CN105316394A - Kit for detecting one pathogenic mutation site in male infertility Galntl5 gene, and PCR amplification method thereof - Google Patents

Kit for detecting one pathogenic mutation site in male infertility Galntl5 gene, and PCR amplification method thereof Download PDF

Info

Publication number
CN105316394A
CN105316394A CN201410360111.3A CN201410360111A CN105316394A CN 105316394 A CN105316394 A CN 105316394A CN 201410360111 A CN201410360111 A CN 201410360111A CN 105316394 A CN105316394 A CN 105316394A
Authority
CN
China
Prior art keywords
primer
gene
galntl5
male infertility
pcr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201410360111.3A
Other languages
Chinese (zh)
Inventor
朱威
贺雄雷
郭蕾
雷楗勇
潘武广
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Geneheal Biotechnology Co ltd
Original Assignee
Geneheal Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Geneheal Biotechnology Co ltd filed Critical Geneheal Biotechnology Co ltd
Priority to CN201410360111.3A priority Critical patent/CN105316394A/en
Publication of CN105316394A publication Critical patent/CN105316394A/en
Pending legal-status Critical Current

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention discloses a kit for detecting one pathogenic mutation site in male infertility Galntl5 gene, and a PCR amplification method thereof. The method is characterized in that mutation detection primers resisting 3'-5'exonuclease digestion modification are introduced into a high fidelity DNA involved PCR reaction so as to improve the PCR specificity, and the product band of the gel electrophoresis can be directly observed so as to determine the genotype of the corresponding mutation site of the Galntl5 gene. According to the present invention, the detection kit has characteristics of low instrument requirements, simple operation, economy, no requirement of sequencing, and capability of being operated in general molecular biology laboratories.

