JP5865319B2 - iRNA complex - Google Patents

Description

  The present invention relates to RNAi and related methods, eg, methods of making and using iRNA agents. The present invention includes methods and compositions for silencing genes expressed in the liver and methods and compositions for directing iRNA agents to the liver.

[Related applications]
This application is based on US Provisional Application No. 60 / 462,097 filed Apr. 9, 2003; US Provisional Application No. 60 / 461,915 filed Apr. 10, 2003; April 17, 2003. US provisional application 60 / 463,772 filed on April 25; US provisional application 60 / 465,802 filed April 25, 2003; US provisional application filed August 8, 2003 No. 60 / 493,986; U.S. Provisional Application No. 60 / 494,597 filed on Aug. 11, 2003; U.S. Provisional Application No. 60 / 506,341 filed on Sep. 26, 2003; US Provisional Application No. 60 / 518,453, filed November 7, 2003; US Provisional Application No. 60 / 469,612, filed May 9, 2003; filed October 9, 2003 US Provisional Application No. 60/5 No. 0,246; U.S. Provisional Application No. 60 / 510,318, filed October 10, 2003; U.S. Provisional Application No. 60 / 465,665, filed Apr. 25, 2003; US Provisional Application No. 60 / 462,894, filed on May 14, International Application No. PCT / US04 / 07070, filed March 8, 2004; and filed April 5, 2004 Claim the benefit of international application number [xxxxxxxx]. The contents of these applications are incorporated herein in their entirety.

[background]
RNA interference or “RNAi” is used to describe the observation that double-stranded RNA can inhibit gene expression when double-stranded RNA (dsRNA) is introduced into a nematode. (Fire) and co-researchers first created the term (Non-patent Document 1). Short dsRNA has provided gene-specific post-transcriptional silencing in many organisms, including vertebrates, and provided a novel tool for studying gene function. RNAi can be accompanied by mRNA degradation.

  Research in this area is represented by a relatively cumbersome approach to dsRNA delivery to living mammals. For example, McCarley Free et al. (Non-Patent Document 2) demonstrated the use of dsRNA to inhibit the expression of a luciferase reporter gene in mice. dsRNA was administered by the method of hydrodynamic tail vein injection (and the inhibition appeared to depend on injection of dsRNA above 2 mg / kg). The inventors have found that, among other things, cumbersome methods represented by several reported methods are not necessary to provide mammals with an effective amount of dsRNA, particularly in therapeutic amounts of dsRNA in human subjects. Found that it is not necessary to provide. Advantages of the present invention include practical and uncomplicated methods of administration and therapeutic application (eg, methods at doses below 2 mg / kg).

Fire et al., 1998, Nature 391, p. 806-811 McCaffrey et al., 2002, Nature 418, p. 38-39

  An object of the present invention is to provide compositions and methods for silencing genes expressed in the liver.

  Aspects of the invention relate to compositions and methods for silencing genes expressed in the liver, eg, to treat liver disorders or liver related disorders. The iRNA agent composition of the present invention may be modified to change the distribution so as to be preferential to the liver. The compositions of the present invention comprise an iRNA agent, eg, an iRNA agent or sRNA agent described herein.

  In one aspect, the invention features a method of reducing apoB-100 levels in a subject (eg, a mammal such as a human). The method includes administering to the subject an iRNA agent that targets apoB-100. The iRNA agent may be as described herein and may be a dsRNA that is substantially identical to a region of the apoB-100 gene. The iRNA can be less than 30 nucleotides in length, eg, 21-23 nucleotides in length. Preferably, the iRNA is 21 nucleotides in length. In one embodiment, the iRNA is 21 nucleotides in length and the double-stranded region of the iRNA is 19 nucleotides in length. In another embodiment, the iRNA is longer than 30 nucleotides.

  In preferred embodiments, the subject is treated with an iRNA agent that targets one of the sequences listed in Table 9 or 10. In preferred embodiments, the iRNA agent targets both the palindromic structure pairing sequences presented in Table 9 or 10. The most preferred targets are listed in order of preference in Table 9 or 10, in other words, more preferred targets are listed earlier in Table 9 or 10.

  In a preferred embodiment, the iRNA agent comprises a region or strand that is complementary to a pair listed in Table 9 or 10. In a preferred embodiment, the iRNA agent comprises a region complementary to the palindromic pair of Table 9 or 10 as a double stranded region.

  In preferred embodiments, the double-stranded region of the iRNA agent targets the sequence listed in Table 9 or 10, but is not completely complementary to the target sequence, eg, at least one base pair is not complementary. Preferably, the iRNA agent has no more than 1, 2, 3, 4, or 5 bases that do not hybridize to the target sequence in whole or per strand.

  An iRNA agent that targets apoB-100 can be administered in an amount sufficient to reduce the expression of apoB-100 mRNA. In one embodiment, the iRNA agent is administered in an amount sufficient to reduce the expression of apoB-100 protein (eg, at least 2%, 4%, 6%, 10%, 15%, 20%). Preferably, the iRNA agent does not reduce the expression of apoB-48 mRNA or protein. This can be done, for example, by selecting an iRNA agent that specifically targets the nucleotide undergoing RNA editing in the apoB-100 transcript.

iRNA agents targeting apoB-100 can be used to increase apoB-100 expression or otherwise undesirable apoB-100 expression, elevated cholesterol level or otherwise undesirable cholesterol level, and dysregulation of lipid metabolism Can be administered to a subject suffering from a disorder characterized by at least one of the following: An iRNA agent can also be administered to an individual at risk for the disorder to delay the onset of the disorder or symptoms of the disorder. These disorders include HDL / LDL cholesterol imbalance; dyslipidemia, eg, familial combined hyperlipidemia (FCHL), acquired hyperlipidemia; hypercholesterolemia; statin resistant high cholesterol Include coronary artery disease (CAD), coronary heart disease (CHD), and atherosclerosis. In one embodiment, an iRNA targeting apoB-100 is administered to a subject suffering from statin resistant hypercholesterolemia.

  The apoB-100 iRNA agent can be administered in an amount sufficient to reduce the level of at least one of serum LDL-C and HDL-C and at least one of total cholesterol in the subject. For example, the iRNA is administered in an amount sufficient to reduce total cholesterol in the subject by at least 0.5%, 1%, 2.5%, 5%, 10%. In one embodiment, the iRNA agent is administered in an amount sufficient to reduce the risk of myocardial infarction in the subject.

  In preferred embodiments, the iRNA agent is administered repeatedly. Administration of the iRNA agent can be performed over a range of time periods. The iRNA agent can be administered daily, once every few days, weekly, or monthly. The timing of administration can vary from patient to patient, depending on factors such as the severity of the patient's symptoms. For example, an effective dose of an iRNA agent can be administered to a patient indefinitely or once a month until the patient no longer requires treatment. In addition, sustained release compositions containing iRNA agents can be used to maintain a relatively constant dose in the patient's blood.

  In one embodiment, the iRNA agent can be directed to the liver (liver-directed) and the expression level of apoB is reduced in the liver after administration of the apoB iRNA agent. For example, an iRNA agent can be complexed with a component that targets the liver, eg, an antibody or ligand that binds to a receptor on the liver.

  iRNA agents, in particular iRNA agents that target apoB, β-catenin, or glucose-6-phosphatase RNA, eg, lipophilic moieties (eg, lipid residues, cholesterol residues, oleyl residues, retinyl residues) , Or cholesteryl residues) can be directed (liver-oriented) to the liver by binding (eg, complexing) with an iRNA agent. Other lipophilic moieties that can be coupled (eg, complexed) with iRNA agents include cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (hexadecyl) glycerol , Geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl Or phenoxazine. In one embodiment, the iRNA agent is directed to the liver (liver-directed) by binding (eg, complexing) the iRNA agent to low density lipoprotein (LDL) (eg, lactosylated LDL). Is possible). In another embodiment, the iRNA agent can be liver-directed by attaching (eg, conjugating) the iRNA agent to a polymer carrier complex having a sugar residue.

In another embodiment, the iRNA agent can be liver-directed by binding (eg, complexing) the iRNA agent to a liposome complexed with a sugar residue. Particularly useful are targeting agents that incorporate sugars (eg, at least one of galactose and analogs thereof). These targeting agents specifically target liver parenchymal cells (see Table 1). In preferred embodiments, the targeting moiety comprises a plurality, preferably two or three galactose moieties. Preferably, the targeting moiety includes, for example, three galactose moieties spaced about 15 angstroms from each other. The targeting moiety may be lactose. Lactose is glucose bound to galactose. Preferably the targeting moiety comprises three lactoses. The targeting moiety may also be N-acetyl-galactosamine, N-Ac-glucosamine. Mannose, or a targeting moiety of mannose-6-phosphate, can be used for targeting to macrophages.

  The targeting agent can be linked directly to the iRNA agent or another delivery or formulation (eg, liposome), eg, covalently or non-covalently. For example, an iRNA agent with a targeting moiety or an iRNA agent that does not include a targeting moiety can be incorporated into a delivery modality with or without a targeting moiety (eg, a liposome).

  In order to complex the iRNA targeting agent to the iRNA agent targeting apoB, β-catenin or glucose-6-phosphatase, it is particularly preferred to use iRNA complexed to a lipophilic substance.

  In one embodiment, the iRNA agent is a delivery agent, eg, a delivery agent (eg, a liposome) as described herein, that modifies the distribution to be preferentially distributed to the liver. Is modified with or bound to the delivery agent. In one embodiment, the modification mediates binding to serum albumin (SA) (eg, human serum albumin (HSA)) or a fragment thereof.

  An iRNA agent, particularly an iRNA agent that targets RNA of apoB, β-catenin, or glucose-6-phosphatase, for example, binds the iRNA agent to an SA molecule (eg, an HSA molecule) or a fragment thereof (eg, Can be directed to the liver. In one embodiment, the iRNA agent or composition thereof has an affinity for SA (eg, HSA), wherein the affinity is such that its level in the liver is in the presence of SA (eg, HSA). It is high enough to be at least 10%, 20%, 30%, 50%, or 100% larger, or to increase delivery to the liver by adding SA externally. These criteria can be measured, for example, by examining the distribution in mice in the presence or absence of exogenous mouse SA or human SA.

  The SA (eg, HSA) targeting agent can be linked directly (eg, covalently or non-covalently) to the iRNA agent or another delivery mode or formulation (eg, liposome). For example, an iRNA agent with or without a targeting moiety can be incorporated into a delivery modality with or without a targeting moiety (eg, a liposome).

  It is particularly preferred to use iRNA complexed to an SA (eg, HSA) molecule, wherein the iRNA agent is an apoB, β-catenin, or glucose-6-phosphatase iRNA targeting agent.

  In another aspect, the invention features a method for reducing glucose-6-phosphatase levels in a subject (eg, a mammal such as a human). The method includes administering to the subject an iRNA agent that targets glucose-6-phosphatase. The iRNA agent can be a dsRNA having a sequence that is substantially identical to the sequence of the glucose-6-phosphatase gene.

In preferred embodiments, the subject is an iR that targets one of the sequences listed in Table 11.
Treated with NA. In a preferred embodiment, the iRNA agent targets both sequences of the palindromic pair provided in Table 11. The most preferred targets are listed in order of preference in Table 11, in other words, more preferred targets are listed earlier in Table 11.

  In a preferred embodiment, the iRNA agent comprises a region or strand that is complementary to a pair in Table 11. In a preferred embodiment, the iRNA agent comprises a region complementary to the palindromic pair of Table 11 as a duplex.

  In a preferred embodiment, the double stranded region of the iRNA agent targets the sequence listed in Table 11, but is not completely complementary to the target sequence, eg, at least one base pair is not complementary. Preferably, the double-stranded region has no more than 1, 2, 3, 4, or 5 bases that do not hybridize to the target sequence, either in total or per strand.

  In preferred embodiments, the iRNA agent comprises an overhang, such as a 3 'or 5' overhang, preferably one or more 3 'overhangs. The overhang is discussed in detail elsewhere herein, but is preferably about 2 nucleotides in length. The overhang may be complementary to the targeted gene sequence or may be another sequence. A preferred protrusion arrangement is TT. It is also possible for the first and second sequences of the iRNA agent to be joined by, for example, an additional base to form a hairpin or by other non-basic linkers.

  Table 11 refers to sequences derived from human glucose-6-phosphatase. Table 12 refers to sequences derived from rat glucose-6-phosphatase. The sequences in Table 12 can be used, for example, in experiments using rats or rat cultured cells.

  In a preferred embodiment, the iRNA agent can have any configuration format, for example, the configuration format described herein. For example, a mode of construction that results in an iRNA agent having an overhang structure, an overall length, a hairpin structure versus a double stranded structure as described herein may be incorporated. In addition, monomers other than naturally occurring ribonucleotides may be used in the selected iRNA agent.

The iRNA targeting glucose-6-phosphatase can be administered in an amount sufficient to reduce the expression of glucose-6-phosphatase mRNA.
An iRNA targeting glucose-6-phosphatase can be administered to a subject to inhibit hepatic glucose production for the treatment of glucose metabolism related disorders such as diabetes (eg, type 2 diabetes). . An iRNA agent can be administered to an individual at risk for a disorder to delay the onset of the disorder or symptoms of the disorder.

  In other embodiments, an iRNA agent having sequence similarity to the following genes can be used to inhibit hepatic glucose production. These other genes include “forkhead homologue in rhabdomyosarcoma (FKHR)”; glucagon; glucagon receptor; glycogen phosphorylase; PPAR-γ coactivator (PGC-1); fructose-1 , 6-bisphosphatase; glucose-6-phosphate locator; glucokinase inhibitory regulatory protein; and phosphoenolpyruvate carboxykinase (PEPCK).

In one embodiment, the iRNA agent can be targeted to the liver, and the RNA expression level of the targeted gene is reduced in the liver after administration of the iRNA agent.
The iRNA agent can be those described herein and can be a dsRNA having a sequence that is substantially identical to the sequence of the target gene. The iRNA can be less than 30 nucleotides in length, for example 21-23 nucleotides. Preferably, this iRNA is 21 nucleotides long. In one embodiment, the iRNA is 21 nucleotides long and the double-stranded region of the iRNA is 19 nucleotides. In another embodiment, the iRNA is greater than 30 nucleotides in length.

  In another aspect, the invention features a method for reducing the level of β-catenin in a subject (eg, a mammal such as a human). The method includes administering to the subject an iRNA agent that targets β-catenin. The iRNA agent can be those described herein and can be a dsRNA having a sequence that is substantially identical to the sequence of the β-catenin gene. The iRNA can be less than 30 nucleotides in length, eg, 21-23 nucleotides in length. Preferably, this iRNA is 21 nucleotides long. In one embodiment, the iRNA is 21 nucleotides long and the double stranded region of the iRNA is 19 nucleotides long. In another embodiment, the iRNA is greater than 30 nucleotides in length.

  In a preferred embodiment, the subject is treated with an iRNA agent that targets one of the sequences listed in Table 13. In a preferred embodiment, the iRNA agent targets both sequences of the palindromic pair provided in Table 13. The most preferred targets are listed in order of preference in Table 13, in other words, more preferred targets are listed earlier in Table 13.

  In a preferred embodiment, the iRNA agent comprises a region or strand that is complementary to one pair in Table 13. In a preferred embodiment, the iRNA agent comprises a region complementary to the palindromic pair of Table 13 as a double stranded region.

  In a preferred embodiment, the double-stranded region of the iRNA agent targets the sequence listed in Table 13, but is not completely complementary to the target sequence, eg, at least one base pair is not complementary. Preferably, the double-stranded region has no more than 1, 2, 3, 4, or 5 bases that do not hybridize to the target sequence, either in total or per strand.

  In preferred embodiments, the iRNA agent comprises an overhang, such as a 3 'or 5' overhang, preferably one or more 3 'overhangs. The overhang is discussed in detail elsewhere herein, but is preferably about 2 nucleotides in length. The overhang may be complementary to the targeted gene sequence or may be another sequence. A preferred protrusion arrangement is TT. It is also possible for the first and second sequences of the iRNA agent to be joined by, for example, an additional base to form a hairpin or by other non-basic linkers.

  An iRNA agent that targets β-catenin can be administered in an amount sufficient to reduce expression of β-catenin mRNA. In one embodiment, the iRNA agent is administered in an amount sufficient to reduce β-catenin protein expression (eg, at least 2%, 4%, 6%, 10%, 15%, 20%). .

An iRNA agent that targets β-catenin can be administered to a subject, wherein the subject is characterized by undesirable cell proliferation in the liver or liver tissue (eg, metastatic tissue originating from the liver). Suffers from an attached disorder. Examples include benign or malignant disorders, such as cancer (eg, hepatocellular carcinoma (HCC), liver metastasis, or hepatoblastoma).

An iRNA agent can be administered to an individual at risk for a disorder to delay the onset of the disorder or symptoms of the disorder.
In preferred embodiments, the iRNA agent is administered repeatedly. Administration of the iRNA agent can be performed over a range of time periods. The iRNA agent can be administered daily, once every few days, weekly, or monthly. The timing of administration can vary from patient to patient, depending on factors such as the severity of the patient's symptoms. For example, an effective dose of an iRNA agent can be administered to a patient once per month for an indefinite period or until the patient no longer requires treatment. In addition, sustained release compositions containing iRNA agents can be used to maintain a relatively constant dose in the patient's blood.

  In one embodiment, the iRNA agent can be targeted to the liver and the expression level of β-catenin is reduced in the liver after administration of the β-catenin iRNA agent. For example, an iRNA agent can be conjugated to a component that targets the liver, eg, an antibody or ligand that binds to a receptor on the liver.

  In another embodiment, the present invention relates to liver disorders (eg, disorders characterized by undesirable cellular proliferation of the liver, hematological disorders, disorders characterized by inflammatory disorders, and metabolic or viral) A method for treating a disease or disorder) is provided. A liver proliferative disorder can be, for example, a benign or malignant disorder, such as cancer (eg, hepatocellular carcinoma (HCC), liver metastasis, or hepatoblastoma). The hematologic or inflammatory disorder of the liver can be, for example, a disorder related to clotting factors, complement-mediated inflammation, or fibrosis. Metabolic diseases of the liver include dyslipidemia and abnormal glucose regulation. Viral diseases of the liver include hepatitis C and hepatitis B. In one embodiment, a liver disorder is treated by administering one or more iRNA agents having a sequence that is substantially identical to a sequence in a gene involved in the liver disorder.

  In one embodiment, the iRNA agent for treating a liver disorder has a sequence that is substantially identical to the sequence of the β-catenin gene or the c-jun gene. In another embodiment, for example, for the treatment of hepatitis C or hepatitis B, the iRNA agent has a sequence that is substantially identical to the sequence of the gene for hepatitis C virus or hepatitis B virus, respectively. Is possible. For example, an iRNA agent can target the 5 'core region of HCV. This region is immediately downstream of the ribosomal toe-print that spans the initiating methionine. As another example, an iRNA agent of the invention can target any one of the HCV: NS3, 4A, 4B, 5A, or 5B nonstructural proteins. For the treatment of hepatitis B, for example, iRNA agents can target the X protein (HBx) gene.

  In a preferred embodiment, the subject is treated with an iRNA agent that targets one of the sequences listed in Table 14. In a preferred embodiment, the iRNA agent targets both sequences of the palindromic pair provided in Table 14. The most preferred targets are listed in order of preference in Table 14, in other words, more preferred targets are listed earlier in Table 14.

  In a preferred embodiment, the iRNA agent comprises a region or strand that is complementary to the pairs in Table 14. In a preferred embodiment, the iRNA agent comprises a region complementary to the palindromic pair of Table 14 as a double stranded region.

In a preferred embodiment, the double-stranded region of the iRNA agent targets the sequence listed in Table 14, but is not completely complementary to the target sequence, eg, at least one base pair is not complementary. Preferably, the iRNA agent has 1, 2, 3, 4, or 5 or fewer bases that do not hybridize to the target sequence, either in whole or per strand.

  In preferred embodiments, the iRNA agent comprises an overhang, such as a 3 'or 5' overhang, preferably one or more 3 'overhangs. The overhang is discussed in detail elsewhere herein, but is preferably about 2 nucleotides in length. The overhang may be complementary to the targeted gene sequence or may be another sequence. A preferred arrangement of protrusions is TT. The sequences of the first and second iRNA agents may be joined by, for example, additional bases to form a hairpin or by other non-basic linkers.

  In another embodiment, the iRNA agent can be administered to modulate blood clotting, for example, to reduce the tendency to form a clot. In a preferred embodiment, the iRNA agent targets Factor V expression, preferably in the liver. One or more iRNA agents can be used to target the wild type allele, the mutant allele (eg, the Leiden Factor V allele), or both. Such administration may treat or prevent venous thrombosis (eg, deep vein thrombosis or pulmonary embolism) or another disorder caused by elevated or undesired expression of factor V, eg, in the liver. Can be used. In one embodiment, an iRNA agent is capable of treating a subject, eg, a human having Leiden Factor V or other genetic traits associated with an undesirable tendency to form a clot.

  In preferred embodiments, administration of an iRNA agent that targets Factor V involves a second treatment, eg, treatment that reduces the tendency of blood to clot (eg, administration of heparin or low molecular weight heparin).

  In one embodiment, the iRNA agent targeting Factor V is a patient, eg, a patient with Leiden Factor V and at risk of thrombosis, eg, a patient who is scheduled to undergo surgery ( In particular, patients who are scheduled to undergo high-risk surgical procedures known to be associated with venous thrombus formation are left in a state of inactivity for a long time (e.g., flight of an automobile, train or aircraft (e.g., 3 It can be used as a preventive measure in patients who are scheduled to be left in a state of less movement with time or air travel or other trips that last longer than 5 hours. Such treatment can assist in the therapeutic use of prophylactic agents for low molecular weight (LMW) heparin.

  In another embodiment, an Factor I-targeted iRNA agent can be administered to a patient with Leiden Factor V to treat deep vein thrombosis (DVT) or pulmonary embolism (PE). is there. Such treatment can be an adjunct (or alternative) to the therapeutic use of heparin or coumadin (trade name). The treatment can be given by inhalation or generally by pulmonary administration.

  In preferred embodiments, iRNA agents administered to treat liver disorders are targeted to the liver. For example, an iRNA agent can be complexed with a targeting moiety, eg, an antibody or ligand that recognizes a receptor specific for the liver.

  The invention is also discussed in any of the genes discussed herein, particularly any of apoB-100, glucose-6-phosphatase, β-catenin, factor V, or herein. Including preparations comprising substantially pure preparations or pharmaceutically acceptable preparations of iRNA agents that silence any of the HCV genes.

  The methods and compositions of the present invention, eg, methods and compositions for treating liver diseases and disorders described herein, may be used with any of the described iRNA agents. Is possible. Furthermore, the methods and compositions of the present invention can be used for the treatment of any disease and disorder described herein and for any subject (eg, any animal, any mammal (eg, any human). )) Can be used for treatment.

