JP5954800B2 - Method for detecting causal factor of male infertility and male infertility model animal - Google Patents

Description

  The present invention relates to detection of a causative factor of male infertility and a human male infertility model nonhuman animal.

The causes of male infertility can be divided into 1) testicular spermatogenesis, 2) blockage of sperm transport, 3) prostatitis, and 4) erectile and ejaculation disorders, of which 2) to 4) can be diagnosed. Each has established a treatment. On the other hand, spermatogenesis disorder, which accounts for 90% of male infertility, is considered to be caused by genetic abnormality, but a method for identifying the causative factor has not been established at all. Establishing an accurate causal factor testing method will lead to life innovations such as the development of reproductive medicine in the future, and also has the potential to greatly contribute to society in terms of preventing the declining birthrate.
The history of spermatogenesis in living organisms has a long history, and various approaches have been pursued so far. In recent years, it has been clarified that many genes contribute to spermatogenesis through the creation of genetically modified mice in mammals, but there have been few reports of identifying gene mutations that cause human spermatogenesis disorders.
The present inventors have attempted to identify a glycosyltransferase gene that adds a sugar to a protein from the human genome. Among them, there are 20 polypeptide N-acetylgalactosaminyltransferase genes (pp-GalNAc-T), which are glycosyltransferases that start the synthesis of O-GalNAc type O-linked sugar chains, in the human genome. It has been reported to do. A novel glycosyltransferase-like gene GALNTL5 that is classified into this gene family but has a characteristic of lacking a C-terminal lectin structure common to other pp-GalNAc-T genes and is expressed specifically in human testis The inventors have succeeded in identifying. Since GALNTL5 is presumed to be a gene that contributes to spermatogenesis or the fertilization mechanism of sperm and ovum from its expression pattern, a patent application has been filed for GALNTL5 protein and gene (see Patent Document 1). On the other hand, since the glycosyltransferase activity of GALNTL5 protein cannot be reproduced in vitro, the function of this gene in spermatogenesis has not been estimated so far.

JP 2008-148594 A

An object of the present invention is to provide a method for detecting male infertility using a mutation in GALNTL5 gene or abnormal expression of GALNTL5 protein as an index, and a human male infertility model animal in which a mutation is introduced into GALNTL5 gene.
Until now, the diagnosis of male infertility due to spermatogenesis disorder is diagnosed only by sperm concentration, sperm motility, and normal sperm morphological rate by semen examination under a microscope. Therefore, at present, only infertility treatment by microinsemination is selected as a therapeutic means without developing an accurate clinical treatment method.
The present inventors have found that the GALNTL5 gene expressed specifically in the spermatogenesis process is mutated and normal GALNTL5 protein is not formed, resulting in a decrease in sperm motility and male infertility. As a result, it has been found that the cause of male infertility can be diagnosed by detecting a mutation in the GALNTL5 gene or measuring the expression level of the GALNTL5 protein.
Furthermore, the present invention has found that, by deleting the Galntl5 gene in a non-human animal, the motility of sperm is reduced and a model animal for human male infertility is produced, and the present invention has been completed.
That is, the present invention is as follows.
[1] A method for detecting male infertility, wherein male infertility is detected using an abnormal expression of GALNTL5 gene in sperm of a male subject as an index.
[2] The method for detecting male infertility according to [1], wherein GALNTL5 protein in sperm of a male subject is quantified, and male infertility is detected using the expression level of GALNTL5 protein as an index.
[3] The method for detecting male infertility according to [2], wherein GALNTL5 protein is measured using an anti-GALNTL5 antibody.
[4] The method for detecting male infertility according to [1] or [2], comprising detecting the presence or absence of a mutation that causes a decrease in expression of the GALNTL5 gene in sperm.
[5] The method for detecting male infertility according to [4], wherein the mutation is a mutation of splicing acceptor site AG between the third intron and the fourth exon of GALNTL5 gene to GG.
[6] The method for detecting male infertility according to [4], wherein the mutation is a deletion of the 106th T of the 6th exon of the GALNTL5 gene.
[7] The method for detecting male infertility according to any one of [1] to [6], wherein the mutation that causes a decrease in the expression of GALNTL5 protein in sperm is heterogeneous.
[8] The method for detecting male infertility according to any one of [1] to [7], wherein the male infertility is asthenozoospermia.
[9] An anti-GALNTL5 protein antibody for detecting male infertility, which is used in the method for detecting male infertility according to any one of [1] to [8].
[10] The anti-GALNTL5 protein antibody according to [9], which is a fragment peptide of human or mouse GALNTL5 protein, and amino acid sequence QQIIYGSEQIPPHPHIVIVKR of the 54th to 72nd amino acids of the human GALNTTL5 protein consisting of the amino acid sequence of SEQ ID NO: 2 No. 8), amino acids 282 to 297 of human GALNTL5 protein consisting of the amino acid sequence of SEQ ID NO: 2 FKWDNVFSYEMDGPEG (SEQ ID NO: 9), amino acids 362 to 377 of human GALNTTL5 protein consisting of the amino acid sequence of SEQ ID NO: 2 The amino acid sequence LLKKR at positions 42 to 58 of the mouse GALNTL5 protein comprising the sequence SKKQTGKPSTIISAMT (SEQ ID NO: 10) and the amino acid sequence of SEQ ID NO: 4 SLGKNAHQQTRH (SEQ ID NO: 5), 263 to 278 amino acid sequence LRWDNVFAYELDGPEG (SEQ ID NO: 6) of mouse GALNTTL5 protein consisting of amino acid sequence of SEQ ID NO: 4 or 342 to 358 of mouse GALNTL5 protein consisting of amino acid sequence of SEQ ID NO: 4 Anti-GALNTL5 protein that specifically recognizes an epitope possessed by the fragment peptide, obtained by immunizing an animal with a fragment peptide comprising a sequence comprising the epitope possessed by the portion represented by the amino acid sequence SKALSQHRRANQSALS (SEQ ID NO: 7) antibody.
[11] QQIIYGSEQIPKPHVIVKR (SEQ ID NO: 8), FKWDNVFSYEMDGPEG (SEQ ID NO: 9) and SKKQTGKPSTIISAMT (SEQ ID NO: 10), LLKKRSLGKNAHQQTRH (SEQ ID NO: 5), LRWDNVFAYELDGGG (SEQ ID NO: 7) A fragment peptide.
[12] A DNA fragment polynucleotide of the human GALNTL5 gene for detection of male infertility according to any one of [1] to [8].
[13] The polynucleotide of [12], which is a primer used for polymerase chain reaction (PCR).
[14] A detection kit comprising the anti-GALNTL5 protein antibody of [9] or [10] for detection of male infertility according to any one of [1] to [8].
[15] A detection kit comprising the polynucleotide of [12] or [13] for detection of male infertility according to any one of [1] to [8].
[16] A male infertility non-human model animal in which all or part of the sperm Galntl5 gene is deleted and GALNTL5 protein expression is lost or decreased.
[17] The male infertility non-human model animal according to [16], wherein the Galntl5 gene deficiency is heterozygous.
[18] The male infertility non-human model animal according to [16] or [17], which is a mouse.
[19] A method for performing homologous recombination on a cell, and selecting a recombinant cell in which homologous recombination has occurred by negative selection, wherein the Galntl5 gene is placed outside the homologous recombination region at the time of homologous recombination. A method comprising selecting a cell introduced as a gene and surviving after homologous recombination.
[20] A negative selection marker for selecting cells in which homologous recombination has occurred, comprising the Galntl5 gene.
This specification includes the contents described in the specification and / or drawings of Japanese Patent Application No. 2012-033273, which is the basis of the priority of the present application.

1-1 is a figure which shows the structure of human GALNTL5 protein (443 amino acids).
1-2 is a figure which shows the result of the quantitative analysis by real-time PCR of the GALNTL5 gene transcript in a human tissue and a human cell line.
1-3 is a figure which shows the result of in situ hybridization using antisense RNA of a mouse | mouth Galntl5 ortholog gene. Fig. 1-3a shows the result using the sense strand, and Fig. 1-3b shows the result using the antisense strand. Fig. 1-3c shows an enlarged view of the image using the antisense strand.
FIG. 2 shows the localization of GALNTL5 protein in adult mouse germ cells. Figures 2a, 2b and 2c show the results of stages III, VI and VII, respectively, of the spermatogenesis process. 2d, 2e, 2f and 2g show enlarged views of anti-GALNTL5 protein antibody staining, PNA staining and DAPI staining, respectively, in epididymal sperm, and FIG. 2g shows a merged image.
FIG. 3-1 is a diagram showing the structure of a vector used to create a Galntl5 gene-modified mouse.
FIG. 3-2 is a diagram showing the results of examining the genomic DNA genotype of Galntl5 gene-deficient ES cells established by homologous recombination by Southern blotting.
FIG. 3-3 is a diagram showing the results of examining the genomic DNA genotype of Galntl5 gene-deficient ES cells established by homologous recombination by PCR.
FIG. 3-4 is a diagram showing the results of examining the genomic DNA genotypes of Wt mice and Ht mice by PCR.
FIG. 3-5 is a graph showing the amount of GALNTL5 protein in epididymal sperm of Wt mouse and Ht mouse.
FIG. 4-1 is a diagram showing fertility of Galntl5 + / + Wt mice, Galntl5 +/− Ht male mice, and Galntl5 +/− Ht female mice.