Description

Detect test kit and the PCR amplification method thereof in male infertility Galntl5 gene 1 pathogenic mutation site
Technical field
The invention belongs to the clinical detection technique in biomedical sector, relate to the detection method to Human male infertility disease gene pathogenic mutation site.
The invention provides a kind of PCR kit detecting the sudden change of Human male infertility disease Disease-causing gene.Content of the present invention relates to a kind of test kit and the PCR amplification method thereof that detect 1 pathogenic mutation site in male infertility Fkbp6 gene, and this detected result can be used to clinical auxiliary detection male infertility.
Background technology
Male infertility, refers to that man is when regularity is lived and do not practised contraception, and does not make healthy spouse gestation in 1 year.Male infertility (MaleInfertility) has a strong impact on modern men's health and happy family life, shows: the couple at child-bearing age about 15% can not give birth to, and wherein male factor accounts for 50% according to WTO statistics.Cause the reason of male sterility extensively complicated, relate to all many-sided exceptions and the obstacle such as reproductive system anatomical structure and function, hormone regulation, genetic material, infection immunity.Wherein quite a few to belong to agnogenic idiopathic sterile, comprise idiopathic without sperm, weak sperm, few sperm, teratozoospermia.
At present, molecular biology method has been deep in the middle of male infertility research.Cause the genetic damage of male sterility to be diversified, except chromosome aneuploid deformity and gene rearrangement, also comprise micro-deleted and individual gene defect.Mouse and drosophila gene knock out the genetic regulation that experiment finds to relate to more than 3000 genes male fertility ability, and genes involved not only relates to androgone system, also comprises and grows relevant functional gene regulated and control network to sexual gland and body.Now been found the large quantities of Chromosome aberrations and the pleiotropy single gene inheritance disease that relate to male sterility.
1.AZF gene
1976, Tiepolo and Zuffardi has found long-armed micro-deleted of 6 routine azoospermia patients Y chromosomes by karyotyping and has proposed without sperm factor (AZF) concept, research is subsequently located in Yq11.23, AZFa disappearance shows as only sustenticular cell syndrome, AZFb disappearance shows as production of sperm retardance, and the pathological manifestations of AZFc disappearance be from normal to without sperm.AZF is not single gene, but the gene family that is functionally mutually related, play a significant role in spermatogenesis, growth and maturation, various research shows that serious spermatogenesis obstacle comprises that about to have 3%-15% to have Y chromosome in azoospermia patients micro-deleted.
2.X originates testes specificity against gene
In spermatogenetic meiophase, sex chromosome is isolated into XY corpusculum, be in transcriptional inactivation state, on X chromosome, active house-keeping gene of expressing also stops transcribing, and at this moment, on euchromosome, some X chromosomes source testes specificity is expressed against gene transcriptional start, compensating action is played to the loss of expression of its older generation's gene, this is called compensation hypothesis, and this hypothesis thinks that inverse gene plays a significant role in spermatogenesis, and their sudden change may cause the generation of male infertility.An oligospermatism man occurs in the reciprocal translocation of 10q22, and CSTE2T gene is located in 10q22 ~ q23, and research infers that the generation of oligospermatism is relevant with it.
3. sexual hormoue genes involved
Relatively common are androgen receptor gene (AR), follicle-stimulating hormone receptor gene (FSHR), luteinizing hormone receptor gene (LHR), gonad-stimulating hormone gene, gonadotropin releasing hormone receptor gene (GnRHR).Wherein, the homozygote point mutation of people's fsh receptor gene the 7th exon shows as production of sperm infringement in various degree.The afunction that LHR transgenation causes can cause interstitial glands dysplasia, and the lighter shows as hypogonadism, and severe one shows as androgynism.The male sex of FSH-b sudden change presents the performance of azoospermia.
4. plastosome genes involved
The integrity of Mitochondrial DNA and sperm motility and semen quality are generally correlated with.KaoS found in nineteen ninety-five, and the spermatid that motility is minimum has the highest 4977bpmtDNA miss rate, thought that mtDNA sudden change plays a significant role in sperm pathology.
5. mankind's production of sperm stage flag gene
The generation of sperm needs several stages such as experience mitotic division, reduction division and spermiogenesis tail, and the production of sperm retardance of different steps can appear in patients with infertility.Research finds, at the key gene of some regulation and control production of sperm of expression of some phasic specificities, utilizes testis biopsy tissue to carry out the detection of specific gene express spectra, just can understand the stage of spermatogenic arrest.
