JP5988212B2 - Method for producing triacylglycerol highly productive algae - Google Patents

Description

  The present invention relates to a method for producing triacylglycerol (hereinafter referred to as “TAG”) highly productive algae, algae produced by the method, and a method for producing TAG using the algae.

  Conventionally, TAG synthase gene is introduced into algae such as Chlamydomonas reinhardtii (hereinafter sometimes referred to as “C. reinhardtii”), and thereby TAG is accumulated in cells (patents). Document 1, Non-Patent Document 1).

  For example, Non-Patent Document 1 discloses a method of introducing DGAT2 gene added with psaD, which is a strong expression promoter, into C. reinhardtii, culturing it in a nitrogen or sulfur deficient condition, and accumulating TAG in the cell. Have been described. Patent Document 1 also describes C. reinhardtii into which DGAT2 gene added with psaD is introduced, as in Non-Patent Document 1.

International publication WO 2011/156520

M. La Russa et al., J. Biotechnol. 2012 Apr 20.

  As described above, methods for accumulating TAG in cells by introducing the TAG synthase gene into algae are already known, but those methods were unable to accumulate a sufficient amount of TAG. For example, Non-Patent Document 1 describes that there was no statistically significant difference in the accumulated amount of TAG between the DGAT2 gene-introduced strain and the wild strain under either nitrogen deficiency or sulfur deficiency conditions. (Fig. 5 etc.)

  An object of the present invention is to provide a means for efficiently accumulating TAG in algae cells.

  The present inventor first thought that there was a cause in the promoter that a sufficient amount of TAG did not accumulate in the conventional method. That is, although TAG is accumulated at the time of nutrient deficiency, we thought that a strong expression promoter such as psaD may not function sufficiently at the time of nutrient deficiency. Therefore, the idea of using a nutrient deficiency responsive promoter instead of a strong expression promoter was obtained.

  In addition, the present inventor examined the accumulation amount of TAG and the fatty acid composition of TAG under nitrogen deficient condition and phosphorus deficient condition. As a result, 1) When proliferating cells are transplanted, the amount of TAG accumulated is higher in phosphorus deficient conditions than in nitrogen deficient conditions. 2) Fatty acids derived from chloroplast membrane lipids in nitrogen deficient conditions. 3) The number of newly synthesized fatty acids is small, and 3) cell growth is inhibited under both nitrogen deficiency and phosphorus deficiency conditions. I understood that it was not obstructed. From these findings, the idea that a TAG high-productive algae is preferable to a phosphorus deficiency responsive one is preferable to a nitrogen deficiency responsive one.

  Furthermore, the present inventor has also found that the promoter of the C. reinhardtii SQD2a gene is suitable as the phosphorus deficiency responsive promoter, and the DGTT4 gene of C. reinhardtii is suitable as the TAG synthase gene.

  The present invention has been completed based on the above knowledge and idea.

That is, the present invention provides the following (1) to (7).
(1) A method for producing a TAG highly productive algae, wherein a TAG synthase gene to which a phosphorus deficiency responsive promoter is added is introduced into algae.
(2) The method for producing a TAG highly productive algae according to (1), wherein the phosphorus deficiency responsive promoter is a promoter of the SQD2 gene.
(3) The method for producing a highly productive algae according to (1) or (2), wherein the TAG synthase gene is a DGAT2 gene.
(4) The method for producing a highly productive algae according to (1) or (2), wherein the TAG synthase gene is a DGTT4 gene.
(5) The algae is Chlamydomonas, Nannochloropsis, Pseudocollistis, Feodactylum, Osterococcus, Cyanidiosion, Klebsolmidium, Chlorochibus, Spirogyra, Kara, Choreokete The method for producing TAG highly productive algae according to any one of (1) to (4), which is an algae belonging to the genus or Chlorella.
(6) TAG highly productive algae produced by the method according to any one of (1) to (5).
(7) A method for producing TAG, comprising culturing the TAG highly productive algae according to (6) under phosphorus-deficient conditions, accumulating TAG in algal cells, and collecting the accumulated TAG.

