α (TNF-α), tumor necrosis factor-β (TNF-β), and BSA Introduced into 96-well ELISA plates. It was left at 4 ° C. overnight in 0.05 M pH 9.0 carbonate coating buffer. The next day, the solution in the well was discarded and the well was washed 3 times with wash buffer. Thereafter, a PBS solution containing 3% BSA was added and sealed for 20 minutes. After washing 3 times with the washing buffer, 100 μL of a diluted solution of the antibody secreted from the monoclonal hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8 was added. It was left at room temperature for 1 hour and washed 3 times with a washing buffer. Goat anti-mouse antibody was cross-linked with horseradish peroxidase (HRP) and diluted 1: 10000 with washing buffer. Thereafter, it was left at room temperature for 1 hour. After washing 3 times with the washing buffer, 50 μL of 3,3 ′, 5,5′-tetramethylbenzidine (TMB) substrate solution was added for color development. Furthermore, it was made to react at room temperature for 10 minutes. Thereafter, the reaction was terminated with 25 μL of 0.5 M sulfuric acid solution. Absorbance at 450 nm was measured. The statistical results are shown in FIG.

  FIG. 7 shows that antibodies secreted from monoclonal hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8 all recognize and bind to BLyS, while not TNF-α or TNF-β.

  Example 6: Determination of the sequence of the variable region of an antibody secreted from a monoclonal hybridoma cell

  Monoclonal hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8 obtained by screening were cultured. Cells were collected by centrifugation at 1000 rpm. Individual hybridoma cell RNA extracted according to the method of Example 1 was reverse transcribed to synthesize the primary strand of cDNA. Using the synthesized cDNA primary strand as a template, the DNA sequence of the variable region for each hybridoma cell was amplified. The sequences of the primers used for such an amplification reaction are as follows:

  The primers required for heavy chain amplification are as follows:

  Primer 1: 5 ′ atg g (ag) a tg (cg) agctg (tg) gt (ca) at (cg) ctc tt;

  Primer 2: 5'ggg gatatc cacc atg (ag) ac ttc ggg (tc) tg agc t (tg) g gtt tt;

  Primer 3: 5 'ggg tatatc cacc atg gct gtc ttg gggctg ctcttct;

  The primers required for light chain amplification are as follows:

  Primer 1: 5 'atg gag aca gac aca ctcctgctat;

  Primer 2: 5'atg gattttcaa gtg cag a tt tic ag;

  Primer 3: 5'atg gag (ta) ca ca (gt) (ta) ct cag gtc ttt (ga) ta;

  Primer 4: 5 'atg (gt) cc coat) (ga) ct cag (ct) t (ct) ct (tg) gt.

  The amplification reaction system is:

10xPCR buffer (with 25 mM Mg2 +) 5μL
dNTP (5 mM) 1 μL
Heavy chain primer mix or light chain primer mix (each primer is 100 ng / μL)
1μL
cDNA (5-50 ng / μL) 1μL
Taq enzyme (2 U / μL) 1μL

  Sterile distilled water was added to the system to bring the volume to a total of 50 μL.

  The PCR reaction procedure is:

Pre-denaturation at 95 ° C for 10 minutes
Denaturation at 94 ° C for 1 minute
Annealing at 55 ° C for 1 minute
Extension at 72 ° C for 115 seconds 30 cycles of denaturation, annealing and extension
Elongation at 72 ° C for 10 minutes

  PCR amplification products were collected by gel electrophoresis and sent to a biology company for sequencing. The SAGE method was performed to obtain the sequence by www.expasy.ch. Table 4 shows the amino acid sequences of the light chain variable region and the heavy chain variable region. Based on the derived amino acid sequence, analysis by Kabat classification was performed to determine the FR and CDR regions of the heavy and light chains of individual hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8. Table 4 shows the amino acid sequences of the light chain variable region and the heavy chain variable region of individual hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8.

  Table 4 Amino acid sequences of light chain variable region and heavy chain variable region of anti-BLyS antibody

  Example 7: Humanization of anti-BLyS antibody

  Humanization was performed on the variable region sequences of antibodies secreted from individual hybridomas.