Along with the progress of Protocols in Molecular Biology and the day by day clear and definite of male infertility Disease-causing gene location, carry out Molecular Detection by technology such as polymerase chain reaction (PCR) and gene sequencing to propagate its belief on a large scale gradually, wherein, " molecular switch " detect sudden change because it is simple to operate, need not check order, the advantage such as with low cost, become a technology of widespread use.
High-fidelity DNA polymerase, when carrying out DNA cloning, when primer and template are matched completely, then directly carries out polyreaction in the polymerization site of polysaccharase; When primer and template incomplete pairing, then deliver to enzymolysis center and correct, the primer after correction is sent back to polymerization site again and carries out polyreaction; If primer can not be corrected immediately, then PCR reaction cannot normally be carried out, thus the non-maturity of initiated polymerization stops.So create " pairing primer can extend, and unpaired primer does not extend " dualization effect.When carrying out point mutation analysis, this dualization effect just can be utilized to carry out either-or dualization identification to specific site.And the identification of polysaccharase to base mismatch is not limited to 3 ' end or the nascent DNA molecule of primer, the mispairing of 1,3 ' end upstream to several base distance also can be identified.According to this feature, there is a process repeatedly identified in base mispairing when can think that exo+ polymerase synthesizes DNA.Thus, the base specific primer that the sulfuration phosphoric acid that resistance to excision enzyme can be digested is modified combines has 3 '-5 ' high-fidelity DNA polymerase of 5 prime excision enzyme activity carries out PCR reaction, and constitute the complex mutation susceptibility " molecular switch " regulated and controled by single base difference.
This mutant sensitivity " molecular switch " is successfully applied to neural heariing loss gJB3gene and pku pAHthe detection of gene mutation site; The detection of the SNP site on sex chromosome and plastosome is also obtained successfully, illustrates that " molecular switch " mutation detection techniques is a kind of easy economical and practical mutation detection methods.This patent uses mutant sensitivity " molecular switch " mutation detection techniques, establishes the detection method in 1 pathogenic mutation site of male infertility Fkbp6 gene.
Summary of the invention
The object of the present invention is to provide and a kind ofly detect the PCR kit of Human male infertility disease Disease-causing gene sudden change and corresponding PCR amplification method.Object sets up the detection method causing 1 pathogenic mutation site in the Fkbp6 gene of Human male infertility disease, and this detected result is used for interpretation patient and whether carries Fkbp6 pathogenic mutation.
Technical essential of the present invention is design primer, and the inaction clinical diagnosis that has according to object fragment provides foundation.For achieving the above object, the technical solution used in the present invention is as follows:
Following primer is designed according to 1 pathogenic mutation site T141G in the Fkbp6 gene of male infertility:
Normal template pairing primer T141GNF:5 '-TCCGAGAAGGAGCTG-3 '; Mutagenesis template pairing primer T141GMF:5 '-TCCGAGAAGGAGCGG-3 '; Common downstream primer T141GR:5 '-AGGCTGAGGCAGGAG-3 '.Wherein, the phosphodiester bond between 3 '-3 and-2 bit bases held of described normal template pairing primer T141GNF and mutagenesis template pairing primer T141GMF adopts phosphorothioate to modify, or is modified through lock nucleination (LNA) by-2 bit bases.Its amplified production length 284bp, its sequence is shown in the sequence 4 in sequence table.
The invention provides the test kit detecting 1 pathogenic mutation site T141G in a kind of male infertility Fkbp6 gene, comprising: 2 × PCR reacts mix.Containing PCR reaction buffer, dNTP, primer, thermotolerance high-fidelity in mix pfuarchaeal dna polymerase, tetrabromophenol sulfonphthalein sample-loading buffer.
For achieving the above object, the technical solution used in the present invention is: a kind of a set of operating process adopting the test kit described in claim 1 and 4 to detect male infertility Fkbp6 gene 1 pathogenic mutation site, comprising:
1, pcr amplification adopts one group of primer of claims 1.
2, pcr amplification is made up of denaturation and 30-40 amplification temperature cycle.PCR reaction conditions is: 95 DEG C of denaturation 10min, 94 DEG C of sex change 30sec, and 55 DEG C of annealing 30sec, 72 DEG C extend 30sec, circulation 30-40 time.After after loop ends, 72 DEG C of polishings extend 10min, reaction terminates.Agarose electrophoretic analysis qualification PCR primer.The electroresis appraisal together with negative control by sample and the positive, after completing, observes gel after ethidium bromide staining, more each swimming lane electrophoretic band situation under ultraviolet lamp, to judge that sample is as being subject to sample product whether with pathogenic mutation.
In technique scheme, described primer is integral part important in round pcr, and it is a bit of single stranded DNA, as the starting point of DNA replication dna.
In such scheme, when using PCR amplification method, by above listed in one group of primer in different mutational site, mutagenesis template pairing primer and downstream primer are a pair, normal template pairing primer and downstream primer are other a pair, the DNA profiling of these two pairs of primers detection site genotype position corresponding to this group respectively, PCR reacts mix and forms two independent reaction systems; Respectively pcr amplification is carried out to 2 independent reaction systems.