The highly productive algae of the present invention have the following effects, for example.
(1) Accumulate more TAG than conventionally known algae.
(2) Since the TAG synthase gene is under the control of a phosphorus deficiency responsive promoter, this gene is not expressed during normal culture. For this reason, the timing of TAG accumulation can be controlled.
(3) Although the proliferation efficiency is lower than that under normal conditions, cell growth is possible to some extent even under phosphorus-deficient conditions. Therefore, it is possible to accumulate TAG while growing cells.
(4) Accumulated fatty acids in TAG are not derived from already synthesized lipids (such as chloroplast lipids), but are newly synthesized, so they are also useful for the production of useful special fatty acids. It is.

The figure which shows the amount of TAG [mg] per 1 L of culture solutions. The figure which shows the fatty acid composition of TAG. The figure which compared the expression level by semi-quantitative PCR. The figure which compared the N terminal area | region of SQD2. Surrounded by a frame is SQD2a of C. reinhardtii, and the arrow is the starting methionine. The figure which compared the N terminal area | region of DGAT2. Encircled is DGTT1 of C. reinhardtii, and the arrow is the starting methionine. The figure which shows the construct for TAG production system reinforcement. The figure which compared the expression level of each gene by semiquantitative PCR (1). The figure which compared the expression level of each gene by semiquantitative PCR (2). The figure which compared the expression level of each gene by semiquantitative PCR (3). The figure which shows the amount of TAG [mg] per 1 L culture solution of HygR-pDGTT1-DGTT2-4 each mutant. The figure which shows the amount of TAG [mg] per 1 L culture solution of HygR-pSQD2a-DGTT2-4 each mutant. The figure which shows the amount of TAG [mg] per 1L of culture solutions. The figure which shows the amount of TAG [pg] per cell. The figure which shows a TAG fatty acid composition.

  Hereinafter, the present invention will be described in detail.

  The method for producing TAG highly productive algae of the present invention is characterized in that a TAG synthase gene to which a phosphorus deficiency responsive promoter is added is introduced into algae.

  As the phosphorus deficiency responsive promoter, for example, the promoter of the SQD2 gene can be used. SQD2 is an enzyme involved in the synthesis of sulfoquinovosyl diacylglycerol (SQDG), and this enzyme and the gene encoding it have been reported in many papers (eg Yu B, Xu C, Benning C ., Proc Natl Acad Sci US A. 2002 Apr; 99 (8): 5732-7.) Since the amino acid sequence of this enzyme is also published in the database (eg, SQD2 (SQD2a) of C. reinhardtii) The amino acid sequence of is described in GenBank Accession No. XP_001689662.), Those skilled in the art can understand what the SQD2 gene is. As the promoter of the SQD2 gene, the promoter of the SQD2a gene of C. reinhardtii can be used, and its sequence is as shown in SEQ ID NO: 1.

  Examples of the nucleotide sequence of the promoter of the SQD2 gene include the nucleotide sequence shown in SEQ ID NO: 1, or the nucleotide sequence showing high identity with the nucleotide sequence shown in SEQ ID NO: 1, and maintaining the promoter activity. it can. “High identity” here means usually 90% or more identity, preferably 95 or more identity, more preferably 97% or more identity, and even more preferably 99% or more identity. The value of “identity” in the present specification can be calculated using a homology search program known to those skilled in the art. For example, it can be calculated by using default (initial setting) parameters in NCBI homology algorithm BLAST (Basic local alignment search tool).

  The SQD2 gene promoter base sequence is a base sequence in which one or several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 1, and the promoter sequence is maintained. There may be. The “one or several” referred to herein is usually 1 to 10, preferably 1 to 5, more preferably 1 to 3, and still more preferably 1. Further, “deletion, substitution or addition” includes not only artificial mutations but also naturally occurring mutations (mutants and variants) such as cases based on individual differences, species or genus differences.

  As the TAG synthase gene, for example, DGAT2 gene can be used. DGAT2 is a kind of diacylglycerol acyltransferase, and this enzyme and the gene encoding it are reported in many papers (for example, Jay M. Shockey et al., The Plant Cell, Vol. 18 September). 2006, 2294-2313, Miller et al., Plant Physiology, vol.154 2010, 1737-1752), those skilled in the art can understand what the DGAT2 gene is.