4-2 is a figure which shows the form of the epididymis spermatozoon of Wt mouse | mouth (a) or Ht mouse | mouth (b).
FIGS. 4-3 is a figure which shows the sperm count (a), abnormal rate (b), motility (c), path | route speed | rate (d), and advancing speed | rate (e) of a Wt mouse | mouth sperm and Ht mouse | mouth sperm.
FIG. 5 is a diagram showing the results of detecting the expression of GALNTL5 protein in epididymis sperm using anti-GALNTL5 antibody. FIG. 5a shows the results of Wt mouse sperm, and FIGS. 5b and 5c show the results of Ht mouse sperm.
Fig. 6-1 shows glycolytic enzymes (hexokinase (HXK), phosphoglycerate kinase 2 (PGK2), and fructose diphosphate aldolase A (ALDOA)) present in epididymal sperm of Wt and Ht mice. It is a figure which shows existence.
FIG. 6-2 is a diagram showing localization of HXK in sperm of Wt male mice (FIG. 6-2a) and Ht male mice (FIG. 6-2b).
FIG. 7 is a diagram showing the results of comparison of proteins possessed by epididymis sperm of Wt male mice and Ht male mice.
FIG. 8 is a diagram showing intracellular localization of calreticulin, GM130, Golgin-97, and ubiquitin in COS1 cultured cells in which GALNTL5 protein is forcibly expressed. a shows calreticulin, b shows GM130, c shows Golgin-97, and d shows the result of ubiquitin staining.
FIG. 9-1 is a diagram showing the localization of ubiquitin in Wt mouse sperm and Ht mouse sperm. Fig. 9-1a shows the result of Wt mouse sperm, and Fig. 9-1b shows the result of Ht mouse sperm.
FIG. 9-2 shows the expression of acrosome protein in mouse epididymal sperm detected by western blotting of epididymal sperm lysates using antibodies against α-tubulin, ubiquitin, acrosin, NSF and tACE. FIG.
FIG. 10 is a diagram showing the localization of acrosin in Wt mouse sperm and Ht mouse sperm. 10a and b show the results for Wt mouse sperm, and FIGS. 10c and d show the results for Ht mouse sperm.
FIG. 11 is a diagram showing the localization of NSF in Wt mouse sperm and Ht mouse sperm. FIGS. 11 a and b show the results for Wt mouse sperm, and FIGS. 11 c and d show the results for Ht mouse sperm.
FIG. 12 is a diagram showing the localization of tACE in Wt mouse sperm and Ht mouse sperm. 12a and b show the results for Wt mouse sperm, and FIGS. 12c and d show the results for Ht mouse sperm.
FIG. 13 shows the results of double staining of ubiquitin and GALNTL5 protein and double staining of ubiquitin and UBC3B in Wt mouse sperm and Ht mouse sperm. FIG. 13a is the result of double staining of ubiquitin and UBC3B of Wt mouse sperm, FIG. 13b is the result of double staining of ubiquitin and UBC3B of Ht mouse sperm, and FIG. 13c is the result of ubiquitin and GALNTL5 protein of Wt mouse sperm. FIG. 13d shows the result of double staining of UBC3B and GALNTL5 protein of Wt mouse sperm.
FIG. 14 shows the colocalization of GALNTL5 protein and Rab27a or Myosin Va in Wt mouse sperm. FIG. 14a shows the localization of GALNTL5 protein and Rab27a in Wt mouse sperm, FIG. 14b shows the localization of GALNTL5 protein and Myosin Va in Wt mouse sperm, and FIG. Indicates localization.
15-1 is a figure which shows the result of a detection of the component protein of the sperm extract | collected from 10 individuals including the patient diagnosed with asthenozoospermia.
15-2 is a figure which shows the arrangement | sequence of the GALNTL5 gene of the sperm of the patient diagnosed with asthenozoospermia. In the figure, the asterisk indicates the mutation site.
FIG. 15-3 is a diagram showing the positions of mutations in the GALNTL5 gene having 9 exons.
Fig. 15-4 shows the results of digestion of GALNTL5 gene with PstI restriction enzyme of 6 sperm (Figs. 15-4a) and blood cells (Figs. 15-4b) including patients diagnosed with asthenozoospermia. It is a figure which shows the DNA fragment when not having existed.
16-1 is a figure which shows the result of the detection of the component protein about the sperm extract | collected from five individuals including the patient diagnosed with asthenozoospermia.
FIG. 16-2 shows the result of nucleotide sequence determination by amplifying each exon of the GALNTL5 gene in the sperm and blood cells of a patient in which a decrease in GALNTL5 protein was observed, and showing a partial sequence of the sixth exon. . A shows the gene sequence of normal 6th exon, and B shows the gene sequence of 6th exon with deletion.
FIG. 16-3 is a diagram showing the positions of mutations in the GALNTL5 gene having 9 exons.

The nucleotide sequence of the human GALNTL5 gene and the amino acid sequence of the human GALNTL5 protein are shown in SEQ ID NOs: 1 and 2. In addition, the nucleotide sequence of the mouse Galntl5 gene and the amino acid sequence of the mouse GALNTL5 protein are shown in SEQ ID NOs: 3 and 4, respectively.
Detection of human male infertility
In male infertility targeted for detection of human male infertility according to the present invention, abnormal expression of GALNTL5 gene occurs due to mutation of GALNTL5 gene in sperm, and normal GALNTL5 protein is not expressed, or the expression level is reduced Male infertility, such as male infertility includes asthenozoospermia. That is, the method of the present invention is also a method for detecting a causative factor of human male infertility. In the present invention, detection of male infertility includes specifying a causative factor of male infertility.
A mutation in the GALNTL5 gene refers to a change in the base sequence of the GALNTL5 gene. This change reduces the expression of the GALNTL5 protein, or even if expressed, the normal function of the GALNTL5 protein is reduced or the normal function is lost. It refers to a mutation that causes GALNTL5 protein to be expressed. Examples of such mutations in the GALNTL5 gene include deletion of all or part of the GALNTL5 gene. The GALNTL5 gene has 9 exons, for example, mutations in any one or more exons, that is, mutations in which a frame shift occurs due to deletion of one base and normal GALNTL5 protein cannot be expressed. It is done. Moreover, the mutation in the splicing acceptor site | part or splicing donor site | part of the boundary of an intron and an exon is mentioned. The splicing donor site is at the upstream end (5 ′ end) of the intron and usually consists of a GT sequence. The splicing acceptor site is at the downstream end (3 ′ end) of the intron and usually consists of an AG sequence. When a mutation occurs in the splicing donor site or the splicing acceptor site, normal splicing does not occur, and the GALNTL5 protein is not expressed, or the normal GALNTL5 protein is not expressed. For example, when a mutation occurs in the sequence of the splicing acceptor site, exon skip occurs. As an example, when the AG sequence of the splicing acceptor site at the boundary between the third intron and the fourth exon is mutated to a GG sequence, the fourth exon is skipped, and a new stop codon appears in the fifth exon due to the frame shift. The expression stops without normal GALNTL5 protein being expressed. Specifically, when the AG sequence of the splicing acceptor site at the boundary between the third intron and the fourth exon represented by TGCCTGCAGGGCGTCTTCAAAAAACTATT (SEQ ID NO: 21) is mutated to a GG sequence and becomes TGCCTGCGGGCGTCTTCAAAAAATT (SEQ ID NO: 22) is there.
In addition, when a deletion of one base occurs in the 6th exon and a stop codon appears, normal GALNTL5 protein expression becomes difficult. Specifically, the 764th T (the 106th T of the sixth exon, the 106th T of the sixth exon, the sequence of the SEQ ID NO: 23) represented by the 735th to 797th CCCAAAATGGTGCGTGTGCCCCCTGATAGAGTTCATTGATGATAGAACTCTGGAGTA (SEQ ID NO: 23) of the DNA encoding the GALNTL5 gene The 23rd T) of CCCAAAATGGTGGGTGGCCCCCGATAGAGTGTATTTGATGATAGAACTCTGGAGTA (SEQ ID NO: 24) appears, and a stop codon appears in the sixth exon, and normal GALNTL5 protein cannot be expressed.
Humans carrying the above GALNTL5 gene mutation in heterogeneity develop asthenozoospermia.
The GALNTL5 gene is a gene that is expressed specifically in the spermatogenesis process. In the method for detecting male infertility according to the present invention, a mutation of the GALNTL5 gene in sperm may be detected, or abnormal expression of GALNTL5 protein in sperm may be detected .
The mutation used for the detection of male infertility is a mutation that compares the base sequence of GALNTL5 gene shown in SEQ ID NO: 1 with the base sequence of GALNTL5 gene of sperm of male infertility patients, and this mutation causes abnormal expression of GALNTL5 protein Can be found by searching for.