Due to the utilization of technique scheme, the present invention compared with prior art has following advantages and effect:
1, the present invention adopts particular design and modified primer, and its PCR primer specificity is very high.Utilize this gene tester, after completing PCR reaction and gel electrophoresis, directly can observe the presence or absence of product band to judge male infertility fkbp6the genotype in gene 1 pathogenic mutation site.
2, the present invention is simple to operate, economical, and without the need to order-checking, general Molecular Biology Lab can operate.
Accompanying drawing explanation
Accompanying drawing 1: the present invention adopts PCR amplification method to detect fkbp6the gel electrophoresis figure (first group of primer, three samples) that gene T141G site obtains.
1st swimming lane, 100bpDNALadderMarker, stripe size (bp) is respectively 1500 from top to bottom, 1000,900,800,700,600,500,400,300,200, under 100(with); 2nd swimming lane, sample 1, the PCR primer electrophorogram that primer T141GNF and T141GR matches; 3rd swimming lane, sample 1, the PCR primer electrophorogram that primer T141GMF and T141GR matches; 4th swimming lane, sample 2, primer T141GNF and T141GR matches; 5th swimming lane, sample 2, the PCR primer electrophorogram that primer T141GMF and T141GR matches; 6th swimming lane, sample 3, the PCR primer electrophorogram that primer T141GNF and T141GR matches; 7th swimming lane, the PCR primer electrophorogram that sample 3 primer T141GMF and T141GR matches.
Embodiment
Below in conjunction with embodiment, the invention will be further described, but the present invention is not by the restriction of embodiment.
Molecular biology manipulations method in all embodiments is familiar with by these those skilled in the art, can with reference to (the laboratory manual such as Sambrook " molecular cloning ", cold spring port, 1989) and " fine works molecular biology experiment guide " (U.S./F. Ao Sibai etc. work, Yan Ziying etc. translate, Beijing, Science Press, 1998).
embodiment one
With Human male infertility disease fkbp6gene pathogenic sites T141G place fkbp6the exon 2 DNA sequence dna of gene is template, utilizes software primerpremier5.0 to design primer.
Detect the base sequence of the primer in T141G mutational site:
Normal template pairing primer T141GNF:5 '-TCCGAGAAGGAGCTG-3 '; Mutagenesis template pairing primer T141GMF:5 '-TCCGAGAAGGAGCGG-3 '; Common downstream primer T141GR:5 '-AGGCTGAGGCAGGAG-3 '.Wherein, the phosphodiester bond between 3 '-3 and-2 bit bases held of described normal template pairing primer T141GNF and mutagenesis template pairing primer T141GMF adopts phosphorothioate to modify, or is modified through lock nucleination (LNA) by-2 bit bases.
embodiment two
Get patient affected by inspection's blood sample, after extracting DNA, ability primer kit uses flow operations.PCR primer gel electrophoresis system is identified, the presence or absence according to electrophoretic band judges fkbp6the genotype in gene T141G mutational site.Concrete determination methods is as follows:
1, the pair of primers formed when mutagenesis template pairing primer and downstream primer carries out pcr amplification to the DNA profiling of the unknown, if observe object electrophoretic band, shows that this unknown DNA profiling contains mutated genes in corresponding detection site.
2, the pair of primers formed when normal template pairing primer and downstream primer carries out pcr amplification to the DNA profiling of the unknown, if observe object electrophoretic band, shows that this unknown DNA profiling contains normal type gene in corresponding detection site.
3, all unknown DNA profiling increased when above-mentioned two pairs of primers and by electrophoresis observation to object band, then show that this detection site is heterozygous.
Pcr amplification result as shown in Figure 1.Judge according to PCR primer electrophoretic band situation, sample 1 fkbp6in gene, T141G site is for normally to isozygoty; The genotype of sample 2 is mutant homozygous; The genotype of sample 3 is heterozygosis.Send order-checking by this fragment, it is correct that sequencing result has confirmed PCR detected result.Judge thus, the probability that the carrier of sample 1 suffers from inherited disease male infertility is very low; The probability that the carrier of sample 2 suffers from heredity male infertility is high.
Sequence table
Jun He bio tech ltd, <110> Guangzhou
<120> detects test kit and the PCR amplification method thereof in male infertility Galntl5 gene 1 pathogenic mutation site
<130>2014
<160>4
<170>PatentInversion3.5
<210>1
<211>15
<212>DNA
<213> artificial sequence
<400>1
gtgattatcagtaga15
<210>2
<211>15
<212>DNA
<213> artificial sequence
<400>2
gtgattatcagtaaa15
<210>3
<211>15
<212>DNA
<213> artificial sequence
<400>3
aacacattttgtgcc15
<210>4
<211>290
<212>DNA
<213>Homosapiens
<400>4
gtgattatcagtagaagcttgggcatcgaaagagaagtgccagataccaggagtaaaatg60
tatgttgtctctctctttctctcattctctagatagatagatagatagatagatagatag120
atagatagatagaaagaaaacagttactaaccagattttaatttgatcatactagaaatg180
ttatagattcctatttttaggacttgaagtcagataatgtcaagattctatttcaagatt240
ctaatgcttatagtgtagagaatgtcttcttcgtgggcacaaaatgtgtt290