  The methods and compositions of the present invention, eg, the methods and iRNA compositions for treating liver system diseases described herein, can be administered at any dose and / or formulation described herein. As well as any route of administration described herein.

  A “substantially identical” sequence is a region that has sufficient homology to the target gene so that the iRNA agent or fragment thereof can mediate down-regulation (down-regulation) of the target gene. Including a sufficient number of nucleotides. Thus, an iRNA agent is or comprises a region that is at least partially, and in some embodiments completely complementary to a target RNA transcript. Although it is not necessary for perfect complementarity to exist between the iRNA agent and the target, the correspondence between the iRNA agent and the target is such that the iRNA agent or its cleavage product is, for example, a target RNA (eg, mRNA ) RNAi cleavage must be sufficient in order to be able to lead to sequence-specific silencing. The degree of complementarity or homology with the target strand is most critical in the antisense strand. While it is often desirable to be completely complementary, particularly in the antisense strand, certain embodiments, particularly in the antisense strand, are one or more but preferably 6, 5, 4, 3, It is possible to include two or fewer mismatches (with respect to the target RNA). Mismatches are most likely to be accepted in the terminal region, especially in the antisense strand, and if present, preferably in the terminal region, eg within 6 nucleotides or 5 nucleotides in at least one of the 5 'end and the 3' end Within 4 nucleotides or 3 nucleotides. The sense strand need only be sufficiently complementary to the antisense strand to maintain the overall double-stranded nature of the molecule.

  The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and from the claims. This application incorporates all cited documents, patents, and patent applications in their entirety.

The figure which shows the structure of the base pair formation in pseudocomplementary siRNA2. Schematic diagram of a dual targeted siRNA designed to target the HCV genome. Schematic representation of pseudo-complementary and dual functional siRNA designed to target the HCV genome. General synthetic scheme for incorporating RRMS monomers into oligonucleotides. The figure which shows the table | surface of a typical RRMS support | carrier. Panel 1 shows pyrroline-based RRMS; Panel 2 shows 3-hydroxyproline-based RRMS; Panel 3 shows piperidine-based RRMS; Panel 4 shows morpholine and piperazine-based RRMS; Panel 5 shows decalin-based RRMS of is shown. R1 is succinic acid or phosphoramidate and R2 is H or a complex ligand. The figure which shows the table | surface of a typical RRMS support | carrier. Panel 1 shows pyrroline-based RRMS; Panel 2 shows 3-hydroxyproline-based RRMS; Panel 3 shows piperidine-based RRMS; Panel 4 shows morpholine and piperazine-based RRMS; Panel 5 shows decalin-based RRMS of is shown. R1 is succinic acid or phosphoramidate and R2 is H or a complex ligand. The figure which shows the table | surface of a typical RRMS support | carrier. Panel 1 shows pyrroline-based RRMS; Panel 2 shows 3-hydroxyproline-based RRMS; Panel 3 shows piperidine-based RRMS; Panel 4 shows morpholine and piperazine-based RRMS; Panel 5 shows decalin-based RRMS of is shown. R1 is succinic acid or phosphoramidate and R2 is H or a complex ligand. The figure which shows the table | surface of a typical RRMS support | carrier. Panel 1 shows pyrroline-based RRMS; Panel 2 shows 3-hydroxyproline-based RRMS; Panel 3 shows piperidine-based RRMS; Panel 4 shows morpholine and piperazine-based RRMS; Panel 5 shows decalin-based RRMS of is shown. R1 is succinic acid or phosphoramidate and R2 is H or a complex ligand. The graph which shows the blood glucose level of a mouse | mouth. (A) Graph showing blood glucose levels of mice treated with non-specific Renilla RNA or mice not treated with siRNA. Mice treated with non-specific Renilla RNA were injected on day 7. (B) Graph showing blood glucose levels in mice treated with siRNA targeting glucose-6-phosphatase. Mice treated with siRNA targeting glucose-6-phosphatase were injected on day 7. (C) A graph showing blood glucose levels in mice that have not been injected with siRNA or that have failed injection. The mice to be injected were injected on day 7. Mean blood glucose levels in 4 mice treated with siRNA targeting glucose-6-phosphatase and 4 mice treated with non-specific Renilla RNA or not treated with siRNA (triangles) Graph showing. siRNA or Renilla RNA was administered on day 7 by hydrodynamic tail vein injection. The graph which shows the level of the luciferase mRNA in the liver of CMV-Luc mouse (Xenogen) after intravenous injection (iv) of a buffer solution or siRNA into the tail vein. Each bar graph represents data from one mouse. RNA levels were quantified by the QuantiGene® assay (Genospectra, Inc., Fremont, Calif., USA) Y-axis is the chemiluminescence value expressed in counts per second (CPS) Represents. The graph which shows the level of the luciferase mRNA in the liver of a CMV-Luc mouse (Xenogen). Values are averages of the data shown in FIG. 8A. The graph which shows the pharmacokinetics of cholesterol complex type | mold siRNA and non-complexed siRNA. Diamond plots represent the amount of uncomplexed 33P-labeled siRNA (ALN-3000) in mouse plasma over time; square plots indicate 33P-labeled siRNA (ALN-3000) mice complexed with cholesterol. The amount in plasma is expressed over time. “L1163” is a term corresponding to ALN3000; “L1163Chol” is a term corresponding to ALN-3001. The amount of cholesterol complexed siRNA (dark bar graph) and the amount of uncomplexed siRNA (light bar graph) detected in the isolated whole liver tissue of mice over a period of time after tail vein injection. Graph showing. The amount of siRNA is expressed as a total dose or as a percentage of 33P-labeled siRNA delivered to the mouse. “L1163” is a term corresponding to ALN3000 (light bar graph); “L1163Chol” is a term corresponding to ALN-3001 (dark bar graph). Graph showing the amount of cholesterol complex siRNA detected in various tissues of two different CMV- mice ("Mouse 69" (light bar) and "Mouse 63" (dark bar)). Mice were injected with 50 mg / kg AL-3001 siRNA by tail vein injection, and tissues were collected 22 hours later. siRNA was detected by RNAse protection assay, and siRNA was quantified using scanning with phosphorimager ™. siRNA is expressed as the amount (μg) per gram of liver tissue. FIG. 19 shows a gel of U / U siRNA (see Table 19) detected in the liver of Balbc mice at the time point after hydrodynamic (hd) tail vein injection. U / U siRNA was injected at a concentration of 4 mg / kg. siRNA was detected by RNA protection assay. The lane labeled “standard” was loaded with purified siRNA to serve as a size and quality standard. “No injection” represents a control sample isolated from the liver of a mouse that was not injected with U / U siRNA. Control samples were further used in parallel RNAse protection assays. FIG. 6 shows a gel comparing different siRNA species detected in the liver of Balbc mice at the time point after hydrodynamic (hd) or non-hydrodynamic (iv) tail vein injection. U / U siRNA was injected by hd and iv injections. 3'C / 3'C and 3'C / U (see Table 19) were each injected at a concentration of 4 mg / kg by iv injection. siRNA was detected by RNA protection assay. The lane labeled “standard” was loaded with purified siRNA to serve as a size and quality standard. “No injection” represents a control sample isolated from the liver of a mouse that was not injected with siRNA. Control samples were further used in parallel RNAse protection assays. The graph which shows the ratio (%) of the luciferase activity in the liver extract of the CMV-Luc mouse injected with siRNA (ALN-3001). The ratio (%) of luciferase activity was defined as the ratio relative to the activity in CMV-Luc mice injected with PBS (pH 4.7). “Buffer 1 siRNA1,” “Buffer 2 siRNA2,” and “Buffer 3 siRNA3” represent the average activity observed in three separate experiments.

  Double-stranded (dsRNA) silences mRNA in a sequence-specific manner through a process known as RNA interference (RNAi). This process occurs in a wide variety of organisms including mammals and other vertebrates.

  It has been demonstrated that 21-23 nucleotide fragments of dsRNA are sequence specific mediators of RNA silencing, for example, by causing RNA degradation. Without wishing to be bound by theory, the molecular signal present in these 21-23 nucleotide fragments, merely a fragment of a particular length, recruits cellular factors that mediate RNAi. It seems to be. Methods for preparing and administering these 21-23 nucleotide fragments, and other iRNA agents, and their use to specifically inactivate gene function are described herein. The use of iRNA agents (or recombinantly produced or chemically synthesized oligonucleotides of the same or similar nature) allows the targeting of specific mRNAs for silencing in mammalian cells. In addition, longer dsRNA agent fragments can also be used, for example, as described below.

  In mammalian cells, long dsRNAs can induce interferon responses that are often detrimental, but sRNAs do not elicit an interferon response to a degree that is at least detrimental to cells and hosts. In particular, the length of the strand of the iRNA agent in the sRNA agent can be, for example, less than 31, 30, 28, 25, or 23 nucleotides, which is short enough to avoid inducing a harmful interferon response. Thus, administration of sRNA agent compositions (eg, formulated as described herein) to mammalian cells is used to suppress target gene expression while avoiding interferon responses. Is possible. Furthermore, the use of individual iRNA agents can be used to selectively target one allele of a target gene, eg, in a subject that is heterozygous for the allele.

  Further, in one embodiment, the mammalian cell is treated with an iRNA agent that affects a component of the interferon response (eg, double stranded RNA (dsRNA) activated protein kinase PKR). Such cells can be treated with a second iRNA agent that contains a sequence that is complementary to the target RNA and that otherwise has a length that could elicit an interferon response.

  In an exemplary embodiment, the subject is a mammal such as a cow, horse, mouse, rat, dog, pig, goat, or primate. The subject can be a dairy animal (eg, cow or goat) or other agricultural animal (eg, chicken, turkey, sheep, pig, fish, shrimp). In a much more preferred embodiment, the subject is a human, eg, a normal individual, or an individual who has, is diagnosed with, or is predicted to have a disease or disorder.

  Furthermore, silencing mediated by an iRNA agent persists for several days after administration of the iRNA agent composition, so in many cases less than once per day, or as an example, for the entire treatment plan It is possible to administer the composition only once. For example, treatment of certain cancer cells can be performed by a single bolus administration, whereas chronic viral infections are administered regularly, eg once a week or once a month. It may be necessary.

  A number of exemplary delivery routes are described that can be used to administer an iRNA agent to a subject. Further, iRNA agents can be formulated according to the exemplary methods described herein.

Liver Disease Exemplary diseases and disorders that can be treated by the methods and compositions of the present invention are diseases of the liver system.

  Disorders involving the liver include, but are not limited to: liver trauma; jaundice and cholestasis (eg, bilirubin and bile formation); liver failure and cirrhosis (eg, cirrhosis, portal hypertension (ascites) Including), portal vein venous shunts, and splenomegaly); infectious disorders such as viral hepatitis (infection with hepatitis A to E and other hepatitis viruses, clinicopathological syndromes (eg, carrier status) ), Asymptomatic infections, including acute viral hepatitis, chronic viral hepatitis, and fulminant hepatitis); autoimmune hepatitis; drug and toxin-induced liver disease (eg, alcoholic liver disease); Abnormal and childhood liver disease (eg, hemochromatosis, Wilson's disease, a1 antitrypsin deficiency, and neonatal hepatitis); intrahepatic bile duct disease (eg, secondary biliary cirrhosis, Primary biliary cirrhosis, primary sclerosing cholangitis, and biliary abnormalities); circulatory disorders (eg, impaired blood flow into the liver (including hepatic arterial disorders and portal vein obstruction and thrombosis), liver Impaired blood flow through (including passive congestion and central lobular necrosis and liver purpura), impaired hepatic venous outflow (including hepatic venous thrombosis (Bud Chiari syndrome) and hepatic venous obstruction)); pregnancy related Liver disease (eg, preeclampsia and eclampsia, gestational acute fatty liver, and gestational intrahepatic cholestasis); liver complications of organ or bone marrow transplantation (eg, drug toxicity after bone marrow transplantation, versus host transplantation) Non-immunological damage to liver disease and liver allografts); tumors and tumor conditions (eg, nodular hyperplasia, adenomas, and malignant tumors (including primary liver cancer and metastatic tumors)) .

An iRNA agent can also be administered to inhibit the expression of factor V in the liver. 2-5% of the US population is heterozygous for an allele of the Factor V gene encoding a single amino acid change at position 1961. These heterozygous individuals have a 3-8 fold higher risk of venous thrombosis, a risk associated with increased factor V activity. This increase in activity results in an increase in thrombin generation from the prothrombinase complex. An iRNA agent directed against Factor V can treat or prevent venous thrombosis, or can treat humans with Leiden Factor V. An iRNA agent that targets factor V can also be used as a prophylactic agent in patients with Leiden factor V undergoing high-risk surgery, and this prophylactic agent is a treatment for a low molecular weight (LMW) heparin prophylactic agent. Can be an adjunct to general use.

  An iRNA agent that targets factor V can also be administered to patients with Leiden factor V to treat deep vein thrombosis (DVT) or pulmonary embolism (PE). Such treatment can be an adjunct to the therapeutic use of heparin or coumadin. Any other disorder caused by elevated levels of Factor V or undesirable levels of Factor V can be treated by administering an iRNA agent that targets Factor V.

The iRNA agent of the present invention can target any gene whose overexpression is associated with liver disease.
Targeting iRNA Agents to the Liver The iRNA agents of the present invention are particularly useful when directed to the liver. An iRNA agent can be liver-directed by a composition comprising an iRNA agent and a liver targeting agent. For example, the liver targeting agent can be a lipophilic moiety. Preferred lipophilic moieties include lipid, cholesterol, oleyl, retinyl, or cholesteryl residues (see Table 1). Other lipophilic moieties that can function as liver targeting agents include cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (hexadecyl) glycerol, geranyloxyhexyl group , Hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl, or phenoxazine included.

  An iRNA agent can also be liver-directed by binding to low density lipoprotein (LDL) (eg, lactosylated LDL). A polymer carrier complexed with a sugar residue can also act to render the iRNA agent tropic.

  Targeting agents that incorporate sugars (eg, galactose and / or analogs thereof) are particularly useful. These targeting agents specifically target liver parenchymal cells (see Table 1). For example, the targeting moiety can comprise a plurality, preferably two or three galactose moieties, spaced about 15 angstroms from each other. This targeting moiety may alternatively be lactose (eg, three lactose moieties), which is glucose conjugated to galactose. The targeting moiety may also be N-acetyl-galactosamine, N-Ac-glucosamine. The targeting moiety of mannose or mannose-6-phosphate can be used to target macrophages.

Complexation of an iRNA agent with serum albumin (SA) (eg, human serum albumin) can also be used to make the iRNA agent liver-directed.
iRNA agents can target specific cell types within the liver by using specific targeting agents that recognize specific receptors in the liver. Exemplary targeting moieties and their associated receptors are presented in Table 1.

Structure of iRNA Agents Isolated iRNA agents that mediate RNAi (eg, RNA molecules (double stranded; single stranded)) are described herein. The iRNA agent suitably mediates RNAi in association with the subject's endogenous gene or pathogen gene.

  An “RNA agent”, as used herein, is an unmodified RNA, modified RNA, or nucleoside surrogate, all of which are defined herein (eg, referred to as RNA agents below) See the section on title). A number of modified RNAs and nucleoside surrogates are described, but preferred examples include those that are more resistant to nuclease degradation than unmodified RNA. Preferred examples include 2 ′ sugar modifications, modifications at single stranded overhangs (preferably 3 ′ single stranded overhangs), or, particularly in the case of single stranded, one or more phosphate groups or one or more Those having 5 'modifications including phosphate group analogs are included.

An “iRNA agent” as used herein can be cleaved into an RNA agent that is capable of down-regulating the expression of a target gene, preferably an endogenous or pathogen target RNA. Is an RNA agent. While not wishing to be bound by theory, iRNA agents act by one or more of a number of mechanisms, including post-transcriptional cleavage of target mRNA, sometimes referred to in the art as RNAi, or pre-transcriptional or pre-translational mechanisms. Is possible. An iRNA agent can include a single strand, or can include one or more strands, for example, an iRNA agent can be a double-stranded iRNA agent. iRN
When agent A is single-stranded, it is particularly preferred to include a 5 ′ modification that includes one or more phosphate groups or one or more analogs of phosphate groups.

  The iRNA agent includes a region of sufficient homology to the target gene and is long enough in nucleotides so that the iRNA agent or fragment thereof can mediate down-regulation of the target gene Should. (For simplicity of description, the term nucleotide or ribonucleotide may be used herein to refer to one or more monomer subunits of an RNA agent. As used herein, “ribonucleotide” or “nucleotide”, in the case of modified RNA or nucleotide surrogates, can also mean modified nucleotides, or moieties substituted with surrogates at one or more positions. Thus, an iRNA agent is, or in some embodiments, is a region that is, or includes, a region that is complementary to the target RNA, at least in part. Although it is not necessary for perfect complementarity between the iRNA agent and the target to exist, the coincidence is that the iRNA agent or its cleavage product is sequenced by, for example, RNAi cleavage of the target RNA (eg, mRNA). It must be sufficient to be able to specifically silence.

  The degree of complementarity or homology with the target strand is most critical in the antisense strand. In particular, perfect complementarity in the antisense strand is often desirable, but certain embodiments are one or more, but preferably 6, 5, 4, 3, 2, especially in the antisense strand. , Or fewer mismatches (with respect to the target RNA). In particular, mismatches in the antisense strand are most tolerated in the terminal region, and if present, preferably in the terminal region, for example, within 6 nucleotides within the 5 ′ end and / or 3 ′ end, within 5 nucleotides, within 4 nucleotides Or within 3 nucleotides. The sense strand need only be complementary to the antisense strand sufficient to maintain the overall duplex nature of the molecule.

  As discussed elsewhere herein, iRNA agents are often modified or include nucleoside surrogates in addition to RRMS. Single-stranded regions of iRNA agents are often modified or contain nucleoside surrogates, eg, unpaired regions of the hairpin structure (eg, the region connecting two complementary regions) are modified or nucleoside You can have a substitute. Also preferred are modifications to stabilize one or more 3 'or 5' ends of the iRNA agent, eg, against exonucleases, or to put an antisense sRNA agent preferentially into the RISC. Modifications include C3 (or C6, C7, C12) amino linker, thiol linker, carboxyl linker, non-nucleotide spacer (C3, C6, C9, C12, abasic, triethylene glycol, hexaethylene glycol), special biotin, Alternatively, it is possible to include a fluorescein reagent provided as a phosphoramidite and having another DMT protected hydroxyl group, allowing multiple couplings during RNA synthesis.

iRNA agents include the following: by molecules that are long enough to elicit an interferon response (this is Dicer, Bernstein et al., 2001. Nature, 409: 363-366). Cleaved and enters RISC (RNAi-induced silencing complex); and a molecule that is short enough not to elicit an interferon response (this molecule can also be cleaved by Dicer and / or Eg, molecules that are sized to allow entry into the RISC, eg, molecules similar to Dicer cleavage products. A sufficiently short molecule that does not elicit an interferon response is referred to herein as an sRNA agent or a short iRNA agent. “SRNA agent or short iRNA agent” as used herein refers to an iRNA agent, eg, a sufficiently short double-stranded RNA agent or single-stranded RNA agent that does not induce a deleterious interferon response in human cells. For example, the RNA agent has a double-stranded region of less than 60 nucleotide pairs, but preferably less than 50, 40, or 30 nucleotide pairs. The sRNA agent or cleavage product thereof can down-regulate the target gene, for example, by inducing RNAi with respect to the target RNA (preferably endogenous or pathogenic target RNA).

  Each strand of the sRNA agent can be up to 30, 25, 24, 23, 22, 21, or 20 nucleotides in length. The strand is preferably at least 19 nucleotides in length. For example, each strand can be between 21 and 25 nucleotides long. Preferred sRNA agents are 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs of duplexes, and one or more overhangs, preferably one or two of 2-3 nucleotides Has a 3 'overhang.

In addition to homology to the target RNA and the ability to down-regulate the target gene, iRNA agents preferably have one or more of the following properties:
(1) is of Formula 1, Formula 2, Formula 3, or Formula 4 shown in the section “RNA Agents” below;
(2) if it is single stranded, it has a 5 ′ modification comprising one or more phosphate groups or one or more phosphate group analogs;
(3) Homologous enough to allow accurate base pairing despite the modification of a large number or all nucleosides, eg sufficient to allow target down-regulation by cleavage of the target RNA Having an antisense strand capable of providing a base (or modified base) in the correct three-dimensional structure so that a double-stranded structure can be formed with a target RNA of choice;
(4) Despite the modification of a very large number or all nucleosides, it still has “RNA-like” properties. That is, it has the overall structure, chemical properties and physical properties of the RNA molecule, even though the content based on ribonucleotides is not exclusive or even partial. For example, an iRNA agent can include, for example, a sense strand and / or an antisense strand where all nucleotide sugars contain, for example, 2 ′ fluoro instead of 2 ′ hydroxyl. This deoxyribonucleotide-containing agent can still be expected to exhibit RNA-like properties. Without wishing to be bound by theory, electronegative fluorine tends to be axially oriented when bound to the C2 ′ position of ribose. This spatial preference of fluorine, in turn, causes a depression to form inside the sugar C ₃ '. This is a dent-forming mode similar to that observed in RNA molecules, resulting in an A family type helix characteristic of RNA. Furthermore, because fluorine is a good hydrogen bond acceptor, it can participate in the same hydrogen bond interactions as water molecules known to stabilize RNA structures. In general, it is preferred that the moiety modified at the 2 ′ position of the sugar is capable of entering an H bond that is characteristic of the OH moiety of ribonucleotides rather than the H moiety of deoxyribonucleotides. Preferred iRNA agents are: C ₃ 'indented inside the sugar, or at least 50, 75, 80, 85, 90, or 95% of the sugar; C ₃ ' in a sufficient amount of sugar of the iRNA agent It is possible to produce an A-family type helix characteristic of RNA, indicating an internal recess; 20, 10, 5, 4, 3, 2, no C ₃ 'internal recess Or has no more than one sugar. These restrictions are particularly preferred in the antisense strand;
(5) Regardless of the nature of the modification, and even if the RNA agent can contain deoxynucleotides or modified deoxynucleotides, particularly in the overhang or other single stranded region, Any molecule that is greater than 50, 60, or 70% of the nucleotides in the sequence, or more than 50, 60, or 70% of the nucleotides in the double-stranded region is a deoxyribonucleotide, or a modified deoxyribonucleotide that is deoxy at the 2 'position Is preferably excluded from the definition of RNA agent.