Detection of a mutation in the GALNTL5 gene may be performed by extracting DNA or RNA from sperm collected from a subject and detecting the mutation. Detection of DNA or RNA can be performed by a known method. Detection of mutation of the obtained DNA or RNA can be performed by a known method. Such methods include methods using primers specific to gene mutation sites, methods using DNA chips (microarrays), methods utilizing restriction fragment length polymorphism (RFLP), direct sequencing, denaturing gradient gel electricity Electrophoresis (DGGE), method using chemical cleavage of mismatch sites (CCM), primer extension method (TaqMan (registered trademark) method), PCR-SSCP method, MADI-TOF / MS method and the like can be used. For example, using the obtained subject's sperm DNA as a template, a fragment containing the site where the mutation exists can be amplified by PCR, and then the sequence can be determined to determine the presence or absence of the mutation. For example, mutation can be detected by hybridization with a probe specific to the mutation site. At this time, one end of the probe can be fixed to a substrate and used as a DNA chip (microarray). In PCR and the like, two types of sequences existing on the 3 ′ side and 5 ′ side of the mutation site can be used as primer pairs. Further, in the method performed by hybridization with a probe specific to the mutation site, a probe comprising a continuous base sequence including the mutation site may be used. The number of bases constituting a polynucleotide such as a primer or probe used for mutation detection is 5 to 50, preferably 10 to 33, more preferably 10 to 30, and particularly preferably 15 to 25. In addition, a polynucleotide having several, preferably 1 to 5, more preferably 1 or 2, and particularly preferably 1 mismatch in the continuous base sequence including the mutation site of the base sequence of the above gene is also used. be able to. The polynucleotide may be labeled with a fluorescent substance, an enzyme, a radioisotope, a chemiluminescent substance, or the like. As a labeling substance used for labeling, a known substance can be used and labeled by a known method. Examples of the fluorescent substance include Cy3, Cy5, rhodamine, fluorescein and the like. The present invention also encompasses polynucleotides such as primers and probes for detecting male infertility.
If the GALNTL5 gene in the sperm of the subject has a mutation that causes abnormal expression of GALNTL5 protein, the subject is caused by male infertility due to abnormal expression of GALNTL5 protein, ie, decreased or lost sperm motility It can be determined that the spermatozoa is male infertility.
Abnormal expression of GALNTL5 protein in sperm having a mutation in the GALNTL5 gene includes a decrease in expression level and loss of expression compared to sperm having a normal GALNTL5 gene. Abnormal expression may be determined by measuring the expression level of GALNTL5 protein in sperm collected from the subject. That is, the GALNTL5 protein may be measured by extracting the protein from the sperm of the subject. The expression level of GALNTL5 protein can be measured using an antibody against GALNTL5 protein, and may be measured by a measurement method using an antigen-antibody reaction such as ELISA, Western blotting, immunoblot method, immunochromatography, latex agglutination method, etc. .
As an antibody which can be used for the measurement of GALNTL5 protein, for example, an anti-GALNTL5 protein antibody described later is exemplified.
Moreover, the decrease of other sperm proteins is recognized with the decrease in the amount of GALNTL5 protein by the abnormal expression of GALNTL5 protein. That is, in normal sperm, GALNTL5 protein has a function to control the distribution of proteins essential for mature spermatogenesis in sperm cells, and should co-localize with sperm acrosome (acrosome) in normal sperm In the absence of GALNTL5, the protein is not transported to the sperm acrosome. For this reason, the amount of sperm acrosome protein also decreases. Proteins for which reduction in sperm protein has been clarified with the decrease in the amount of GALNTL5 protein include glycolytic enzymes (hexokinase (HXK), phosphoglycerate kinase 2 (PGK2), and fructose diphosphate aldolase A (ALDOA). )), Ubiquitin, acrosin, UBC3B, NSF, tACE. In addition to the detection of GALNLT5 protein in sperm, by simultaneously detecting and quantifying these proteins, it is possible to more accurately determine that the cause of the decrease in sperm motility is due to the deletion of the GALNTL5 gene. These other proteins can be detected using antibodies against the respective proteins. The present invention relates to GALNTL5 protein and glycolytic enzymes (sperm kinase (HXK), phosphoglycerate kinase 2 (PGK2), fructose diphosphate aldolase A (ALDOA)), ubiquitin, acrosin, UBC3B, NSF and tACE in sperm. A method for detecting male infertility using at least one selected from the group consisting of 1, 2, 3, 4, 5, 6, 7 or 8 is also included. Also, from the group consisting of anti-GALNTL5 antibody and glycolytic enzyme group (hexokinase (HXK), phosphoglycerate kinase 2 (PGK2), fructose diphosphate aldolase A (ALDOA)), ubiquitin, acrosin, UBC3B, NSF and tACE Also included is a kit for detecting male infertility comprising a combination of antibodies against at least one selected protein.
If the sperm collected from the subject does not have normal GALNTL5 protein or is present in a small amount compared to normal GALNTL5 protein contained in normal male sperm, the subject is male infertile due to abnormal expression of GALNTL5 protein. Can be determined to be asthenozoospermia, a male infertility caused by reduced or lost sperm motility. At this time, the amount of GALNTL5 protein contained in normal male sperm is measured, a cut-off value is set based on the measured value, and when the amount of GALNTL5 protein in the sperm of the subject is lower than the cut-off value, male infertility It can be determined that
The present invention also includes a kit for detecting male infertility by measuring GALNTL5 gene deficiency or GALNTL5 protein expression abnormality. The kit includes a primer and a probe for detecting a gene mutation when detecting a gene, and an anti-GALNTL5 antibody when detecting a protein. Moreover, the reagent for extracting the GALNTL5 gene or GALNTL5 protein from a spermatozoon may be included.
The method for detecting male infertility according to the present invention can also be referred to as an inspection method for diagnosing male infertility. Moreover, the ability of sperm, such as a sperm motility, can be estimated by detecting the variation | mutation of the GALNTL5 gene of a sperm or the abnormal expression of GALNTL5 protein by the method of this invention.
The sperm of a male infertility patient determined to have an abnormality in the GALNTL5 gene by the method of the present invention has decreased motility, and it can be determined that the patient has asthenozoospermia. In addition, sperm with abnormal GALNTL5 gene may reduce the efficiency of natural fertilization in vitro with the ovum, so the intracytoplasmic sperm injection method (ICSI) is particularly effective among microinsemination methods. Yes (from Table 1 mouse experiments).
Fragment polypeptide of GALNTL5 protein and anti-GALNTL5 protein antibody
The present invention includes anti-GALNTL5 protein antibodies. The antibody can be prepared using a fragment peptide containing an epitope of GALNTL5 protein. The fragment peptide can be prepared by immunizing animals such as mice, rabbits, guinea pigs, rats, goats, pigs and horses. A fragment peptide containing an epitope of GALNTL5 protein can be predicted based on the structure of a protein encoded by a gene other than the Galntl5 gene belonging to the polypeptide N-acetylgalactosaminyltransferase gene (pp-GalNAc-T) family. That is, for example, the three-dimensional structure of the GALNTL10 protein is analyzed, and a fragment containing a site that is located outside the molecule in three-dimensional structure and is likely to be recognized as an epitope may be selected. A fragment containing the amino acid sequence of GALNTL5 protein having high amino acid sequence homology with the fragment containing the selected site can be used as a fragment peptide containing an epitope of GALNTL5 protein. As a fragment peptide containing the epitope of the mouse GALNTL5 protein, the amino acid sequence LLKKRSLKGNAHQQTRH (SEQ ID NO: 5) of the 42nd to 58th amino acid sequence of the mouse GALNTTL5 protein consisting of the amino acid sequence of SEQ ID NO: 4, and the mouse GALNTL5 protein consisting of the amino acid sequence of SEQ ID NO: 4 A fragment comprising the amino acid sequence represented by the amino acid sequence SKALSQHRRANQSALS (SEQ ID NO: 7) of the amino acid sequence 342 to 358 of the mouse GALNTTL5 protein consisting of the amino acid sequence of 263 to 278 amino acid sequence LRWDNVFAYELDGPEG (SEQ ID NO: 6) or SEQ ID NO: 4 Can be mentioned. Further, as a fragment peptide containing an epitope of human GALNTL5 protein, human GALNTTL5 consisting of amino acid sequence QQIIYGSEQIPPHPHIVKR (SEQ ID NO: 8) and amino acid sequence of SEQ ID NO: 2 of human GALNTTL5 protein consisting of amino acid sequence of SEQ ID NO: 2 Consists of an amino acid sequence represented by the amino acid sequence SKKQTGKPSTIISAMT (SEQ ID NO: 10) of the 362nd to 377th amino acid sequence of the human GALNTL5 protein consisting of the amino acid sequence FKWDNVFSYEMDGPEG (SEQ ID NO: 9) of the protein and the amino acid sequence of SEQ ID NO: 2. A fragment can be mentioned. Antibodies include both polyclonal and monoclonal antibodies. For example, a polyclonal antibody can be immunized simultaneously with a fragment peptide comprising the amino acid sequence represented by SEQ ID NO: 5, a fragment peptide comprising the amino acid sequence represented by SEQ ID NO: 6 and a fragment peptide comprising the amino acid sequence represented by SEQ ID NO: 7. An antibody composition in which antibodies against the three types of fragment peptides obtained as described above were mixed, a fragment peptide comprising the amino acid sequence represented by SEQ ID NO: 8, a fragment peptide comprising the amino acid sequence represented by SEQ ID NO: 9, and SEQ ID NO: 10 The antibody composition which mixed the antibody with respect to three types of fragment peptides obtained by immunizing simultaneously the fragment peptide containing the amino acid sequence represented by these is also included.
The present invention relates to (i) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 5, 6, 7, 8, 9 or 10, and (ii) an amino acid represented by SEQ ID NO: 5, 6, 7, 8, 9 or 10. A polypeptide comprising a sequence, which is a polypeptide consisting of an amino acid sequence consisting of 16-30 amino acid residues, preferably 17-30, more preferably 19-30, (iii) SEQ ID NOs: 5, 6, 7 A fragment polypeptide of GALNTL5 protein containing an epitope possessed by a polypeptide consisting of the amino acid sequence represented by 8, 9 or 10.