  As the DGAT2 gene, for example, the DGTT4 gene can be used. DGTT4 is a protein belonging to the DGAT2 family contained in C. reinhardtii. Since this protein and the gene encoding it have been reported in many papers (for example, Boyle et al. The Journal of biological chemistry, 287 (2012), pp. 15811-15825, Chen JE and Smith AG, J Biotechnol. 2012 Jun 29), those skilled in the art can understand what the DGTT4 gene is. The amino acid sequence of DGTT4 and the base sequence of the gene encoding it are as shown in SEQ ID NO: 3 and SEQ ID NO: 2, respectively. The DGTT4 gene in the present invention includes not only the DGTT4 gene of C. reinhardtii (Cre03.g205050) but also a gene (such as a homolog) corresponding to this gene in other organisms. Specific examples of the DGTT4 gene in organisms other than C. reinhardtii include the DGAT2 (JGI protein ID77655) gene of Volvox carteri f. Nagariensis, the DGAT2 (JGI protein ID 21937) gene of Ostreococcus tauri, and the like.

  An example of the base sequence of the DGTT4 gene is the base sequence shown in SEQ ID NO: 2. The base sequence of the DGTT4 gene is a base sequence having high identity with the base sequence shown in SEQ ID NO: 2, and is a base sequence encoding a protein having activity (such as diacylglycerol acyltransferase activity). Also good. “High identity” here means usually 90% or more identity, preferably 95 or more identity, more preferably 97% or more identity, and even more preferably 99% or more identity.

  The base sequence of the DGTT4 gene consists of an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 3, and an active protein (such as diacylglycerol acyltransferase activity). You may code. The “one or several” referred to herein is usually 1 to 10, preferably 1 to 5, more preferably 1 to 3, and still more preferably 1. Further, “deletion, substitution or addition” includes not only artificial mutations but also naturally occurring mutations (mutants and variants) such as cases based on individual differences, species or genus differences.

  Algae to be introduced, such as TAG synthase gene, are not particularly limited. For example, Chlamydomonas genus, Nannochloropsis genus, Pseudochoricystis genus, Phaeodactylum genus, Ostereo The genus Cosmo (Ostreococcus), the genus Cyanidioschyzon, the genus Klebsormidium, the genus Chlorokybus, the genus Spirogyra, the genus Chara, the genus Coleochaete, or the chlorella Algae belonging to the genus (Chlorella) can be used. Examples of the algae of the genus Chlamydomonas include Chlamydomonas reinhardtii, and the algae of the genus Nannochloropsis include Nannochloropsis oculata, Nannochloropsis salina, Nannochloropsis salina, Examples of the algae of the genus Pseudochoricystis (Pseudochoricystis ellipsoidea) and the algae of the genus Phaeodactylum (Phaeodactylum). Tricornutum (Phaeodactylum tricornutum) can be illustrated, Osterococcus tauri (Osterococcus tauri) can be illustrated as an algae of the genus Osterococcus (Cyanidioschyzon merolae) can be exemplified, Klebsormidium flaccidum can be exemplified as an algae of the genus Klebsormidium, and Chara fragilis can be exemplified as an algae of the genus Kalabs. Examples of the algae of the genus include Coleochaete scutata, and examples of the algae of the genus Chlorella include Chlorella vulgaris.

  Operations such as adding a phosphorus deficiency responsive promoter to the TAG synthase gene and introducing it into algae can be performed according to conventional methods.

The TAG highly productive algae produced by the above-described method can be cultured in the same manner as normal algae culture except that the TAG is accumulated under phosphorus-deficient conditions at the time of TAG accumulation. For example, when C. reinhardtii is cultured as an algae, TAP medium or the like can be used as the medium, the culture temperature can be about 2325 ° C., and the light intensity during culture is 1040 μE / m ² / sec. It can be.

When TAG is accumulated in TAG highly productive algae, it is cultured under phosphorus-deficient conditions. Cultivation under phosphorus-deficient conditions may be performed by removing a phosphorus component (for example, K ₂ HPO ₄ , KH ₂ PO _4, etc.) from the medium used at the time of growth or using a medium having a concentration of 33 μM or less. Usually, a sufficient amount of TAG is accumulated in the cells after culturing for about 813 days.

  TAG can be collected from cells that have accumulated TAG according to a conventional method.