A “single-stranded iRNA agent”, as used herein, is an iRNA agent that is made from a single molecule. This may include a double stranded region formed by intrastrand pairing, for example, the region may or may include a hairpin structure or a pan-handle structure. The single stranded iRNA agent is preferably antisense with respect to the target molecule. In preferred embodiments, the single stranded iRNA agent is 5 ′ phosphorylated or comprises a phosphoryl analog at the 5 ′ prime terminus. 5 'phosphate modifications include those that are compatible with RISC-mediated gene silencing. Suitable modifications include: 5 ′ monophosphate ((HO) 2 (O) P—O-5 ′); 5 ′ diphosphate ((HO) 2 (O) P—O—P ( HO) (O) -O-5 ');5' triphosphate ((HO) 2 (O) PO- (HO) (O) PO-OP (HO) (O) -O-5 ');5' guanosine cap (7-methylated or unmethylated) (7m-GO-5 '-(HO) (O) PO- (HO) (O) PO-OP (HO) ) (O) -O-5 ′); 5 ′ adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N—O-5 ′-(HO) (O) PO— (HO)) (O) P—O—P (HO) (O) —O-5 ′); 5 ′ monothiophosphoric acid (phosphorothioate; (HO) 2 (S) P—O-5 ′); 5 ′ monodithiophosphoric acid ( Phosphorodithioate; (HO) (H ) (S) P—O-5 ′), 5 ′ phosphorothiolic acid ((HO) 2 (O) PS—5 ′); oxygen / sulfur substituted monophosphate, diphosphate, and triphosphate Any further combination of (for example, 5′-α-thiotriphosphate, 5′-γ-thiotriphosphate, etc.), 5 ′ phosphoramidate ((HO) 2 (O) P—NH-5 ′ , (HO) (NH2) (O) PO-5 ′), 5 ′ alkylphosphonic acid (R = alkyl = methyl, ethyl, isopropyl, propyl, etc., for example, RP (OH) (O) —O-5 '-, (OH) 2 (O) P-5'-CH2), 5' alkyl ether phosphonic acid (R = alkyl ether = methoxymethyl (MeOCH2-), ethoxymethyl, etc., for example, RP (OH) (O) -O-5'-). (These modifications can also be used with the antisense strand of a double-stranded iRNA.)
A single-stranded iRNA agent should be long enough so that it can enter the RISC and can participate in RISC-mediated cleavage of the target mRNA. Single stranded iRNA agents are at least 14 nucleotides in length, and more preferably at least 15, 20, 25, 29, 35, 40, or 50 nucleotides in length. Single stranded iRNA agents are preferably less than 200, 100, or 60 nucleotides in length.

  Hairpin iRNA agents are equal to 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs, or at least 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotides It has a pair of double stranded regions. The length of this double stranded region is preferably no more than 200, 100, or 50 nucleotide pairs. Preferred ranges for the double stranded region are 15-30, 17-23, 19-23, and 19-21 nucleotide pairs long. The hairpin preferably has a single-stranded overhang or unpaired region at the end (preferably the 3 'end, preferably on the antisense side of the hairpin). Preferred overhangs are 2-3 nucleotides long.

  A “double stranded (ds) iRNA agent”, as used herein, is more than one strand, preferably capable of forming a double stranded structure by hybridization between strands, preferably An iRNA agent containing two strands.

  The antisense strand of the double-stranded iRNA agent is equal to 14, 15, 16, 17, 18, 19, 25, 29, 40, or 60 nucleotides in length, or at least 14, 15, 16, 17, 18, 19 25, 29, 40, or 60 nucleotides in length. This should be no more than 200, 100, or 50 nucleotides in length. Preferred ranges are 17-25, 19-23, and 19-21 nucleotides in length.

  The sense strand of the double stranded iRNA agent is equal to 14, 15, 16, 17, 18, 19, 25, 29, 40, or 60 nucleotides in length, or at least 14, 15, 16, 17, 18, 19, Should be 25, 29, 40, or 60 nucleotides in length. This should be no more than 200, 100, or 50 nucleotides in length. Preferred ranges are 17-25, 19-23, and 19-21 nucleotides in length.

  The double stranded portion of the double stranded iRNA agent is equal to 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 60 nucleotide pairs in length, or It should be at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 60 nucleotide pairs long. This should be no more than 200, 100, or 50 nucleotide pairs in length. Preferred ranges are 15-30, 17-23, 19-23, and 19-21 nucleotide pairs long.

  In many embodiments, the ds iRNA agent is large enough so that it can be cleaved by an endogenous molecule (eg, by Dicer) to produce a smaller ds iRNA agent (eg, an sRNA agent).

  It may be desirable to modify one or both of the antisense strand and the sense strand of a double stranded iRNA agent. In some cases, these strands have the same modification or the same class of modifications, while in other cases the sense and antisense strands have different modifications, eg, in some cases only the sense strand is modified. It is desirable. It may be desirable to modify only the sense strand, for example to inactivate the sense strand, eg the sense strand inactivates the sense strand and prevents the formation of active sRNA / protein or RISC Can be modified to This can be achieved by modifications that interfere with 5 ′ phosphorylation of the sense strand, for example by modification with 5′-O-methyl ribonucleotides (Nykaenen et al., (2001). ) "ATP requirements and small interfering RNA structure in the RNA interference pathway." Cell 107, 309-321). Other modifications that interfere with phosphorylation can also be used, for example, simply replacing 5'OH with H rather than O-Me. As an alternative, a large bulky group may be added to the 5 ′ phosphate group, which may be converted to a phosphodiester bond, which causes the phosphodiesterase to cleave such a bond and remove the functional sRNA 5 ′ end. Since it can be liberated, it may be less desirable. Antisense strand modifications include 5 'phosphorylation as well as any of the other 5' modifications discussed herein, particularly the 5 'modifications discussed above in the section on single-stranded iRNA molecules.

It is preferred that the sense and antisense strands are selected such that the ds iRNA agent includes a single stranded region or unpaired region at one or both ends of the molecule. Therefore, ds
The iRNA agent is preferably paired sense and antisense strands to include overhangs (eg, one or two 5 ′ or 3 ′ overhangs, but preferably 2-3 nucleotide 3 ′ overhangs). including. Many embodiments have a 3 'overhang. Preferred sRNA agents have a single stranded overhang, preferably a 3 'overhang at the end of each nucleotide, preferably 1 or 2 or 3 nucleotides long. This overhang may be the result of one strand being longer than the other, or it may be the result of two strands of the same length with a shift. The 5 ′ end is preferably phosphorylated.

Preferred lengths for the double stranded region are, for example, between 15 and 30 nucleotide lengths, most preferably 18, 19, 20, 21, 22, and 23 nucleotides in the range of sRNA agents discussed above. is there. sRNA agents may be similar in length and structure to natural Dicer processed products from long dsRNA. Also included are embodiments in which the two strands of the sRNA agent are joined (eg, covalently joined). Hairpins, or other single stranded structures that provide the required double stranded regions, and preferably 3 ′ overhangs are also within the scope of the invention.

  Isolated iRNA agents described herein, including ds iRNA agents and sRNA agents, are capable of mediating silencing of transcripts of target RNA, eg, mRNA, eg, genes encoding proteins. . For convenience, such mRNA is also referred to herein as silenced mRNA. Such a gene is also referred to as a target gene. In general, the RNA to be silenced is an endogenous gene or a pathogen gene. It is also possible to target RNA other than mRNA, for example tRNA and viral RNA.

  As used herein, the phrase “mediates RNAi” refers to the ability to silence a target RNA in a sequence specific manner. Without wishing to be bound by theory, it is believed that silencing uses RNAi mechanisms or processes and guide RNA (eg, 21-23 nucleotide sRNA agents).

  As used herein, “specifically hybridizable” and “complementary” are sufficient such that stable and specific binding occurs between a compound of the invention and a target RNA molecule. A term used to indicate a certain degree of complementarity. Specific binding is an oligomer under conditions where specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatments or under conditions under which the assay is performed in the case of in vitro assays. A sufficient degree of complementarity is required to avoid nonspecific binding of compounds to non-target sequences. Non-target sequences generally differ by at least 5 nucleotides.

  In one embodiment, the iRNA agent is “sufficiently complementary” to the target RNA (eg, target mRNA) such that the iRNA agent silences the production of the protein encoded by the target mRNA. In another embodiment, the iRNA agent is “strictly complementary” to the target RNA (excluding the RRMS-containing subunit), eg, the target RNA and iRNA agent are preferably strictly complementary. Anneal to form a hybrid composed exclusively of Watson-Crick base pairs in the region. A “sufficiently complementary” target RNA can include an internal region (eg, a region of at least 10 nucleotides) that is exactly complementary to the target RNA. Furthermore, in certain embodiments, iRNA agents specifically distinguish single nucleotide differences. In this case, an iRNA agent mediates RNAi only if strict complementarity is found in a single nucleotide difference region (eg, a region within 7 nucleotides).

  As used herein, the term “oligonucleotide” refers to a nucleic acid molecule (RNA or DNA), preferably less than 100, 200, 300, or 400 nucleotides in length.

RNA agents discussed herein include otherwise unmodified RNA, as well as, for example, RNA modified to improve efficacy, and polymers of nucleoside surrogates. Unmodified RNA is a molecule in which the nucleic acid components, i.e. sugar, base, and phosphate moieties, are naturally occurring, preferably the same or substantially the same as naturally occurring in the human body. Say. The art refers to rare or uncommon but naturally occurring RNA, such as modified RNA, such as Limbach et al. (1994) Summary: the modified nucleosides of RNA. Nucleic Acids Res. 22: 2183-2196. Such rare or uncommon RNAs, often referred to as modified RNAs (obviously because it is generally due to the result of post-transcriptional modification), are used in the term “unmodified” as used herein. Within the scope of “RNA”. Modified RNA, as used herein, is one in which one or more nucleic acid components, ie sugar, base, and phosphate moieties, are different from those that exist in nature, preferably present in the human body. And a different molecule. These are referred to as modified “RNAs”, but of course will include molecules that are not RNA because they are modified. A nucleoside surrogate is a molecule in which the ribophosphate backbone is replaced with a non-ribophosphate construct that allows bases to be presented in the correct spatial association, so that hybridization is the case with a ribophosphate backbone. (Eg, uncharged mimics of the ribophosphate backbone). All the above examples are discussed herein.

  Much of the discussion below refers to single-stranded molecules. In many embodiments of the invention, double-stranded iRNA agents (eg, partially double-stranded iRNA agents) are required or preferred. Thus, a double-stranded structure made from the single-stranded structure described below (eg, when two separate molecules come into contact to form a double-stranded region, or a double-stranded region is an intramolecular pairing ( For example, it is understood that (when formed by a hairpin structure) is included within the scope of the present invention. Preferred lengths are described elsewhere in this specification.

  Since nucleic acids are subunit or monomeric polymers, many of the modifications described below are present at repeated positions in the nucleic acid (eg, bases, or phosphate moieties, or unbound O of phosphate moieties). Qualification). In some cases, the modifications are present at all of the positions of interest in the nucleic acid, but in many and practically not the case. By way of example, a modification may be present only at the 3 ′ or 5 ′ end, and only at the terminal region (eg, terminal nucleotide position or last 2, 3, 4, 5, or 10 nucleotides in the chain) there's a possibility that. The modification may be present in the double stranded region, the single stranded region, or both. The modification may be present only in the double stranded region of the RNA or may be present only in the single stranded region of the RNA. For example, phosphorothioate modifications at unbound O-positions may be present only at one end or at both ends, or at the terminal region (eg, at a position on the terminal nucleotide or at the last 2, 3, 4 5 or 10 nucleotides), or double and single stranded regions, particularly at the ends. It is also possible that the 5 'end (one or both) is phosphorylated.

  In certain embodiments, at a single stranded overhang (eg, a 5 ′ or 3 ′ overhang, or both), for example, to enhance stability, include a specific base in the overhang, or a modified nucleotide Alternatively, it is particularly preferred to include nucleotide surrogates. For example, it may be desirable to include purine nucleotides in the overhang. In certain embodiments, all or some of the bases in the 3 'or 5' overhang are modified using, for example, the modifications described herein. Modifications include, for example, the use of modifications at the 2′OH group of ribose sugars, such as the use of deoxyribonucleotides (eg, deoxythymidine) instead of ribonucleotides, and modifications in phosphate groups (eg, phosphothioate modifications). ) May be included. The overhang need not be homologous to the target sequence.

  Modifications and nucleotide surrogates are discussed below.

  The backbone presented above in Formula 1 represents a portion of ribonucleic acid. The basic components are ribose sugar, base, terminal phosphate, and internucleotide phosphate linker. The base is a naturally occurring base (eg, adenine, uracil, guanine, or cytosine), the sugar is an unmodified 2 ′ hydroxyl ribose sugar (as shown), and W, X, and Z are all O Yes, Formula 1 represents a naturally occurring unmodified oligoribonucleotide.

  Unmodified oligoribonucleotides may not be optimal in certain applications, for example, unmodified oligoribonucleotides may tend to undergo degradation by, for example, cellular nucleases. Nucleases can hydrolyze phosphodiester bonds in nucleic acids. However, chemical modifications to one or more of the above RNA components can impart improved properties, for example, making oligoribonucleotides more stable to nucleases. Unmodified oligoribonucleotides may also be less than optimal in terms of providing a tethering moiety for binding a ligand or other moiety to the iRNA agent.

Modified nucleic acids and nucleotide surrogates can include one or more of the following:
(I) changes, eg, substitution of one or both of unbound phosphate oxygen (X and Y), and / or one or more substitutions of bound phosphate oxygen (W and Z) (phosphate is in terminal position) In some cases, one of positions W or Z does not bind a phosphate to an additional element in a naturally occurring ribonucleic acid, but for simplicity of terminology, 5 of the nucleic acid, unless otherwise noted. 'The W position at the end and the Z position at the 3' end of the nucleic acid are within the scope of the term “bound phosphate oxygen” as used herein);
(Ii) changes, eg, replacement of a component of a ribose sugar (eg, a 2 ′ hydroxyl on the ribose sugar), or a structure of the ribose sugar other than ribose (eg, as described herein) Large-scale replacement with
(Iii) large-scale substitution of the phosphate moiety (bracket I) with a “dephospho” linker;
(Iv) modification or substitution of naturally occurring bases;
(V) substitution or modification of the ribose-phosphate backbone (bracket II);
(Vi) Modification of the 3 ′ or 5 ′ end of RNA, such as removal, modification, or substitution of a terminal phosphate group, or attachment of a component (eg, to either the 3 ′ end or 5 ′ end of RNA) Of fluorescent labeling moiety).

  The terms “substitution”, “modification”, “change” and the like, as used in this context, do not imply any step limitations, eg, modification refers to standard or naturally occurring ribonucleic acid. Does not mean that it must be started and modified to produce a modified ribonucleic acid, "modified" simply means the difference from a naturally occurring molecule.

  Of course, it is not possible to fully represent the actual electronic structure of a chemical entity by only one standard type (ie, the Lewis structure). Without wishing to be bound by theory, the actual structure may instead be a mixture or weighted average of two or more standard types, collectively known as resonant types or resonant structures. Resonant structures exist only on paper, not individual chemical entities. They differ from each other only in the arrangement or “localization” of bonded and nonbonded electrons for a particular chemical entity. It may be possible for one resonant structure to contribute to the hybrid to a greater extent than the other. Accordingly, the descriptions and illustrations of the embodiments of the present invention are made in terms of what is recognized in the art as the primary resonance type for a particular type of entity. For example, any phosphoramidate (substitution of non-bonded oxygen with nitrogen) is represented by X = O and Y = N in the above figure.

Certain modifications are discussed in more detail below.
Phosphate group The phosphate group is a negatively charged group. The charge is uniformly distributed across the two non-bonded oxygen atoms (ie, X and Y in Formula 1 above). However, the phosphate group can be modified by substituting one oxygen with a different substituent. One consequence of such modifications to the RNA phosphate backbone may be an increase in the resistance of the oligoribonucleotides to nuclease degradation. Thus, while not wishing to be bound by theory, it may be desirable in some embodiments to introduce changes that result in either an uncharged linker or a charged linker having an asymmetric charge distribution. .

  Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, phosphonate hydrogens, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioate has both unbound oxygens replaced with sulfur. Unlike the situation where only one of X or Y is changed, the phosphorus center in phosphorodithioate is achiral, which prevents the formation of oligoribonucleotide diastereomers. Diastereomer formation can produce preparations in which individual diastereomers exhibit varying resistance to nucleases. Furthermore, the hybridization affinity of RNA containing chiral phosphate groups may be low compared to the corresponding unmodified RNA species. Thus, without wishing to be bound by theory, modifications to both X and Y that remove chiral centers (eg, phosphorodithioate formation) are not capable of producing a diastereomeric mixture. In this sense, it may be desirable. Thus, X can be any one of S, Se, B, C, H, N, or OR (R is alkyl or aryl). Thus, Y can be any one of S, Se, B, C, H, N, or OR (R is alkyl or aryl). Substitution with at least one of X and Y is preferred.

  The phosphate linker is modified by substitution of the attached oxygen (ie, W or Z in Formula 1) with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylenephosphonate). It is also possible. This substitution can occur at the terminal oxygen (position W (3 ') or position Z (5')). Substitution of W with carbon or substitution of nitrogen with Z is preferred.

Candidate agents can be evaluated for suitability as described below.
Sugar group-modified DNA can contain all or some modifications of the sugar group of the ribonucleic acid. For example, the 2 ′ hydroxyl group (OH) can be modified or substituted with a number of different “oxy” or “deoxy” substituents. Without being bound by theory, enhanced stability is expected because the hydroxyl is no longer deprotonated to form the 2 ′ alkoxide. The 2 ′ alkoxide can catalyze degradation by intramolecular nucleophilic attack on the linker phosphorus atom. Again, while not wishing to be bound by theory, it may be desirable for certain embodiments to introduce changes that do not allow alkoxide formation at the 2 ′ position.

Examples of “oxy” -2 ′ hydroxyl group modifications include: alkoxy or aryloxy (OR, eg, R═H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol ( PEG), O (CH ₂ CH ₂ O) _n CH ₂ CH ₂ OR; a “locked” nucleic acid in which the 2 ′ hydroxyl is connected to the 4 ′ carbon of the same ribose sugar, for example by a methylene bridge ( LNA); O-AMINE (AMINE = NH 2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino) and aminoalkoxy, O _{(CH 2) n} AMINE, (eg AMI NE = NH ₂ ; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino). It is noteworthy that oligonucleotides containing only methoxyethyl groups (MOE), (OCH ₂ CH ₂ OCH ₃ , PEG derivatives) show comparable nuclease stability to those modified with a robust phosphorothioate modification. .

“Deoxy” modifications include: hydrogen (ie, deoxyribose sugar, which is particularly relevant in part to the overhang of ds RNA); halo (eg, fluoro); amino (eg, NH ₂ ; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino _{acid,); NH (CH 2 CH} 2 NH) n CH 2 CH 2 -AMINE (AMINE = NH 2; alkyl Amino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino), NHC (O) R (R = alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano; Mercapto; Archi - thio - alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl (which optionally example, may be substituted with amino functionality). Preferred substituents are 2'-methoxyethyl, 2'-OCH3, 2'-O-allyl, 2'-C-allyl, and 2'-fluoro.

  A sugar group can also contain one or more carbons that have the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, a modified RNA can include, for example, a nucleotide that includes arabinose as a sugar.

Modified RNAs can also include “abasic” sugars that lack nucleobases in C-1 ′. These abasic sugars can also contain further modifications at one or more atoms of the constituent sugars.

  To maximize nuclease resistance, the 2 'modification can be used in combination with one or more phosphate linker modifications (eg, phosphorothioate). So-called “chimeric” oligonucleotides contain two or more different modifications.

  Modifications can also involve large-scale substitution with another entity of the ribose structure at one or more sites of the iRNA agent. These modifications are described in the section entitled Ribose substitution for RRMS.

Candidate modifications can be evaluated as described below.
Phosphoric Group Substitution Phosphoric groups can be substituted by connections including other than phosphoric acid (see bracket I in Formula 1 above). Without wishing to be bound by theory, since the charged phosphodiester group is the reactive center in nuclease degradation, replacing this group with a neutral structural mimetic should confer enhanced nuclease stability. It is believed that. Again, while not wishing to be bound by theory, in some embodiments it may be desirable to introduce changes in which the charged phosphate group is replaced by a neutral moiety.

  Examples of moieties that can replace the phosphate group include: siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioform acetal, form acetal, Oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino. Preferred substitutions include a methylenecarbonylamino group and a methylenemethylimino group.

Candidate modifications can be evaluated as follows.
Replacement of the ribonic acid backbone It is also possible to construct an oligonucleotide mimetic backbone in which the phosphate linker and ribose sugar are replaced by a nuclease-resistant nucleoside or nucleotide surrogate (see bracket II in formula 1 above). ). Without wishing to be bound by theory, it is believed that the absence of repetitively charged backbones reduces binding to proteins that recognize polyanions (eg, nucleases). Again, without wishing to be bound by theory, it may be desirable in some embodiments to introduce changes in which the base is linked by a neutral surrogate backbone.

  Examples include nucleoside substitutes such as mophilino, cyclobutyl, pyrrolidine, and peptide nucleic acids (PNA). A preferred substitute is a PNA substitute.

Candidate modifications can be evaluated as described below.
Terminal Modifications The 3 ′ and 5 ′ ends of the oligonucleotide can be modified. Such modifications can be made at the 3 ′ end, 5 ′ end, or both ends of the molecule. The modification can include modification or substitution of the entire terminal phosphate or one or more atoms of the terminal phosphate group. For example, the 3′-end and 5′-end of the oligonucleotide may have other functional molecular entities such as labeling moieties (eg, fluorophores such as pyrene, TAMRA, fluorescein, Cy3 dye or Cy5 dye) or protecting groups (eg, sulfur , Silicon, boron, or an ester-containing group). The functional molecular entity can be linked to a sugar via a phosphate group and / or a spacer. The terminal atom of the spacer can connect or replace the bonding atom of the phosphate group or the C-3 ′ or C-5 ′ O, N, S, or C group of the sugar. Alternatively, the spacer can connect or replace a terminal atom of a nucleotide surrogate (eg, PNA). These spacers or linkers can include _{e.g., - (CH 2) n -} , - (CH 2) n N -, - (CH 2) n O -, - (CH 2) n S-, O (CH 2 CH 2 O) _n CH ₂ CH ₂ OH (eg n = 3 or 6), abasic sugar, amide, carboxy, amine, oxyamine, oximine, thioether, disulfide, thiourea, sulfonamide, morpholino, etc., or biotin reagents and Fluorescein reagent may be included. When the sequence structure of “spacer / phosphate-functional molecular entity-spacer phosphate” is interposed between the two strands of the iRNA agent, this sequence structure is substituted for the hairpin RNA loop in the hairpin RNA agent. It is possible to function. The 3 ′ end can be an —OH group. Without wishing to be bound by theory, it is believed that conjugation of specific moieties can improve properties regarding transport, hybridization and specificity. Again, without wishing to be bound by theory, it may be desirable to introduce terminal changes that improve nuclease resistance. Other examples of terminal modifications include dyes, intercalating agents (eg, acridine), cross-linking agents (eg, psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, saffirin), polycyclic aromatic hydrocarbons (eg, , Phenazine, dihydrophenazine), artificial endonuclease (eg, EDTA), lipophilic carrier (eg, cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (hexadecyl) glycerol, Geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholic acid, dimethoxytrityl, Ma The phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2, polyamino, alkyl, Substituted alkyl, radiolabeled marker, enzyme, hapten (eg, biotin), transport / absorption enhancer (eg, aspirin, vitamin E, folic acid), synthetic ribonuclease (eg, imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole) Complex, tetraaza macrocycle Eu3 + complex).