In addition, in the amino acid sequence represented by SEQ ID NO: 5, 6, 7, 8, 9 or 10, an amino acid sequence having one or two amino acids deleted, substituted, inserted or added and having an epitope A polypeptide consisting of
An anti-GALNTL5 antibody that specifically recognizes and binds to the peptide can be produced using the peptide. The antibody can be used for detection of GALNTL5. The present invention also encompasses specific antibodies against the above epitope of GALNTL5.
The antibodies of the present invention include antibodies that have been modified in their amino acid sequence without reducing the desired activity (eg, the activity of recognizing and binding to GALNTL5 protein). Amino acid sequence variants of the antibodies of the invention can be made by introducing mutations into the DNA encoding the antibody chains of the invention or by peptide synthesis. Such modifications include, for example, residue substitutions, deletions, additions and / or insertions within the amino acid sequences of the antibodies of the invention. The site where the amino acid sequence of the antibody is modified may be the constant region of the heavy chain or light chain of the antibody as long as it has an activity equivalent to that of the antibody before modification, and the variable region (framework region and CDR). Modification of amino acids other than CDR is considered to have a relatively small effect on the binding affinity with the antigen, but at present, the amino acid of the CDR is modified to screen for an antibody having an increased affinity for the antigen. Techniques are known.
The number of amino acids to be modified is preferably within 10 amino acids, more preferably within 5 amino acids, and most preferably within 3 amino acids (eg, within 2 amino acids, 1 amino acid). The amino acid modification is preferably a conservative substitution. In the present invention, “conservative substitution” means substitution with another amino acid residue having a chemically similar side chain. Groups of amino acid residues having chemically similar amino acid side chains are well known in the technical field to which the present invention belongs. For example, acidic amino acids (aspartic acid and glutamic acid), basic amino acids (lysine, arginine, histidine), neutral amino acids, amino acids with hydrocarbon chains (glycine, alanine, valine, leucine, isoleucine, proline), hydroxy groups Amino acids with amino acids (serine / threonine), amino acids with sulfur (cysteine / methionine), amino acids with amide groups (asparagine / glutamine), amino acids with imino groups (proline), amino acids with aromatic groups (phenylalanine / tyrosine / (Tryptophan).
In addition, the modification of the antibody of the present invention may be modification of a post-translational process of the antibody such as changing the number, position, and type of glycosylation sites. Antibody glycosylation is typically N-linked or O-linked. Antibody glycosylation is highly dependent on the host cell used to express the antibody. The glycosylation pattern can be modified by a known method such as introduction or deletion of a specific enzyme involved in sugar production. Furthermore, in the present invention, deamidation is suppressed by substituting an amino acid adjacent to the amino acid deamidated or deamidated with another amino acid for the purpose of increasing the stability of the antibody. May be. Alternatively, glutamic acid can be substituted with other amino acids to increase antibody stability. The present invention also provides the antibody thus stabilized.
Human male infertility non-human model animal deficient in Galntl5 gene
Furthermore, the present invention includes a human male infertility non-human model animal that lacks the Galntl5 gene. The human male infertility non-human model animal of the present invention is a knockout animal of Galntl5 gene. Non-human animals include mice, rats, rabbits, guinea pigs, dogs, cats, monkeys and the like, and are preferably rodent animals such as mice or rats that have a short time to ontogeny and are easy to reproduce.
In the human male infertility non-human model animal of the present invention, a mutation is artificially introduced into the Galntl5 gene specifically present in sperm, and the expression of GALNTL5 protein becomes abnormal. Here, the expression of GALNTL5 protein becomes abnormal means that GALNTL5 protein does not express or does not retain the function of normal GALNTL5 protein even if expressed. As a result, the motility of the sperm decreases and it becomes difficult for the sperm to reach the egg, resulting in infertility and infertility. The deficiency of the Galntl5 gene means that the Galntl5 gene is mutated so that expression of normal GALNTL5 protein is suppressed. A mutation in the Galntl5 gene is introduced by deleting all or part of the Galntl5 gene, or by inserting or replacing another gene at any site of the Galntl5 gene, or by replacing the entire Galntl5 gene with another gene. can do. The mutation can be introduced by deleting the entire base sequence of the Galntl5 gene by a known genetic engineering technique. In addition, a part of the base sequence of the Galntl5 gene is deleted, another gene is inserted into the base sequence of the Galntl5 gene, or the base sequence of the Galntl5 gene is partially replaced with another gene, Alternatively, it can be introduced by replacing the entire Galntl5 gene with another gene. Partial deletion of the Galntl5 gene, insertion of another gene into the base sequence of the Galntl5 gene, or partial replacement of the Galntl5 gene with another gene destroys the promoter or exon, resulting in abnormal expression of GALNTL5 protein become. Mutation can be introduced, for example, by site-directed mutagenesis or homologous recombination. For example, an exon can be destroyed by inserting a drug resistance gene such as a neomycin resistance gene or a hygromycin resistance gene or a reporter gene such as lacZ (β-galactosidase gene) or CAT (chloramphenicol acetyltransferase gene) into the exon portion. In addition, an element that terminates transcription of a gene such as a polyA addition sequence may be inserted into the intron portion, for example, the second exon of the Galntl5 gene may be replaced with a neomycin resistance gene. It can be carried out by a known method using a targeting vector designed so that other genes can be replaced with part or all of the Galntl5 gene by homologous recombination.
In order to create a human male infertility non-human animal model having a mutation in the Galntl5 gene of the present invention, at least one allele of the Galntl5 gene of an embryonic stem cell (ES cell) of a non-human animal using the above targeting vector Established Galntl5 gene-deficient ES cells in which the gene is disrupted. The targeting vector can be introduced into ES cells by a known method such as electroporation or microinjection. Whether the Galntl5 gene in ES cells is deficient can be selected using the drug resistance gene or reporter gene used for homologous recombination as a marker. Established ES cells are transplanted into non-human animal embryos. At this time, a blastocyst is used as an embryo. Transplantation can be performed, for example, by the blastocyst microinjection method. Next, the scutellum method is transplanted into a pseudopregnant female animal that is a temporary parent of a non-human animal to obtain a chimeric animal. A heterozygous (Ht) deficient animal of the Galntl5 gene can be obtained by crossing a germline chimeric animal with a normal animal. Hetero-deficient male animals are infertile because of abnormalities in GALNTL5 protein expression. On the other hand, hetero deficient female animals have fertility. Thus, by mating a heterodeficient female animal and a wild type (normal) male animal, a Galntl5 gene heterodeficient animal can be obtained. Whether or not the obtained animal is a heterozygous mutant of the Galntl5 gene is extracted by extracting DNA from somatic tissues including the tail and sperm or eggs that are germ cells, identifying the genotype by PCR or Southern hybrid method, and discriminating To do. Alternatively, RNA can be isolated from the obtained animal sperm and confirmed by RT-PCR or Western blotting, for example, by examining the expression levels of the Galntl5 gene and GALNTL5 protein in the animal sperm. It should be noted that Galntl5 gene heterodeficient mice are infertile because sperm motility is reduced, and may not retain the natural fertilization ability of sperm. By insemination of Galntl5 heterozygous male sperm and Galntl5 heterozygous female egg by internal sperm injection method (ICSI), a homodeficient animal deficient in the Galntl5 gene of both alleles can be obtained.
The obtained male infertility model animal can be used as a model animal for human asthenozoospermia for the development of therapeutic drugs and the like.
Use of Galntl5 gene as a negative selection marker
Currently, when a gene is incorporated into ES cells by homologous recombination, the neomycin gene is inserted as a positive selection marker, and the thymidine kinase (TK) gene sequence is inserted outside the homologous recombination region as a negative selection marker. The technique of obtaining the gene homologous recombination was taken. When the Galntl5 gene is expressed, the structure and function of the Golgi apparatus are impaired, and the expressed cells cause cell death. Therefore, the Galntl5 gene can be used as a negative selection marker. For example, in the case of homologous recombination, by introducing the expression-inducible Galntl5 gene outside the homologous recombination region, the recombinant cell in which the target gene homologous recombination did not occur is killed by the expression of the remaining Galntl5 gene. To do. The Galntl5 gene may be incorporated into a targeting vector used for homologous recombination. The present invention includes a method of using Galntl5 gene as a negative selection marker and a negative selection marker comprising Galntl5 gene. As the Galntl5 gene, a human GALNTL5 gene and a mouse Galntl5 gene, as well as a Galntl5 gene derived from other species can be used. As the mouse Galntl5 gene, the gene consisting of the base sequence shown in SEQ ID NO: 3 can be used, and as the human GALNTL5 gene, the gene consisting of the base sequence shown in SEQ ID NO: 1 can be used. Further, in the base sequence represented by SEQ ID NO: 3, one or more bases are deleted, substituted, inserted or added, and the protein encoded by the base sequence has the function of GALNTL5 protein, and the sequence A gene having one or more bases deleted, substituted, inserted or added in the base sequence represented by No. 1 and the protein encoded by the base sequence having the function of GALNTL5 protein is also used as a negative selection marker gene Can be used.