  The humanization procedure mainly consists of the following important steps.

  A. The gene sequence of the antibody secreted from each hybridoma is compared with the antibody gene sequence of the human embryonic system to find a sequence having high homology.

  B. Affinity with HLA-DR is tested by in silico analysis, and human embryonic reading frame sequences that have weak affinity are selected.

C. The amino acid sequences of the variable regions and their surrounding reading frames were analyzed using molecular binding by computer simulation technology to examine the three-dimensional combination shape. By calculating electrostatic forces, van der Waals forces, hydrophobicity and hydrophilicity, and entropy values,
Individual important amino acids in the gene sequence of an antibody secreted from individual hybridoma cells that can interact with BLyS and maintain a special framework are analyzed. Such amino acids are transferred into the selected human embryonic gene reading frame. As described above, four humanized anti-BLyS antibodies were obtained. The sequences of the light chain variable region and heavy chain variable region are shown in Table 5.

  Table 5 Sequences of light chain variable region and heavy chain variable region of humanized anti-BLyS antibody

Example 8: Construction of expression vector for humanized anti-BLyS antibody

  The heavy chain constant region Fc fragment was amplified from human blood cells using upstream primer VH5 and downstream primer VH3. The Fc fragment of the light chain k constant region was amplified from human blood cells using the upstream primer VL5 and the downstream primer VL3. An Xho I endonuclease recognition site and an Age I endonuclease recognition site were provided in the heavy chain. A Sma I endonuclease recognition site and a Dra III endonuclease recognition site were provided in the light chain fragment. It was introduced into pCDNA 3.1 plasmid, and it was confirmed by sequencing that the clone was correct. All subsequent experimental materials were extracted from cells transduced with the series of plasmids described above. The nucleic acid sequences of VH5, VH3, VL5 and VL3 are as follows:

  VH5: 5'gcggaattc (c / g) a ggtg (a / c) agct (g / t) c a (c / g) (c / g) a (a / g) tc (a / t) gg;

  VH3: 5'accgccggat ccaccaccgc ccg agccacc gccacctgcg gagacgatga cc (a / g) tgg tccc;

  VL5: 5'ggtggtggatccggcggtgg cggttccgacattgtgatgacccagtctcca;

  VL3: 5'ggatacagttggtgcagcctcgagctacc gttt.

  The resulting four humanized antibodies were named BLyS-I, BLyS-II, BLyS-III and BLyS-IV.

  Example 9: In vitro inhibition of B cell proliferation by humanized anti-BLyS antibody

  B cells were extracted from human peripheral blood using CD19-labeled MACS magnetic beads. B cells were subcultured in a 96-well plate at 100,000 per plate. Recombinant BLyS (10 ng / mL) and goat anti-human IgMFab fragment (4 μg / mL) were added to complete medium to stimulate B cells to promote growth. Individual humanized anti-BLyS antibodies obtained in Example 8 were added to the medium at various concentrations and cultured for 6 days. Thereafter, the number of B cells was measured with Celltiter Glo of Promega. The numerical value (RLU) is counted by fluorescence. The results are shown in FIG.

  FIG. 8 shows that the four humanized anti-BLyS antibodies BLyS-I, BLyS-II, BLyS-III and BLyS-IV prepared in Example 8 can inhibit B cell growth to different degrees.

  The above examples are only used to help understand the method of the present invention and its concepts. Modifications or modifications of the present invention may be made by those skilled in the art within the scope of the present invention without departing from the essence of the present invention.

  Example 10: In vivo pharmacokinetic study for humanized anti-BLyS antibody

1) Determination of the amount of BLyS to stimulate and proliferate B cells

  Different concentrations of recombinant BLyS were injected into the tail vein of mice. The body weight (gram), spleen weight (mg), and lymph node weight (mg) of the mice were measured after one week. The results are shown in Table 6.

  From the results, it was shown that the in vivo production of BLyS by 0.3 mg / kg stimulates B cells effectively and promotes growth. Lymph node weight can be used as the primary pharmacodynamic measure to assess the proliferation of cells stimulated by BLyS. This is because 50% of the lymph nodes are B cells. Also, the ratio of B cells becomes higher when stimulated with BLyS.