Claims (5)

1. detect a PCR kit for Human male infertility disease Disease-causing gene sudden change, it is characterized in that: described test kit comprises in the group-specific primers detecting 1 pathogenic mutation site G323A in male infertility Galntl5 gene and PCR reacts mix.
2. according to claim 1, with the exon 2 DNA sequence dna of the Galntl5 gene at male infertility Galntl5 gene pathogenic sites G323A place for template design primer, it is characterized in that: in the primer pair designed by pathogenic sites G323A, 3 ' end of normal template pairing primer middle and upper reaches primer is containing sequence A GTAGA, and 3 ' end of mutagenesis template pairing primer middle and upper reaches primer is containing sequence A GTAAA; Phosphodiester bond wherein between 3 '-3 and-2 bit bases held adopts phosphorothioate to modify, or is modified through lock nucleination (LNA) by-2 bit bases.
3., according to claim 2, the sequence of a preferred group-specific primers is as follows respectively:
Normal template pairing primer G323ANF:5 '-GTGATTATCAGTAGA-3 '; Mutagenesis template pairing primer G323AMF:5 '-GTGATTATCAGTAAA-3 '; Common downstream primer G323AR:5 '-AACACATTTTGTGCC-3 '; Wherein, the phosphodiester bond between 3 '-3 and-2 bit bases held of described normal template pairing primer G323ANF and mutagenesis template pairing primer G323AMF adopts phosphorothioate to modify, or is modified through lock nucleination (LNA) by-2 bit bases.
4., according to claim 3, the phosphodiester bond between 3 '-3 and-2 bit bases held of described normal template pairing primer and mutagenesis template pairing primer adopts phosphorothioate to modify, or is modified through lock nucleination (LNA) by-2 bit bases.
5. the PCR amplification method adopting claim 1 and 2 to detect 1 pathogenic mutation site G323A in Human male infertility disease Galntl5 gene, it is characterized in that: pcr amplification is made up of denaturation and 30-40 amplification temperature cycle, cycling condition is 95 DEG C of denaturation 10min, 94 DEG C of sex change 30sec, 55 DEG C of annealing 30sec, 72 DEG C extend 30sec, circulation 30-40 time, and after after loop ends, 72 DEG C of polishings extend 10min, reaction terminates.
CN201410360111.3A 2014-07-28 2014-07-28 Kit for detecting one pathogenic mutation site in male infertility Galntl5 gene, and PCR amplification method thereof Pending CN105316394A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410360111.3A CN105316394A (en) 2014-07-28 2014-07-28 Kit for detecting one pathogenic mutation site in male infertility Galntl5 gene, and PCR amplification method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410360111.3A CN105316394A (en) 2014-07-28 2014-07-28 Kit for detecting one pathogenic mutation site in male infertility Galntl5 gene, and PCR amplification method thereof

Publications (1)

Publication Number Publication Date
CN105316394A true CN105316394A (en) 2016-02-10

Family

ID=55244712

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410360111.3A Pending CN105316394A (en) 2014-07-28 2014-07-28 Kit for detecting one pathogenic mutation site in male infertility Galntl5 gene, and PCR amplification method thereof

Country Status (1)

Country Link
CN (1) CN105316394A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107619862A (en) * 2017-11-13 2018-01-23 黄志玲 Anemia male spermatogenesis dysfunction Disease-causing gene NFATC1 and its detection method