Cancer treatment
From the results of forced expression of GALNTL5 protein in cultured cells, it was shown that GALNTL5 protein is a substance that can be a cellular toxin that causes the Golgi body to disappear and kills cells, except for cells in the process of spermatogenesis. In fact, no expression of the Galntl5 gene has been observed in cultured cells containing various cancer origins. Therefore, the GALNTL5 gene can be used as a therapeutic gene for killing cancer cells specifically. In order to use the GALNTL5 gene for cancer treatment, the expression of the GALNTL5 gene originally encoded in the human genome may be selectively expressed only in cancer cells. For example, it is considered effective to use a histone demethylating agent as a drug that activates the expression of the GALNTL5 gene. Alternatively, the GALNTL5 gene may be introduced into a vector, and the GALNTL5 gene may be delivered specifically to cancer cells using the vector and specifically expressed in cancer cells. As a method for introducing a gene into a subject, there are a method using a viral vector and a method using a non-viral vector, and various methods are known (separate volume experimental medicine, basic technology of gene therapy, Yodosha, 1996; separate volume). Experimental Medicine, Gene Transfer & Expression Analysis Experimental Method, Yodosha, 1997; edited by Japanese Society of Gene Therapy, Gene Therapy Development Research Handbook, NTS, 1999).
Examples of viral vectors for gene transfer include methods using viral vectors such as adenovirus, adeno-associated virus, and retrovirus. Delivery of GALNTL5 gene to cancer cells can be achieved, for example, by binding a compound capable of specifically binding to a cancer cell-specific cell surface protein to a vector. The present invention includes a cancer therapeutic agent containing the GALNTL5 gene. The cancer therapeutic agent includes a carrier, a diluent, and an excipient normally used in the pharmaceutical field. For example, lactose and magnesium stearate are used as carriers and excipients for tablets. As an aqueous solution for injection, isotonic solutions containing physiological saline, glucose and other adjuvants are used, and suitable solubilizers such as polyalcohols such as alcohol and propylene glycol, nonionic surfactants, etc. You may use together. As the oily liquid, sesame oil, soybean oil or the like is used, and as a solubilizing agent, benzyl benzoate, benzyl alcohol or the like may be used in combination. The dosage varies depending on symptoms, age, body weight, etc., but may be administered by subcutaneous injection, intramuscular injection, or intravenous injection at a dose of 0.001 mg to 100 mg once every several days, weeks or months.
In the examples, preparation and analysis of each material were performed by the following methods.
1. Identification of GALNTL5 cDNA
Human GALNTL5 cDNA (Refseq accession number: NP — 660335) was identified by BLAST search of human expressed sequence tag using human pp-GalNAc-Ts cloned by the present inventor as a query. The full-length mouse Galntl5 cDNA clone is derived from the mouse testis QUICK-Clone. ^TM Using cDNA (Clontech) as a template, 5'-ATGAAAGTGTCATAATTCAGGG-3 '(SEQ ID NO: 11) and 5'-CTAGAAACGATTTTTTTCCTTTTCCTCTCTGTGTTAAATGG-3' (SEQ ID NO: 12) were used for amplification.
2. Quantitative analysis of human GALNTL5 transcript
Quantitative real-time PCR was carried out using TaqMan Universal PCR Master Mix and ABI PRISM 7700 Sequence Detection System (Applied Biosystems Japan, Ltd. 2), T2 et al. A. et al. J Biol Chem 276, 22032-40 (2001); Wang, H. et al. Biochem Biophys Res Commun 300, 738-44 (2003)). The sequences of the PCR primers used were 5′-GAAGCTTGGGCATCATGAAA-3 ′ (SEQ ID NO: 13) and 5′-GCGGGCTGGGTAATGTTT-3 ′ (SEQ ID NO: 14).
3. In situ hybridization analysis
Sense and antisense RNA probes were generated from linear mouse full-length Galntl5 cDNA and subcloned into pBluescript using digoxigenin-UTP (Roche Molecular Biochemicals). In situ hybridization of adult mouse testis sections was performed according to the method of Fujiwara et al. (Fujiwara, Y. et al. Proc Natl Acad Sci USA 91, 12258-62 (1994)).
4). Creation of mutant mice
Mouse Galntl5 gene genomic BAC clone RP23-229N3 was purchased from Research Genetics, Inc. Obtained from. A targeting vector was constructed and the second exon of the Galntl5 gene was replaced with a neomycin resistance gene. 20 μg of plasmid was introduced by electroporation into E14 embryonic stem cells cultured in neomycin resistant fibroblasts. After double drug selection using G418 (Gibco) and ganciclovir (WAKO), each colony was analyzed by Southern blotting and PCR to confirm that homologous recombination had occurred. After digestion with SpeI, the 19.8 kbp fragment was detected from the normal allele with the 5 ′ probe, and the 19.8 kbp fragment and the 14.6 kbp fragment were detected from the target allele. Genotypes of embryonic stem cells and mouse tails were determined using PCR and genomic DNA extracted by DNeasy Blood & Tissue Kit (QIAGEN). The wild type allele uses primer 6605A (5′-GAGACCTTAGGCTTGAAAACAAAAACCAC-3 ′ (SEQ ID NO: 15) and primer 5970S (5′-GATTTCCCAGGTTCATCTGCCATCCCG-3 ′ (SEQ ID NO: 16)) consisting of a sequence adjacent to the second exon of mouse Galntl5. The mutant allele was a primer NeoLeft25 (5′-TGCGCTGACAGCCGGAACAGGCGG-3 ′ (SEQ ID NO: 17)) consisting of the sequence of the neo gene and a sequence in the third intron outside the 3 ′ end of the 3.4 kbp homologous region. The primer AvrHind2-2 (5′-TATACCACAATTGAATGGATATAGA-3 ′ (SEQ ID NO: 18) consisting of
In the present invention, the resulting Galntl5 gene heterozygous (Ht) -deficient mouse is referred to as an Ht mouse, and a wild type mouse is referred to as a Wt mouse. Also, Ht mouse sperm is called Ht mouse sperm, and Wt mouse sperm is called Wt mouse sperm.
5). Circular sperm cell injection
Spermatogenic cells were collected from the testes of Wt and Ht male mice (Ogura, A. et al. Biol Reprod 48, 219-25 (1993)). Elongated sperm cells were directly injected into the egg cytoplasm of Ht mature oocytes using a piezoelectrically driven micromanipulator. Embryos with a size of 4-8 cells after 48 hours in culture were transferred to pseudopregnant female fallopian tubes on day 0.5.
6). Sperm motility assay
To assess sperm motility, sperm samples were placed on microslides (0.1 x 2.0 mm). Sperm motility parameters were measured using IVOS TOX automation system (Hamilton Throne) in samples containing more than 300 spermatozoa.
7). antibody
The following anti-GALNTL5 protein antibody was used for immunostaining and the like.
Three types of polypeptides (LLKKRSLGKNAHQQTRH (SEQ ID NO: 5), LRWDNVFAYELDGPEG (SEQ ID NO: 6), SKALSQHRRANQSALS (SEQ ID NO: 7)) were synthesized based on the amino acid sequence deduced from the mouse Galntl5 mRNA sequence. In addition, three types of polypeptides (QQIIYGSEQIPPHPHIVKR (SEQ ID NO: 8), FKWDNVFSYEMDGPEG (SEQ ID NO: 9) and SKKQTGKPSTIISAMT (SEQ ID NO: 10)) corresponding to the amino acid region of human GALNTL5 protein were synthesized. Cysteine was added to the N-terminus of each polypeptide and conjugated with a carrier. The anti-mouse GALNTL5 protein antibody was prepared using guinea pigs and the anti-human GALNTL5 protein antibody was immunized with rabbits. The obtained antiserum was purified using an affinity column. The anti-human GALNTL5 protein antibody was finally purified using a Protein A Sepharose column. Commercially available antibodies are used for α-tubulin, hexokinase I (HXK I), phosphoglycerate kinase 1/2 (PGK1 / 2), aldolase A, NSF, ACE, ubiquitin, acrosin, Rab27a, UBC3B and myosin Va. Using.
8). Western blotting
Mouse spermatozoa were collected from the caudal epididymis, suspended in PBS (pH 7.4) and counted using a Makler Counting Chamber (Sefi-Medical Instruments, Ltd.). Human sperm was collected from semen washed several times with PBS. 5 × 10 ⁶ Protein lysates were obtained from each sperm by vortexing using RIPA lysis buffer (25 mM Tris-HCl, pH 7.6; 150 mM NaCl; 1% NP-40; 1% sodium deoxycholate; 0.1% SDS). The testis was homogenized in a lysis buffer to obtain a crude lysate. Western blotting was performed using the resulting lysate.
9. Mass spectrometry
5 × 10 ⁵ Each sperm was electrophoresed on a 10% SDS-PAGE denaturing gel. The protein band was silver stained. Proteins were eluted from the gel, trypsinized, peptide sequences were analyzed by mass spectrometry (Ultraflex, Bruker Daltoniks, Bremen, Germany) and analyzed using the MS-Fit search program (http://prospector.ucsf.edu. /Prospector/mshome.htm).
10. Immunofluorescence microscopy
The GFP-mGalntl5 construct was generated using the pAcGFP-C1 GFP reporter vector (Clontech). COS1 cells grown on cover slips were transiently transfected with GFP-mGalntl5 plasmid DNA using Lipofectamine 2000. Cells were fixed in methanol for 2 minutes 48 hours after transfection and then treated with 0.1% Triton X-100 for 1 minute at room temperature. Finally, the cells were blocked with PBS containing 5% bovine serum albumin. Antibodies against calreticulin, GM130 and Golgin-97 were used as primary antibodies, and secondary antibodies labeled with Alexa594 were used. The cover slip was placed on a slide glass and stained with DAPI (4 ′, 6-diamidino-2-phenylindole) using VECTASHIELD, and the nucleus was counterstained. Images were taken with a fluorescence microscope and a digital camera.
