JP5896355B2 - Alginate lyase - Google Patents

Description

  The present invention relates to alginate lyase. More specifically, the present invention relates to an alginate lyase that efficiently produces an unsaturated uronic acid monosaccharide from alginic acid, and a method for efficiently producing an unsaturated uronic acid monosaccharide from alginic acid.

  Alginic acid (algininate) is a polysaccharide in which two pyranose ring forms of two uronic acids, D-mannuronic acid (M) and L-guluronic acid (G), are mainly β1-> 4 linked. The composition ratio of M and G varies depending on the organism (mainly algae), but there are M blocks, G blocks, and mixed blocks of M and G (see Fig. 1).

  Since alginic acid is abundant in nature, it is expected that unsaturated uronic acid monosaccharides can be efficiently produced by decomposing alginic acid to the minimum unit of M or G. To date, several alginate-degrading enzymes (alginate lyases) have been identified, but these are “endo-type” alginate lyases that produce oligosaccharides composed of two or more M or G (see figure 2) and “exo-type” alginate lyases that produce uronic acid monosaccharides (see FIG. 3).

  As an endo-alginate lyase, an enzyme derived from the genus Alteromonas (Patent Document 1) has been reported, and as an exo-alginate lyase, an enzyme derived from Sphingomonas genus A1 (Non-patent Document 1) has been reported. .

JP2000-342278

Molecular identification of oligoalginate lyase of Sphingomonas sp. Strain A1 as one of the enzymes required for complete depolymerization of alginate.Hashimoto W, Miyake O, Momma K, Kawai S, Murata K. J Bacteriol. 2000 Aug; 182 (16): 4572 -7.

  The problem to be solved by the present invention is to provide a method for efficiently producing uronic acid monosaccharides from alginic acid. The present inventors have identified a novel exo-type alginate-degrading enzyme from the seaweed-degrading bacterium AR06 strain (Pseudoalteromonas atlantica), and have completed the invention of a method for producing uronic acid monosaccharides using the same.

That is, the present invention includes the following embodiments, but is not limited thereto.
[Embodiment 1]
An isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having at least 86% identity with the sequence:
Here, the polypeptide has alginate lyase activity.
[Embodiment 2]
A method for producing an unsaturated uronic acid monosaccharide comprising the following steps:
(a) providing alginic acid comprising at least two uronic acid moieties;
(b) contacting the alginic acid with the polypeptide described in Embodiment 1, and
(c) A step of keeping the mixture of alginic acid and polypeptide in the above step in the presence of water.
[Embodiment 3]
Prior to the step (c), the method further comprises contacting the alginic acid with an isolated polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 85% identity with the sequence. The method for producing the unsaturated uronic acid monosaccharide according to Embodiment 2:
Here, the polypeptide has alginate lyase activity.
[Embodiment 4]
Prior to the step (c), the method further comprises contacting the alginic acid with an isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3 or an amino acid sequence having at least 85% identity with the sequence. The method for producing the unsaturated uronic acid monosaccharide according to Embodiment 2:
Here, the polypeptide has alginate lyase activity.
[Embodiment 5]
Before the step (c), contacting the alginic acid with an isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 85% identity with the sequence; and The unsaturation according to embodiment 2, further comprising contacting the alginic acid with the isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3 or an amino acid sequence having at least 85% identity with the sequence. Method for producing uronic acid monosaccharide:
Here, the polypeptide has alginate lyase activity.
[Embodiment 6]
An isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 85% identity with the sequence:
Here, the polypeptide has alginate lyase activity.
[Embodiment 7]
A method for producing an unsaturated uronic acid monosaccharide comprising the following steps:
(a) providing alginic acid comprising at least two uronic acid moieties;
(b) contacting the alginic acid with the polypeptide described in Embodiment 6, and
(c) A step of keeping the mixture of alginic acid and polypeptide in the above step in the presence of water.
[Embodiment 8]
Prior to the step (c), the method further comprises contacting the alginic acid with an isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3 or an amino acid sequence having at least 85% identity with the sequence. The method for producing the unsaturated uronic acid monosaccharide according to Embodiment 7:
Here, the polypeptide has alginate lyase activity.

  The exo-alginic acid-degrading enzyme and the method using the same provided by the present invention enable efficient production of uronic acid monosaccharides.

It is a schematic diagram which shows the structure of alginic acid. In the figure, n is a natural number. It is a schematic diagram of cleavage of alginate by endo-type alginate lyase. It is a schematic diagram of decomposition | disassembly of alginic acid by exo-type alginate lyase. It is the photograph which isolate | separated the purified alginate lyase by SDS-polyacryl gel electrophoresis and dye | stained CBB. The result of having developed the sample which made the alginic acid degrading enzyme A, C, or D act on alginic acid to the thin layer chromatography is shown. Lane 1: Alginic acid only sample (negative control). Lane 2: Sample in which alyA protein is allowed to act on alginic acid. Lane 3: sample in which alyC protein was allowed to act on alginic acid. Lane 4: Sample in which alyD protein is allowed to act on alginic acid. Lane 5: Sample in which alyC protein and alyD protein are allowed to act on alginic acid. Lane 6: Sample in which alyA protein and alyC protein were allowed to act on alginic acid. Lane 7: Sample in which alyA protein and alyD protein are allowed to act on alginic acid. Lane 8: Sample in which alyA protein, alyC protein, and alyD protein were allowed to act on alginic acid. The result of having developed the sample which made the alginic acid degrading enzyme C or D act on M block (M), G block (G), and MG block (MG) alginate to the thin layer chromatography is shown. Lane 1: oligosaccharide sample of 2-4 sugars. Lane 2: Sample in which alyC protein was allowed to act on M alginate. Lane 3: Sample in which alyC protein is allowed to act on G-alginic acid. Lane 4: Sample in which alyC protein was allowed to act on MG alginate. Lane 5: Sample in which alyD protein is allowed to act on M alginate. Lane 6: Sample in which alyD protein is allowed to act on G-alginic acid. Lane 7: Sample in which alyD protein was allowed to act on MG alginate. Lane 8: oligosaccharide sample of 2-4 sugars. Lane 9: Sample obtained by allowing alyC protein and alyD protein to act on MG alginate.