Terminal modifications can be added to modulate activity or to adjust resistance to degradation for a number of reasons, including those discussed elsewhere in this specification. . Terminal modifications that are useful for modulating activity include modification of the 5 'end with phosphate or phosphate analogs. For example, in a preferred embodiment, the iRNA agent, particularly the antisense strand, may be 5 ′ phosphorylated or may include a phosphate group analog at the 5 ′ prime terminus. 5 'phosphate modifications include those that are compatible with RISC-mediated gene silencing. Suitable modifications include: 5 ′ monophosphate ((HO) 2 (O) P—O-5 ′); 5 ′ diphosphate ((HO) 2 (O) P—O—P ( HO) (O) -O-5 ');5' triphosphate ((HO) 2 (O) PO- (HO) (O) PO-OP (HO) (O) -O-5 ');5'-guanosine cap (7-methylated or unmethylated) (7m-GO-5'-(HO) (O) PO- (HO) (O) PO-OP ( HO) (O) -O-5 ′); 5′-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N—O-5 ′-(HO) (O) P—O— ( HO) (O) P-O-P (HO) (O) -O-5 ');5' monothiophosphoric acid (phosphorothioate; (HO) 2 (S) P-O-5 ');5' monodithiophosphorus Acid (phosphorodithioate; (HO) HS) (S) P—O-5 ′), 5′-phosphorothiolic acid ((HO) 2 (O) PS—5 ′); oxygen / sulfur substituted monophosphate, diphosphate, and tri Any further combination of phosphoric acids (eg, 5′-α-thiotriphosphate, 5′-γ-thiotriphosphate, etc.), 5′-phosphoramidate ((HO) 2 (O) P—NH -5 ', (HO) (NH2) (O) PO-5'), 5'-
Alkylphosphonic acid (R = alkyl = methyl, ethyl, isopropyl, propyl, etc., for example, RP (OH) (O) —O-5 ′, (OH) 2 (O) P-5′-CH2), 5′— Alkyl ether phosphonic acids (R = alkyl ether = methoxymethyl (MeOCH2), ethoxymethyl, etc., for example, RP (OH) (O) —O-5 ′).

  Terminal modifications can also be useful for monitoring distribution, but in such cases, preferred groups added include fluorophores (eg, fluorescein) or Alexa ™ dyes (eg, Alexa 488). ) Is included. Terminal modifications can also be useful to enhance uptake, but modifications useful for this purpose include cholesterol. Terminal modifications may also be useful for cross-linking RNA agents to another moiety, but useful modifications for this include mitomycin C.

Candidate modifications can be evaluated as described below.
Bases Adenine, guanine, cytosine, and uracil are the most common bases found in RNA. These bases can be modified or substituted to provide RNA with improved properties. For example, nuclease resistant oligonucleotides can be used with these bases or with synthetic or natural nucleobases (eg, inosine, thymine, xanthine, hypoxanthine, nuvularine, isoguanisine, or tubercidine). And can be prepared using any one of the above modifications. Alternatively, substituted or modified analogs of any of the above may be utilized, such as “unusual bases” and “generic bases”. Examples include, but are not limited to: 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and 5- Halocytosine, 5-propynyluracil and 5-propynylcytosine, 6-azouracil, 6-azocytosine, and 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5- (2-aminopropyl) uracil, 5-aminoallyluracil, 8-halo, amino, thiol, thioalkyl, hydroxyl, and other 8-substituted adenine and guanine, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine, 5- Substituted pyrimidines, 6 Azapyrimidine, and N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine), 5-propynyluracil and 5-propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine, 2 -Aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkylcytosine, 7-deazaadenine, N6, N6-dimethyladenine, 2,6-diaminopurine, 5-amino-allyl-uracil, N3-methyluracil, Substituted 1,2,4-triazole, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid, 5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5-methoxycarbonylmethyl-2-thiouracil, 5- Chill aminomethyl-2-thiouracil, 3- (3-amino-3-carboxypropyl) uracil, 3-methylcytosine, 5-methylcytosine, ^{N 4} - acetyl cytosine, 2-thiocytosine, N6-methyl adenine, N6-iso Pentyl adenine, 2-methylthio-N6-isopentenyl adenine, N-methyl guanine, or O-alkylated base. Additional purines and pyrimidines are disclosed in US Pat. No. 3,687,808, “Concise Encyclopedia Of Polymer.
Science And Engineering ", pages 858-859, edited by Kroschwitz JI, John Wiley &
Sons, 1990, and English et al., Angelwandte Chemie, International Edition, 1991, 30, p. 613 is included.

  In general, base changes are not preferred to promote stability, but may be useful for other reasons. For example, some 2,6-diaminopurines and 2aminopurines are fluorescent. Modified bases can reduce target specificity. This should be considered in the design of iRNA agents.

Candidate modifications can be evaluated as described below.
Evaluation of Candidate RNA A selected property by exposing a candidate RNA agent (eg, a modified RNA) to the appropriate conditions and exposing the RNA agent or modified molecule and a control molecule to the appropriate conditions. Can be evaluated. For example, resistance to a degradation agent can be evaluated as follows. Candidate modified RNA (and preferably a control molecule, usually unmodified) can be exposed to degrading conditions, eg, an environment containing a degrading agent (eg, nuclease). For example, a biological sample can be used, such as an environment that may be encountered in therapeutic use, eg, blood or cell fractions (eg, cell-free homogenates or disrupted cells). Similar biological sample. Candidates and controls can then be evaluated for resistance to degradation by any of a number of approaches. For example, candidates and controls can be preferably labeled prior to exposure, for example, using radioactive or enzyme labels or fluorescent labels (eg, Cy3 or Cy5, etc.). Control RNA and modified RNA can be incubated with a degradation agent and optionally a control (eg, an inactivated (eg, heat inactivated) degradation agent). The physical parameters (eg, the size of the modified molecule and the control molecule) are then determined. These may be determined by physical methods (eg, by polyacrylamide gel electrophoresis or size fractionation columns) to assess whether the molecule maintained its original length, or It is also possible to evaluate functionally. Alternatively, Northern blot analysis can be used to assay the length of unlabeled modified molecules.

  Functional assays can also be used to evaluate candidate agents. A functional assay is an initial or early non-functional assay (eg, an assay for resistance to degradation) to determine whether a modification alters the molecule's ability to silence gene expression. It can be applied later. For example, cells (eg, mammalian cells such as mouse or human cells) are co-transfected with a plasmid expressing a fluorescent protein (eg, GFP) and a candidate RNA agent that is homologous to a transcript encoding the fluorescent protein. (See, for example, WO 00/44914). For example, a modified dsRNA that is homologous to GFP mRNA is compared to a control cell that did not include a candidate dsRNA in the transfection (eg, a control to which no RNA agent was added and / or a control to which unmodified RNA was not added). Thus, it is possible to assay for the ability to inhibit GFP expression by monitoring for a decrease in cellular fluorescence. The potency of candidate agents for gene expression can be assessed by comparing the fluorescence of cells in the presence of modified and unmodified dsRNA agents.

In an alternative functional assay, candidate dsRNA agents that are homologous to an endogenous mouse gene (preferably a maternally expressed gene such as c-mos) evaluate the ability of the RNA agent to inhibit gene expression in vivo. To this end, it may be injected into immature mouse oocytes (see, for example, WO 01/36646). The oocyte phenotype (eg, the ability to maintain arrest in metaphase II) can be monitored as an indicator that the RNA agent inhibits expression. For example, cleavage of c-mos mRNA by a dsRNA agent causes oocytes to escape metastasis and initiate parthenogenetic development (College et al., Nature 370: 65-68). 1994; Hashimoto et al., Nature 370: 68-71, 1994). The effect of the modified RNA agent on target RNA levels was confirmed by Northern blot to assay for decreased levels of target mRNA or by Western blot analysis to assay for decreased levels of target protein compared to negative controls Is possible. Controls can include cells to which no RNA agent is added and / or cells to which unmodified RNA is added.

References General References Oligoribonucleotides and oligoribonucleosides used in accordance with the present invention are possible using solid phase synthesis, see for example: “Oligocleotides synthesis, a practical approach”, MJ. Edited by M. J. Gait, IRL Press, 1984; “Oligocleotides and Analogues, A Practical Approach”, edited by F. Eckstein, IRL Press, 1991 (especially, Chapter 1, “Moderns”). of oligodeoxyribonucleotide synthesis ", Chapter 2" Oligor ibonucleotide synthesis ", Chapter 3,"2'-O-Methyloligoribonucleotide-s: synthesis and applications ", Chapter 4," Phosphorothioate oligonucleotides ", Chapter 5," Synthesis of oligonucleotide phosphorodithioates ", Chapter 6," Synthesis of oligo-2 ' -Deoxyribonucleoside methylphosphonates "and chapter 7" Oligodeoxynucleotides contingent modified bases "). Other particularly useful synthesis procedures, reagents, blocking groups, and reaction conditions are described by Martin, P., Helv. Chim. Acta. 1995, 78, 486-504; Beaucage, SL, Iyer, RP, Tetrahedron, 1992, 48, 2223-2311 and Beaucage, S.L. L.) and Iyer, RP, Tetrahedron, 1993, 49, 6123-6194, or references cited therein.

  The modifications described in WO 00/44895, WO 01/75164, or WO 02/44321 can be used herein. .

The disclosures of all publications, patents, and published patent applications listed herein are hereby incorporated by reference.
Phosphate group references The preparation of phosphinic acid oligoribonucleotides is described in US Pat. No. 5,508,270. The preparation of alkyl phosphonate oligoribonucleotides is described in US Pat. No. 4,469,863. The preparation of phosphoramidite oligoribonucleotides is described in US Pat. No. 5,256,775 or US Pat. No. 5,366,878. The preparation of phosphotriester oligoribonucleotides is described in US Pat. No. 5,023,243. The preparation of boranophosphate oligoribonucleotides is described in US Pat. No. 5,130,302 and US Pat. No. 5,177,198. The preparation of 3′-deoxy-3′-aminophosphoramidate ribooligonucleotides is described in US Pat. No. 5,476,925. 3'-deoxy 3'-methylene phosphonate oligoribonucleotides are described in An, An et al. Org. Chem. 2001, 66, 2789-2801. The preparation of sulfur-bridged nucleotides is described by Sproat et al.
al. ), Nucleosides Nucleotides 1988, 7, 651 and Crostic et al., Tetrahedron Lett. 1989, 30, 4693.

Sugar Group References Modifications to the 2 ′ modification are described in Verma, S .; Et al., Annu. Rev. Biochem. 1998, 67, 99-134 and all references within the same document. Specific modifications to ribose can be found in the following references: 2'-fluoro (Kawasaki et al., J. Med. Chem., 1993, 36, 831-841), 2 '-MOE (Martin, P. Helv. Chim. Acta 1996, 79, 1930-1938), "LNA" (Wengel, J. Acc Chem. Res. 1999, 32, 301-310). .

References for Phosphate Group Replacement Methylenemethylimino-linked oligoribonucleosides (also identified herein as MMI-linked oligoribonucleosides), methylenedimethylhydrazo-linked oligoribonucleosides (herein MDH And also identified as a linked oligoribonucleoside), and a methylenecarbonylamino linked oligonucleoside (also identified herein as an amide-3 linked oligoribonucleoside), and a methyleneaminocarbonyl linked oligonucleoside (herein). Among them, also identified as amide-4-linked oligoribonucleosides), and mixed backbone compounds (eg, having alternating MMI and PO or PS linkages) are described in US Pat. No. 5,378,825, , 386,0 No. 23, No. 5,489,677, and published PCT applications PCT / US92 / 04294 and PCT / US92 / 04305 (International Publication No. 92/20822 and International Publication No. 92/20823, respectively). (Published as No. Pamphlet). Form acetal and thioform acetal linked oligoribonucleosides can be prepared as described in US Pat. No. 5,264,562 and US Pat. No. 5,264,564. Ethylene oxide linked oligoribonucleosides can be prepared as described in US Pat. No. 5,223,618. For siloxane substitution, see Cormier, JF et al., Nucleic Acids Res. 1988, 16, 4583. Carbonate substitution is described in Tittensor, JR, J.A. Chem. Soc. C1971, 1933. Carboxymethyl substitution is described in Edge, MD, J. et al. Chem. Soc. Perkin Trans. 1 1972, 1991. Carbamate substitution is described in Stirchak, EP, Nucleic Acids Res. 1989, 17, 6129.

Bibliography for Phosphate-Ribose Backbone Substitution Cyclobutyl compounds as sugar substitutes can be prepared as described in US Pat. No. 5,359,044. Pyrrolidine sugar surrogates can be prepared as described in US Pat. No. 5,519,134. Morpholino sugar substitutes can be prepared as described in US Pat. No. 5,142,047 and US Pat. No. 5,235,033, as well as other related patent disclosures. Peptide nucleic acids (PNA) are known per se, and “Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applicates”.
ions, "Bioorganic & Medicinal Chemistry, 1996, 4, 5-23, and can be prepared according to any of the various procedures cited. They can also be prepared according to US Pat. No. 5,539,083.

Terminal Modification Literatures Terminal modifications are described in Manoharan, M. et al., Antisense and Nucleic Acid Drug Development 12, 103-128 (2002) and references cited therein.

Base References N-2 substituted purine nucleoside amidites can be prepared as described in US Pat. No. 5,459,255. 3-Deazapurine nucleoside amidites can be prepared as described in US Pat. No. 5,457,191. 5,6-substituted pyrimidine nucleoside amidites can be prepared as described in US Pat. No. 5,614,617. 5-propynylpyrimidine nucleoside amidites can be prepared as described in US Pat. No. 5,484,908. Further references can be disclosed in the above section on base modification.

Preferred iRNA agents Preferred RNA agents have the following structure (see Formula 2 below):

Referring to Equation 2 above, R ¹ , R ² , and R ³ are each independently H (ie,
Abasin nucleotides), adenine, guanine, cytosine, and uracil, inosine, thymine, xanthine, hypoxanthine, nubalarin, tubercidin, isoguanidine, 2-aminoadenine, adenine and guanine 6-methyl and other alkyl derivatives, adenine and guanine 2-propyl and other alkyl derivatives of 5-halouracil and 5-halocytosine, 5-propynyluracil and 5-propynylcytosine, 6-azouracil, 6-azocytosine, and 6-azothymine, 5-uracil (pseudouracil), 4- Thiouracil, 5-halouracil, 5- (2-aminopropyl) uracil, 5-aminoallyluracil, 8-halo, amino, thiol, thioalkyl, hydroxyl, and other 8-substituted adenines and Guanine, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6, and O-6 substituted purines (2-amino Propyladenine), 5-propynyluracil and 5-propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine, 2-aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkylcytosine, 7-deazaadenine 7-deazaguanine, N6, N6-dimethyladenine, 2,6-diaminopurine, 5-amino-allyl-uracil, N3-methyluracil, substituted 1,2,4-triazole, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 5-methoxyuracil, uracil- -Oxyacetic acid, 5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5-methoxycarbonylmethyl-2-thiouracil, 5-methylaminomethyl-2-thiouracil, 3- (3-amino-3-carboxypropyl) ) uracil, 3-methylcytosine, 5-methylcytosine, ^{N 4} - acetyl cytosine, 2-thiocytosine, N6-methyl adenine, N6-isopentyl adenine, 2-methylthio -N6- isopentenyladenine, N- methyl guanine or, O-alkylated base.

R ⁴ , R ⁵ , and R ⁶ are each independently OR ⁸ , O (CH ₂ CH ₂ O) _m CH ₂ CH ₂ OR ⁸ ; O (CH ₂ ) _n R ⁹ ; O (CH ₂ ) _n OR ^9, H; _{^{halo; NH 2; NHR 8; N}} (R 8) 2; NH (CH 2 CH 2 NH) m CH 2 CH 2 NHR 9; NHC (O) R 8; cyano; mercapto; ^SR 8; Alkyl-thio-alkyl; alkyl, aralkyl, cycloalkyl, aryl, heteroaryl, alkenyl, alkynyl (each of which is optionally halo, hydroxy, oxo, nitro, haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy, Aryloxy, amino, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroaryl Reelamino, diheteroarylamino, acylamino, alkylcarbamoyl, arylcarbamoyl, aminoalkyl, alkoxycarbonyl, carboxy, hydroxyalkyl, alkanesulfonyl, alkanesulfonamide, allenesulfonamide, aralkylsulfonamide, alkylcarbonyl, acyloxy, cyano, or R ⁴ , R ⁵ , and R ⁶ may be combined with R ⁷ to combine [—O— between the 2 ′ and 4 ′ carbons of the sugar. CH ₂ -] to form a covalent bond crosslinking.

A ¹ is

H; OH; OCH ₃ ; W ₁ ; abasic nucleotides; or absent;
(Preferred A1 is the following: 5 ′ monophosphate ((HO) ₂ (O) P—O-5 ′); 5 ′ diphosphate ((HO) ₂ (O) P— O—P (HO) (O) —O-5 ′); 5 ′ triphosphate ((HO) ₂ (O) P—O— (HO) (O) P—O—P (HO) (O)) -O-5 ');5'-guanosine cap (7-methylated or unmethylated) (7m-GO-5'-(HO) (O) PO- (HO) (O) P- O—P (HO) (O) —O-5 ′); 5′-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N—O-5 ′-(HO) (O) P -O- (HO) (O) P-OP (HO) (O) -O-5 ');5' monothiophosphoric acid (phosphorothioate; (HO) ₂ (S) PO-5 '), 5 'monodithioline (Phosphorodithioate; (HO) (HS) ( S) P-O-5 '), 5'- phosphorythiolation acid _{((HO) 2 (O)} P-S-5'); oxygen / sulfur-substituted Any further combination of monophosphate, diphosphate, and triphosphate (eg, 5′-α-thiotriphosphate, 5′-γ-thiotriphosphate, etc.), 5′-phosphoramidate ( (HO) ₂ (O) P—NH-5 ′, (HO) (NH ₂ ) (O) P—O-5 ′), 5′-alkylphosphonic acid (R = alkyl = methyl, ethyl, isopropyl, propyl) For example, RP (OH) (O) -O-5′-, (OH) ₂ (O) P-5′-CH ₂ ), 5′-alkyl ether phosphonic acid (R = alkyl ether = methoxymethyl ( MeOCH ₂ -), ethoxymethyl, for example, selected from the RP (OH) (O) -O -5'-) )
A ₂ is

In it, _{A 3} is

And A ₄ is

H; Z ⁴ ; reverse nucleotide; abasic nucleotide; or absent.
W ¹ is OH, (CH ₂ ) _n R ¹⁰ , (CH ₂ ) _n NHR ¹⁰ , (CH ₂ ) _n OR ¹⁰ , (CH ₂ ) _n SR ¹⁰ , O (CH ₂ ) _n R ¹⁰ , O (CH ₂ ) _n OR ¹⁰ , O (CH _{2
^{) N NR 10, O (CH}} 2) n SR 10, O (CH 2) n SS (CH 2) n OR 10, O (CH 2) n C (O) OR 10, NH (CH 2) n R 10 NH (CH ₂ ) _n NR ¹⁰ ; NH (CH ₂ ) _n OR ¹⁰ , NH (CH ₂ ) _n SR ¹⁰ ; S (CH ₂ ) _n R ¹⁰ , S (CH ₂ ) _n NR ¹⁰ , S (CH _{2 ^{) n OR 10, S (CH}} 2) n SR 10 O (CH 2 CH 2 O) m CH 2 CH 2 OR 10; O (CH 2 CH 2 O) m CH 2 CH 2 NHR 10; NH (CH 2 CH _{2 NH) m CH 2 CH 2} NHR 10; Q-R 10, O-Q-R 10, N-Q-R 10, S-Q-R 10, or -O-. W ⁴ is O, CH ₂ , NH, or S.

X ¹ , X ² , X ³ , and X ⁴ are each independently O or S.
Y ¹ , Y ² , Y ³ , and Y ⁴ are each independently OH, O ⁻ , OR ⁸ , S, Se, BH ₃ ⁻ , H, NHR ⁹ , N (R ⁹ ) ₂ , alkyl, cyclo Alkyl, aralkyl, aryl, or heteroaryl, each of which may be optionally substituted.

Z ¹ , Z ² , and Z ³ are each independently O, CH ² , NH, or S. Z ⁴ is OH, (CH ₂ ) _n R ¹⁰ , (CH ₂ ) _n NHR ¹⁰ , (CH ₂ ) _n OR ¹⁰ , (CH ₂ ) _n SR ¹⁰ , O (CH ₂ ) _n R ¹⁰ , O (CH _{^{2) n OR 10, O (}} CH 2) n NR 10, O (CH 2) n SR 10, O (CH 2) n SS (CH 2) n OR 10, O (CH 2) n C (O) OR ¹⁰ , NH (CH ₂ ) _n R ¹⁰ ; NH (CH ₂ ) _n NR ¹⁰ ; NH (CH ₂ ) _n OR ¹⁰ , NH (CH ₂ ) _n SR ¹⁰ ; S (CH ₂ ) _n R ¹⁰ , S (CH _{^{2) n NR 10, S (}} CH 2) n OR 10, S (CH 2) n SR 10 O (CH 2 CH 2 O) m CH 2 CH 2 OR 10; O (CH 2 CH 2 O) m CH 2 _{^{CH 2 NHR 10; NH (CH}} 2 CH 2 N It is ^{Q-R 10, O-Q} -R 10, N-Q-R 10, S-Q-R 10;) m CH 2 CH 2 NHR 10.

x is selected to satisfy the length of the RNA agent described herein and is 5-100.
R ⁷ is H or combines with R ⁴ , R ⁵ , or R ⁶ to form a [—O—CH ₂ —] covalent bridge between the 2 ′ and 4 ′ carbons of the sugar. .