11. Immunocytochemistry
Miki, K .; et al. In the method described in Dev Biol 248,331-42 (2002), spermatozoa collected from the epididymis tail were placed on a coverslip, washed with PBS, and then sperm was conjugated with Alex Fluor 488 or Alex Fluor 594. Subsequent antibodies and PNA conjugated with fluorescein isothiocyanate were incubated for 30 minutes at room temperature. Immunostaining was observed using a fluorescence microscope (OLYMPUS).
12 PCR and DNA sequence analysis of human individual tissues
Genomic DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN), and 20 ng of the obtained genomic DNA was used as a primer for the fourth exon (5′-ACACAGTCTCGAGAAAGAGC-3 ′ (SEQ ID NO: 19 and 5′-ATACTCAAGTGCCCATGGGG-3 ′). (SEQ ID NO: 20) and Takara Taq (registered trademark) (TAKARA BIO INC.) Were mixed and PCR amplified, and amplification was performed for 30 cycles (94 ° C. for 20 seconds, 60 ° C. for 30 seconds, 72 ° C. for 1 minute). The product was purified from an agarose gel, sequenced and subcloned into pGEM®-T Easy Vector (Promega).

Creation of Galntl5 genetically modified mice In silico screening (Narimatsu, H. Glycoconj J 21, 17-24 (2004).), Cloning of a plurality of human UDP-GalNAc genes and novel pp-GalNac encoding GANNTL5 protein -The T gene was identified. Fig. 1-1 shows the structure of human GALNTL5 protein (443 amino acids). For comparison, the structure of GALNT12 (581 amino acids), which is a family protein, is also shown. The GALNTL5 protein lacks the C-terminal lectin domain unique to the GalNAc-T gene family protein, but other typical motifs possessed by the pp-GalNA-T gene family protein, namely transmembrane It has a catalytic unit consisting of a domain (TM), a stem region (Stem), and a GT1 motif and a Gal / GalNAC-T motif.
FIG. 1-2 shows the results of quantitative analysis of GALNTL5 gene transcripts in 23 types of human tissues and two types of human cell lines. The amount of GALNTL5 gene transcript is normalized with GAPDH and is expressed as the copy number relative to GAPDH in 1 μg of total RNA. As shown in FIG. 1-2, the expression of GALNTL5 mRNA was limited to human testis.
Next, for the purpose of clarifying the function of the Galntl5 gene in spermatogenesis and the like, attention is paid to the Galntl5 homologous gene existing in the mouse genome, and the mouse GALNTL5 protein is specifically identified by the method described in “7. Antibodies were recognized and the localization of GALNTL5 protein was revealed using mouse testis slices and epididymis sperm.
Adult mouse testis was used as the material, and in situ hybridization was performed using antisense RNA of the mouse Galntl5 ortholog gene. Fig. 1-3a shows the result using the sense strand, and Fig. 1-3b shows the result using the antisense strand. Fig. 1-3c shows an enlarged view of the image using the antisense strand. As shown in FIG. 1-3, Galntl5 mRNA was mainly expressed in circular sperm cells and elongated sperm cells, but not in inner lining cells of seminiferous tubules.
The inner cell of the seminiferous tubule includes spermatogonia and Sertoli cells which are somatic cells. The localization of GALNTL5 protein was examined by immunohistochemistry of mouse testis sections. Specifically, adult testis sections were immunostained with anti-GALNTL5 protein antibody and counterstained with Hoechst staining. The results are shown in FIG. Figures 2a, 2b and 2c show the results of stages III, VI and VII of the spermatogenesis process, respectively. 2d, 2e, 2f and 2g show enlarged views of anti-GALNTL5 protein antibody staining, PNA staining and DAPI staining, respectively, and FIG. 2g shows a merged image. Acrosomes are stained by PNA staining, and nuclei are stained by DAPI staining. As shown in FIG. 2, the GALNTL5 protein was mainly localized around the cytoplasm and the acrosome of differentiated sperm cells (FIGS. 2a-c). GALNTL5 protein was also observed in the residual body of step-16 sperm cells just prior to release into the epididymis (FIG. 2c). In epididymal spermatozoa, GALNTL5 protein was present in trace amounts in the middle tail (middle-piece) or accumulated in the sperm neck around the head-tail coupling apparatus (Fig. 2d). From these figures, the GALNTL5 protein is localized in the sperm cytoplasm during meiotic spermatogenesis, and in epididymal mature sperm, it is weakly scattered in the middle part of the sperm tail, but is strongly accumulated in the sperm neck. (FIG. 2). The possibility that the Galntl5 gene contributes to spermatogenesis was strongly shown from the sperm localization in the spermatogenesis process of the above-mentioned GALNTL5 protein.
Therefore, a vector was constructed in which the second exon encoding the translation initiation site in the mouse Galntl5 gene composed of nine exons was converted into a neomycin resistance gene. Fig. 3-1 shows the structure of the vector. FIG. 3A shows a normal allele having the first 3 exons of 9 containing the mouse Galntl5 gene. The center of FIG. 3-1 shows the structure of a targeting vector containing a neomycin resistance gene (NEO) and a thymidine kinase gene (TK) as selection markers. Homologous recombination was performed in a 6.0 kbp region and a 3.4 kbp region containing the first and third exons, respectively. The lower part of FIG. 3-1 shows the target allele in which the second exon including the translation initiation region is replaced with the Neo cassette. In FIG. 3-1, a numbered box indicates an exon, a dotted line indicates a homologous DNA region, and a bar and an arrow indicate the positions of 5 ′ probe and PCR primers (6605A, 5970S, NeoLeft25 and AvrHind2-2), respectively. Restriction enzyme sites are represented by A (Avr II), H (Hind III), P (Pml I) and S (Spe I).
Galntl5 gene-deficient ES cells were established by homologous recombination using the above targeting vector, and the genomic DNA genotype was determined by Southern blotting. After digestion with SpeI, 19.8 kb and 14.5 kb fragments were detected as a normal allele and a target allele (FIG. 3-2). The genotype of the ES cell was also determined by PCR using the four primers described in “4. Production of mutant mice” in the method column. A 0.7 kb DNA fragment was amplified from the normal allele, and a 4.4 kb DNA fragment was amplified from the target allele (FIG. 3-3). In addition, DNA was purified from the tail of the mouse and the genotype was determined by PCR (FIGS. 3-4). Furthermore, the amount of GALNTL5 protein in the epididymis sperm of Wt mouse and Ht mouse was measured by Western blotting. As shown in FIG. 3-5, the amount of GALNTL5 protein in Ht mouse sperm was less than half that in Wt mouse sperm.
In this method, genetically engineered ES cells established by the method described in “4. Production of mutant mice” in the method column are introduced into mouse embryos, and attempts are made to create Galntl5 gene-deficient mice. We succeeded in obtaining 7 chimeric male mice, which were presumed to have differentiated. However, since all the chimeric male mice do not show fertility, it was extremely difficult to establish a transgenic mouse strain. Thus, a chimeric female mouse introduced with a genetically modified ES cell was mated with a normal male mouse (C57BL / 6J) to successfully produce offspring of a Galntl5 gene heterozygous (Ht) deficient mouse. Since no abnormality was observed in the fertility of the Galntl5 gene Ht female mouse, the strain of the Galntl5 gene-deficient Ht mouse was maintained by crossing the Galntl5 gene Ht female mouse with a normal male mouse. The result of having examined the fertility of the male mouse in FIG. 4-1. FIG. 4-1 shows the fertility of Galntl5 + / + Wt mice, Galntl5 +/− Ht male mice, and Galntl5 +/− Ht female mice. As shown in the figure, the Galntl5 gene Ht-deficient male mouse in which the strain was established did not show fertility like the chimeric male mouse. As a result of sperm observation in order to investigate the cause of male infertility in Ht mice, it was found that the abnormal frequency of the head shape was high. FIGS. 4-2a and 4-2b show the sperm morphology of the epididymis of Wt mice or Ht mice. Arrows in FIG. 4-2b indicate deformed sperm of Ht male mice. 4-3a to 4-3e show the sperm count, abnormal rate, motility, path velocity and progressive velocity of Wt mouse sperm and Ht mouse sperm. As shown in the figure, it was shown that there was an impairment in the motility caused by sperm shaking the tail (FIGS. 4-3c, d and e). Table 1 shows the number of embryos obtained by injecting extended sperm cells of Wt male mice or Ht male mice. As shown in Table 1, microinsemination (ICSI: intracytoplasmic sperm injection method) using Ht male mouse spermatozoa was performed, and there was no difference in the number of normal male mouse spermatozoa and offspring produced in Ht male mice. It became clear that the cause of male infertility in male mice was an impairment of sperm motility.
Moreover, the expression of GALNTL5 protein in epididymis sperm was detected using an anti-GALNTL5 antibody. The results are shown in FIG. FIG. 5a shows the results of Wt mouse sperm, and FIGS. 5b and 5c show the results of Ht mouse sperm. As shown in the figure, in Wt mouse sperm, weak expression was observed in the middle part of the tail, and strong expression was observed in the head-tail binding site. Expression in Ht mouse sperm was weaker than in Wt mouse sperm.