Hereinafter, the present invention will be described in more detail with reference to examples.
[Experimental material]
Two wild strains of C. reinhardtii (C9 strain CC-408 mt- and CW15 strain CC-400 cw15 mt +) were used. Both strains are available from the Chlamydomonas Center (http://chlamycollection.org/).

  The gene name and protein ID (JGI Chlamydomonas reinhardtii 4.0) used in the experiment are as follows.

[Experimental operation]
(1) Culture conditions
Na ₂ EDTA ・ 2H ₂ O 5 g, ZnSO ₄・ 7H ₂ O 2.2 g, H ₃ BO ₃ 1.14 g, MnCl ₂・ 4H ₂ O 506 mg, FeSO ₄・ 7H ₂ O 499 mg, CoCl ₂・ 6H ₂ O 161 mg, CuSO ₄・ 5H ₂ O 157 mg, (NH ₄ ) ₆ Mo ₇ O ₂₄・ 4H ₂ O 110 mg, KOH 1.6 g are dissolved in 1 L of ion exchange water and stored at 4 ° C as Hutner's trace elements. Oita.

NH ₄ Cl 400 mg, CaCl ₂・ 2H ₂ O 51 mg, MgSO ₄・ 7H ₂ O 100 mg, K ₂ HPO ₄ 119 mg, KH ₂ PO ₄ 60.3 mg, Hutner's trace elements 10 mL, acetic acid 1 mL, Tris ( Hydroxymethyl) aminomethane (2.42 g) was dissolved in 998 mL of ion-exchanged water and autoclaved before use as a liquid TAP medium. When used as a plate medium, 12 g of INA Agar was added before autoclaving.

TAP medium was used as a medium for normal culture, and swirl culture was performed at 2030 μE / m ² / sec, 23 ° C. In the phosphorus-deficient medium, K ₂ HPO ₄ and KH ₂ PO ₄ were removed from the TAP medium, and in the nitrogen-deficient medium, NH ₄ Cl was removed.
(2) Lipid Extraction 100 to 450 mL of the culture solution was centrifuged at 800 × g for 5 minutes to precipitate the cultured cells, suspended in 1 mL of ion-exchanged water, and stored at −80 ° C.