  The polypeptide of the present invention is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or 2 or an amino acid sequence having at least 85% identity with the sequence, and used in the production method of the present invention. The polypeptide is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, 2, or 3 or an amino acid sequence having at least 85% identity with the sequence. In any invention, the level of identity is at least 85%, 86%, 87%, 88%, 89%, preferably 90%, 91%, 92%, 93%, 94%, more preferably 95. %, 96%, 97%, 98%, or 99%, or 100% identical.

  Any polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1, 2, or 3 or an amino acid sequence having at least 85% identity with the sequence has alginate lyase activity.

  Here, the polypeptide consisting of an amino acid sequence having at least 85% identity with SEQ ID NO: 1 is 30% or more, preferably compared to the alginate lyase activity against the M block of the polypeptide of SEQ ID NO: 1. Alginate lyase activity against 50% or more or 70% or more M block. A polypeptide comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 1 is 30% or more, preferably 50% or more, compared to the alginate lyase activity against the G block of the polypeptide of SEQ ID NO: 1. Alternatively, it has alginate lyase activity for G block of 70% or more. A polypeptide comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 1 is 30% or more, preferably 50% or more, compared to the alginate lyase activity against the MG block of the polypeptide of SEQ ID NO: 1. Alternatively, it has alginate lyase activity against MG block of 70% or more.

  Further, a polypeptide comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 2 is 30% or more, preferably 50% compared to the alginate lyase activity against the G block of the polypeptide of SEQ ID NO: 2. It has alginate lyase activity for G block of 70% or more or 70% or more.

  When referring to an “isolated” polypeptide in the context of the present invention, it is meant that it has been purified to a level that has never existed in nature and fully exhibits the desired activity. That is, an “isolated” polypeptide can contain traces or some impurities.

  In the present specification, the term “alginic acid” includes a partial degradation product of alginic acid used as a starting material by an alginate lyase, such as an oligosaccharide. However, unsaturated uronic acid monosaccharides are not included in alginic acid.

  In the context of the present invention, the term “unsaturated uronic acid monosaccharide” refers to “unsaturated monosaccharide having a double bond at the non-reducing end, released from the terminal of alginic acid or alginate oligosaccharide by β-elimination reaction of exo-type alginate lyase. It means “sugar”.

  In the context of the present invention, the “uronic acid moiety” of alginic acid refers to β1-> 4-linked M or G in alginic acid.

  In the context of the present invention, “contacting” alginic acid and one or more polypeptides means mixing them in the form of a solid, an aqueous solution, or a suspension. Alginic acid and the polypeptide or polypeptides may be in different forms before being mixed.

  In the context of the present invention, keeping warm "in the presence of water" means adding water when both alginic acid and the polypeptide or polypeptides are mixed in solid form. If the mixture of alginic acid and polypeptide already contains water, the amount of water may be adjusted accordingly.

  In the context of the present invention, the term “keep warm” in the presence of water means that the polypeptide used in the present invention keeps the temperature within a range where the alginate lyase activity can be exerted. The incubation time may be any time as long as the decomposition of alginic acid can be confirmed.

  When a plurality of polypeptides are brought into contact with alginic acid, the plurality of polypeptides may be contacted simultaneously or sequentially. In the case of sequentially contacting a plurality of polypeptides with alginic acid, the mixture of alginic acid and polypeptide is present in the presence of water between the step of contacting one polypeptide with alginic acid and the step of contacting another polypeptide with alginic acid. A step of keeping the temperature below may be added. That is, in the present specification, “before the step (c)” means “before the final heat retaining step”, and does not limit the number of the heat retaining steps.

  In the present specification, “alginate degrading enzyme” and “alginate lyase” are used synonymously. In addition, when described as alyC, it represents any of alyC gene, mRNA transcribed from alyC gene, or protein encoded by alyC gene. These may be referred to as alyC gene, alyC mRNA, or alyC protein. Where apparent in context, the terms gene, mRNA, or protein may be omitted. The same applies to the descriptions alyD and alyA.

[Example 1]
[Experimental materials and experimental methods]
<Alginic acid>
Sodium alginate (500 cps; NACALAI TESQUE, INC.) Was used.

<Microorganisms and culture conditions>
Marine broth Difco (Marine broth, MB) was used as a complete medium for the AR06 strain. (Artificial Sea Water (ASW) medium was used as the minimum medium, and 0.3% sodium alginate was added as a carbon source.) Culture was performed at 20 ° C. When an agar medium was used, agar powder was added at a final concentration of 1.5% (w / v) to the medium.

  E. coli DH5α was used as a host for plasmid construction and protein expression. As a complete medium, LB medium (LB broth, LB) was used for E. coli. If necessary, ampicillin (Ap) was added to the E. coli selective medium to a final concentration of 50 μg / ml. The culture was performed at 37 ° C.

  Restriction enzymes and other enzymes were purchased from TAKARA BIO INC, TOYOBO CO., LTD., Or New England Biolabs Inc., and used according to the instructions in the attached instructions. Other recombinant DNA-related procedures were in accordance with conventional methods (Sambrook et al., Molecular cloning, Cold Spring Harbor Laboratory (1989)). Plasmid recovery from E. coli was performed using the QIAprep Spin Miniprep Kit (QIAGEN).

  Each expression plasmid was transformed into E. coli DH5α, and protein expression was induced by induction with IPTG. Each E. coli strain cultured in LB until OD reached a stationary phase was diluted to 1/5, and cultured overnight at 20 ° C. under the induction of 0.1 mM IPTG.

<Cloning of alginate lyase C gene (alyC) of seaweed-degrading bacteria AR06>
Using genome DNA extracted from AR06 strain with QIAGEN Genomic-tip 500 / G (QIAGEN), whole genome analysis was performed with Illumina Genome Analyzer, and a total of 1,188 Mb single-read AR06 strain genome sequence was obtained. Using the de novo assemble program Velvet (Zerbino et al, 2008) specializing in short fragment sequences obtained with 2nd generation sequencers, the genome of AR06 strain was assembled and 1781 contigs with a length of 41 bp or more were obtained. It was.