R ⁸ is alkyl, cycloalkyl, aryl, aralkyl, heterocyclyl, heteroaryl, amino acid, or sugar; R ⁹ is NH ₂ , alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, Diheteroarylamino, or amino acid; and R ¹⁰ is H; fluorophore (eg, pyrene, TAMRA, fluorescein, Cy3 dye or Cy5 dye); sulfur, silicon, boron, or ester protecting group; intercalating agent (For example, acridine), cross-linking agent (for example, psoralen, mitomycin C), porphyrin (TPPC4, texaphyrin, suffirin), polycyclic aromatic hydrocarbons (for example, phenazine, dihydrophenazine), artificial endonuclear (Eg EDTA), lipophilic carriers (cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (hexadecyl) glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholic acid, dimethoxytrityl, or phenoxazine) and peptide complexes (eg antenna peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2, polyamino, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl Radiolabeled marker, enzyme, hapten (eg, biotin), transport / absorption enhancer (eg, aspirin, vitamin E, folic acid), synthetic ribonuclease (eg, imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole complex) Body, tetraaza macrocycle Eu3 + complex); or RNA agent. m is 0 to 1,000,000, and n is 0 to 20. Q is a spacer selected from the group consisting of an abasic sugar, amide, carboxy, oxyamine, oxyimine, thioether, disulfide, thiourea, sulfonamide or morpholino, biotin, or fluorescein reagent.

  Preferred RNA agents in which the entire phosphate group is substituted have the following structure (see Formula 3 below):

Referring to Formula 3, A ¹⁰ -A ⁴⁰ is L-G-L; at least one of A ¹⁰ and A ⁴⁰ may not be present. Where L is a linker, and one or both L may or may not be present, and CH ₂ (CH ₂ ) _g ; N (CH ₂ ) _g ; O (CH ₂ ) _g ; Selected from the group consisting of S (CH ₂ ) _g . G is siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioform acetal, form acetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, And a functional group selected from the group consisting of methyleneoxymethylimino.

R ¹⁰ , R ²⁰ , and R ³⁰ are each independently H (ie, abasic nucleotide), adenine, guanine, cytosine, and uracil, inosine, thymine, xanthine,
Hypoxanthine, nubalarin, tubercidine, isoguanidine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and 5-halocytosine, 5- Propinyluracil and 5-propynylcytosine, 6-azouracil, 6-azocytosine, and 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5- (2-aminopropyl) uracil, 5-aminoallyl Uracil, 8-halo, amino, thiol, thioalkyl, hydroxyl, and other 8-substituted adenine and guanine, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine, 5 Substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine), 5-propynyluracil and 5-propynylcytosine, dihydrouracil, 3-deaza- 5-azacytosine, 2-aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkylcytosine, 7-deazaadenine, 7-deazaguanine, N6, N6-dimethyladenine, 2,6-diaminopurine, 5-amino- Allyl-uracil, N3-methyluracil substituted 1,2,4-triazole, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid, 5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5-methoxyca Bonirumechiru 2-thiouracil, 5-methylaminomethyl-2-thiouracil, 3- (3-amino-3-carboxypropyl) uracil, 3-methylcytosine, 5-methylcytosine, ^{N 4} - acetyl cytosine, 2-thiocytosine, N6-methyladenine, N6-isopentyladenine, 2-methylthio-N6-isopentenyladenine, N-methylguanine, or O-alkylated base.

R ⁴⁰ , R ⁵⁰ , and R ⁶⁰ are each independently OR ⁸ , O (CH ₂ CH ₂ O) _m CH ₂ CH ₂ OR ⁸ ; O (CH ₂ ) _n R ⁹ ; O (CH ₂ ) _n OR ^9, H; _{^{halo; NH 2; NHR 8; N}} (R 8) 2; NH (CH 2 CH 2 NH) m CH 2 CH 2 R 9; NHC (O) R 8 ;; cyano; mercapto; SR ⁷ Alkyl-thio-alkyl; alkyl, aralkyl, cycloalkyl, aryl, heteroaryl, alkenyl, alkynyl (each of which is optionally halo, hydroxy, oxo, nitro, haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy Aryloxy, amino, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, hete Roarylamino, diheteroarylamino, acylamino, alkylcarbamoyl, arylcarbamoyl, aminoalkyl, alkoxycarbonyl, carboxy, hydroxyalkyl, alkanesulfonyl, alkanesulfonamide, allenesulfonamide, aralkylsulfonamide, alkylcarbonyl, acyloxy, cyano, Or may be substituted with a ureido group); or R ⁴⁰ , R ⁵⁰ , and R ⁶⁰ may be combined together with R ⁷⁰ to form [—O between the 2 ′ and 4 ′ carbons of the sugar. —CH ₂ —] forms a covalent bridge.

x is selected to satisfy the length of the RNA agent described herein and is 5-100.
R ⁷⁰ is H or combined with R ⁴⁰ , R ⁵⁰ , or R ⁶⁰ to form a [—O—CH ₂ —] covalent bridge between the 2 ′ and 4 ′ carbons of the sugar. To do.

R ⁸ is alkyl, cycloalkyl, aryl, aralkyl, heterocyclyl, heteroaryl, amino acid, or sugar; R ⁹ is NH ₂ , alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, Diheteroarylamino or amino acid, m is 0 to 1,000,000, n is 0 to 20, and g is 0 to 2.

  A preferred nucleoside surrogate has the following structure (see Formula 4 below):

S is selected from the group consisting of morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acids. L is a linker, and _{CH 2 (CH 2) g;} N (CH 2) g; O (CH 2) g; S (CH 2) g; -C (O) (CH 2) n - group consisting of It may be more selected or absent. M is an amide bond; sulfonamide; sulfinic acid; a phosphate group; a modified phosphate group as described herein; or may be absent.

R ¹⁰⁰ , R ²⁰⁰ , and R ³⁰⁰ are each independently H (ie, abasic nucleotide), adenine, guanine, cytosine, and uracil, inosine, thymine, xanthine, hypoxanthine, nubalarin, tubercidine, isoguanidine, 2 -Aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and 5-halocytosine, 5-propynyluracil and 5-propynylcytosine, 6- Azouracil, 6-azocytosine, and 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5- (2-aminopropyl) uracil, 5-aminoallyluracil, 8-halo, amino Thiols, thioalkyls, hydroxyls, and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanines, 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine), 5-propynyluracil and 5-propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine, 2-aminopurine, 5-alkyluracil 7-alkylguanine, 5-alkylcytosine, 7-deazaadenine, 7-deazaguanine, N6, N6-dimethyladenine, 2,6-diaminopurine, 5-amino-allyl-uracil, N3-methyluracil substituted 1,2, 4-triazole, 2-pyridinone, 5-nitrate Loindole, 3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid, 5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5-methoxycarbonylmethyl-2-thiouracil, 5-methylaminomethyl 2-thiouracil, 3- (3-amino-3-carboxypropyl) uracil, 3-methylcytosine, 5-methylcytosine, N ⁴ -acetylcytosine, 2-thiocytosine, N6-methyladenine, N6-isopentyladenine, 2-methylthio-N6-isopentenyladenine, N-methylguanine, or O-alkylated base.

x is selected to satisfy the length of the RNA agent described herein and is 5-100; g is 0-2.
Nuclease resistant monomer RNA, such as iRNA agents, is further co-pending US Provisional Patent Application No. 60 / 469,612, filed May 9, 2003, as described herein. And nuclease resistant monomers (NRM) as described in International Application No. PCT / US04 / 07070, both of which are incorporated herein by reference.

  In addition, the present invention includes iRNA agents having NRMs and other elements described herein. For example, the present invention provides an iRNA agent described herein, eg, an iRNA agent having a palindromic structure, an iRNA agent having a non-standard pairing, a gene described herein, eg, a gene that is active in the liver. Targeted iRNA agent, iRNA agent having the configuration or structure described herein, iRNA agent combined with amphiphilic delivery agent described herein, coupled to drug delivery module described herein An iRNA agent, an iRNA agent administered as described herein, or an iRNA agent formulated as described herein, which also incorporates an NRM.

  An iRNA agent can include, for example, a monomer that has been modified to inhibit degradation by a nuclease (eg, an endonuclease or exonuclease) found in a subject's body. These monomers are referred to herein as NRMs or nuclease resistance promoting monomers or nuclease resistance promoting modifications. In many cases, these modifications may affect other properties of the iRNA agent, such as the ability to interact with a member of a protein (eg, transport protein (eg, serum albumin)) or RISC (RNA-induced silencing complex), or the initial sequence. The properties of the ability of the second and second sequences to form a duplex with each other or another sequence, such as a duplex with the target molecule, are similarly regulated.

  Without wishing to be bound by theory, modified sugars, bases and / or phosphate backbones of iRNA agents enhance endonuclease resistance and exonuclease resistance, as well as one or more of transport proteins and RISC complexes. It is thought to enhance the interaction with the functional elements. Preferred modifications increase exonuclease resistance and endonuclease resistance, thus extending the half-life of the iRNA agent prior to interacting with the RISC complex, but at the same time for endonuclease activity in the RISC complex. It is a modified product that does not make the iRNA agent resistant. Again, without wishing to be bound by any theory, the preferred nuclease resistance depicted above can be achieved by placing the modification at or near the 3 ′ and / or 5 ′ end of the antisense strand. It is believed that iRNA agents that meet the criteria will result. Again, without wishing to be bound by any theory, it is believed that an iRNA agent with a relatively low off-target potential can be made by placing the modification, for example, in the middle of the sense strand.

  The modifications described herein can be incorporated into any double-stranded RNA and RNA-like molecule described herein, eg, an iRNA agent. An iRNA agent can include a duplex composed of a hybridized sense and antisense strand, where the antisense and / or sense strand includes one or more modifications described herein. It is possible. The antisense strand is 1 to 6 nucleotides from the 3 ′ end and / or 5 ′ end and / or any end of the strand, eg 1-5, 1-4, 1-3, 1-2 nucleotides. Modifications can be included at one or more positions. The sense strand can include modifications at any one of the 3 'and / or 5' ends and / or intervening positions between both ends of the strand. An iRNA agent can also include a duplex composed of two antisense strands that are hybridized. The first and / or second antisense strand can include one or more modifications as described herein. Thus, one and / or both antisense strands are 1 to 6 nucleotides from the 3 ′ end and / or 5 ′ end and / or either end of the strand, eg 1-5, 1-4, 1 Modifications can be included at one or more positions of 3, 1-2 nucleotides. The specific structure is described below.

Modifications that may be useful for making iRNA agents that meet the preferred nuclease resistance criteria delineated above are one or more chemicals for sugar, base and / or phosphate backbones, as described below. And / or can include stereochemical modifications:
(I) the chiral _{(S P)} thioates. Accordingly, preferred NRMs are enriched for a specific chiral type of modified phosphate group containing a heteroatom at a non-bridging position normally occupied by oxygen, eg, Sp or Rp at position X, or for said modified phosphate group Contains pure nucleotide dimers. Further, S, Se, Nr ₂ or Br ₃ may be considered as the X atom. If X is S, conjugation with enriched or pure Sp for chiral forms is preferred. Enrichment means that the preferred type is at least 70, 80, 90, 95 or 99%. Such NRMs are described in more detail below;
(Ii) attachment of one or more cationic groups to the phosphorus atom of the sugar, base and / or phosphate backbone moiety or modified phosphate backbone moiety. Accordingly, preferred NRMs include monomers derivatized with a cationic group at the end. Since the 5 ′ end of the antisense sequence needs to have a terminal —OH or phosphate group, the NRM is preferably not used at the 5 ′ end of the antisense sequence. This cationic group is located at a position on the base that minimizes interference with hydrogen bond formation and hybridization, such as a position away from the surface that interacts with the complementary base of the other strand (eg, the 5 ′ position of the pyrimidine or purine). 7th place). These are described in more detail below;
(Iii) Non-phosphate linkage at the end. Thus, preferred NRMs include non-phosphate bonds, such as 4-atom bonds that are more resistant to cleavage than phosphate bonds. _{Examples, 3'CH2-NCH 3 -O-CH2-5} ' and 3'CH2-NH- (O =) - CH2-5' and the like.

(Iv) 3 'bridged thiophosphate and 5' bridged thiophosphate. Accordingly, preferred NRMs can include the structures described above.
(V) L-RNA, 2′-5 ′ bond, reverse bond, α-nucleoside. Accordingly, other preferred NRMs include nucleotide dimers derived from L nucleosides and L-nucleosides; 2′-5 ′ phosphate, non-phosphate and modified phosphate linkages, such as thiophosphate , Phosphoramidates and borated phosphates; dimers with reverse linkage, eg 3′-3 ′ or 5′-5 ′ linkage; monomers with α linkage at the 1 ′ position of the sugar, eg book A structure having an α-bond described in the specification;
(Vi) a linking group. Thus, preferred NRMs can include, for example, a target binding moiety, or a binding ligand described herein that binds to a monomer, for example through a sugar, base, or backbone.

(Vi) Abasic binding. Thus, preferred NRMs are, for example, abasic monomers as described herein (eg, monomers without nucleobases), aromatic or heterocyclic monomers as described herein, or polyheterocycles Formula aromatic monomers can be included;
(Vii) 5'-phosphonate and 5'-phosphate type prodrugs. Accordingly, preferred NRMs include monomers in which one or more atoms of the phosphate group are derivatized with a protecting group, preferably at a terminal site (eg, 5 ′ position), wherein the one or more protecting groups are Removed by the action of a body component of the subject, such as carboxyesterase or an enzyme present in the body of the subject. For example, phosphate prodrugs where carboxyesterase cleaves the protected molecule resulting in a thioate anion, and the thioate anion attacks the carbon adjacent to the phosphate O resulting in an unprotected phosphate.

  One or more different NRM modifications can be introduced into the iRNA agent or sequence of the iRNA agent. NRM modifications can be used more than once in a sequence or iRNA agent. Since some NRMs prevent hybridization, the total incorporation must be such that an acceptable level of iRNA agent duplex formation is maintained.

  In some embodiments, NRM modifications are introduced into terminal truncation sites or regions of sequences that do not target the desired sequence or gene of interest (sense strand or sense sequence). This can reduce silencing by off-target.

Chiral S _P thioate modifications may include changes in one or unbound both (X and Y) phosphate oxygens and / or one or more binding (W and Z) phosphate oxygens (e.g. substitutions). Formula X below represents a phosphate moiety to which two sugar / sugar substitute-base moieties (SB ₁ and SB ₂ ) are attached.

In certain embodiments, one of the unbound phosphate oxygens (X and Y) of the phosphate backbone moiety is any one of the following: S, Se, BR ₃ (R is hydrogen, alkyl, aryl, etc.), C (Ie, an alkyl group, an aryl group, etc.), H, NR ₂ (R is hydrogen, alkyl, aryl, etc.), or OR (R is alkyl or aryl). The phosphorus atom of the unmodified phosphate group is achiral. However, the phosphorus atom is chiralized by replacing one of the unbound oxygens with one of the above atoms or groups of atoms. In other words, the phosphate atom in the phosphate group thus modified is a stereocenter. The stereogenic phosphorus atom can have an “R” configuration (here, R _P ) or an “S” configuration (here, S _P ). Thus, 60% of the phosphorus atom stereocenters when having R _P configuration, the phosphorus atom of 40% stereocenters remaining will have a S _P configuration.

In some embodiments, an iRNA agent having a phosphate group in which non-phosphate phosphate oxygens are replaced with other atoms or groups of atoms is at least about 50% of the stereogenic atoms (eg, at least of the stereogenic atoms. About 60%, at least about 70% of the same atom, at least about 80% of the same atom, at least about 90% of the same atom, at least about 95% of the same atom, at least about 98% of the same atom, at least about 99 of the same atom percent) can include a population of stereogenic phosphorus atoms having the S _P configuration. Alternatively, an iRNA agent having a phosphate group in which non-phosphate phosphate oxygens are replaced with other atoms or groups of atoms has at least about 50% of the stereogenic atoms (eg, at least about 60% of the stereogenic atoms at least about 70% of atoms of at least about 80% of the atoms, at least about 90% of the atoms, at least about 95 percent of the atoms, at least about 98% of the atoms, at least about 99% of the atoms) _{R P} It is possible to include a population of stereogenic phosphorus atoms having a configuration. In other embodiments, it has a population of stereogenic phosphorus atoms have S _P configuration and may be substantially free of stereogenic phosphorus atoms having the R _P configuration. In still other embodiments, the population of stereogenic phosphorus atoms having the R _P configuration and may be substantially free of stereogenic phosphorus atoms having the S _P configuration. As used herein, the phrase "substantially free of stereogenic phosphorus atoms having the R _P configuration" is the conventional methods known portion comprising a stereogenic phosphorus atoms in the art having the R _P configuration (chiral HPLC, ¹ H NMR analysis using a chiral shift reagent, etc.). As used herein, the phrase "substantially free of stereogenic phosphorus atoms having the S _P configuration" is the conventional method (chiral HPLC moiety containing stereogenic phosphorus atoms is known in the art having the Sp configuration , ¹ H NMR analysis using a chiral shift reagent, etc.).

In a preferred embodiment, the modified iRNA agent comprises a phosphorothioate group, ie, a phosphate group in which the non-bonded oxygen of the phosphate is replaced with a sulfur atom. In a particularly preferred embodiment, the population of stereogenic phosphorus atoms phosphorothioates can be substantially free of stereogenic phosphorus atoms having having S _P configuration, and R _P configuration.

  Phosphorothioates are dimers (eg, Formula X-1 and Formula X-2)

Can be incorporated into an iRNA agent. The former can be used to introduce a phosphorothioate at the 3 ′ end of the strand, the latter can be the 5 ′ end of the strand or, for example, the first, second, third, fourth, fifth or sixth nucleotide from either end Used to introduce a modification at the position. In the above formula, Y may be 2-cyanoethoxy, W and Z may be O, R ₂ ′ may be, for example, a substituent capable of imparting a C-3 terminal structure to the sugar, such as OH, F, OCH ₃ Often, DMT is dimethoxytrityl, and the “base” may be a natural base, an unusual base, or a universal base.

X-1 and X-2 use chiral reagents or have basically only the R _P configuration (ie, substantially free of the _SP configuration) or have only the _SP configuration (ie, substantially Can be prepared using a coordinating control group capable of generating phosphorothioate-containing dimers having a population of stereogenic phosphorous atoms (not specifically including the _RP configuration). Alternatively, dimer, can be about 50% had R _P configuration, approximately 50% of the atoms is adjusted to have a population of stereogenic phosphorus atoms having the S _P configuration. Identify dimers having stereogenic phosphorus atoms R _P configuration, be separated from dimers having stereogenic phosphorus structure of S _P located using, for example, enzymatic degradation and / or conventional chromatographic methods Is possible.

Cationic groups Modifications can also include the attachment of one or more cationic groups to the phosphorus atom of the sugar, base and / or phosphate backbone moiety or modified phosphate backbone moiety. The cationic group can be attached to any atom that can be substituted on a natural, unusual or universal base. Preferred positions are those that do not interfere with hybridization, i.e. do not interfere with the hydrogen bond interactions necessary for base pairing. The cationic group can be attached, for example, via the C2 ′ position of the sugar, or a similar position in a cyclic or acyclic sugar substitute. Cationic groups are for example protonated amino groups derived from O-AMINE (AMINE = NH ₂ ; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino), for example O _{(CH 2)} n AMINE (e.g. AMINE = NH _2; alkylamino, dialkylamino, Heterushikuriru, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino etc.) aminoalkoxy of, amino (e.g., NH ₂ Alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino or amino acid); Or _{NH (CH 2 CH 2 NH)} n CH 2 CH 2 -AMINE ( e.g. AMINE = NH _2; alkylamino, dialkylamino, Heterushikuriru, arylamino, diarylamino, heteroarylamino or diheteroarylamino) may include Is possible.

Non-phosphate bonds The modifications can also incorporate non-phosphate bonds at at least one of the 5 'and 3' ends of the chain. Examples of non-phosphate linkages that can replace the phosphate group include methylphosphonic acid, hydroxylamino, siloxane, carbonic acid, carboxymethyl, carbamic acid, amide, thioether, ethylene oxide linker, sulfonic acid, sulfonamide, thioform Including acetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino. Preferred substituents comprise a methylphosphonic acid group and a hydroxylamino group.

3 ′ bridged thiophosphate and 5 ′ bridged thiophosphate; locked RNA, 2′-5 ′ linkage, reverse linkage, α-nucleoside; linking group; abasic linkage; and 5 ′ phosphonic acid and 5 ′ phosphate pro Drugs Referring to Formula X above, the modification can include a substitution of one of the phosphate backbone moieties bridged or bound phosphate oxygens (W and Z). Unlike the situation where only one of X or Y is changed, the center of the phosphorodithioate phosphorus atom is achiral, preventing the formation of iRNA agents containing a stereogenic phosphorus atom.

Modifications can also include linking two sugars via a phosphate group or a modified phosphate group through the 2 ′ position of the first sugar and the 5 ′ position of the second sugar. Similarly considered are reverse linkages in which the first sugar and the second sugar are each bonded through their 3 ′ positions. The modified RNA can also include a “basic” sugar that lacks a nucleobase at C-1 ′. The sugar group can also contain one or more carbons that have the opposite stereochemical configuration than the corresponding carbon in ribose. Thus, modified iRNA agents can include nucleotides including, for example, arabinose as a sugar. In another subset of the above modifications, natural, unusual or universal bases can have an α-configuration. Moreover, the modified body can contain L-RNA.

Further, the modification example _{^{P (O) (O -)}} 2 -X-C 5 '- sugar (X = CH2, CF2, CHF, etc.) of the 5'-phosphonic acid and example P (O) [OCH2CH2SC (O ) R ] ₂ CH ₂ C ⁵ - which may include a phosphonate prodrug '5 such as sugars'. In the latter case, the prodrug group may be cleaved through an action that begins with carboxyesterase first. The remaining ethyl thiolate groups via intramolecular S _N 2 substitution can be separated as episulfides, resulting in non-derivatized phosphate groups.

  The modification can also include adding a linking group described elsewhere herein, and the linking group can be attached to the iRNA agent via any amino group that can be attached. preferable.

  Nuclease resistant modifications include modifications that can be placed only at the ends and modifications that can be placed at any position. In general, a modification capable of suppressing hybridization is preferably used only in a terminal region, and preferably not used in a cleavage site or cleavage region of a sequence targeting a target sequence or gene. Any position in the sense sequence can be used provided that sufficient hybridization is maintained between the two sequences of the iRNA agent. In some embodiments, it is possible to minimize off-target silencing, so it is desirable to place the NRM at the cleavage position or region of the sequence that does not target the sequence or gene of interest.

  Furthermore, an iRNA agent described herein can have a protrusion that does not form a double-stranded structure with the other sequence of the iRNA agent. This is an overhang, but hybridizes with itself or another nucleic acid other than the other sequence of the iRNA agent.