The frozen cells were thawed, 1 mL of chloroform and 2 mL of methanol were added, and the mixture was left at room temperature for 1 hour while being suspended every 10 minutes. Centrifugation was performed with a swing rotor at 800 g for 5 minutes, and 4 mL of the supernatant was recovered. Add 1% (W / V) KCl (0.8 mL), chloroform (1 mL), and methanol (2 mL) to the precipitate, suspend it, and centrifuge at 800 × g for 5 minutes with a swing rotor. And recovered. Chloroform 2 mL, 1% (W / V) KCl 1.2 mL was added to the supernatant 7.8 mL, suspended, and centrifuged at 800 × g for 5 minutes with a swing rotor to recover the lower layer lipid extract. The lipid extract was dried, dissolved in chloroform: methanol = 2: 1 to 60 mg / mL, and stored at −20 ° C.
(3) Lipid analysis 50 μL of lipid extract was spotted on a thin-layer silica plate and developed with a developing solution of hexane: diethyl ether: acetic acid = 160: 40: 4 for 45 minutes. TAG was confirmed under UV irradiation using 0.001% primulin. The silica on the part where the TAG was placed was scraped, 100 μL of 1 mM pentadecanoic acid and 500 μL of 5% hydrochloric acid / methanol were added, suspended, and then allowed to stand at 85 ° C. for 1 hour. After adding 500 μL of hexane and suspending, it was centrifuged with a swing rotor at 800 × g for 5 minutes to recover the methyl esterified fatty acid in the upper layer. After adding 500 μL of hexane again to the lower layer and suspending it, the mixture was centrifuged at 800 × g for 5 minutes with a swing rotor, and the upper layer was recovered. The methyl esterified fatty acid was dried and then dissolved in 60 μL of hexane to obtain a gas chromatography sample. Gas chromatography was performed by attaching HR-SS-10 (0.25 φ x 0.25 m) (SHINWA CHEMICAL INDUSTRIES, LTD.) To SHIMADZU GC-2014.
(4) RNA extraction Three times or more of the RNA extract and 3 times or more of the acidic phenol were added to the frozen cells, and ultrasonication (15 seconds of ultrasonic waves, 30 seconds of ice cooling) was performed 4 times while frozen. Centrifugation was performed at 20000 × g for 5 minutes at 4 ° C., and 400 to 500 μL of supernatant was collected. 300 μL of acidic phenol and 300 μL of chloroform were added to the supernatant and suspended, and then centrifuged at 140 k rpm for 5 minutes at 4 ° C., and 400 to 500 μL of the supernatant was collected, and this operation was repeated 5 times. The supernatant was added with 1/10 volume of 3 M sodium acetate and 1 volume of isopropanol, suspended, and centrifuged at 20000 × g for 5 minutes at 4 ° C. 1 mL of 70% ethanol was added to the precipitate and centrifuged at 20000 × g for 5 minutes at 4 ° C. This operation was repeated twice, and then the precipitate was dried. The dried precipitate was dissolved in 400 μL of sterilized ion-exchanged water, and it was confirmed that the nucleic acid had a concentration of 1 μg / μL or higher. 10 × DNase I Buffer 5 μL, DNase I 0.5 μL, and sterilized ion-exchanged water 4.5 μL were added to 40 μL of nucleic acid and allowed to stand at 37 ° C. for 30 minutes. 50 μL of acidic phenol and 50 μL of chloroform were added and suspended, and then centrifuged at 20000 × g for 10 minutes at 4 ° C. to recover 35 μL of the supernatant. The supernatant was added with 1/10 volume of 3 M sodium acetate and 1 volume of isopropanol, suspended, and centrifuged at 20000 × g for 10 minutes at 4 ° C. 150 μL of 70% ethanol was added to the precipitate, and centrifuged at 20000 × g for 10 minutes at 4 ° C. This operation was repeated twice, and then the precipitate was dried. The dried precipitate was dissolved in 50 μL of sterilized ion-exchanged water and confirmed to be RNA having a concentration of 1 μg / μL or more.
(5) Preparation of cDNA
To 1 μg of RNA, 0.5 mM of 10 mM dNTP, 0.25 μL of 100 mM oligo dT18, and 3.65 μL of RNase free water were added, treated at 65 ° C. for 5 minutes, and allowed to stand on ice. Add 5xcDNA Synthesis Buffer 2 μL, 0.1 M DTT 0.5 μL, RNase OUT 0.5 μL, Thermo Script RT 0.5 μL, RNase free water 0.5 μL, and add 50 ° C, 40 minutes, 60 ° C, 20 minutes, 85 ° C, 5 minutes. Processed. The obtained cDNA was stored at -20 ° C.
(6) Semi-quantitative PCR method
LA PCR x10 buffer 1.5 μL, 2.5 mM dNTP 1.2 μL, MgCl ₂ 1.05 μL, LA Taq 0.075 μL, 5 M Betaine 1.5 μL, DMSO 0.45 μL, 10 μM primer_F 1.5 μL, 10 μM primer_R 1.5 μL, cDNA 0.2 μL, Sterile Ion exchange water (6.1 μL) was suspended and used for PCR reaction. PCR reaction conditions were performed in the following two steps.
step1: 94 ℃ for 3 minutes
step2: 94 ° C. for 30 seconds, 54 ° C. for 30 seconds, 72 ° C. for 1 minute for 1834 cycles The following primers were used.
DGAT1_F TGGTGGAATGCGGCTACGGT (SEQ ID NO: 4)
DGAT1_R TCTGTTGAGCTTCTTGCGCA (SEQ ID NO: 5)
DGTT1_F CTATAAGCCAAGCATGGGTG (SEQ ID NO: 6)
DGTT1_R GCGCCTCTGTGGCAAATGCC (SEQ ID NO: 7)
DGTT2_F TGGCTATGTTGACGCTCTTC (SEQ ID NO: 8)
DGTT2_R TCTCTGCGATGCCTCCCACG (SEQ ID NO: 9)
DGTT3_F AGACGGAAGCAGATGGCAGG (SEQ ID NO: 10)
DGTT3_R GACAAAGATGTAGCGCTTGT (SEQ ID NO: 11)
DGTT4_F TTCAAGGAGTGCTGTATGAG (SEQ ID NO: 12)
DGTT4_R GTCAGCTGCAGCGGCGTGAA (SEQ ID NO: 13)
DGTT5_F AGCCCGCACGGCGCCTTCCC (SEQ ID NO: 14)
DGTT5_R TGACGTGTACATCTCCGCAATGC (SEQ ID NO: 15)
UGP3_F CATGAACGTGGTGCAGGAG (SEQ ID NO: 16)
UGP3_R GGTTGGAGACCAGGAAGGTG (SEQ ID NO: 17)
SQD2a_F GGTGCAGGTGTGGAAGAAGG (SEQ ID NO: 18)
SQD2a_R CGTGATGATGTCGGGGATG (SEQ ID NO: 19)
(7) Acquisition of promoter sequence
A PCR reaction was carried out using the genome of the C9 strain as a template to obtain promoter regions pSQD2a and pDGTT1. The obtained sequence of about 1 kb was introduced into pMD20-T vector (TAKARA) or pZErO-2 (Invitrogen).

