JP5906019B2 - Application of immunostimulation G9.1 to creation of anti-tuberculosis booster vaccine - Google Patents

Description

  The present invention relates to a novel anti-tuberculosis booster vaccine.

  About one-third of the world's population is infected with tuberculosis, and about 8 million new tuberculosis patients occur each year, and about 2 million people die. In this way, tuberculosis is still a serious bacterial infection, and a worldwide response is required.

  In Japan, the onset of tuberculosis among generations from the mid-teens to the elderly, whose immunity to BCG inoculated during infancy declines, has become a problem. BCG, the only tuberculosis vaccine in the world, works well in children with tuberculous meningitis and miliary tuberculosis, but has limited effects on pulmonary tuberculosis in adults. Moreover, the effectiveness of BCG revaccination against adult tuberculosis is not clear.

  Therefore, in order to enhance the immune effect by BCG, DNA binding protein (MDP-1) of Mycobacterium tuberculosis (Patent No. 4415200; J. Immunol. 175, 441-449, 2005; Tuberculosis Vol. 82, No. 10 2007) Year pp. 786-789) is proposed. However, the development of more effective methods for stimulating tuberculosis immunity in adulthood has become a challenge.

Patent No. 3976742 Patent No. 4415200 U.S. Patent No. 7718623

J. Immunol. 175, 441-449, 2005 Tuberculosis Volume 82 Number 10 2007 Pages 786-789

  In Japan, it is stipulated that the first BCG vaccination should be performed within the first 6 months of life. Therefore, on the premise of this, the present invention enhances the effect of the first immunization and enhances the reduced tuberculosis immunity after adulthood. An anti-tuberculosis booster vaccine is provided.

  As a result of various studies to solve the above problems, the present inventors have found that oligonucleotide G9.1 (GGGGGGGGGGACGATCGTCG) known to have an immunostimulatory effect (Patent No. 3976742, U.S. Pat. No. 7718623) And the combined use with M. tuberculosis DNA binding protein (MDP1), a remarkable anti-tuberculosis immunostimulatory effect was found, and the present invention was completed.

  Accordingly, the present invention provides an anti-tuberculosis booster vaccine characterized by a combination of an oligonucleotide (sometimes referred to as G9.1) consisting of the following base sequence: GGGGGGGGGGACGATCGTCG and Mycobacterium tuberculosis DNA binding protein (MDP1) . The Mycobacterium tuberculosis DNA binding protein (MDP1) is preferably recombinantly produced. This anti-tuberculosis booster vaccine is preferably administered by nasal administration, intradermal / subcutaneous administration, intramuscular administration and the like.

As is apparent from the description of Examples below, G9.1 enhances Th1-type immune response in nasal administration of M. tuberculosis protein MDP1 to mice. It was higher than B subunit (rCTB) adjuvant.
Moreover, it was shown that G9.1 enhances the DTH response to M. tuberculosis protein MDP1 in guinea pigs that had been inoculated intradermally with BCG in advance for 8 weeks.
From these results, it was shown that G9.1 can be applied to the creation of an anti-tuberculosis booster vaccine by combining with M. tuberculosis protein MDP1.

FIG. 1 shows the effect of the combined use of MDP1 and G9.1 on the production of MDP1-specific antibody IgG2c in C57BL / 6 mice, and the combined use of MDP1 and recombinant cholera toxin B subunit (rCTB). It is a graph shown in comparison. FIG. 2 is a graph showing the enhancement effect on the production of MDP1-specific antibody IgG2a by the combined use of MDP1 and G9.1 in BALB / c mice compared to the combined use of MDP1 and rCTB.

FIG. 3 is a graph showing the effect of a single administration of the combined use of MDP1 and G9.1 in a guinea pig inoculated with BCGII by delayed-type hypersensitivity (DTH). FIG. 4 is a graph showing the effect of two administrations of the combined use of MDP1 and G9.1 in a guinea pig inoculated intradermally with BCGII by a delayed-type hypersensitivity reaction (DTH).

Oligonucleotide G9.1
Oligonucleotide G9.1 (GGGGGGGGGGACGATCGTCG) which is an active ingredient of the present invention can be obtained by any method such as chemical synthesis according to a conventional method.

Mycobacterium tuberculosis DNA binding protein MDP1
The Mycobacterium tuberculosis DNA-binding protein [MDP1] in the present invention is a major cell protein of Mycobacterium tuberculosis showing the immunogenicity of Mycobacterium tuberculosis, and has a structure as described in the specification of Japanese Patent No. 4415200. For example, it can be obtained by the method described in the patent specification. This protein MDP1 can be isolated and purified directly from Mycobacterium tuberculosis, and can also be produced by genetic recombination.

  As described in Japanese Patent No. 4415200, M. tuberculosis DNA-binding protein [MDP1] is one or more in the protein consisting of the amino acid sequence set forth in SEQ ID NO: 1 and the amino acid sequence set forth in SEQ ID NO: 1. It includes a polypeptide having an amino acid sequence obtained by substitution, addition or deletion, and having DNA binding ability and growth retardation ability.

According to recent statistics, the number of new tuberculosis patients in Japan increases from around 20 years old when the effect of immunity by BCG is considered to decrease. Therefore, the anti-tuberculosis booster vaccine of the present invention is preferably administered from 15 to 20 years old.
The dosage is about 0.1-50 μg / Kg body weight for M. tuberculosis DNA binding protein [MDP1] and about 1-50 μg / Kg body weight for G9.1. The administration is preferably performed once from the age of 15 to 20 years, and it is preferably performed 1-2 times at intervals of 2-8 weeks as necessary. In addition, it is preferable to perform additional administration as needed for high-risk adults.