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013122265A1 (en) * 2012-02-17 2013-08-22 独立行政法人産業技術総合研究所 Method for detecting causitive factor in male infertility, and male infertility model animal
CN103911424A (en) * 2012-12-28 2014-07-09 广州君赫生物科技有限公司 Kit and PCR amplification method for detection of one pathogenic mutation site of male infertility Dmc1 gene

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013122265A1 (en) * 2012-02-17 2013-08-22 独立行政法人産業技術総合研究所 Method for detecting causitive factor in male infertility, and male infertility model animal
CN103911424A (en) * 2012-12-28 2014-07-09 广州君赫生物科技有限公司 Kit and PCR amplification method for detection of one pathogenic mutation site of male infertility Dmc1 gene

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NOBUYOSHI TAKASAKI等: "A heterozygous mutation of GALNTL5 affects male infertility with impairment of sperm motility", 《PNAS》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107619862A (en) * 2017-11-13 2018-01-23 黄志玲 Anemia male spermatogenesis dysfunction Disease-causing gene NFATC1 and its detection method
CN107619862B (en) * 2017-11-13 2020-10-13 黄志玲 Sperm production disorder pathogenic gene NFATC1 for mild anemia men and detection method thereof

Similar Documents

Publication Publication Date Title
Guo et al. Sperm-carried RNAs play critical roles in mouse embryonic development
CN103911452B (en) Chinese population deaf gene screening kit and application thereof
CN105087756A (en) Method and kit for non-invasive measurement on fetus deaf pathogenic gene mutation
Tang et al. Polymorphisms of the bovine growth differentiation factor 9 gene associated with superovulation performance in Chinese Holstein cows
Jung et al. Genetic variants in microRNA machinery genes are associate with idiopathic recurrent pregnancy loss risk
CN103911424A (en) Kit and PCR amplification method for detection of one pathogenic mutation site of male infertility Dmc1 gene
Smith et al. Large-scale transcriptome-wide profiling of microRNAs in human placenta and maternal plasma at early to mid gestation
CN101979659A (en) Method for quickly detecting prolificacy FecB gene in sheep
Li et al. Investigation of AZF microdeletions in patients with Klinefelter syndrome
Modarres et al. Assessment of DPY19L2 deletion in familial and non-familial individuals with globozoospermia and DPY19L2 genotyping
CN105441540A (en) Non-syndromic deafness gene polymorphism detecting kit and application thereof
CN103773859A (en) SNP marker of mitochondria DNA related to asthenospermia with unknown clinical causes and application thereof
CN105200040A (en) Reagent kit for simultaneously detecting multiple deafness genes on single cell level
CN105316394A (en) Kit for detecting one pathogenic mutation site in male infertility Galntl5 gene, and PCR amplification method thereof
CN105316395A (en) Kit for detecting male infertility Fkbp6 gene mutation site, and PCR amplification method thereof
CN105316396A (en) Kit for detecting one pathogenic mutation site in male infertility Kif18a gene, and PCR amplification method thereof
Wu et al. Restriction fragment length polymorphism in the exon 2 of the BoLA-DRB3 gene in Chinese Holstein of the south China
CN105296603A (en) Reagent kit for detecting mutation site of male infertility Katnal1 genes and PCR (polymerase chain reaction) amplification method implemented by reagent kit
CN105154545A (en) Primers and method for detecting MPL gene mutation
CN111621552B (en) Method and system for detecting mtDNA mutation
Sharifi et al. Molecular mechanisms of resistance to bovine mastitis
EP3129033B1 (en) Carrier status of annexin a5 m2 haplotype and obstetric risks
Mei et al. Identification of lncRNAs differentially expressed during natural and induced estrus in sheep
CN107029238B (en) Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis
Ghirelli-Filho et al. Incidence of Y-chromosome microdeletions in children whose fathers underwent vasectomy reversal or in vitro fertilization with epididymal sperm aspiration: a case-control study

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20160210