2) In vivo test of inhibitory effect of anti-BLyS antibody against BLyS

  Based on the above, 0.3 mg / kg BLyS was mixed with 0.05 mg / kg mice 1D12, 2B10, 2G3 and 5A5 and human BLyS-I (13G8). Thereafter, the weight of these lymph nodes and the amount of IgA in the serum were measured (see FIGS. 9 and 10).

  The results showed the following: mouse 1D12, 2B10, 2G3, 5A5 and human BLyS-I (13G8) effectively inhibit BLyS.

Claims (14)

An anti-BLyS antibody comprising light chain CDR1, CDR2 and CDR3 and heavy chain CDR1, CDR2 and CDR3,
Examples amino acid sequence of the light chain CDR1, CDR2 and amino acid sequence and the heavy chain CDR1, CDR2 and CDR3 of CDR3, the following A, B, C, Ru is set selected from among the set of D and E, anti-BLyS antibody :

Here, the anti-BLyS antibody Ru murine or humanized antibody der. The anti-BLyS antibody comprises a light chain variable region and a heavy chain variable region;
Examples amino acid sequence of amino acid sequence and the heavy chain variable region of the light chain variable region, is a set selected from among the following each set, an anti-BLyS antibody of claim 1:
.. a: SEQ ID NO 31 and SEQ ID NO 32 amino acid sequence represented by;
.. b: SEQ ID NO 33 and SEQ ID NO amino acid sequence represented by 34;
.. c: SEQ ID NO 35 and SEQ ID NO amino acid sequence represented by 36;
.. d: SEQ ID NO 37 and SEQ ID NO amino acid sequence represented by 38;
e:.. SEQ ID NO 39 and SEQ ID NO amino acid sequence represented by 40. The anti-BLyS antibody comprises a light chain variable region and a heavy chain variable region;
The light chain variable amino acid sequence and the heavy chain variable region amino acid sequence of the regions are set selected from among the following each set, an anti-BLyS antibody of claim 1:
.. I: SEQ ID NO 41 and SEQ ID NO amino acid sequence represented by 42;
.. II: SEQ ID NO 43 and SEQ ID NO amino acid sequence represented by 44;
.. III: SEQ ID NO 45 and SEQ ID NO amino acid sequence represented by 46;
IV:.. SEQ ID NO 47 and SEQ ID NO amino acid sequence represented by 48.   Further comprising a human light chain constant region and a human heavy chain constant region, and a light chain variable region and a heavy chain variable region that bind to the human light chain constant region and the human heavy chain constant region, respectively. 4. The anti-BLyS antibody according to 3.   The anti-BLyS antibody according to claim 4, wherein the human light chain constant region is a human light chain κ constant region.   The anti-BLyS antibody according to claim 4 or 5, wherein the human heavy chain constant region is a human heavy chain Fc fragment.   A DNA molecule encoding the anti-BLyS antibody according to any one of claims 1-6.   8. A DNA molecule according to claim 7 having a nucleic acid sequence selected from SEQ ID NO. 49-58.   A recombinant DNA vector comprising the DNA molecule according to claim 7 or 8.   A host cell comprising the recombinant DNA vector according to claim 9. Use of an anti-BLyS antibody according to any one of claims 1 to 6 in the manufacture of a medicament for preventing and / or treating a disease caused by excessive proliferation of B cells,
The use wherein the drug contains an effective amount of the anti-BLyS antibody according to any one of claims 1 to 6.   Use according to claim 11, characterized in that the disease caused by excessive proliferation of B cells is selected from systemic lupus erythematosus, rheumatoid arthritis, ankylosing arthritis and B cell lymphoma.   A pharmaceutical composition comprising the antibody according to any one of claims 1 to 6 and an effective amount of an antibody and a pharmaceutically acceptable carrier.   A method for preparing an anti-BLyS antibody, comprising culturing a host cell according to claim 10 and obtaining an antibody.

Images