  In most cases, a nuclease resistance-promoting modification is whether the sequence targets the sequence of interest (often referred to as the antisense sequence) or does not target the sequence of interest (often referred to as the sense sequence) ) Depending on the arrangement. If the sequence targets a sequence of interest, modifications that interfere with or inhibit endonuclease cleavage should not be inserted into a region that undergoes RISC-mediated cleavage, such as a cleavage site or region. (Elbashir et al., 2001, Genes and Dev. 15: 188 [incorporated herein by reference], target cleavage is approximately in the middle of approximately 20 or 21 nt guide RNA. Or occurs 10 or 11 nucleotides upstream of the first nucleotide complementary to the guide sequence, where the cleavage site is the nucleotide on either side of the cleavage site on the target or on the strand of the iRNA agent that hybridizes to the target. The cleavage region means the nucleotide at the cleavage site and 1, 2 or 3 nucleotides in both directions).

Such modifications can be introduced into terminal regions of sequences that target or not target the sequence of interest, eg, at the end, or at positions 2, 3, 4 or 5 of the end.
An iRNA agent can have a first strand and a second strand selected from:

A first strand that does not target the sequence and has an NRM modification at position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6 from the 3 ′ end;
A first strand that does not target the sequence and has an NRM modification at position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6 from the 5 ′ end;
Not targeting the sequence and having an NRM modification at position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6 from the 3 ′ end; 'First strand with NRM modification at position 1, 2, 3, 4, 5 or 6 from the end or within position 1, 2, 3, 4, 5 or 6;
A first strand that does not target the sequence and has an NRM modification at the cleavage site or region,
Does not target sequence, has NRM modification at cleavage site or cleavage region, and position 1, 2, 3, 4, 5 or 6 from the 3 ′ end or 1, 2, 3, 4, 5 or 6 NRM modification in the position within the position and NRM modification at the position 1, 2, 3, 4, 5 or 6 from the 5 ′ end, or the position within the position 1, 2, 3, 4, 5 or 6 or 3 One or more of positions 1, 2, 3, 4, 5 or 6 or NRM modifications within positions 1, 2, 3, 4, 5 or 6 from both the 'terminal and 5' ends A first strand having,
A second strand targeting the sequence and having an NRM modification at position 1, 2, 3, 4, 5 or 6 from the 3 ′ end or within position 1, 2, 3, 4, 5 or 6;
A second strand (5 ′) targeted to the sequence and having an NRM modification at position 1, 2, 3, 4, 5 or 6 from position 5 ′ or within position 1, 2, 3, 4, 5 or 6 The terminal modification is preferably at a position 1, 2, 3, 4, 5 or 6 away from the 5 ′ end of the antisense strand rather than the end)
Targeting sequence and having NRM modification at position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6 from the 3 'end, and further 5' end A second strand having an NRM modification at position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6;
A second strand that targets the sequence and preferably has no NRM modifications at the cleavage site or region;
NRM modification of the cleavage site or region targeted to the sequence, and position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6 from the 3 ′ end NRM modification at positions 1, 2, 3, 4, 5 or 6 from the 5 ′ end, or NRM modifications within positions 1, 2, 3, 4, 5 or 6 or 3 ′ and 5 ′ ends A second strand (5) in which one or more of the NRM modifications at positions 1, 2, 3, 4, 5 or 6 or positions within 1, 2, 3, 4, 5 or 6 from both are absent. The 'end modification is preferably at a position 1, 2, 3, 4, 5 or 6 away from the 5' end of the antisense strand rather than the end).

An iRNA agent can also target two sequences and can have a first strand and a second strand selected from:
A first strand that targets the sequence and has an NRM modification at position 1, 2, 3, 4, 5 or 6 from the 3 ′ end or within position 1, 2, 3, 4, 5 or 6;
A first strand (5 ′) that targets the sequence and has an NRM modification at position 1, 2, 3, 4, 5 or 6 from the 5 ′ end or within position 1, 2, 3, 4, 5 or 6 The terminal modification is preferably at a position 1, 2, 3, 4, 5 or 6 away from the 5 ′ end of the antisense strand rather than the end)
Targeting sequence and having NRM modification at position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6 from the 3 'end, and further 5' end A first strand having an NRM modification at position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6;
A first strand that targets the sequence and preferably has no NRM modification at the cleavage site or region;
NRM modification of the cleavage site or region targeted to the sequence, and position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6 from the 3 ′ end NRM modification at positions 1, 2, 3, 4, 5 or 6 from the 5 ′ end, or NRM modifications within positions 1, 2, 3, 4, 5 or 6 or 3 ′ and 5 ′ ends The first strand (5) in which one or more of the NRM modifications at positions 1, 2, 3, 4, 5 or 6 or positions within 1, 2, 3, 4, 5 or 6 from both are absent. 'Terminal modifications are preferably at positions 1, 2, 3, 4, 5 or 6 away from the 5' end of the antisense strand rather than the end);
A second strand targeting the sequence and having an NRM modification at position 1, 2, 3, 4, 5 or 6 from the 3 ′ end or within position 1, 2, 3, 4, 5 or 6;
A second strand (5 ′) targeted to the sequence and having an NRM modification at position 1, 2, 3, 4, 5 or 6 from position 5 ′ or within position 1, 2, 3, 4, 5 or 6 The terminal modification is preferably at a position 1, 2, 3, 4, 5 or 6 away from the 5 ′ end of the antisense strand rather than the end)
Targeting sequence and having NRM modification at position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6 from the 3 'end, and further 5' end A second strand having an NRM modification at position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6;
A second strand that targets the sequence and preferably has no NRM modifications at the cleavage site or region;
Target the sequence, NRM modification of the cleavage site or cleavage region, and position 1, 2, 3, 4, 5 or 6 or within position 1, 2, 3, 4, 5 or 6 from the 3 ′ end NRM modification at positions 1, 2, 3, 4, 5 or 6 from the 5 ′ end, or NRM modifications within positions 1, 2, 3, 4, 5 or 6 or 3 ′ and 5 ′ ends A second strand (5) in which one or more of the NRM modifications at positions 1, 2, 3, 4, 5 or 6 or positions within 1, 2, 3, 4, 5 or 6 from both are absent. The 'end modification is preferably at a position 1, 2, 3, 4, 5 or 6 away from the 5' end of the antisense strand rather than the end).

Ribose mimics RNA, e.g., iRNA agents, are co-owned and co-owned on March 13, 2003, both incorporated herein by reference, as well as ribose mimics, e.g., the ribose mimics described herein. US provisional application No. 60 / 454,962 and international application no. It is possible to incorporate ribose mimics and the like described in PCT / US04 / 07070.

  The present invention further includes iRNA agents having ribose mimics and other components described herein. For example, the present invention provides an iRNA agent described herein, for example, an iRNA agent having a palindromic structure, an iRNA agent having a non-standard pairing, a gene described herein, for example, a gene active in the liver. Targeted iRNA agent, iRNA agent having the configuration or structure described herein, iRNA combined with amphiphilic delivery agent described herein, iRNA combined with drug delivery module described herein An iRNA agent administered as described herein, or an iRNA agent formulated as described herein, which also incorporates a ribose mimic.

Accordingly, one aspect of the invention features an iRNA agent that includes a secondary hydroxyl group that can increase efficiency and / or confer nuclease resistance to the iRNA agent. Nucleases, such as cellular nucleases, can hydrolyze phosphodiester bonds in nucleic acids, resulting in partial or complete degradation of nucleic acids. The secondary hydroxyl group confers nuclease resistance to the iRNA agent by reducing the tendency of the iRNA agent to undergo nuclease degradation compared to iRNA lacking this modification. While not wishing to be bound by theory, it is believed that the presence of the second hydroxyl group on the iRNA agent acts as a structural mimic of the hydroxyl group of the 3 ′ ribose, making the iRNA agent less susceptible to degradation.

  A secondary hydroxyl group refers to an “OH” group attached to a carbon atom replaced by two other carbons and hydrogen. The secondary hydroxyl group conferring nuclease resistance as described above may be part of any acyclic carbon-containing group. The hydroxyl group may be part of any cyclic carbon-containing group, and the following conditions: (1) no ribose moiety is present between the hydroxyl group and the terminal phosphate group, or (2) the It is preferred that the hydroxyl group is not present in the sugar moiety attached to the base, to meet one or more of the above. The hydroxyl group is at least 2 bonds (2 chemical bonds) from the terminal phosphate group phosphorus of the iRNA agent (eg, at least 3 bonds away, at least 4 bonds away, at least 5 bonds away, at least 6 bonds away, at least 7 bonds away, at least 8 bonds away, at least 9 bonds away, at least 10 bonds away). In a preferred embodiment, there are five intervening bonds between the terminal phosphate group phosphorus and the secondary hydroxyl group.

  A preferred iRNA agent delivery module having five intervening bonds between the terminal phosphate group phosphorus and the second hydroxyl group has the following structure (see Formula Y below):

Referring to Formula Y, A is an iRNA agent and includes any iRNA agent described herein. The iRNA agent can be linked directly or indirectly (eg, via a spacer or linker) to the phosphate group “W”. These spacers or linkers, for example _{- (CH 2) n -,} - (CH 2) n N -, - (CH 2) n O -, - (CH 2) n S-, O (CH 2 CH 2 O _N CH ₂ CH ₂ OH (eg, n = 3 or 6), abasic sugar, amide, carboxy, amine, oxyamine, oximine, thioether, disulfide, thiourea, sulfonamide, or morpholino, or biotin reagents and It is possible to include a fluorescein reagent.

The iRNA agent can have a terminal phosphate group in an unmodified state (eg, W, X, Y, and Z are O) or a modified terminal phosphate group. The modified to have a phosphate group, W and Z are NH independently may be O or S; X and Y are S ^{_{independently, Se, BH 3 -, C}} 1 ~C 6 _alkyl, C 6 -C It may be ₁₀ aryl, H, O, O ⁻ , alkoxy or amino (including alkylamino, arylamino and the like). It is preferred that W, X and Z are O and Y is S.

R ₁ and R ₃ are each independently hydrogen; or C ₁ -C ₁₀₀ alkyl, wherein C ₁ -C ₁₀₀ alkyl is optionally substituted with a hydroxyl, amino, halo, phosphoric acid or sulfate group, and N / O, S, alkenyl or alkynyl may optionally be inserted.

R ₂ is hydrogen; or C ₁ -C ₁₀₀ alkyl, where C ₁ -C ₁₀₀ alkyl is optionally substituted with a hydroxyl, amino, halo, phosphoric acid or sulfate group and / or optionally N, O, S, alkenyl or alkynyl may be inserted; or when n is 1, R ₂ may combine with R ₄ or R ₆ to form a 5-12 atom ring.

R ₄ is hydrogen; or C ₁ -C ₁₀₀ alkyl, where C ₁ -C ₁₀₀ alkyl is optionally substituted with a hydroxyl, amino, halo, phosphoric acid or sulfate group and / or is optionally N, O, S, alkenyl or alkynyl may be inserted; or when n is 1, R ₄ may combine with R ₂ or R ₅ to form a 5-12 atom ring.

R ₅ is hydrogen, or C ₁ -C ₁₀₀ alkyl, where C ₁ -C ₁₀₀ alkyl is optionally substituted with a hydroxyl, amino, halo, phosphoric acid or sulfate group and / or optionally N, O, S, alkenyl or alkynyl may be inserted; or when n is 1, R ₅ may combine with R ₄ to form a 5-12 atom ring.

R ₆ is hydrogen, or C ₁ -C ₁₀₀ alkyl, wherein C ₁ -C ₁₀₀ alkyl is optionally substituted with a hydroxyl, amino, halo, phosphoric acid or sulfate group and / or optionally N, O, S, alkenyl or alkynyl may be inserted, or when n is 1, R ₆ may combine with R ₂ to form a 6-10 atom ring.

R ₇ is hydrogen, C ₁ -C ₁₀₀ alkyl, or C (O) (CH ₂ ) _q C (O) NHR ₉ ; T is hydrogen or a functional group; n and q are each independently 1-100 R ₈ is C ₁ -C ₁₀ alkyl or C ₆ -C ₁₀ aryl; and R ₉ is hydrogen, C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl or a solid support material.

Preferred embodiments can include one or more of the following subsets of iRNA agent delivery modules.
In one subset of RNAi agent delivery modules, A can be linked directly or indirectly through the terminal 3 ′ or 5 ′ ribose sugar carbon of the RNA agent.

In another subset of RNAi agent delivery modules, X, W and Z are O and Y is S.
In yet another subset of RNAi agent delivery modules, n is 1, R ₂ and R ₆ together form a ring containing 6 atoms, and R ₄ and R ₅ together form a ring containing 6 atoms. . The ring system is preferably trans-decalin. For example, this subset of RNAi
The agent delivery module can include a compound of formula (Y-1):

  The functional group may be, for example, a targeting (targeting) group (eg, a steroid or carbohydrate), a reporter group (eg, a fluorophore), or a label (isotopically labeled moiety). Targeting groups include protein binding agents, endothelial cell targeting groups (eg RGD peptides and mimetics), cancer cell targeting groups (eg folate vitamin B12, biotin), bone cell targeting groups (eg bisphosphonates, polyglutamic acid, poly Aspartic acid), multivalent mannose (eg for macrophage testing), lactose, galactose, N-acetyl-galactosamine, monoclonal antibodies, glycoproteins, lectins, melanotropins, or thyrotropins.

  As will be appreciated by those skilled in the art, methods of synthesizing the compounds of the formulas herein will be apparent to those skilled in the art. The synthesized compound can be separated from the reaction mixture and further purified by methods such as column chromatography, high performance liquid chromatography, or recrystallization. In addition, various synthetic steps can be performed in other orders or sequences to provide the desired compound. Synthetic chemical transformations and methods for protecting groups (protection and deprotection) useful in synthesizing the compounds described herein are known in the art, eg, R. Larock, “Comprehensive Organic. "Transformations", VCH Publishers (1989); T. W. Greene and PG Wuts, "Protective Groups in Organic Synthesis", Second Edition, Joh. (1991); L. Fieser and M. Fieser, “Fieser and Fieser's Reagents”. for Organic Synthesis ", John Wiley and Sons (1994); and L. Paquette, ed. , “Encyclopedia of Reagents for Organic Synthesis”, John Wiley and Sons (1995), and subsequent versions thereof.

Ribose-substituted monomer subunits iRNA agents can be modified in several ways that can optimize one or more properties of the iRNA agent. RNA agents, such as iRNA agents, are ribose-substituted monomer subunits (RRMS), such as the RRMS described herein as well as US Provisional Application No. 60/493, filed Aug. 8, 2003, which is incorporated herein by reference. No. 986; U.S. Provisional Application No. 60 / 494,597 filed on Aug. 11, 2003, incorporated herein by reference; U.S. Provisional Application filed on September 26, 2003, incorporated herein by reference. No. 60 / 506,341; US Provisional Application No. 60 / 158,453, filed Nov. 7, 2003, incorporated herein by reference; and filed Mar. 8, 2004, incorporated herein by reference. International application no. RRMS described in one or more of PCT / US04 / 07070 may be included.

  The present invention further includes iRNA agents having RRMS and other components described herein. For example, the present invention provides an iRNA agent described herein, for example, an iRNA agent having a palindromic structure, an iRNA agent having a non-standard pairing, a gene described herein, for example, a gene active in the liver. Targeted iRNA agent, iRNA agent having the configuration or structure described herein, iRNA coupled to amphiphilic delivery agent described herein, iRNA coupled to drug delivery module described herein An iRNA agent administered as described herein, or an iRNA agent formulated as described herein, which also incorporates RRMS.

  The ribose sugar of one or more ribonucleotide subunits of the iRNA agent can be replaced with other components, such as non-carbohydrate (preferably cyclic) carriers. A ribonucleotide subunit in which the subunit ribose sugar is thus substituted is referred to herein as a ribose substitution modified subunit (RRMS). The cyclic carrier may be a carbocyclic system (ie, all ring atoms are carbon atoms) or a heterocyclic system (ie, one or more ring atoms are heteroatoms such as nitrogen, oxygen, sulfur). It may be. The cyclic carrier may be a monocyclic system or may contain more than one ring, for example a fused ring. The cyclic support may be a fully saturated ring system or it may contain one or more double bonds.

  The carrier further includes (i) at least two “backbone attachment points” and (ii) at least one “linkage attachment point”. As used herein, a “backbone point of attachment” refers to the incorporation of a carrier into a functional group, such as a hydroxyl group, or generally a backbone (eg, a modified phosphate backbone such as containing a ribonucleic acid phosphate backbone or sulfur). Refers to a bond available and suitable. As used herein, a “linkage point” is a constituent ring atom of a cyclic carrier, such as a carbon atom or a heteroatom (different from the atom that provides the backbone point of attachment), and a selected component and Refers to the atom that binds. The selected component can be, for example, a ligand (eg, a targeting moiety or delivery component), or a component that alters the physical properties (eg, lipophilicity) of the iRNA agent. In some cases, the selected components are bound to the cyclic carrier by intervening linkages. Thus, the selected component will include a functional group (eg, an amino group) or generally provide a bond suitable for incorporation or linking of other chemical entities (eg, ligands to the constituent rings).

  By incorporating one or more RRMS as described herein into an RNA agent (eg, an iRNA agent), particularly when linked to an appropriate entity, one or more new properties are imparted to the RNA agent. And / or one or more pre-existing properties of the RNA molecule can be altered, enhanced or regulated. For example, one or more of lipophilicity or nuclease resistance can be altered. Modulating (eg, increasing) the binding affinity of an iRNA agent for a target mRNA by incorporating one or more RRMSs described herein into the iRNA agent, particularly when the RRMS is linked to an appropriate entity. Can change the shape of the double helix of the iRNA agent, can change the distribution, or can direct the iRNA agent to a specific part of the body, or (eg, RISC It is possible to modify the interaction with the nucleic acid binding protein (during formation and strand separation).

  Accordingly, in one aspect, the present invention is preferably an iRNA agent comprising a first strand and a second strand, wherein at least one subunit having the formula (R-1) is in at least one of the strands Characterized by incorporated iRNA agent.

Referring to formula (R-1), X is N (CO) R ⁷ , NR ⁷ or CH ₂ ; Y is NR ⁸ , O, S, CR ⁹ R ¹⁰ or absent, and Z Is CR ¹¹ R ¹² or absent.

Each of R ¹ , R ² , R ³ , R ⁴ , R ⁹ , and R ¹⁰ is independently H, OR ^a , OR ^b , (CH ₂ ) _n OR ^a , or (CH ₂ ) _n OR ^b , Provided that at least one of R ¹ , R ² , R ³ , R ⁴ , R ⁹ , and R ¹⁰ is OR ^a or OR ^b and R ¹ , R ² , R ³ , R ⁴ , R ⁹ , and At least one of R ¹⁰ is (CH ₂ ) _n OR ^a , or (CH ₂ ) _n OR ^b (when RRMS is present at the end, R ¹ , R ² , R ³ , R ⁴ , R ⁹ , and One of R ¹⁰ includes R ^a and one includes R ^b ; when RRMS is present, ^{two of} R ¹ , R ² , R ³ , R ⁴ , R ⁹ , and R ¹⁰ are each containing ^{R b);} further, OR ^a, together with _{(CH 2)} n OR ^b It was seen _{there, (CH 2)} n OR ^a shall preferably exists only with OR ^b.

Each of R ⁵ , R ⁶ , R ¹¹ , and R ¹² is independently H, C ₁ -C ₆ alkyl optionally substituted with 1 to 3 R ¹³ , or C (O) NHR ⁷ ; Alternatively, R ⁵ and R ¹¹ together form a C ₃ -C ₈ cycloalkyl optionally substituted with R ¹⁴ .

R ⁷ is C ₁ -C ₂₀ alkyl substituted with NR ^c R ^d ; R ⁸ is C ₁ -C ₆ alkyl; R ¹³ is hydroxy, C ₁ -C ₄ alkoxy, or halo; and R ¹⁴ is NR ^c R ⁷ .

^Ra is

And R ^b is

It is.
Each of A and C is independently O or S.
B is OH, O ⁻ , or

It is.
R ^c is H or C ₁ -C ₆ alkyl; R ^d is H or a ligand; n is 1-4.

In a preferred embodiment, ribose is substituted with a pyrroline backbone and X is N (CO) R ⁷ or NR ⁷ , Y is CR ⁹ R ¹⁰ and Z is absent.
In other preferred embodiments, the ribose is substituted with a piperidine backbone, and X is N (CO) R ⁷ or NR ⁷ , Y is CR ⁹ R ¹⁰ , and Z is CR ¹¹ R ¹² .

In another preferred embodiment, ribose is substituted with a piperazine skeleton, and X is N (CO) R ⁷ or NR ⁷ , Y is NR ⁸ and Z is CR ¹¹ R ¹² .
In another preferred embodiment, the ribose is substituted with a morpholino backbone, and X is N (CO) R ⁷ or NR ⁷ , Y is O, and Z is CR ¹¹ R ¹² .

In another preferred embodiment, ribose is substituted with a decalin backbone and X is CH ₂ ; Y is CR ⁹ R ¹⁰ ; and Z is CR ¹¹ R ¹² ; and R ⁵ and R ¹¹ are together To form C ⁶ cycloalkyl.

In other preferred embodiments, the ribose is substituted with a decalin / indan backbone and X is CH ₂ ; Y is CR ⁹ R ¹⁰ ; and Z is CR ¹¹ R ¹² ; and R ⁵ and R ¹¹ It forms a C ⁵ cycloalkyl together.

In other preferred embodiments, the ribose is substituted with a hydroxyproline backbone.
The RRMS described herein can be incorporated into any double-stranded RNA-like molecule described herein, such as an iRNA agent. An iRNA agent can comprise a duplex composed of a hybridized sense strand and an antisense strand, wherein the antisense strand and / or the sense strand is one or more of those described herein. RRMS can be included. RRMS can be introduced at one or more locations in one or both strands of a double stranded iRNA agent. The RRMS may be located at or near the 3 ′ or 5 ′ end of the sense strand (within 1, 2, or 3 positions) or at or near the 3 ′ end of the antisense strand (within 2 or 3 positions) ). In some embodiments, it is preferred that the RRMS is not at or near the 5 ′ end of the antisense strand (within 1, 2, or 3 positions). The RRMS may be present internally and will preferably be located in a region where the antisense is not critical for binding to the target.