  Putative alginate lyase (locus_tag; ATW7_03777), putative alginate lyase precursor (locus_tag; ATW7_06243), putative chondroitin AC / alginate lyase (7 And P. haloplanctis TAC125 strain putative alginate lyase (locus_tag; PSHAa0571), alyll (locus_tag; PSHAa1748), putative alginate lyase precursor (partial match) (locus_tag; PSHAa1749) It was found to be located on the chain.

Vector creation
A vector for expressing a recombinant protein with a histidine tag added to the C-terminus was prepared. Primers GTIR-Fp (GTGCACTCTCAGTACAATCTGC) and GTIR-Rp (TATGCGGTGTGAAATACCGCACA) were used to amplify pGReenTIR (National Institute of Genetics) by PCR with KOD-Plus (TOYOBO) and phosphorylate with T4 Polynucleotide Kinase (TaKaRa Bio) Thereafter, plasmid pGTk was prepared by removing one NdeI site on the vector by self-ligation using Ligation High (TOYOBO). NdeI-blunted Bpu1102I containing the histidine tag fragment was cut out from pET26b (Novagen / Merck KGaA, Darmstadt, Germany) and inserted into NdeI-blunted ASP718 of pGTk to create pGTk3.

  Since alyC was presumed to have a signal peptide at the N-terminus, KOD using the primers alyCmn (TGGCGCATCCAAATTTGGTAATAAC) and alyCcxI (ATCCCTCGAGCTCCTGATTATTCTTCATC) from the 30th codon excluding the signal peptide (coding Ala) to the 3 'end Amplified by PCR with -Plus (TOYOBO), digested with XhoI, and inserted into the blunted NdeI-XhoI site of pGTk3 to prepare pLACH.

<Cloning of alginate lyase D gene (alyD) of seaweed-degrading bacteria AR06>
As with alyC, the AR06 strain genomic sequence contig was searched using the alginate lyase genes of the related strains Alteromonadales bacterium TW-7 and P. haloplanctis TAC125 and located on the complementary strand of contig 134 I found out.

  Since alyD was presumed to have a signal peptide at the N-terminus, the 24th codon excluding the signal peptide (which encodes Lys) to the 3'-end were used with primers alyDmn (TGAAAGATTATTTTGTAGACACTAAACAAG) and alyDcXI (CATCACTCGAGGTTCACCTTATTTAAAACG) Amplified by PCR with -Plus (TOYOBO), digested with XhoI, and inserted into the blunted NdeI-XhoI site of pGTk3 to prepare pLADH.

<Cloning of alginate lyase A gene (alyA) of seaweed-degrading bacteria AR06>
Similar to the above-mentioned alginate lyase gene, against the AR06 strain genomic sequence contig, the extracellular alginate lyase gene alyPEEC (Carbohydrate Research 2001 Sep 21; 335 (1): 11-21) of the related strain Pseudoalteromonas. Elyakovii IAM14594 ) Was found to be located on the sense strand of Contig 486.

<DNA sequence of alginate lyase C gene (alyC) of seaweed-degrading bacteria AR06>
The nucleic acid sequence corresponding to the start codon to the stop codon of alyC mRNA is shown below. This sequence is identical to the sequence of SEQ ID NO: 4.
>
ATGATGAATTTAACCCAAAATAAGTCATTATTTAAAACGCTGGGTGTCACTGTAAGTGCCTTAGTTTTATCGATAAACGCCTACGCAGCGCATCCAAATTTGGTAATAACCAATGATGATGTACAGCAAATGCGCCAAGCAATTAGCAACAATGAACAGGGCAAGTTTGCCAACGCATTTGCAGCGCTTAAGGCACAAGTGGATGAGCAAATTAAAAGCCCTATAACAGTGCCTGTACCAAAAGACGGTGGGGGAGGGTATACCCACGAACGACACAAAAAAAATTATCAGCTTATGTATAACGCCGGTGTTATTTATCAGCTTAGCCAAGATGATAAATACGCTCATTACGTACGTGATATGTTGCTTGAGTATGCCAAATTATACCCAACACTTGATGTACACCCTAAGCGCAAAGTTAAGTCGCAAAACCCAGGTAAACTATTTTGGCAAAGCCTTAATGAGGCCATGTGGCTTGTTTATACCATTCAAGCATACGATTTAGTGCATGATGCGTTAAGCGCCGCTAATATTAAAACCATCGAAAATGACTTACTGCGCCCAGTATCGTTATTTTTATCACAAGGCCAGCCATCAACCTTTAACAAGGTACATAACCATGGTACGTGGGCTACAGCCGGTGTAGGCATGGCAGGGTATGTATTAGATGAATCTGAGTGGGTCGAAAAGTCTCTTTACGATTTAGATAAATCGGGCGAGGGTGGCTTTATTAAGCAGCTAGACATGCTGTTTTCGCCACAGGGCTATTACAACGAAGGTCCTTATTATCAACGCTTTGCACTACTTCCGTTTGTTACCTTTGCTAAAGCAATTGAAAACAACGAACCGCAGCGAGACATTTTTGAATATCGCGATGGCATATTACTTAAAGCCATTGATACCACTATTCAGCTAAGCTATAACGGTTTGTTTTTCCCGATAAACGATGCAATTAAAAGTAAAGGTATAGACACAATAGAGCTGGTACACGGTGTAACAG CCGCTTATGGTTTAACACACGATACTGGTTACTTAGATATAGCTAAAAAGCAAAATCAAATAATACTCTCTGGCGATGGCCTAAAAGTGGCTCAAGCGCTGGATAAAAATAAGCAAACTCCTTATGTATTTAAATCGGTTGCGTTTGGCGATGGTAACGATGGCGAGCAAGGGGCGTTGGTAGTAATGCGTACGCAAACTGGTGGCGACCAAGCACTTTTATTTAAACCTGCCGCACAGGGTTTAGGGCATGGACATTTTGATAAATTAACATGGCAGTTTTACGATCATGGCAATGAAATTGTATCTGATTATGGCGCTGCACGTTTTTTAAATGTTGAGGCTAAATACGGCGGCCGTTACCTACCAGAAAACGAAACTTACGCAAAACATACCGTGGCACACAATACGGTTGTGATTGATGAAACCTCGCATTTTAATGCAAATGTTAAACTGGGTAATAACAATCATCCTACGCTTAATTTCTTTGAAACAAACCAATACGGAACGGTGTCAAGTGGGCAAATAAGCACCGCTTACAAAGGTGTTGAGCTTGAACGCACGTTAGCGTTAATTAATTTACCTATGCTTGAAAGCACGCTTGCAGTTGATATTTTTAATGTGACTGCAGATACCTCCCATAAAATTGATTTACCACTGCATTACAAAGGCCAATTAATTGATACCAGCTTTGAGTTACTTGGTAACACCAAAAGCTTAGCTGCGCTGGGTGATAAAAATGGCTATCAACATTTATGGTTAAAAGCACAATCGCAACCAGATGAAGGCCTAGCAAAGGTAACGTGGTTAAACGACAACGGCCGTTTTTATACACAAACTAGCCTAGTAAAAGGGGATGAGTCTTTCTTATTTACGCAAATAGGGGCAAACGATCCACACTTTAATCTTCGTAACGAAAATGGCTACATTCGCCGTGTAGAAGGTAAAAAACAGCATAAATTTATTTCAGTACTTGAGCCTCACGGTGAATACAACCCAAG TAAAGAATATACCCTAGAGGCTGTTAGCCGTGTATCGTCACTTAAGTATGACGCGCAAGAGCACTTAGACCTAATTGAAGTTAAAGTAAAAAATAATACCTATTTGGTTGCTATCAACAAAGCCGATAAAGCAGCTAAACACACATTCACATATCAAAATAAAGCATTCACCTTAAATGGCCGCCTTGGCTATTATGCGATGAATAAT