  The anti-tuberculosis booster vaccine of the present invention can be administered by nasal administration, intradermal administration, subcutaneous administration, intramuscular administration, oral administration and the like. The dosage form can be selected by a conventional method according to the administration route.

Next, the present invention will be described more specifically with reference to examples.
Example 1. Effect of G9.1 oligonucleotide on immune response of MDP1 in mice
Experiment 1:
Twelve C57BL / 6 mice were divided into 3 groups, 1 group (4 mice) had only MDP1 (5 μg / mouse), 2 groups (4 mice) had MDP1 (5 μg / mouse) and rCTB (20 μg ) And 3 groups (4 mice) were administered MDP1 (5 μg / mouse) and G9.1 (20 μg) nasally under light anesthesia, respectively. After the first immunization (8 weeks old), the same composition was boosted at 2 weeks, 3 weeks, and 4 weeks, blood was collected at 5 weeks, and the antibody titer of MDP1-specific antibody IgG2c was measured.
RCTB is a recombinantly produced product of the cholera toxin B subunit gene derived from Inaba-type cholera toxin 569B strain expressed in Bacillus brevis (Ichikawa Y, Yamagata H, Tochikubo K, Udaka). 1993 Aug 1; 111 (2-3): 219-224). S. Very efficient extracellular production of cholera toxin B subunit using Bacillus brevis. FEMS Microbil lett.
The results are shown in Table 1 below and FIG.

As is clear from the above results, the antibody titer of the anti-MDP1 antibody IgG2c was significantly higher in the MDP1 + G9.1 co-administration group than in the MDP1 single administration group and the MDP1 + rCTB co-administration group.
In nasal administration of recombinant Mycobacterium tuberculosis protein MDP1, the production of IgG2c, an indicator of Th1-type immune response, was increased by combining G9.1, which is useful for enhancing cellular immunity against tuberculosis It means that.

Experiment 2:
Twelve BALB / c mice were divided into 3 groups, 1 group (4 mice) had only MDP1 (5 μg / mouse), 2 groups (4 mice) had MDP1 (5 μg / mouse) and rCTB (20 μg ) And 3 groups (4 mice) were administered MDP1 (5 μg / mouse) and G9.1 (20 μg) nasally under light anesthesia, respectively. After the first immunization (8 weeks old), the same composition was boosted at 2 weeks, 3 weeks and 4 weeks, blood was collected at 5 weeks, and the antibody titer of MDP1-specific antibody IgG2a was measured.
The results are shown in Table 2 below and FIG.

As is clear from the above results, the antibody titer of the anti-MDP1 antibody IgG2a was significantly higher in the MDP1 + G9.1 co-administration group than in the MDP1 single administration group and the MDP1 + rCTB co-administration group.
In nasal administration of recombinant M. tuberculosis protein MDP1, the production of IgG2a, an indicator of Th1-type immune response, was increased by combining G9.1, which is useful for enhancing cellular immunity against tuberculosis It means that.

Example 3. Effect of G9.1 oligonucleotide on immune response of MDP1 in guinea pigs
Experiment 1:
Eight guinea pigs were divided into two groups, and four mice per group were inoculated intradermally with 5-week-old guinea pigs with a low ability to induce tuberculosis immunity. After 8 weeks, as a booster, 20 μg / animal MDP1 and 20 μg / animal G9.1 were inoculated intradermally. Two months later, a delayed-type hypersensitivity (DTH) (mm) against MDP1 (0.2 and 2 μg) was measured. In 2 groups of 4 animals, the same treatment as in Group 1 was carried out, but 20 μg / animal of MDP1 was inoculated intradermally as a booster. DTH response was measured as in group 1.
The guinea pig inoculated intradermally with BCGII is a model animal that mimics an adult with reduced tuberculosis immunity.
The results are shown in Table 3 below and FIG.

As is clear from the above results, delayed hypersensitivity reaction (DTH) was induced higher in guinea pigs boosted with MDP1 together with G9.1 than in guinea pigs boosted with MDP1 alone.
Thus, G9.1 is shown to be effective in combination with MDP1 to enhance reduced tuberculosis immunity in adults.

Experiment 2:
Experiment 2 was performed in the same manner as Experiment 1, except that the booster immunization after BCG II inoculation was repeated twice, the first inoculating 8 weeks later and the second inoculating 16 weeks later.
The results of measuring delayed hypersensitivity reaction (DTH) 2 months after the second inoculation are shown in Table 4 and FIG.

As is clear from the above results, delayed sensitization (DTH) was higher in guinea pigs boosted with MDP1 together with G9.1 than in guinea pigs boosted with MDP1 alone, even when boosted twice. Induced.
Thus, G9.1 is shown to be effective in combination with MDP1 to enhance reduced tuberculosis immunity in adults.

Claims (2)

  The following nucleotide sequence: GGGGGGGGGGACGATCGTCG, characterized by a combination of M. tuberculosis DNA binding protein (MDP1) and reduced in immunity to BCG inoculated in infancy, in the mid-teen to older generations Anti-tuberculosis booster vaccine to enhance tuberculosis immunity. The antituberculosis booster vaccine according to claim 1, which is a nasal administration agent, an intradermal / subcutaneous administration agent or an intramuscular administration agent.

Images