Furthermore, biochemical experiments revealed that the decrease in motility of Ht mouse sperm was caused by a decrease in the amount of energy-producing glycolytic enzymes essential for sperm motility. FIGS. 6-1 and 6-2 show glycolytic enzymes (hexokinase (HXK), phosphoglycerate kinase 2 (PGK2), and fructose diphosphate aldolase A) present in sperm of the epididymis of Wt mice and Ht mice. The result of examination of ALDOA)) is shown. FIG. 6-1 shows the results of separation of sperm lysates from male mice of each genotype by SDS-PAGE and detection using anti-HXK antibody, anti-PGK2 antibody and anti-ALDOA antibody. α-tubulin was used as a control. FIGS. 6-2a and 6-2b show the localization of HXK in the sperm of Wt male mice (FIG. 6-2a) and Ht male mice (FIG. 6-2b). The localization of HXK was detected by visualization using an anti-rabbit IgG immunofluorescent secondary antibody. The acrosome was stained with PNA and the nucleus was stained with DAPI. As shown in the figure, there was little HXK in Ht male mice. FIG. 7 shows the results of comparison of proteins possessed by sperm of the epididymis of Wt male mice and Ht male mice. Proteins were identified by MS / MS analysis. Comparison of the amount of each protein was performed by performing SDS-PAGE for sperm proteins and silver staining. (FIGS. 6-1, 6-2 and 7). These results indicate that haplo deficiency of the Galntl5 gene suppresses sperm motility by reducing the glycolytic enzyme level of normal sperm.
The phenotype of this Ht mouse sperm motility disorder is very similar to that of asthenozoospermia observed in human male infertility. Can be effectively used as a model mouse for asthenozoospermia disease.

Functional assay of GALNTL5 protein The pp-GalNAc-T protein is localized in the Golgi apparatus in the cell and functions as a glycosyltransferase. The GALNTL5 protein has a GT1 motif and a transmembrane (TM) domain, like the other pp-GalNAc-T gene family proteins, but lacks the C-terminal lectin domain (FIG. 1-1). . The transmembrane domain of GALNTL5 protein at least indicates that GALNTL5 protein is present in the Golgi apparatus. Thus, except for the deletion of the C-terminal lectin structure, the GALNTL5 protein showing high homology with other pp-GalNAc-Ts is also expected to be localized in the Golgi apparatus as with other pp-GalNAc-T proteins. However, in the immunostaining using a mouse testis section with an anti-mouse GALNTL5 protein antibody, an image in which the GALNTL5 protein was localized in the sperm intracellular Golgi apparatus during morphogenesis was not observed. Therefore, in order to confirm the intracellular localization of the GALNTL5 protein, an attempt was made to forcibly express the GALNTL5 protein added with the GFP protein tag in COS1 cells. A transient expression plasmid was prepared by the following method. Mouse Galntl5 cDNA was introduced into a commercially available pAcGFP-C1 GFP reporter vector (Clontech) to construct a GFP-Galntl5 gene expression vector. The introduction method into the cells was as described in “10. Observation with immunofluorescence microscope” in the method column. Fluorescence of COS1 cells transfected with GFP-mGalntl5 plasmid DNA using antibodies to the endoplasmic reticulum marker Calreticulin, the cis Golgi marker GM130, the trans Golgi marker Golgin-97 and ubiquitin Immunostained. FIG. 8 shows intracellular localization of calreticulin, GM130, Golgin-97, and ubiquitin in COS1 cultured cells in which GALNTL5 protein is forcibly expressed. FIGS. 8a, 8b, 8c and 8d show the results of staining for calreticulin, GM130, Gollin-97 and ubiquitin, respectively.
It was confirmed that the GALNT3 protein belonging to the pp-GalNAc-T gene family, whose enzyme activity was confirmed and localization in the Golgi apparatus, was localized in the Golgi apparatus. On the other hand, it was shown that the GALNTL5 protein does not localize in the endoplasmic reticulum (ER) and the Golgi apparatus but stays in the cells around the nucleus (FIG. 8). Interestingly, in the cells forcibly expressing the GALNTL5 protein, the disappearance of the Golgi apparatus marker was observed although the calreticulin (ER marker) was normal (FIG. 8a). We have tried to establish a stable GALNTL5 protein-expressing cell line so far, but have not been successful, and according to this example, GALNTL5 protein expression has the effect of causing damage to the structure and function of the Golgi apparatus and killing the cell. It has become clear that it is a substance that is toxic to cells. On the other hand, the sperm cell in which the expression of GALNTL5 protein is observed has a Golgi body contracting during the spermatogenesis process, and the Golgi body is an intracellular organ that is finally removed from the sperm cell by the residual body. It is speculated that may be responsible for the contraction of the Golgi apparatus in the sperm cell during the spermatogenesis process, or the switching of protein transport from the Golgi apparatus to the membrane structure and acrosome specific to the sperm cell. In fact, the signal of the GFP-tagged GALNTL5 protein is observed in the form of intracellular vesicles or granules (FIG. 8). Interestingly, there is an image in which the ubiquitin signal is packed in the vesicles formed by the GALNTL5 protein. Observed (Figure 8d).
The above results in cultured cells suggest that the GALNTL5 protein contributes to protein transport to the acrosome, which is a membrane structure unique to sperm cells in the spermatogenesis process.
Knockdown of the Galntl5 gene was predicted to damage the acrosome-constituting proteins including ubiquitinated proteins. Then, the localization amount of the acrosome protein represented by acrosin transported from the Golgi apparatus to the acrosome which is a membrane structure peculiar to a sperm cell was compared between the Wt mouse sperm and the Ht mouse sperm.
The results are shown in FIGS.
FIG. 9-1 shows the localization of ubiquitin. FIGS. 9-1a and b show the localization of ubiquitin in epididymal sperm detected using an anti-ubiquitin antibody, FIG. 9-1a shows the result of Wt mouse sperm, and FIG. 9-1b shows the result of Ht mouse sperm. Indicates. FIG. 9-2 shows the expression of acrosome protein in mouse epididymal sperm detected by western blotting of epididymal sperm lysates using antibodies against α-tubulin, ubiquitin, acrosin, NSF and tACE. . As expected, the ubiquitin signal was deleted in the sperm acrosome of Ht mice.
FIG. 10 shows the localization of acrosin measured using an anti-acrosin antibody in Wt mouse sperm and Ht mouse sperm. 10a and b show the results for Wt mouse sperm, and FIGS. 10c and d show the results for Ht mouse sperm. Acrosin expression was less in Ht mouse sperm. FIG. 11 shows the localization of NSF measured using anti-NSF antibodies in Wt mouse sperm and Ht mouse sperm. FIGS. 11 a and b show the results for Wt mouse sperm, and FIGS. 11 c and d show the results for Ht mouse sperm. NSF was detected in the head of the Wt mouse sperm, but less in the head of the Ht mouse sperm. FIG. 12 shows the localization of tACE measured using anti-tACE antibody in Wt mouse sperm and Ht mouse sperm. 12a and b show the results for Wt mouse sperm, and FIGS. 12c and d show the results for Ht mouse sperm. In Wt mouse spermatozoa, localization was observed in the outer membrane of acrosome, and there was little in the central part of the tail. Many Ht mouse spermatozoa were localized in the cell membranes of the head and tail.
FIG. 13 shows the results of double staining of Wt mouse sperm and epididymal sperm ubiquitin and GALNTL5 protein and double staining of ubiquitin and UBC3B (ubiquitin- conjugating enzyme E2). FIG. 13a is the result of double staining of Wt mouse sperm ubiquitin and UBC3B, and UBC3B was localized only in the sperm neck. Ubiquitin was localized not only in the acrosome but also in the head-tail binding site region. FIG. 13b shows the result of double staining of ubiquitin and UBC3B in Ht mouse sperm, and abnormal localization of UBC3B was observed in the tail. Ubiquitin was not localized in the head-tail binding site region or in the acrosome. FIG. 13c is the result of double staining of Wt mouse sperm ubiquitin and GALNTL5 protein, where ubiquitin is expressed in both the acrosome and head-tail binding site region, and the strong co-localization of ubiquitin and GALNTL5 protein is It was strongly observed only with the head-tail coupling device. FIG. 13d shows the result of double staining of UtB3B and GALNTL5 proteins in Wt mouse sperm, and UBC3B was localized only in the sperm neck. This result indicates that GALNTL5 protein is localized with ubiquitin and UBC3B in the sperm head-tail binding site region, and GALNTL5 protein is a ubiquitin-proteasome protein in the head-tail binding site region. To be involved in the accumulation of
FIG. 14 shows the co-localization of GALNTL5 protein and Rab27a or Myosin Va in Wt mouse sperm. FIG. 14a shows the localization of GALNTL5 protein and Rab27a in Wt mouse sperm. Nuclei were stained with DAPI. As shown in the figure, GALNTL5 protein and Rab27a co-localized in the head-tail binding site region and the middle-piece cytoplasm. FIG. 14b shows the localization of GALNTL5 protein and Myosin Va in Wt mouse sperm. As shown in the figure, GALNTL5 protein and Myosin Va were colocalized in the head-tail binding site region. FIG. 14c shows the localization of GALNTL5 protein and Rab27a in testicular sperm of Wt mice. As shown in the figure, GALNTL5 protein and Rab27a were colocalized in the cytoplasm of elongated sperm cells. The actin-based vesicle-motor protein complex includes Myosin Va and Rab27a / b. As shown in FIG. 14, Rab27a and Myosin Va and GALNTL5 protein co-localized mainly in the sperm head-tail binding site region. In the testis, Rab27a and GALNTL5 protein co-localized in the cytoplasm of the elongated sperm cells.