<DNA sequence of alginate lyase D gene (alyD) of seaweed-degrading bacteria AR06>
The nucleic acid sequence corresponding to the start codon to the stop codon of alyD mRNA is shown below. This sequence is identical to the sequence of SEQ ID NO: 5.
>
ATGCGTTTAATTAATATAATAAAGCTTAGCCTAGTTCTTATTGGGTGCACATCCACACAATTGGCAGCCAAAGATTATTTTGTAGACACTAAACAAGCTTTTCAAGAGATCTCTGACAAACTCGTTGCTGGCGATAAAGTAACTCTCAAAGACGGTACGTGGTCTAATTTCGAAATTTTATTACAAGGCCAAGGAACCAAAAACGCCCCTATAAAGCTTACAGCGCAAACCAAGGGTAATGTTATTTTATCAGGGCAATCTAATTTAAGACTGGCGGGTTCGTATTTAGAAGTGTCAGGGCTTGTATTTAAAAATGGTTATACGCCTAGCTCAGCCGTTATTGAATTTCGTAAAAATAAAGATGAGCTTGCTACTCACTCCCGCGTAACACAAGTCGTTATCGATAACTACAATAACCCCGATAAACGAGAATCAGACTATTGGGTGGCTCTATATGGTAAACACAATCGTTTTGATCACAGCCACTTAGTAGGTAAACGTAACAAAGGCGTTACGGTTGCAGTAAGGCTTAATAGTGAGCAAAGCCAACAAAACCACCATCAAATTGATCATAACTTCTTTGGCTATCGTCCTACTTTTGGATCTAACGGCGGTGAAACACTGCGCATTGGTACTAGCCACTATTCATTAAGTGATTCATTGACCTTAGTTGAAAACAACTACTTTGAACGTACTAACGGCGAAGTAGAAATAATCTCGGTTAAATCAGGGAAAAACCAAATCCGCAATAATGTGTTTTTTGAATCTCGCGGCACACTAACGCTGCGCCATGGTAATGGCAATATTATAGAAGAGAACGTTTTTTTTGGTAACGGTGTAGATCACACAGGTGGCATTCGCATCATTAATAAAAACCAAACAGTAAAAAATAACTACTTAGAAGGTTTAACAGGCTACCGTTTTGGCAGTGGTTTTACGGTTATGAACGGCGTACCTAACTCACCAATAAATCGCTACCATCAGGTAGAAAACGCGACAA TTGAAAACAATACCTATGTAAATGTGCGTCATATACAACTTGGTGCAGGTAGCGATAGCGAGCGTAGCGCTGCACCAATTAATAGCGTAATGAAAAATAACCTTATTATTAATCAAAATGGCGAGCAGCCTTTTACAACCTTTGATGATGTAAGCGGTATTAAATTTAGTGAAAATGTAGCTAATACCCAGGTATTAAAAGAGTTAAATTACGGTGTTAAACAGCAAAATGTAACACTAACCAGAGCTAGTAACGGTTTACTGTATCCTGAATCAAGCAAAATTAGTGCAGGTGCTAAACGCGGTTTAAAGGTGCTAAAAAAGGCCGATACCGGCGTTAGTTGGTATCCAAAAACAGAGCAAGTTGTAGCATTTGATACGGGTAAAACTCACCAGGTTAAAGCAACTGCAGATGCCTTACTTAACGCAATCAATGCAGCCCAAACGGGTGATGTATTAGAGCTTGCAGATGGTCAATACGATGTATCTAAACTCGTTAAAATAACAAAAGTGCTTACCCTTAAGGCTAAACATACTGGCAAAGCTAAGCTGACCTACCAACGCTCCACCTTATTCGAAATTCATGATGGCGGTAGCTTAAAGCTAGATGGTTTAGTTATTTCGGGTGAAAACGCACCTGATGCCATTAATAATAGTGTGGTACGTACTAAAAAGTGGGGCATGGTTGATAACTACCGCTTTGAAATACACAACTCACAATTAACTAATCTTGATATTAATCACTCATTTCACTTTTTTGTAACGGGTAAAGGGGCGATGGCAGATGAAATCACGTTAGTAAATAACACCTTTAAAAATGTAACTGGCGATATTTTACGTCTCGATACCGAAATAGAAGACTTAGGTATTTATAACGCAGAGTATGTAACACTTAAAAACAATACCTTTAATGAGGTAGCCGGTGGCGTCGTTAAGTTATACCGAGGTGGAAGTGATGAAAGCACCTTTGGTCCGCATTTATTAATGACCAATAACACCCT AACTAAAGTAGGTTTAGGTAAGCGTAACAAGGCGCAAGCGAGTGTGTATGCGCACGGTGTACAAGTAACAAATATTGCAAGCAACGTATTTGAAAAATCGGCACCGATTAAAATTGAGCACACGGTTGGTGAGCCAATAACAGCCATTACAGATAACACCTTTGATGCAACTCAAGCGCCCAGAGTATAAAGGGTCGCGTT