  In one embodiment, the iRNA agent can have an RRMS at the 3 'end of the antisense strand (or within 1, 2, or 3 positions from the 3' end). In one embodiment, the iRNA agent is at the 3 ′ end of the antisense strand (or within 1, 2, or 3 positions from the 3 ′ end) and the 3 ′ end of the sense strand (or 1, 2, or 3 from the 3 ′ end). Can have RRMS within the range. In one embodiment, the iRNA agent can have an RRMS at the 3 ′ end of the antisense strand (or within 1, 2, or 3 positions from the 3 ′ end) and an RRMS at the 5 ′ end of the sense strand. Yes, where both ligands are located at the same end of the iRNA agent.

  In some embodiments, two ligands are linked, preferably the ligand on each chain is a hydrophobic component. While not wishing to be bound by theory, it is believed that the hydrophobic ligands can be paired to stabilize iRNA agents through intermolecular Van-Del-Wars interactions.

  In one embodiment, the iRNA agent can have an RRMS at the 3 ′ end of the antisense strand (or within 1, 2, or 3 positions from the 3 ′ end) and an RRMS at the 5 ′ end of the sense strand. Yes, where both RRMS can share the same ligand (eg, cholic acid) by binding each RRMS to a separate location on the ligand. A ligand shared between two adjacent RRMSs is referred to herein as a “hairpin ligand”.

  In other embodiments, the iRNA agent can have an RRMS at the 3 'end of the sense strand and an RRMS at an internal position of the sense strand. The iRNA agent can have an RRMS at an internal position of the sense strand; or can have an RRMS at an internal position of the antisense strand; or an RRMS at an internal position of the sense strand and the antisense strand It is also possible to have an RRMS at the internal location.

  In a preferred embodiment, the iRNA agent comprises a first sequence and a second sequence, the sequences being two separate molecules rather than two sequences located on the same strand, eg under physiological conditions such as helicase or other Preferably, they have sufficient complementarity to each other to hybridize (and thereby form a double-stranded region) under physiological conditions that do not contact the unwinding enzyme.

It is preferred that the first and second sequences be selected such that the ds iRNA agent includes a single stranded region or unpaired region at one or both ends of the molecule. Thus, the ds iRNA agent preferably comprises a first and second sequence paired to include an overhang, wherein the overhang is, for example, one or two 5 ′ or 3 ′ overhangs, although preferably Is a 3 'overhang of 2-3 nucleotides. Most embodiments have a 3 'overhang. Preferred sRNA agents have a single stranded overhang, preferably a 3 ′ overhang, at each end, 1 nucleotide length or preferably 2 or 3 nucleotides in length. These protrusions may be the result of one chain being longer than the other, or the result of a shift of two chains of the same length. The 5 ′ end is preferably phosphorylated.

  A preferred (but not limited) RRMS-containing RNA agent, for example an iRNA agent, is represented in FIG. 4 as formula (R-2). The carrier includes two “backbone attachment points” (hydroxyl groups), one “linkage attachment point”, and one ligand indirectly bound to the carrier by an intervening linkage. The RRMS may be the 5 ′ or 3 ′ terminal subunit of the RNA molecule, ie, one of the two “W” groups may be a hydroxyl group and the other “W” group may be two or more. Of unmodified or modified ribonucleotides. Alternatively, the RRMS may occupy an internal position and the two “W” groups may both be one or more unmodified or modified ribonucleotides. More than one RRMS may be present in an RNA molecule, such as an iRNA agent.

  Modified RNA molecules of formula (R-2) can be obtained using oligonucleotide synthesis methods known in the art. In a preferred embodiment, the modified RNA molecule of formula (II) is synthesized using one or more corresponding RRMS monomer compounds (RRMS monomers, eg, A in FIG. 4 using, for example, the phosphoramidite method or the H-phosphonate linkage method. , B, and C) can be prepared by incorporation into the growing sense or antisense strand.

RRMS monomers generally include two different functionalized hydroxyl groups (OFG ¹ and OFG ^{2 in} FIG. 4) attached to a carrier molecule (see, eg, A in FIG. 4), and a junction point of attachment. As used herein, the term “functionalized hydroxyl group” means that the proton of the hydroxyl group is replaced with another substituent. As shown in representative structures B and C, one hydroxyl group (OFG ¹ ) on the support is functionalized with a protecting group (PG). Another hydroxyl group (OFG ² ) can be directly or indirectly via a linker L with a liquid-phase or solid-phase synthetic support reagent (solid circle), as in (1) B, or (2) Like C, it can be functionalized with phosphorus-containing moieties (eg, phosphoramidites). When the monomer is incorporated into the growing sense or antisense strand, the junction point can be attached to a hydrogen atom, a linkage, or a ligand linked to the linkage (R in Scheme 1). See). The ligand linked to the linking moiety can be combined with the monomer when incorporated into the growing chain, but this need not be the case. In some embodiments, a linkage, ligand, or ligand linked to a linkage can be coupled to a “precursor” RRMS after the “precursor” RRMS monomer is incorporated into the chain.

For example, from T. W. Greene and PGM Wuts, "Protective Groups in Organic Synthesis", 2nd edition, John Wiley and Sons (1991), (OFG ¹ ) It is possible to select protecting groups as desired. The protecting group is preferably stable under amidite synthesis conditions, storage conditions, and oligonucleotide synthesis conditions. The hydroxyl group, —OH, is a nucleophilic group (ie, Lewis base) and reacts with the electrophile (ie, Lewis acid) via oxygen. Hydroxyl groups in which hydrogen is replaced by a protecting group such as a triarylmethyl group or a trialkylsilyl group are hardly reactive as electrophiles in substitution reactions. Thus, protected hydroxyl groups are useful, for example, in preventing homobonding of compounds exemplified by structure C during oligonucleotide synthesis. A preferred protecting group is a dimethoxytrityl group.

If OFG ^{2 of} B contains a linker, eg, a long chain organic linker, coupled with a soluble or insoluble support reagent, once OFG ¹ is deprotected, other nucleosides containing electrophilic groups (eg, amidite groups) or Once free to react with the monomer as a nucleophile, solution and solid phase synthesis techniques can be used to construct natural and / or modified ribonucleotide chains. Alternatively, a natural or modified ribonucleotides or oligoribonucleotides strand, it is possible to bond with the monomer C via amidite group or H- phosphonate group OFG ^2. After this operation, OFG ¹ can be deblocked and the recovered nucleophilic hydroxyl group can react with other nucleosides or monomers containing electrophilic groups (see FIG. 1). ). R ′ may be substituted or unsubstituted alkyl or alkenyl. In preferred embodiments, R ′ is methyl, allyl or 2-cyanoethyl. R ″ may be a C ₁ -C ₁₀ alkyl group, and R ″ is preferably a branched group containing 3 or more carbons, such as isopropyl.

B OFG ² can also functionalize the hydroxyl with a linker, which in turn contains a liquid or solid phase synthesis support reagent at the other end of the linker. The support reagent may be any support medium capable of supporting the monomers described herein. By attaching the monomer to an insoluble support via a linker L, it is possible to solubilize the monomer (and the growing chain) in the solvent in which the support is placed. Solubilized but still immobilized monomers can react with the reagents in the surrounding solvent; unreacted reagents and soluble by-products are solids to which the monomer or monomer-derived product is bound. It can be easily washed away from the support. Alternatively, the monomer can be coupled with a soluble support component, such as polyethylene glycol (PEG), and the chain can be constructed using liquid phase synthesis techniques. The choice of linker and support medium is within the skill of the art. In general, the linker may be —C (O) (CH ₂ ) _q C (O) —, or —C (O) (CH ₂ ) _q S—, preferably oxalyl, succinyl or thioglycolyl. It is not possible to use a standard porous glass solid phase synthesis support with a fluoride labile 5 'silyl protecting group. This is because the glass is decomposed by fluoride and the amount of full-length product is greatly reduced. A polystyrene-based support that is stable to fluoride, or PEG is preferred.

Preferred carriers have the general formula (R-3) given below. (In the structure, preferred backbone attachment points can be selected from R ¹ or R ² ; R ³ or R ⁴ ; or R ⁹ and R ¹⁰ when Y is CR ⁹ R ¹⁰ (two Select a position and let it be two backbone attachment points, for example R ¹ and R ⁴ , or R ⁴ and R ⁹ ) The preferred attachment point is R ⁷ ; when X is CH ₂ R ⁵ or R containing ^6. these carriers are described in the following as an entity that can be incorporated in the chain. Thus, of course, these structures, one (in the case of a terminal position) or two (internal position the point of attachment of the case), for example ^{R 1} or ^R 2; ^{R 3} or ^{R 4;} or ^{R 9} and ^{R 10} (when Y is ^CR 9 ^{R 10)} is a phosphate or modified phosphate, e.g., sulfur-containing For example, one of the aforementioned R groups may be -CH2-, where one bond is bonded to the carrier and one bond is a backbone atom, such as bonded oxygen or It is bonded to the central phosphorus atom.)

X is N (CO) R ⁷ , NR ⁷ or CH ₂ ; Y is NR ⁸ , O, S, CR ⁹ R ¹⁰ ; and Z is CR ¹¹ R ¹² or absent.
Each of R ¹ , R ² , R ³ , R ⁴ , R ⁹ , and R ¹⁰ is independently H, OR ^a , or (CH ₂ ) _n OR ^b , provided that R ¹ , R ² , R ³ , R ⁴ , R ⁹ , and R ¹⁰ are OR ^a and / or (CH ₂ ) _n OR ^b .

Each of R ⁵ , R ⁶ , R ¹¹ , and R ¹² is independently a ligand, H, C ₁ -C ₆ alkyl optionally substituted with 1 to 3 R ¹³ , or C (O) NHR ⁷ Or R ⁵ and R ¹¹ together form a C ₃ -C ₈ cycloalkyl optionally substituted by R ¹⁴ .

R ⁷ is H, a ligand, or C ₁ -C ₂₀ alkyl substituted with NR ^c R ^d ; R ⁸ is H or C ₁ -C ₆ alkyl; R ¹³ is hydroxy, C ₁ -C ₄ alkoxy R ¹⁴ is NR ^c R ⁷ ; R ¹⁵ is C ₁ -C ₆ alkyl, optionally substituted with cyano, or C ₂ -C ₆ alkenyl; R ¹⁶ is C _1- C ₁₀ alkyl; and R ¹⁷ is a liquid phase or solid phase support reagent.

L is —C (O) (CH ₂ ) _q C (O) —, or —C (O) (CH ₂ ) _q S—; R ^a is CAr ₃ ; R ^b is P (O) ( O ⁻ ) H, P (OR ¹⁵ ) N (R ¹⁶ ) ₂ or LR ¹⁷ ; R ^c is H or C ₁ -C ₆ alkyl; and R ^d is H or a ligand.

Each Ar is independently C ₆ -C ₁₀ aryl optionally substituted with C ₁ -C ₄ alkoxy; n is 1-4; and q is 0-4.
Representative carriers include, for example, a carrier where X is N (CO) R ⁷ or NR ⁷ , Y is CR ⁹ R ¹⁰ and Z is absent; or X is N (CO) R ⁷ or NR ⁷ A carrier wherein Y is CR ⁹ R ¹⁰ and Z is CR ¹¹ R ¹² ; or X is N (CO) R ⁷ or NR ⁷ ; Y is NR ⁸ ; and Z is CR ¹¹ A carrier that is R ¹² ; or a carrier wherein X is N (CO) R ⁷ or NR ⁷ , Y is O, and Z is CR ¹¹ R ¹² ; or X is CH ₂ and Y is CR ⁹ A carrier that is R ¹⁰ and Z is CR ¹¹ R ¹² and R ⁵ and R ¹¹ together form a C ₆ cycloalkyl (formula H, z = 2), or an indane ring system, eg, X is is CH _2, Y is ^CR 9 ^{R 10,} Z is ^CR 11 ^{R 1} , And the and ^{R 5} and ^{R 11} is a carrier to form a _{C 5} cycloalkyl together (Formula H, z = 1).

In some embodiments, the carrier is a pyrroline or 3-hydroxyproline ring system, eg, X is N (CO) R ⁷ or NR ⁷ , Y is CR ⁹ R ¹⁰ and Z is absent. May be based on (formula D).

OFG ¹ is preferably bonded to a primary carbon bonded to one of the carbons in the 5-membered ring, such as an exocyclic alkylene group, such as a methylene group (—CH ₂ OFG ^{1 in} Formula D). OFG ² is preferably bonded directly to one of the carbons in the 5-membered ring (—OFG ^{2 in} Formula D). For pyrroline-based carriers, —CH ₂ OFG ¹ can bind to C-2 and OFG ² can bind to C-3; or —CH ₂ OFG ¹ can bind to C-3, and OFG ² can bind to C-4. In some embodiments, CH ₂ OFG ¹ and OFG ² may be substituted at one of the aforementioned carbons at the geminal position. With respect to the 3-hydroxyproline-based carrier, —CH ₂ OFG ¹ can bind to C-2 and OFG ² can bind to C-4. Thus, pyrroline-based and 3-hydroxyproline-based monomers can contain bonds (eg, carbon-carbon bonds), where the rotation of the bond is limited for that individual bond (eg, due to the presence of a ring). Limit). Thus, CH ₂ OFG ¹ and OFG ² may be cis or trans relative to each other in any of the foregoing pairs. Thus, all cis / trans isomers are expressly included. Monomers can contain one or more asymmetric centers and can therefore exist as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such monomer isomers are expressly included. The connection point is preferably nitrogen.

In some embodiments, the carrier is a piperidine ring system (formula E), eg, X is N (CO) R ⁷ or NR ⁷ , Y is CR ⁹ R ¹⁰ , and Z is CR ¹¹ R ¹² . May be based on things.

OFG ¹ is preferably bonded to a primary carbon bonded to one of the carbons in the 6-membered ring, such as an exocyclic alkylene group such as a methylene group (n = 1) or an ethylene group (n = 2) [formula E in ^{_{- (CH 2) n OFG 1}} ]. OFG ² is preferably bonded directly to one of the carbons in the 6-membered ring (—OFG ^{2 in} Formula E). - _{(CH 2)} n OFG ¹ and OFG ² may also be disposed in a geminal manner on the ring, i.e., two groups bonded to the same carbon, for example, C-2, C-3 or C-4, It is possible. Alternatively, — (CH ₂ ) _n OFG ¹ and OFG ² may be placed in a vicinal position on the ring, ie, two groups can be attached to adjacent carbon atoms of the ring, eg, — _{(CH 2)} n OFG ¹ binds to C-2, and OFG ² is C-3 and is capable of binding _;-( CH ₂₎ n OFG ¹ binds to C-3, and OFG ² the C-2 and is capable of binding _;-( CH ₂₎ n OFG ¹ binds to C-3, and OFG ² is capable of binding to C-4; or - (CH _{2 N} OFG ¹ can bind to C-4 and OFG ² can bind to C-3. Piperidine-based monomers can thus contain a bond (eg a carbon-carbon bond), where the rotation of the bond is restricted for that individual bond (eg due to the presence of a ring). _{Thus, - (CH 2) n OFG} 1 and OFG ² may be cis or trans with respect to one another in any of the pairings delineated above. Thus, all cis / trans isomers are expressly included. Monomers can contain one or more asymmetric centers and can therefore exist as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such monomer isomers are expressly included. The connection point is preferably nitrogen.

In some embodiments, the support is a piperazine ring system (formula F), for example, where X is N (CO) R ⁷ or NR ⁷ , Y is NR ⁸ and Z is CR ¹¹ R ¹² , or For example, it may be based on a morpholine ring system (formula G) wherein X is N (CO) R ⁷ or NR ⁷ , Y is O, and Z is CR ¹¹ R ¹² .

OFG ¹ is preferably bonded to a primary carbon bonded to one of the carbons in the 6-membered ring, such as an exocyclic alkylene group, such as a methylene group (—CH ₂ OFG ¹ in Formula F or Formula G). OFG ² is preferably bonded directly to one of the carbons in the 6-membered ring (—OFG ² in Formula F or Formula G). With respect to F and G, —CH ₂ OFG ¹ may be bound to C-2 and OFG ² may be bound to C-3; or vice versa. In some embodiments, CH ₂ OFG ¹ and OFG ² may be substituted at one of the aforementioned carbons at the geminal position. Piperazine-based and morpholine-based monomers can thus contain a bond (eg a carbon-carbon bond), where the rotation of the bond is limited for that individual bond (eg, due to the presence of a ring). Thus, CH ₂ OFG ¹ and OFG ² may be cis or trans relative to each other in any of the foregoing pairs. Thus, all cis / trans isomers are expressly included. Monomers can contain one or more asymmetric centers and can therefore exist as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such monomer isomers are expressly included. R ′ ″ may be, for example, C ₁ -C ₆ alkyl, preferably CH ₃ . In both Formula F and Formula G, the connecting point is preferably nitrogen.

In some embodiments, the carrier is, for example, X is CH ₂ , Y is CR ⁹ R ¹⁰ , Z is CR ¹¹ R ¹² , and R ⁵ and R ¹¹ together are C ₆ cyclo Decalin ring system (formula H, z = 2) forming alkyl, or for example X is CH ₂ , Y is CR ⁹ R ¹⁰ , Z is CR ¹¹ R ¹² , and R ⁵ and R ¹¹ are It may be based on an indane ring system (formula H, z = 1) that together forms C ₅ cycloalkyl.

OFG ¹ is bonded to a primary carbon bonded to ^one of C-2, C-3, C-4, or C-5, for example, an exocyclic methylene group (n = 1) or an ethylene group (n = 2). [— (CH ₂ ) _n OFG ^{1 in} Formula H] is preferred. OFG ² preferably binds directly to one of C-2, C-3, C-4, or C-5 (—OFG ^{2 in} Formula H). - _{(CH 2)} n OFG ¹ and OFG ² may have disposed in a geminal manner on the ring, i.e., two groups have the same carbon, for example, C-2, C-3, C-4 or C-5, And may be combined. Alternatively, — (CH ₂ ) _n OFG ¹ and OFG ² may be placed in a vicinal position on the ring, ie, two groups can be attached to adjacent carbon atoms of the ring, eg, — _{(CH 2)} n OFG ¹ binds to C-2, and OFG ² is C-3 and is capable of binding _;-( CH ₂₎ n OFG ¹ binds to C-3, and OFG ² the C-2 and is capable of binding _;-( CH ₂₎ n OFG ¹ binds to C-3, and OFG ² is capable of binding to C-4; or - (CH ₂ ) _N OFG ¹ can bind to C-4 and OFG ² can bind to C-3; — (CH ₂ ) _n OFG ¹ binds to C-4, and OFG ² binds to C— 5 and is capable of binding; or _{- (CH} 2) n OFG ¹ Bound to C-5, and OFG ² is capable of binding to C-4. Decalin-based or indane-based monomers can thus contain a bond (eg a carbon-carbon bond), where the rotation of the bond is restricted for that individual bond (eg due to the presence of a ring). _{Thus, - (CH 2) n OFG} 1 and OFG ² may be cis or trans with respect to one another in any of the pairings delineated above. Thus, all cis / trans isomers are expressly included. Monomers can contain one or more asymmetric centers and can therefore exist as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such monomer isomers are expressly included. In preferred embodiments, the substitutions at C-1 and C-6 are trans to each other. The connecting point is preferably C-6 or C-7.

  Other carriers may include carriers based on 3-hydroxyproline (Formula J).

_{Thus, - (CH 2) n OFG} 1 and OFG ² may have be cis or trans with each other. Thus, all cis / trans isomers are expressly included. Monomers contain one or more asymmetric centers and can therefore exist as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such monomer isomers are expressly included. The connection point is preferably nitrogen.

A typical carrier is shown in FIG.
In some embodiments, a component, such as a ligand, can be indirectly bound to a carrier by intervening linkages. Coupling unit is coupled in tethering attachment point (TAP) and a carrier, preferably any _C 1 _{-C 100} carbon containing component (e.g. _{C 1 ~C 75, C 1 ~C} 50 having at least one nitrogen atom, _{C 1 ~C 20, C 1 ~C} 10, C 1 ~C 6) can include. In a preferred embodiment, the nitrogen atom forms part of the terminal amino group on the linkage and can serve as a point of attachment to the ligand. Preferred coupling portion _{(underlined), TAP - (CH 2)} n NH 2; TAP -C (O) (CH 2) n NH 2; or _{TAP -NR '''' (CH} 2) n NH 2 is Where n is 1-6, R ″ ″ is C ₁ -C ₆ alkyl, and R ^d is hydrogen or a ligand. In other embodiments, nitrogen terminal oxyamino group, e.g., -ONH _2, or hydrazino group, it is possible to form part of -NHNH _2. The linkage may be optionally substituted, for example with hydroxy, alkoxy, perhaloalkyl, and / or optionally inserted with one or more additional heteroatoms, such as N, O, or S. . Preferred ligands linked to the linkage include, for example, TAP- (CH ₂ ) _n NH (ligand) ,
_{TAP- C (O) (CH 2} ) n NH ( ligand), or _{TAP- NR '''' (CH} 2) n NH ( Ligand);
TAP- (CH ₂ ) _n ONH (ligand) , TAP- C (O) (CH ₂ ) _n ONH (ligand) , or TAP- NR ″ ″ (CH ₂ ) _n ONH (ligand) ; TAP- (CH ₂ ) _n NHNH ₂ (ligand) ,
TAP- C (O) (CH ₂ ) _n NHNH ₂ (ligand) or TAP- NR ″ ″ (CH ₂ ) _n NHNH ₂ (ligand)
Is mentioned.

In other embodiments, the linkage can include an electrophilic group, preferably at a terminal position of the linkage. Preferred electrophilic groups are, for example, aldehydes, alkyl halides, mesylate, tosylate, nosylate, or brosylate, or activated carboxylic acid esters, such as NHS esters, or pentafluorophenyl esters. A preferred linking part (underlined part) includes TAP- (CH ₂ ) _n CHO ; TAP- C (O) (CH ₂ ) _n CHO ; or TAP- NR ″ ″ (CH ₂ ) _n CHO (n is 1 an ~6, R '''' is _C 1 -C ₆ alkyl);
Alternatively _{TAP - (CH 2) n C} (O) ONHS; TAP- C (O) (CH 2) n C (O) ONHS; or _{TAP- NR '''' (CH} 2) n C (O) ONHS ( n is 1-6 and R ″ ″ is C ₁ -C ₆ alkyl);
_{TAP- (CH 2) n C (} O) OC 6 F 5; TAP- C (O) (CH 2) n C (O) OC 6 F 5; or _{TAP- NR '''' (CH} 2) n C (O) OC ₆ F ₅ (n is 1-6, R ″ ″ is C ₁ -C ₆ alkyl);
Alternatively _{- (CH 2) n CH 2} LG; TAP- C (O) (CH 2) n CH 2 LG; or _{TAP- NR '''' (CH} 2) n CH 2 LG (n is 1 to 6 , R ″ ″ is C ₁ -C ₆ alkyl) (LG may be a leaving group such as halide, mesylate, tosylate, nosylate, brosylate). Linkage can be accomplished by coupling a nucleophilic group of the ligand, such as a thiol or amino group, with an electrophilic group on the linkage.