  Suspend 2x GC Buffer II 5 μL, 2.5 mM dNTP 1.6 μL, C9 strain genome 1 μL, LA Taq 0.05 μL, 10 μM primer_F 1 μL, 10 μM primer_R 1 μL, sterile ion-exchanged water 1.35 μL Using.

PCR reaction conditions were performed in the following 3 steps.
step1 94 ℃ for 2 minutes
step2 40 cycles of 94 ℃ 45 seconds, 55 ℃ 30 seconds, 71 ℃ 1 minute 30 seconds
step3 5 minutes at 71 ℃

The following primers were used.
DGTT1_F2 AGCAGCCACACGTAGTTGTC (SEQ ID NO: 20)
DGTT1_R2 CACGAGCTCTAGTTGGTTCA (SEQ ID NO: 21)
SQD2a_F2 CGGGATAGTTGTAGCTGTAG (SEQ ID NO: 22)
SQD2a_R2 CGAAGAGTTGAGGTGTGTGTTC (SEQ ID NO: 23)
(8) Acquisition of DGTT2-4 gene sequence A PCR reaction was carried out using the phosphorus-deficient cDNA as a template to obtain the full length of the DGTT2-4 gene. The obtained sequence of about 1 kb was introduced into pMD20-T vector (TAKARA) or pZErO-2 (Invitrogen). The composition of the PCR reaction solution was the same as that of the semi-quantitative PCR method.

PCR reaction conditions were performed in the following 3 steps.
step1 94 ℃ 3 minutes
step2 94 ° C for 30 seconds, 54 ° C for 30 seconds, 72 ° C for 1 minute for 41 cycles
step3 72 ° C for 3 minutes The following primers were used.
DGTT2_F2 ATGGCGATTGATAAAGCACC (SEQ ID NO: 24)
DGTT2_R2 TCAGCTGATGACCAGCGGTC (SEQ ID NO: 25)
DGTT3_F2 ATGGCAGGTGGAAAGTCAAACG (SEQ ID NO: 26)
DGTT3_R2 CTACTCGATGGACAGCGGGC (SEQ ID NO: 27)
DGTT4_F2 ATGCCGCTCGCAAAGCTGCG (SEQ ID NO: 28)
DGTT4_R2 CTACATTATGACCAGCTCCTC (SEQ ID NO: 29)
(9) C. reinhardtii transformation method
50 μL of 10% (v / v) Tween 20 was added to 50 mL of CW15 strain cultured to 1 to 3 × 10 ⁶ cells / ml in TAP medium and stirred. The cells were precipitated by centrifugation at 4 ° C., 800 × g, 5 minutes with a swing rotor. After removing the supernatant, it was suspended in ice-cooled 40 mM Sucrose / TAP to a final concentration of 1 × 10 ⁸ cells / ml. To 50 μL of concentrated cells, 2 μL of 0.1 mg / ml construct DNA and 1 μL of carrier ssDNA (Salmon Sperm) were added. The cell suspension was placed in an electroporation cuvette (1 mm width), and a voltage was applied once at 2000 V / cm and a time constant of 5 msec. 1 mL of 40 mM Sucrose / TAP was added to the cuvette to suspend the cells, and then transferred to a 1.5 mL tube. It was allowed to stand at 10 to 20 μE / m ² / sec at 23 ° C. After 24 hours, the cells were precipitated by centrifugation at 800 × g for 5 minutes. After removing the supernatant, 0.5 mL of 20% (w / v) corn starch / 40 mM Sucrose / TAP was added, and the mixture was plated on a TAP plate to which 10 μg / μL hygromycin had been added. It was allowed to stand at 20 to 30 μE / m ² / sec at 23 ° C., and the grown colonies were planted as transformants on a new hygromycin-containing TAP plate.