<DNA sequence of alginate lyase A gene (alyA) of seaweed-degrading bacteria AR06>
The nucleic acid sequence corresponding to the start codon to the stop codon of alyA mRNA is shown below. This sequence is identical to the sequence of SEQ ID NO: 6.
>
ATGATTAACCATAAAAAACTGTTTTTTTACAGCGCAATTGCGACAAGTTCAGCGCTATCTCATGCTGCAACAATTAATAATGCAGGCTTTGAAAGTGGCTTTAGTAACTGGAACGAAACCGACCCAGCCGCTATTTCTTCAGATGCTTACAGTGGCTCAAAATCGTTAAAAATTCAGGGCAGTCCAGCACGGGTTTATCAAGTGGTAGATATACAGCCTAACACTGAATACACCCTAAGTGCTTATGTGCTGGGTAAAGGGCAAATTGGTGTAAACGATTTAAATGGTTTATTTAAAAACCAAACCTTTAATGTTTCTTCGTGGACTAAAGTAACAAAAACATTTACCTCAGCAAACACCAATTCACTTCAGGTTTTTGCTAAACATTACAACAACACCAGCGATGTAAGGTTTGATAATTTTGCCTTGGTTGAGGGCAGCGGCAGTAATGATGGTGGCTCAGATGGCGGCAGCGATAACTCAAATGGTTCAACAATTCCTAGCAGCATAACCAGTGGTAGCATTTTTGATTTAGAGGGGGATAACCCAAATCCTCTCGTTGACGATAGCACCTTAGTGTTTGTGCCGTTAGAGGCACAACATATTACGCCTAATGGTAATGGCTGGCGTCATGAGTATAAGGTTAAAGAAAGTTTACGCGTTGCTATGACTCAAACCTATGAAGTGTTCGAAGCTACGGTAAAAGTTGAGATGTCTGATGGCGGAAAAACAATTATATCGCAGCACCATGCTAGCGATACCGGCACTATATCTAAAGTGTATGTGTCGGATACTGATGAATCGGGCTTTAATGATAGCGTAGCGAACAACGGAATTTTTGATGTGTACGTACGTTTACGTAATACCAGCGGTAATGAAGAAAAATTTGCTTTGGGTACAATGACCAGCGGTGAGACATTTAACTTGCGGGTAGTTAATAACTACGGCGATGTAGAGGTTACGGCATTCGGTAACTCGTTCGGTATACCAGTAGAGGATG ATTCGCAGTCATACTTTAAGTTTGGTAACTACCTGCAATCGCAAGACCCATACACATTAGATAAATGTGGTGAGGCCGGAAACTCTAACTCGTTTAAAAACTGTTTTGAGGATTTAGGCATTACAGAGTCAAAAGTGACGATGACCAATGTGAGTTATACGCGCGAAACTAATTAA

<Amino acid sequence of alginate lyase C protein of seaweed-degrading bacteria AR06>
The full-length amino acid sequence of alginate lyase C protein is shown below. This sequence is identical to the sequence of SEQ ID NO: 1.
>
MMNLTQNKSLFKTLGVTVSALVLSINAYAAHPNLVITNDDVQQMRQAISNNEQGKFANAFAALKAQVDEQIKSPITVPVPKDGGGGYTHERHKKNYQLMYNAGVIYQLSQDDKYAHYVRDMLLEYAKLYPTLDVHPKRKVKSQNPGKLFWQSLNEAMWLVYTIQAYDLVHDALSAANIKTIENDLLRPVSLFLSQGQPSTFNKVHNHGTWATAGVGMAGYVLDESEWVEKSLYDLDKSGEGGFIKQLDMLFSPQGYYNEGPYYQRFALLPFVTFAKAIENNEPQRDIFEYRDGILLKAIDTTIQLSYNGLFFPINDAIKSKGIDTIELVHGVTAAYGLTHDTGYLDIAKKQNQIILSGDGLKVAQALDKNKQTPYVFKSVAFGDGNDGEQGALVVMRTQTGGDQALLFKPAAQGLGHGHFDKLTWQFYDHGNEIVSDYGAARFLNVEAKYGGRYLPENETYAKHTVAHNTVVIDETSHFNANVKLGNNNHPTLNFFETNQYGTVSSGQISTAYKGVELERTLALINLPMLESTLAVDIFNVTADTSHKIDLPLHYKGQLIDTSFELLGNTKSLAALGDKNGYQHLWLKAQSQPDEGLAKVTWLNDNGRFYTQTSLVKGDESFLFTQIGANDPHFNLRNENGYIRRVEGKKQHKFISVLEPHGEYNPSKEYTLEAVSRVSSLKYDAQEHLDLIEVKVKNNTYLVAINKADKAAKHTFTYQNKAFTLNGRLGVYAMKNNQE