As described above, it was revealed that the localization amount of acrosome (acrosome) protein was significantly decreased in Ht mouse sperm (FIGS. 9-1 to 12). Furthermore, a sperm cell-specific intracellular structure Chromatoid body (CB) whose function has not yet been clarified is transported to the mature sperm neck by the membrane transport mechanism, and the ubiquitin-proteasome protein packed in the CB is transformed into the mature sperm neck. It has been clarified in the study of rat spermatozoa. It was confirmed that ubiquitin-proteasome protein was also accumulated in the sperm neck in mouse sperm, but in Ht mouse sperm, it was observed that the signal of ubiquitin-proteasome protein disappeared or was located ectopically. (FIGS. 13a-b).
It has been reported that the actin-based vesicle-motor protein complex containing Myosin Va and Rab27a / b contributes to protein transport from the Golgi body to the acrosome and transport of CB to the sperm neck. It was observed that the endogenous GALNTL5 protein co-localizes with the actin-based vesicle-motor protein complex containing Myosin Va and Rab27a / b in the spermatogenesis process in the testis, and further in the mature sperm neck (FIG. 14). The GALNTL5 protein does not function as a glycosyltransferase, but as a part of the vesicle-motor protein complex, it has a novel function of controlling the intracellular distribution of proteins essential for mature spermatogenesis It was strongly suggested.

Examination of human male infertility Galntl5 gene Ht-deficient mouse sperm cells, using proteins of five sperm proteins, including GALNTL5 protein in which abnormalities were detected in the localization, proteins in human sperm formation diagnosed as human spermatogenesis disorder A change in the amount was detected. Detection was performed by Western blotting using antibodies against GALNTL5, tACE, NSF and HXK. The amount of α-tubulin was used as a control.
The results are shown in FIG. FIG. 15-1 shows the results of detection of sperm constituent proteins collected from 10 individuals including patients diagnosed with asthenozoospermia. Table 2 shows the results of clinical analysis of semen.
As shown in Table 2, among patients spermatozoa diagnosed with asthenozoospermia, patients who closely resembled the decrease pattern in the sperm of GALNTL5 gene Ht-deficient mice could be found. FIG. 15-1 shows sperm constituent proteins of 10 individuals (lanes 1-4: normal sperm of control, lanes 5-10: sperm of infertile patients), and a decrease in GALNTL5 protein and related proteins is observed in the patient of lane 5 It was done. Further, genomic DNA analysis was performed on patient sperm (patient in lane 5 in FIG. 15-1) in which GALNTL5 protein was reduced by the method described in “12. PCR and DNA sequence analysis of human individual tissue”. . That is, in order to evaluate the effect of mutations in the human GALNTL5 gene on abnormal sperm, flanking primers for nine exons were designed, DNA fragments were amplified from abnormal sperm, and PCR products were directly sequenced. The results are shown in Fig. 15-2. FIG. 15-2 shows a DNA sequence chromatogram of the site between the third intron and the fourth exon. A restriction enzyme site PstI exists between the third intron and the fourth exon of the normal GALNTL5 gene, and 49 clones out of 56 clones obtained by PCR from the sperm of the patient in lane 5 had PstI. In 7 of the clones, a point mutation was observed at the splicing acceptor site. FIG. 15-3 shows the position of the mutation in the GALNTL5 gene having 9 exons. The asterisks in FIGS. 15-2 and 15-3 indicate the positions of mutations. As shown in FIGS. 15-2 and 15-3, mutations were identified in the splicing acceptor sites of the third intron and the fourth exon of the GALNTL5 gene. The mutation causes the fourth exon to be skipped, and a new stop codon appears in the fifth exon due to the frame shift. Interestingly, the identified DNA mutation was not present in somatic blood cells but only in sperm cells. FIG. 15-4a shows the result of blotting DNA of a 790 bp region amplified from around the fourth exon of genomic DNA of six sperm including patients diagnosed with asthenozoospermia. The left figure shows the results without digestion with restriction enzymes, and the right figure shows the results with digestion with PstI restriction enzymes. As shown in FIG. 15-4a, a mutation in the PstI restriction site was observed only in the above-mentioned patient in lane 5. FIG. 15-4b shows the blood cell results of the six patients used in FIG. 15-4a. In the blood cells, no mutation was observed in the above-mentioned lane 5 patient. This result suggests that the mutation occurred in sperm stem cells. This result shows that the mutation in the human GALNTL5 gene is the cause of asthenozoospermia due to the decreased expression level of GALNTL5 protein.

Inspection of human male infertility (2)
Constituent proteins were detected in the same manner as in Example 3 for sperm collected from 5 patients diagnosed with asthenozoospermia.
The results are shown in FIG. As shown in FIG. 16-1, a decrease in GALNTL5 protein and related proteins was observed in the lane 5 patient.
Using the sperm and blood cells of a patient in which a decrease in GALNTL5 protein was observed (patient in lane 5 in FIG. 1), each exon was amplified by PCR in the GALNTL5 gene in the same manner as in Example 3. It was determined. The results are shown in Fig. 16-2. FIG. 16-2 shows a DNA sequence chromatogram of the 6th exon site. As shown in FIG. 16-2, in the sixth exon, it was possible to observe a single base deletion in the genome in both sperm and blood cells.
FIG. 16-3 shows the position of the mutation in the GALNTL5 gene having 9 exons. The asterisk in FIG. 16-3 indicates the position of the mutation. As shown in FIG. 16-3, a new stop codon appears in the sixth exon due to the mutation of the sixth exon of the GALNTL5 gene.
From these results, it was shown that patients carrying the human GALNTL5 gene mutation heterozygously develop asthenozoospermia.

Extracting proteins from the sperm of patients diagnosed with infertility due to spermatogenesis disorder and quantifying the amount of various proteins essential for mature spermatogenesis by Western blotting with specific antibodies is the cause of spermatogenesis disorders. It is a very effective means for identification, and sperm asthenia can be detected by quantifying the expression of GALNTL5 gene, which is directly involved in sperm motility. This method is an epoch-making that has not been established so far to accurately identify the causative factors of male infertility due to spermatogenesis disorder, and is useful as an effective biomarker in the development of drugs for male infertility. Is very expensive. Furthermore, the motility of sperm in a non-human animal deficient in the Galntl5 gene is lost or reduced, and the non-human animal can be used as a model animal for human asthenozoospermia. Can be searched for therapeutic agents for symptom.
The method for detecting male infertility according to the present invention accurately identifies the causative factor of male infertility due to spermatogenesis disorder, and is a breakthrough that has not been established so far. The utility value as an effective biomarker is very high.
All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.
[Sequence Listing]

Claims (10)

Sperm asthenia, which detects sperm asthenia by using abnormal expression of Galntl5 gene as an index, in which normal GALNTL5 protein is no longer expressed in sperm of male subjects or the expression level is less than that in normal male sperm Detection method.   Quantitative analysis of GALNTL5 protein in sperm of male subjects and detection of asthenozoospermia using the expression level of GALNTL5 protein as an index, compared with GALNTL5 protein that is absent in normal male sperm The method for detecting asthenozoospermia according to claim 1, wherein it is determined that there is asthenozoospermia.   The method for detecting asthenozoospermia according to claim 2, wherein GALNTL5 protein is measured using an anti-GALNTL5 antibody. The method for detecting asthenozoospermia according to claim 1 or 2, comprising detecting the presence or absence of a mutation that causes a decrease in the expression of the Galntl5 gene in sperm as compared with that in normal male sperm . 5. The method of detecting asthenozoospermia according to claim 4 , wherein the mutation causing a decrease in sperm GALNTL5 protein expression when compared to expression in normal male sperm is heterozygous. A sperm asthenia detection kit comprising an anti-GALNTL5 protein antibody used in the method for detecting asthenozoospermia according to any one of claims 1 to 5 . Fragment peptide of human or mouse GALNTL5 protein, human GALNTL5 protein consisting of amino acid sequence QQIIYGSEQIPKPHVIVKR (SEQ ID NO: 8) of amino acid sequence 54 to 72 of human GALNTL5 protein consisting of the amino acid sequence of SEQ ID NO: 2, and amino acid sequence of SEQ ID NO: 2 From amino acid sequence SKKQTGKPSTIISAMT (SEQ ID NO: 10) of SEQ ID NO: 4 from amino acid sequence 362 to 377 of human GALNTL5 protein consisting of amino acid sequence FKWDNVFSYEMDGPEG (SEQ ID NO: 9), amino acid sequence of SEQ ID NO: 2 42nd to 58th amino acid sequence LLKKRSLGKNAHQQTRH (SEQ ID NO: 5) of mouse GALNTL5 protein, and 263 to 278th amino acid sequence LRWDNVFAYELDGPEG (SEQ ID NO: 6) of mouse GALNTL5 protein consisting of the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 4 342 to 358 of mouse GALNTL5 protein consisting of the amino acid sequence of Including anti GALNTL5 protein antibody against a fragment peptide consisting of the amino acid sequence SKALSQHRRANQSALS (SEQ ID NO: 7), according to claim 6 asthenozoospermic detection kit according.   A sperm asthenia non-human model animal in which all or part of the Galntl5 gene in sperm is deleted and GALNTL5 protein expression is lost or decreased. The non-human model animal of asthenozoospermia according to claim 8 , wherein the deficiency of the Galntl5 gene is a hetero deficiency. The asthenozoospermia non-human model animal according to claim 8 or 9 , which is a mouse.