〔Experimental result〕
(1) Control study of TAG / membrane lipid synthesis system
It is reported that lipid accumulation in the model algae C. reinhardtii is that lipid accumulates under nitrogen-deficient conditions, TAG as a storage lipid accumulates in lipids, and the percentage of saturated fatty acids increases. (BMC Biotechnol. 2011; 11: 7.).

On the other hand, there is no detailed knowledge about lipid accumulation under phosphorus-deficient conditions that the present inventors have focused on in higher plants. Therefore, the amount of TAG accumulation under nitrogen deficiency and phosphorus deficiency conditions was compared.
(2) Comparison of TAG accumulation amount under nutrient deficiency conditions Comparison was made between the stationary phase where growth stopped, the logarithmic phase where growth was active, nitrogen deficiency conditions, and phosphorus deficiency conditions.

When planted in a nitrogen deficient condition in the logarithmic phase, the accumulation of TAG, which is an oil and fat, was small, and it was found that improvement was necessary to obtain TAG. When transplanted to phosphorus deficient conditions, growth is not inhibited as much as under nitrogen deficient conditions, the proportion of polyunsaturated fatty acids such as C16: 4, C18: 3 is decreased, and the proportion of newly synthesized fatty acids is relatively increased Since the amount of accumulated TAG was large, it was found that the composition of fatty acid of TAG is suitable for greatly modifying the fatty acid contained in the membrane lipid (FIGS. 1 and 2).
(3) Search for lipid synthesis key genes
Diacylglycerol acyltransferase (DGAT) is an enzyme that catalyzes the final step of TAG biosynthesis. DGAT is an enzyme widely present in animals and plants, and two types of DGAT1 and DGAT2 have been reported.

  As a result of searching a public database (JGI Chlamydomonas reinhardtii v4.0) for DGAT in C. reinhardtii, it was found that there was one DGAT1 and five DGAT2 (DGTT1-5). Among these, it has been reported that DGTT1 shows a change in the amount of mRNA under N-deficient conditions, and DGTT2 and DGTT3 have a small change in the amount of mRNA under nitrogen-deficient conditions (Plant physiol. 2010, Vol. 154, 1737-1752).

C. reinhardtii strain C9 was inoculated to 250 mL of TAP medium at 1 × 10 ⁵ cells / mL, and cells were collected by centrifugation in a logarithmic phase (5-6 × 10 ⁶ cells / mL). After washing with a deficient medium, the cells were passaged to 250 mL of a phosphorus-deficient medium or a nitrogen-deficient medium at 1 × 10 ⁵ cells / mL. Cells were recovered from 1 mL of the culture solution using a centrifuge on the fifth day after planting, which is a condition where TAG derived from a new fatty acid begins to accumulate, and stored at −80 ° C., and then RNA was extracted. CDNA was obtained from RNA by reverse transcription. Each gene expression was examined semi-quantitatively by PCR using cDNA as a template. As a result of PCR, it was confirmed that DGAT1 and DGTT1-4 were expressed. Expression of DGTT5 could not be confirmed (FIG. 3).

In C. reinhardtii, it was confirmed that DGAT1 and DGAT2 were expressed. Therefore, a promoter that induces strong expression was added upstream of DGAT1 or DGAT2 only under nutrient deficiency conditions, and DGAT working in the endoplasmic reticulum membrane was increased. We decided to develop a method to promote TAG accumulation in the endoplasmic reticulum.
(4) Control promoter search cDNAs were prepared in the same manner as in the search for lipid synthesis key genes, and the expression levels of each gene were compared (FIG. 3). The genes compared are DGAT1 and DGAT2, which are factors involved in TAG biosynthesis, and UGP3 (Okazaki et al Plant Cell 2009) and SQD2, which are factors involved in SQDG biosynthesis previously discovered by the present inventors.