<Amino acid sequence of alginate lyase D protein from seaweed-degrading bacteria AR06>
The full-length amino acid sequence of alginate lyase D protein is shown below. This sequence is identical to the sequence of SEQ ID NO: 2.
>
MRLINIIKLSLVLIGCTSTQLAAKDYFVDTKQAFQEISDKLVAGDKVTLKDGTWSNFEILLQGQGTKNAPIKLTAQTKGNVILSGQSNLRLAGSYLEVSGLVFKNGYTPSSAVIEFRKNKDELATHSRVTQVVIDNYNNPDKRESDYWVALYGKHNRFDHSHLVGKRNKGVTVAVRLNSEQSQQNHHQIDHNFFGYRPTFGSNGGETLRIGTSHYSLSDSLTLVENNYFERTNGEVEIISVKSGKNQIRNNVFFESRGTLTLRHGNGNIIEENVFFGNGVDHTGGIRIINKNQTVKNNYLEGLTGYRFGSGFTVMNGVPNSPINRYHQVENATIENNTYVNVRHIQLGAGSDSERSAAPINSVMKNNLIINQNGEQPFTTFDDVSGIKFSENVANTQVLKELNYGVKQQNVTLTRASNGLLYPESSKISAGAKRGLKVLKKADTGVSWYPKTEQVVAFDTGKTHQVKATADALLNAINAAQTGDVLELADGQYDVSKLVKITKVLTLKAKHTGKAKLTYQRSTLFEIHDGGSLKLDGLVISGENAPDAINNSVVRTKKWGMVDNYRFEIHNSQLTNLDINHSFHFFVTGKGAMADEITLVNNTFKNVTGDILRLDTEIEDLGIYNAEYVTLKNNTFNEVAGGVVKLYRGGSDESTFGPHLLMTNNTLTKVGLGKRNKAQASVYAHGVQVTNIASNVFEKSAPIKIEHTVGEPITAITDNTFDATQAPSVKELRVAGPHTATIKNNNVLNKVN

<Amino acid sequence of alginate lyase A protein from seaweed-degrading bacteria AR06>
The full-length amino acid sequence of alginate lyase A protein is shown below. This sequence is identical to the sequence of SEQ ID NO: 3.
>
MINHKKLFFYSAIATSSALSHAATINNAGFESGFSNWNETDPAAISSDAYSGSKSLKIQGSPARVYQVVDIQPNTEYTLSAYVLGKGQIGVNDLNGLFKNQTFNVSSWTKVTKTFTSANTNSLQVFAKHYNNTSDVRFDNFALVEGSGSNDGGSDGGSDNSNGSTIPSSITSGSIFDLEGDNPNPLVDDSTLVFVPLEAQHITPNGNGWRHEYKVKESLRVAMTQTYEVFEATVKVEMSDGGKTIISQHHASDTGTISKVYVSDTDESGFNDSVANNGIFDVYVRLRNTSGNEEKFALGTMTSGETFNLRVVNNYGDVEVTAFGNSFGIPVEDDSQSYFKFGNYLQSQDPYTLDKCGEAGNSNSFKNCFEDLGITESKVTMTNVSYTRETN

<Purification of alginate lyase C from recombinant E. coli expression system>
The Escherichia coli DH5α cells carrying the plasmid pLACH, in which the expression of the recombinant protein was induced by induction with IPTG, were recovered by centrifugation. The cells were suspended in PBS (-) and crushed with a sonicator. The supernatant fraction was collected by centrifugation and further filtered through a 0.22 μ filter.

  Recombinant expressed alginate lyase C was purified by TALONspin Column (Clontech / TaKaRa Bio). The recovered alginate lyase C was concentrated using a 10 kDa Amicon Ultra (Millipore) -0.5 centrifugal filter unit and buffer exchanged with PBS (-) to obtain purified alginate lyase C.

<Purification of alginate lyase D from recombinant E. coli expression system>
E. coli DH5α cells carrying plasmid pLADH, in which expression of the recombinant protein was induced by induction with IPTG, were collected by centrifugation. The cells were suspended in PBS (-) and crushed with a sonicator. The supernatant fraction was collected by centrifugation and further filtered through a 0.22 μ filter.

  Recombinant expressed alginate lyase D was purified by TALONspin Column (Clontech). The recovered alginate lyase D was concentrated and exchanged with PBS (-) using a 10 kDa Amicon Ultra-0.5 centrifugal filter unit to obtain purified alginate lyase D.

<Purification of Alginate Lyase A from AR06 Culture Solution>
The AR06 strain cultured until OD reached the stationary phase in MB was added 1/100 vol to ASW containing 0.3% alginate, and cultured at 20 ° C. for 24 hours. The supernatant fraction was collected by centrifugation, added with ammonium sulfate having a final concentration of 80%, and allowed to stand at 4 ° C. for 1 hour. The precipitate was collected by centrifugation, suspended in PBS (−) and filtered through a 0.22 μ filter. Dialyzed with Slide-A-Lyzer 10,000 MWCO Dialysis Cassette (Thermo Fisher Scientific KK), exchanged buffer with PBS (-) to adjust the concentration to 0.5 μg / μl to obtain a crude enzyme solution of alginate lyase A. (Appl Microbiol Biotechnol. 2010 Mar; 86 (2): 567-76)

<Enzyme and protein assay>
The protein concentration was measured by BCA Protein Assay-Reducing Agent Compatible (Thermo Fisher Scientific KK).

  Purified alginate lyase was subjected to SDS-polyacryl gel electrophoresis using a 10-20% gradient precast gel (Marisol SIC). The gel after electrophoresis was stained using Quick-CBB Plus (Wako Pure Chemical Industries, Ltd.). The results are shown in FIG. According to the analysis by Image J (http://rsb.info.nih.gov/ij/), the purified alginate lyase C was 96%, and the purified alginate lyase D was 42%.

  Decomposition of alginate by alginate lyase A: 100 μl of a crude enzyme of alginate lyase A was mixed with an equal amount of 2% alginate solution and decomposed overnight at 37 ° C.

  Decomposition of alginic acid by alginate lyase C: 100 μl of PBS (−) containing 12 μg of purified alginate lyase C and an equal amount of 2% alginate solution were mixed and decomposed overnight at 37 ° C.

  Decomposition of alginic acid by alginate lyase D: 100 μl of PBS (−) containing 26.6 μg of purified alginate lyase D and an equal amount of 2% alginate solution were mixed and decomposed overnight at 37 ° C.

  Decomposition of alginic acid by alginate lyase C and alginate lyase D: Mix 12 μg of purified alginate lyase C and 100 μl of PBS (−) containing 26.6 μg of purified alginate lyase D and an equal amount of 2% alginate solution at 37 ° C. Decomposed overnight.

  Decomposition of alginic acid by alginate lyase A and alginate lyase C: 17 μl of crude enzyme of alginate lyase A, 100 μl of PBS (−) containing 12 μg of purified alginate lyase C and 117 μl of 2% alginate solution were mixed at 37 ° C. Decomposed overnight.

  Decomposition of alginate by alginate lyase A and alginate lyase D: 17 μl of crude enzyme of alginate lyase A, 100 μl of PBS (−) containing 26.6 μg of purified alginate lyase D, and 117 μl of 2% alginate solution were mixed at 37 ° C. Decomposed overnight.

  Degradation of alginate by alginate lyase A, alginate lyase C and alginate lyase D: 17 μl of crude alginate lyase A, 12 μg of purified alginate lyase C, 100 μl of PBS (−) containing 26.6 μg of purified alginate lyase D, 117 μl 2% alginate solution was mixed and decomposed overnight at 37 ° C.

<Thin layer chromatography>
Alginate degradation products were confirmed by thin layer chromatography. 1 μl of each sample was spotted on a silica gel HPTLC plate (Merck) and dried. After developing using a developing solution of butanol: formic acid: water = 4: 6: 1 (v / v), a coloring solution in which an equal amount of 0.2% naphthoresorcin ethanol and 20% sulfuric acid was mixed was sprayed. Detection was carried out at 100 ° C for 10 minutes.

[Results and discussion]
Analysis using bioinformatics predicted the following for the proteins encoded by alyC, alyD, and alyA.

alyC: encoded 2,220 bp, 739 amino acids, was deduced to have an isoelectric point of pI 6.64 and a molecular weight of 82.7 kDa. It had a 29 amino acid signal peptide at the N-terminus and was predicted to exist in the extracellular membrane. The N ⁴⁶⁸ from the amino acid residue G ^388, had a heparinase-like domain Heparinase II / III-like protein ( pfam07940). It showed 83% and 84% identity at the amino acid level between the putative chondroitin AC / alginate lyase (ATW7_06248) of the Alteromonadales bacterium TW-7 strain and the putativealginate lyase (PSHAa1748) of the Pseudoalteromonas atlantica TAC125 strain, respectively.

  alyD: encoded 2,259 bp, 752 amino acids, deduced to have an isoelectric point of pI of 9.11 and a molecular weight of 82.7 kDa. It had a 23 amino acid signal peptide at the N-terminus and was predicted to be present in the extracellular membrane. I couldn't find a conserved domain. It showed 77% and 77% identity at the amino acid level between putative alginate lyase precursor (ATW7_06243) of Alteromonadales bacterium TW-7 strain and putativealginate lyase precursor (partial match) (PSHAa1749) of Pseudoalteromonas atlantica TAC125 strain, respectively.

alyA: encoding 1,176 bp, 391 amino acids, deduced to have an isoelectric point of pI 4.57 and a molecular weight of 42.4 kDa. It had a 22 amino acid signal peptide at the N-terminus and was predicted to be secreted extracellularly. Following the signal peptide, the carbohydrate-binding domain (CBM) [CBM_4_9 (pfam02018)] was expected to be present in A ²³ -E ¹⁴⁵ and the alginate lyase domain [Alginate_lyase2 (pfam08787)] was expected to be present in D ¹⁷⁷ -E ³⁷⁶ . In [Carbohydrate-Active enZymes (CAZy) database, http://www.cazy.org/], 21 of the polysaccharide lyase (EC 4.2.2.-) has been identified due to the homology of the amino acid sequence reflecting the structural specificity. Classified as family. The AR06 strain alyA showed 76% amino acid level identity with AlyPEEC of Pseudoalteromonas elyakovii IAM 14594, an extracellular alginate lyase of the polysaccharidelyase family 18. Furthermore, 233 amino acids on the C-terminal side were identical to AALyase of Pseudoalteromonas sp. Strain 272.

  FIG. 5 shows the results of allowing alginic acid degrading enzyme A, C, or D to act on alginic acid. Since alginic acid has a large molecular weight, development was not observed (lane 1). When alyA protein was allowed to act on alginic acid, alginate degradation products of disaccharide, trisaccharide and tetrasaccharide were confirmed (lane 2). This indicates that the alyA enzyme is an endo-alginate lyase.

  On the other hand, when alyC protein was allowed to act on alginic acid, no oligosaccharide was confirmed, and the production of unsaturated uronic acid monosaccharide was confirmed (lane 3). This result indicates that the alyC enzyme is an exo-type alginate lyase. In addition, when the alyD protein was allowed to act on alginic acid, no oligosaccharide was confirmed, and the production of a small amount of unsaturated uronic acid monosaccharide was confirmed (lane 4). This result suggests that alyD alone has a lower alginic acid degradation activity than alyC alone.

  Surprisingly, when both alyC and alyD were allowed to act on alginic acid, the production of unsaturated uronic acid monosaccharides was observed, far exceeding the sum of the amounts produced when each acted alone. (Lane 5). This result indicates that the combination of alyC and alyD has a remarkable effect that cannot be predicted from the result of each single. It is expected that alyC and alyD cooperate by an unknown mechanism.

  When alyA and alyC (lane 6) or alyA and alyD (lane 7) were allowed to act on alginic acid, production of unsaturated uronic acid monosaccharide, disaccharide, trisaccharide and tetrasaccharide was observed. By increasing the incubation time, all oligosaccharides are expected to be decomposed to unsaturated uronic acid monosaccharides.

  When alyA, alyC, and alyD were allowed to act on alginic acid, no oligosaccharide was confirmed, and the production of unsaturated uronic acid monosaccharide was confirmed (lane 8).

  From the above results, it is proved that unsaturated uronic acid monosaccharide can be produced from alginic acid by combining alyA enzyme with one or both of alyC enzyme or alyD enzyme, or one or both of alyC enzyme or alyD enzyme. It was done.