From FIG. 3, SQD2a, UGP3, and DGTT1 were confirmed to increase in expression under nutrient deficiency conditions. Among them, SQD2a was specifically upregulated under phosphorus deficiency conditions, and DGTT1 was upregulated under both nitrogen deficiency and phosphorus deficiency conditions. DGAT1 and DGTT2-4 did not show a significant increase in expression. Therefore, the promoter regions of SQD2a and DGTT1 were selected as control promoter candidates.
(5) Key gene regulation by candidate promoters (pSQD2a, pDGTT1)
Since SQD2a and DGTT1 could not determine the start codon in the public database, the cDNA was sequenced to determine the start codon.

  Since the start codon was determined, the promoter regions pSQD2a and pDGTT1 were defined as about 1 kb upstream from there.

Promoter regions pSQD2a and pDGTT1 were amplified by PCR using the C. reinhardtii genome as a template. In addition, the sequences of DGTT2-4 genes were obtained from the C. reinhardtii phosphorus-deficient cDNA. pSQD2a and pDGTT1 were connected upstream of the DGTT2-4 gene to give pSQD2a-DGTT2-4 and pDGTT1-DGTT2-4. Hygromycin gene resistance gene (HygR) was connected upstream for selection of mutant strains to obtain HygR-pSQD2a-DGTT2-4, HygR-pDGTT1-DGTT2-4 (FIG. 6).
(6) Increased TAG production by promoter (pSQD2a, pDGTT1) and DGAT gene These constructs were transformed into C. reinhardtii and selected with hygromycin to obtain 2030 mutants. Mutants were placed under phosphorus-deficient conditions, and strains in which increased expression of each gene was confirmed by semi-quantitative PCR were further selected (FIGS. 7, 8, and 9).

  Three strains from each mutant strain (strains surrounded by a frame in FIGS. 7, 8, and 9) were cultured in 250 mL each of TAP medium and phosphorus-deficient medium, and the amount of accumulated TAG was examined (FIGS. 10 and 11). .

  10 and 11, more TAG accumulation was observed in HygR-pSQD2a-DGTT4 # 18, # 19 than in the control strain under phosphorus-deficient conditions. # 15 had only the same level of TAG accumulation as the control strain, so TAG accumulation was confirmed again using # 21, which had gene expression equivalent to # 18 and # 19 in FIG. 79, as a candidate strain ( 12 and 13).

  12 and 13, it was found that HygR-pSQD2a-DGTT4 strain accumulated 2-3 times more TAG than the control strain under phosphorus-deficient conditions. This was 45 times the accumulation of fat and oil synthesizing gene transfection methods with a strong expression promoter in algae reported so far. This technique is extremely useful in order to realize biodiesel production and useful lipid production in algae, which have larger biomass than plants.

  Furthermore, the fatty acid composition of TAG of HygR-pSQD2a-DGTT4 and control strains under phosphorus-deficient conditions is as shown in FIG. 14, as in FIG. 2. The proportion decreased and the proportion of newly synthesized fatty acids increased relatively. This suggests that the fatty acid composition of TAG is suitable for greatly modifying the fatty acid contained in the membrane lipid.

  Since the phosphorus deficiency response promoter pSQD2 used in the present invention does not induce expression during normal culture, the timing of fat accumulation can be controlled. It is suitable for the synthesis of novel fatty acids because it allows fat and oil accumulation while allowing cells to grow under phosphorus-deficient conditions. This is an effective method for accumulating useful special fatty acids.

  The present invention can be used in various industrial fields related to TAG production.

Claims (5)

A method for producing a triacylglycerol- producing alga comprising introducing a triacylglycerol synthase gene to which an SQD2 promoter derived from an algae belonging to Chlamydomonas reinhardi is added to an algae belonging to Chlamydomonas reinhardi . The method for producing a triacylglycerol- producing alga according to claim 1 , wherein the triacylglycerol synthase gene is a DGAT2 gene. The method for producing a triacylglycerol- producing alga according to claim 1 , wherein the triacylglycerol synthase gene is a DGTT4 gene. Triacylglycerol- producing algae produced by the method according to any one of claims 1 to 3 . A triacylglycerol- producing alga according to claim 4 is cultured under phosphorus-deficient conditions, triacylglycerol is accumulated in the algal cells, and the accumulated triacylglycerol is collected. Method.