[Example 2]
[Experimental materials and experimental methods]
<Preparation of M block and G block from sodium alginate>
Alginic acid is a heteropolymer composed of mannuronic acid and guluronic acid, but alginic acid composed of mannuronic acid (M) block and guluronic acid (G) block is obtained by acid hydrolysis by Haug et al. (Acta Chem Scand. 1966 20: 183-190) were modified and prepared as follows.

Operation
1. 10 g of sodium alginate was dissolved by heating in 950 ml of distilled water.
2. 50 ml of 6N HCl was added and mixed well, and the mixture was incubated at 100 ° C. for 20 minutes for hydrolysis.
3. Centrifugation (10,000 rpm, 20 min) was performed.
4. After neutralizing the supernatant with NaOH, NaCl was added to a concentration of 0.1M. Then, twice the amount of ethanol was added, and the precipitate was collected by centrifugation (10,000 rpm, 10 min), washed with 70% ethanol and 99% ethanol, and lyophilized. Thereby, alginic acid composed of MG block (sometimes referred to as MG block) was obtained.
5. 1,000 ml of 0.3 N HCl was added to the precipitate, and the mixture was incubated at 100 ° C. for 20 hours for hydrolysis. After completion of the decomposition, the centrifuged precipitate was suspended in distilled water, and neutralized and dissolved with NaOH to a volume of 500 ml.
6. NaCl was added to a final concentration of 0.1M. Thereafter, HCl was added to adjust to pH 2.85. Precipitation occurred.
7. Centrifugation (10,000 rpm, 20 min) was performed.
8. The supernatant was neutralized with NaOH, and 2 volumes of ethanol was added. The precipitate was collected by centrifugation (10,000 rpm, 10 min), washed with 70% ethanol and 99% ethanol, and lyophilized. As a result, alginic acid composed of M block (sometimes referred to as M block) was obtained.
9. The precipitate was dissolved while neutralizing, and NaCl was added to a final concentration of 0.1 M. Two times the amount of ethanol was added and mixed. The precipitate was collected by centrifugation (10,000 rpm, 10 min), washed with 70% ethanol and 99% ethanol, and lyophilized. Thereby, alginic acid composed of G block (sometimes referred to as G block) was obtained.
10. The composition of each alginic acid was confirmed by H ¹ -NMR using ECA-500 manufactured by JEOL.

<Degradation of M block (M), G block (G), MG block (MG) alginate by alginate lyase C>
100 μl of PBS (−) containing 12 μg of purified alginate lyase C and an equal volume of 2% M, G, MG alginate solution were mixed and decomposed overnight at 37 ° C.

  Degradation of M, G, MG alginate by alginate lyase D: Mix 100 μl of PBS (-) containing 26.6 μg of purified alginate lyase D with an equal volume of 2% M, G, MG alginate solution at 37 ° C overnight. Disassembled.

  Degradation of MG alginate by alginate lyase C and alginate lyase D: Mix 12 μg of purified alginate lyase C and 100 μl of PBS (−) containing 26.6 μg of purified alginate lyase D and an equal amount of 2% MG alginate solution, 37 Decomposes overnight.

[Results and discussion]
FIG. 6 shows the results of allowing alginic acid-degrading enzyme C or D to act on M, G, or MG alginate. Alginate lyase C showed high degradation activity against M alginate (lane 2), but not so much degradation against G and MG alginate (lanes 3 and 4). In contrast, alginic acid lyase D showed little degradation activity for M and MG alginate (lanes 5 and 7), but high degradation activity for G alginate (lane 6). For MG alginate, high degradation activity was shown by combining alginate lyase C and alginate lyase D (lane 9).

  According to the present invention, an unsaturated uronic acid monosaccharide can be efficiently produced from alginic acid. In addition, the unsaturated monosaccharide produced by the enzyme is naturally converted to α-keto acid, and further converted to 2-keto-3-deoxygluconate (KDG) by dehydrogenase. KDG can be used in various organisms as an intermediate.

Claims (8)

An isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having at least 90 % identity with the sequence:
Here, the polypeptide has alginate lyase activity. A method for producing an unsaturated uronic acid monosaccharide comprising the following steps:
(a) providing alginic acid comprising at least two uronic acid moieties;
(b) contacting the alginic acid with the polypeptide of claim 1; and
(c) A step of keeping the mixture of alginic acid and polypeptide in the above step in the presence of water. Prior to the step (c), the method further comprises contacting the alginic acid with an isolated polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90 % identity with the sequence. The method for producing the unsaturated uronic acid monosaccharide according to claim 2,
Here, the polypeptide has alginate lyase activity. Prior to the step (c), the method further comprises contacting the alginic acid with an isolated polypeptide comprising the amino acid sequence shown in SEQ ID NO: 3 or an amino acid sequence having at least 90 % identity with the sequence. The method for producing the unsaturated uronic acid monosaccharide according to claim 2,
Here, the polypeptide has alginate lyase activity. Before the step (c), contacting the alginic acid with an isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90 % identity with the sequence; and The process according to claim 2, further comprising the step of contacting the alginic acid with the isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3 or the amino acid sequence having at least 90 % identity with the sequence. Method for producing uronic acid monosaccharide:
Here, both said polypeptides have alginate lyase activity. An isolated polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90 % identity with the sequence:
Here, the polypeptide has alginate lyase activity. A method for producing an unsaturated uronic acid monosaccharide comprising the following steps:
(a) providing alginic acid comprising at least two uronic acid moieties;
(b) contacting the alginic acid with the polypeptide of claim 6; and
(c) A step of keeping the mixture of alginic acid and polypeptide in the above step in the presence of water. Prior to the step (c), the method further comprises contacting the alginic acid with an isolated polypeptide comprising the amino acid sequence shown in SEQ ID NO: 3 or an amino acid sequence having at least 90 % identity with the sequence. The method for producing the unsaturated uronic acid monosaccharide according to claim 7,
Here, the polypeptide has alginate lyase activity.