What is to be linked A wide variety of things (entities) can be linked to the iRNA agent, eg to the carrier of RRMS. Examples are described below in connection with RRMS, but the RRMS is merely preferred and the entity can be attached to the iRNA agent at other points. Preferred entities are those that target the liver.

A preferred component is a ligand, which is bound to the RRMS carrier, preferably covalently, either directly or indirectly through an intervening linkage. In a preferred embodiment, the ligand is bound to the carrier via an intervening linkage. As discussed previously, the ligand or ligand linked to the linking moiety may be present on the RRMS monomer when the RRMS monomer is incorporated into the growing chain. In some embodiments, the “precursor” RRMS can incorporate a ligand after the “precursor” RRMS monomer has been incorporated into the growing chain. For example, for example, incorporating an RRMS monomer with a linkage having an amino terminus (ie no ligand attached), eg TAP- (CH ₂ ) _n NH _2, into the extending sense or antisense strand. Is possible. In a later operation, i.e. after incorporation of the precursor monomer into the chain, the ligand having an electrophilic group (e.g., pentafluorophenyl ester or aldehyde group) is then replaced with the electrophilic group of the ligand and the precursor RRMS. Can be coupled to the precursor RRMS by coupling with a terminal nucleophilic group.

  In preferred embodiments, the ligand alters the distribution, targeting or longevity of the iRNA agent into which the ligand is incorporated. In a preferred embodiment, the ligand is a selected target, such as a molecule, cell or cell type, compartment, such as a cell or organ compartment, tissue, organ or body, for example as compared to a molecular species in which no such ligand is present. High affinity for the region. Preferred ligands will not participate in double stranded pairing in double stranded nucleic acids.

  Preferred ligands are capable of improving transport, hybridization, and specificity, and produce natural or modified oligoribonucleotides, or any combination of monomers and / or natural or modified ribonucleotides described herein. It is also possible to improve the nuclease resistance of polymer molecules comprising

Common ligands include, for example, therapeutic modulators to increase uptake; diagnostic compounds or reporter groups to examine distribution; crosslinkers; and components that confer nuclease resistance, for example. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptidomimetics.

  Ligands include naturally occurring substances such as proteins (eg, human serum albumin (HSA), low density lipoprotein (LDL), or globulins); carbohydrates (eg, dextran, pullulan, chitin, chitosan, inulin, cyclohexane). Dextrin or hyaluronic acid); or lipids. The ligand may be a recombinant or synthetic molecule, such as a synthetic polymer, such as a synthetic polyamino acid. Examples of polyamino acids include polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic anhydride copolymer, poly (L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, There are N- (2-hydroxypropyl) methacrylamide copolymers (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly (2-ethyl acrylate), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, polyamine There are quaternary salts or alpha helical peptides.

  A ligand can also include an antibody that binds to a specific cell type, such as a targeting group, eg, a substance that targets a cell or tissue, eg, a lectin, glycoprotein, lipid or protein, eg, hepatocyte. Targeting groups are thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin, carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine polyvalent mannose, polyvalent fucose A glycosylated polyamino acid, polyvalent galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, biotin, or RGD peptide or RGD peptidomimetic.

Other examples of ligands include dyes, intercalating agents (eg, acridine), cross-linking agents (eg, psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, saphyrin), polycyclic aromatic hydrocarbons (eg, phenazine, Dihydrophenazine), artificial endonucleases (eg EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (hexadecyl) glycerol, geranyloxyhexyl group , Hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholic acid, dimethoxytrityl, or fe Kisajin), and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [ MPEG] 2, polyamino, alkyl, substituted alkyl , Radiolabeled markers, enzymes, haptens (eg, biotin), transport / absorption enhancers (eg, aspirin, vitamin E, folic acid), synthetic ribonucleases (eg, imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole complexes, tetra Eu3 + complex of aza macrocycle), dinitrophenyl, HRP, or AP.

A ligand can be a protein (eg, a glycoprotein) or a peptide, such as a molecule having specific affinity for a common ligand, or an antibody (eg, an antibody that binds to a specific cell type such as cancer cells, endothelial cells, or bone cells). It's okay. Ligand can also include hormones and hormone receptors. The ligand is a non-peptide molecular species such as lipid, lectin, carbohydrate, vitamin, cofactor, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine polyvalent mannose, or multivalent fucose May also be included. The ligand may be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB.

  The ligand can increase the uptake of the iRNA agent into the cell, for example by disrupting the cytoskeleton of the cell, for example by disrupting the microtubules, microfilaments, and / or intermediate filaments of the cell. It may be a substance, for example a drug. The drug is, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin. It's okay.

  The ligand can increase the uptake of the iRNA agent into the cell, for example by activating an inflammatory response. Exemplary ligands that appear to have such effects include tumor necrosis factor α (TNFα), interleukin-1β, or γ interferon.

  In one aspect, the ligand is a lipid or lipid-based molecule. Such lipids or lipid-based molecules preferably bind to serum proteins such as human serum albumin (HSA). HSA binding ligands can distribute the complexes of the invention to target tissues of the body, such as non-liver target tissues. Preferably, the target tissue is the liver including liver parenchymal cells. Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. Lipids or lipid-based ligands can (a) increase resistance to degradation of the complex, (b) increase targeting or transport to target cells or cell membranes, and / or (c). It can be used to modulate the binding of serum proteins such as HSA.

  Lipid-based ligands can be used to modulate, eg control, the binding of the complex of the invention to the target tissue. For example, lipids or lipid-based ligands that bind more strongly to HSA will appear less targeted to the liver and therefore less likely to be removed from the body.

  In a preferred embodiment, the lipid-based ligand binds HSA. The ligand preferably binds HSA with sufficient affinity such that the complex of the invention is preferably distributed in non-renal tissue. However, the affinity is preferably not so strong that the binding between HSA and the ligand is irreversible.

  In other embodiments, the ligand is a component that is taken up by a target cell, such as a proliferating cell, such as a vitamin. These ligands are very useful for treating diseases characterized by unwanted cell proliferation, such as malignant or non-malignant cell proliferation, such as cancer cell proliferation. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. HSA and low density lipoprotein (LDL) are also included.

In other embodiments, the ligand is a cell permeable material, preferably a helical cell permeable material. The substance is preferably amphiphilic. Exemplary substances are peptides such as tat or antennapedia. Where the substance is a peptide, it is possible to modify the peptide, including the use of peptidyl mimetics, invertmers, non-peptide or pseudo-peptide bonds, and D-amino acids. The helical material is preferably an α helical material, preferably having a lipophilic and oleophobic phase.

  The ligand may be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule that can fold into a fixed three-dimensional structure similar to a natural peptide. The binding of peptides and peptidomimetics and iRNA agents can affect the pharmacokinetic distribution of iRNA, such as by increasing cellular recognition and absorption. A peptide or peptidomimetic component may be about 5-50 amino acids long, eg, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long (see, eg, Table 2 reference).

The peptide or peptidomimetic can be, for example, a cell permeable peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (eg, composed primarily of Tyr, Trp, or Phe). The peptide moiety may be a dendrimer peptide, a constrained peptide or a cross-linked peptide. The peptide moiety may be an L-peptide or a D-peptide. In other alternatives, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 6715).
An RFGF analog comprising a hydrophobic MTS (eg, amino acid sequence AALLPVLLAAP (SEQ ID NO: 6716)) can also be a targeting moiety. The peptide moiety may be a “delivery” peptide that can carry large polar molecules including peptides, oligonucleotides, and proteins across the cell membrane. For example, a sequence from the HIV Tat protein (GRKKRRQRRRPPPQ (SEQ ID NO: 6717)) and a sequence from the Drosophila antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 6718)) have been found to be able to function as delivery peptides. . The peptide or peptidomimetic may be encoded by a random sequence of DNA, such as a peptide identified from a phage display library or a one bead one compound (OBOC) combinatorial library (Lam et al. al.), Nature, 354: 82-84, 1991). The peptide or peptidomimetic linked to an iRNA agent via an incorporated monomer unit is preferably a cell targeting peptide, such as an arginine-glycine-aspartic acid (RGD) peptide, or an RGD mimic. The length of the peptide portion can range from about 5 amino acids to about 40 amino acids. The peptide moiety can have structural modifications, such as to increase stability or to obtain conformational properties. Any structural modification described below can be used.

The RGD peptide moiety can be used to target tumor cells, such as endothelial tumor cells or breast cancer tumor cells (Zitzmann et al., Cancer Res., 62: 5139-43, 2002). ). RGD peptides may promote the tropism of iRNA agents that target tumors in various other tissues, including lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8: 783-787, 2001). RGD peptides can be linear or cyclic and can be modified, eg, glycosylated or methylated, to promote directivity targeting specific tissues. For example, glycosylated RGD peptides can deliver iRNA agents to tumor cells that express α _v β ₃ (Haubner et al., Jour. Nucl. Med., 42: 326-336). 2001).

Peptides that target abundant markers in proliferating cells can be used. For example, RGD-containing peptides and peptidomimetics can target cancer cells, particularly cells that present α _v β ₃ integrin. Thus, it seems possible to use RGD peptides, cyclic peptides containing RGD, RGD peptides containing D-amino acids, and synthetic RGD mimics. In addition to RGD, other components that target the α _V β ₃ integrin ligand can be used. In general, such ligands can be used to control proliferating cells and angiogenesis. Preferred complexes of this type include iRNA agents that target PECAM-1, VEGF, or other oncogenes, such as the oncogenes described herein.

  A “cell penetrating peptide” is capable of penetrating cells, eg, microbial cells such as bacterial or fungal cells, or mammalian cells such as human cells. Microbial cell penetrating peptides are, for example, α-helical linear peptides (eg LL-37 or cellopin P1), disulfide bond-containing peptides (eg α-defensins, β-defensins or bactenecins), or only one or two A peptide (eg PR-39 or indolicidin) mainly containing The cell penetrating peptide can also include a nuclear localization signal (NLS). For example, the cell penetrating peptide may be a two-part amphipathic peptide such as MPG derived from the fusion peptide domain of HIV-1 gp41 and the NLS of the SV40 large T antigen (Simeoni et al. ), Nucl.Acids Res.31: 2717-2724, 2003).

In one embodiment, the targeting peptide linked to the RRMS may be an amphipathic alpha helical peptide. Exemplary amphipathic α-helical peptides include cecropin, lycotoxin, paradoxine, buforin, CPF, bombinin-like peptide (BLP), cathelicidin, seratotoxin, S. cerevisiae. clava peptides, hagfish intestinal antimicrobial peptides (HFIAP), magainin, Burebinin -2, Damasepuchin, melittin, Pureu rosiglitazone Dinh, _{H 2} A peptide, Xenopus peptides, Esukarenchin -1, and there are Kaerin, these It is not limited to only. In order to keep the stability of the helix completely, it may be preferable to consider several factors. For example, use the maximum number of helical stabilizing residues (eg leu, ala, or lys) and the minimum number of helical destabilizing residues (eg proline or cyclic monomer units). Residues with cap structures are also contemplated (eg, Gly is an example of an N-cap structure residue and / or C-terminal amidation can be used to provide a special H bond to stabilize the helix. Is possible). Stability may be brought about by the formation of salt bridges between residues with opposite charges, i ± 3, or i ± 4 positions apart. For example, a cationic residue such as lysine, arginine, homo-arginine, ornithine or histidine can form a salt bridge with an anionic residue, glutamic acid or aspartic acid.

  Peptides and peptide mimetic ligands include natural or modified peptides, such as D or L peptides; α, β, or γ peptides; N-methyl peptides; azapeptides; peptides having one or more amides, ie one Or a peptide bond substituted with multiple urea, thiourea, carbamate, or sulfonylurea bonds; or a ligand with a cyclic peptide.

Methods for Making iRNA Agents iRNA agents can be modified or unnatural bases, such as co-pending and co-owned US Provisional Application No. 60/463, filed Apr. 17, 2003, incorporated herein by reference. 772 and / or bases described in co-pending and co-owned US Provisional Application No. 60 / 465,802, filed Apr. 25, 2003, incorporated herein by reference. Can be included. Monomers and iRNA agents containing such bases are disclosed in US Provisional Application No. 60 / 463,772 filed April 17, 2003, and / or US Provisional Application filed April 25, 2003. It can be made by the method found in application 60 / 465,802.

  The invention further includes iRNA agents having modified or unnatural bases and other elements described herein. For example, the present invention provides an iRNA agent described herein, for example, an iRNA agent having a palindromic structure, an iRNA agent having a non-standard pairing, a gene described herein, for example, a gene active in the liver. Targeted iRNA agent, iRNA agent having the configuration or structure described herein, iRNA combined with amphiphilic delivery agent described herein, iRNA combined with drug delivery module described herein An iRNA agent administered as described herein, or an iRNA agent formulated as described herein, which also incorporates a modified or unnatural base.

  Synthesis and purification of oligonucleotide peptide conjugates can be performed by established methods. For example, Trufert et al., Tetrahedron, 52: 3005, 1996; and Manoharan, “Oligonucleotide Conjugates in Antisense Technology, Tetrahedron Inc., Antisense Drug Teck, Antisense Drug Teck, S. T. Crooke, Marcel Dekker, Inc.), 2001.

In one embodiment of the invention, a peptidomimetic can be modified to create a constrained peptide that has a clear, specific and preferred conformation that increases the potency and selectivity of the peptide. It is possible to make it. For example, the constrained peptide may be an azapeptide (Gante, Synthesis, 405-413, 1989). An azapeptide is synthesized by replacing the α-carbon of an amino acid with a nitrogen atom without changing the structure of the amino acid side chain. For example, azapeptides can be synthesized by using hydrazine in traditional peptide synthesis coupling methods, such as by reacting hydrazine with a “carbonyl donor” such as phenyl chloroformate.

In one embodiment of the invention, the peptide or peptidomimetic (eg, a peptide or peptidomimetic linked to RRMS) may be an N-methyl peptide. N-methyl peptides are composed of N-methyl amino acids, but N-methyl amino acids may provide other means of resistance to proteolytic cleavage by providing additional methyl groups in the peptide backbone. is there. N-methyl peptides can be synthesized by methods known in the art (eg, Lindgren et al.
et al. ), Trends Pharmacol. Sci. 21:99, 2000; Cell Penetrating Peptides: Processes and
Applications, Langel, ed. , CRC Press, Boca Raton, FL, 2002; Fische et al., Bioconjugate. Chem. 12: 825, 2001; Wander et al., J. MoI. Am. Chem. Soc. 124: 13382, 2002). For example, the Ant peptide or Tat peptide may be an N-methyl peptide.

  In one embodiment of the invention, the peptide or peptidomimetic (eg, a peptide or peptidomimetic linked to RRMS) may be a β-peptide. β-peptides form stable secondary structures such as helices, pleated sheets, turns and hairpins in solution. A cyclic derivative of β-peptide can be folded into a nanotube in the solid state. β-peptides are resistant to degradation by proteolytic enzymes. β-peptides can be synthesized by methods known in the art. For example, the Ant peptide or Tat peptide may be a β-peptide.

  In one embodiment of the invention, the peptide or peptidomimetic (eg, a peptide or peptidomimetic linked to RRMS) may be an oligocarbamate. Oligocarbamate peptides are internalized into cells by transport pathways facilitated by carbamate transporters. For example, the Ant peptide or Tat peptide may be an oligocarbamate.

In one embodiment of the invention, a peptide or peptidomimetic (eg, a peptide or peptidomimetic linked to RRMS) is an oligourea complex (or oligothiothiol) in which the amide bond of the peptidomimetic is replaced with a urea moiety. Urea complex). Substitution of the amide bond confers high resistance to degradation by proteolytic enzymes such as those in the gastrointestinal tract. In one embodiment, the oligourea conjugate is linked to an iRNA agent for use in oral delivery. The backbone in each repeating unit of the oligourea peptidomimetic may extend by one carbon atom compared to the natural amino acid. The spread of one carbon atom can increase, for example, the stability and lipophilicity of the peptide. Thus, oligourea peptides may be advantageous when the iRNA agent is intended to cross the bacterial cell wall, or when the iRNA agent must cross the blood-brain barrier, such as for the treatment of neurological disorders. is there. In one embodiment, a hydrogen bonding unit is attached to the oligourea peptide to create a high affinity with the receptor. For example, the Ant peptide or Tat peptide may be an oligourea complex (or oligothiourea complex).

  The siRNA peptide complexes of the invention can be associated with, for example, linked to RRMS present at various locations on the iRNA agent. For example, the peptide may be bound to the terminus either on the sense strand or on the antisense strand, or the peptide may be bis-bonded (one peptide linked at each end, one end bound to the sense strand, one end Binds to the antisense strand). In other options, the peptide may be bound internally, such as in a loop of short hairpin structure iRNA agents. In yet another option, the peptide may be associated with a complex, such as a peptide-carrier complex.

  A peptide-carrier complex includes at least one carrier molecule that can encapsulate one or more iRNA agents (such as for delivery to biological systems and / or cells) and the carrier complex to a particular tissue or cell type. A peptide moiety linked to the outside of the carrier molecule, such as for directing against. The carrier complex can also carry additional targeting molecules on the outside of the complex, or a cell fusion agent that helps delivery to the cell. One or more iRNA agents encapsulated within the carrier may be conjugated with a lipophilic molecule that can aid in the delivery of the substance to the interior of the carrier.

  The carrier molecule or carrier structure may be, for example, a micelle, a liposome (eg, a cationic liposome), a nanoparticle, a microsphere, or a biodegradable polymer. The peptide moiety can be linked to the carrier molecule by various bonds such as disulfide bonds, acid labile bonds, peptide-based bonds, oxyamino bonds or hydrazine bonds. For example, the peptide-based linkage can be a GFLG peptide. Some bindings have individual advantages that can be considered depending on the target tissue or intended application. For example, peptide bonds are stable in the bloodstream but are susceptible to enzymatic cleavage in lysosomes.

Targeting The iRNA agents of the invention are particularly useful when targeting the liver. An iRNA agent can be liver-directed by incorporating an RRMS that includes a ligand that targets the liver. For example, the liver targeting agent is a lipophilic moiety. Preferred lipophilic moieties include lipid, cholesterol, oleyl, retinyl, or cholesteryl residues. Other lipophilic moieties that can function as liver targeting agents include cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (hexadecyl) glycerol, geranyloxyhexyl group , Hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl, or phenoxazine included.

  An iRNA agent can also be liver-directed by binding the iRNA agent to a low density lipoprotein (LDL) (eg, lactosylated LDL). A polymer carrier complexed with a sugar residue can also function so that the iRNA agent is liver-directed.

Targeting agents that incorporate sugars such as galactose and / or analogs thereof are particularly useful. These targeting agents specifically target liver parenchymal cells. For example, the targeting moiety may comprise two or more, preferably two or three galactose moieties separated from each other by about 15 angstroms. Alternatively, the targeting moiety can be lactose (eg, three lactose moieties), which is glucose coupled to galactose. The targeting moiety may be N-acetyl-galactosamine, N-Ac-glucosamine. The targeting moiety of mannose or mannose-6-phosphate can be used to target macrophages.

It is also possible to direct an iRNA agent to non-renal tissues such as the liver using binding of the iRNA agent and serum albumin (SA) such as human serum albumin.
An iRNA agent that targets the liver with the RRMS targeting moiety described herein can target a gene expressed in the liver.

  An iRNA agent that targets the liver with an RRMS targeting moiety described herein can target a gene expressed in the liver. For example, an iRNA agent can target p21 (WAF1 / DIP1), P27 (KIP1), α-fetoprotein gene, β-catenin, or c-MET, for example, to treat liver cancer. is there. In another embodiment, the iRNA agent is, for example, HDL / LDL cholesterol imbalance; dyslipidemia, eg, familial combined hyperlipidemia (FCHL), or acquired hyperlipidemia; ApoB-100 can be targeted for the treatment of statin resistant hypercholesterolemia; coronary artery disease (CAD); coronary heart disease (CHD) or atherosclerosis. In another embodiment, the iRNA agent is for example for rhabdomyosarcoma forkhead homolog (FKHR) for the treatment of diabetes, eg, for the purpose of inhibiting hepatic glucose production in a mammal (eg, human); Glucagon; glucagon receptor; glycogen phosphorylase; PPAR-γ coactivator (PGC-1); fructose-1,6-bisphosphatase; glucose-6-phosphatase; glucose-6-phosphate translocator; glucokinase inhibitory regulatory protein And phosphoenolpyruvate carboxykinase (PEPCK) can be targeted. In another embodiment, an iRNA agent that targets the liver can target a Factor V, eg, a Leiden Factor V allele, for example, to reduce the tendency to form a clot. An iRNA agent that targets the liver may comprise a sequence that targets a hepatitis virus (eg, hepatitis A, B, C, D, E, F, G, or H). Is possible. For example, the iRNA agent of the present invention can target any one of the non-structural proteins of HCV: NS3, 4A, 4B, 5A, or 5B. For the treatment of hepatitis B, iRNA agents can target, for example, the X protein (HBx) gene.

Preferred ligands on RRMS include folic acid, glucose, cholesterol, cholic acid, vitamin E, vitamin K, or vitamin A.
Definitions The term “halo” refers to any group of fluorine, chlorine, bromine or iodine.

The term “alkyl” refers to a straight or branched hydrocarbon chain containing the indicated number of carbon atoms. For example, the C ₁ -C ₁₂ alkyl, indicating that said group can have 1 to 12 carbon atoms in it. The term “haloalkyl” refers to an alkyl in which one or more hydrogen atoms are replaced by halo, and includes alkyl moieties in which all hydrogens are replaced by halo (eg, perfluoroalkyl). Alkyl and haloalkyl groups may optionally have O, N, or S inserted. The term “aralkyl” refers to an alkyl moiety in which an alkyl hydrogen atom is replaced by an aryl group. Aralkyl includes groups in which two or more hydrogen atoms have been replaced by aryl groups. Examples of “aralkyl” include benzyl, 9-fluorenyl, benzhydryl, and trityl groups.

The term “alkenyl” refers to a straight or branched hydrocarbon chain characterized in that it contains 2 to 8 carbon atoms and has one or more double bonds. Typical alkenyl examples include, but are not limited to, allyl, propenyl, 2-butenyl, 3-hexenyl and 3-octenyl groups. The term “alkynyl” refers to a straight or branched hydrocarbon chain characterized by containing 2 to 8 carbon atoms and having one or more triple bonds. Some examples of typical alkynyl are ethynyl, 2-propynyl, and 3-methylbutynyl, and propargyl. The sp ² and sp ³ carbons may optionally act as attachment points for alkenyl and alkynyl groups, respectively.

  The term “alkoxy” refers to an —O-alkyl group. The term “aminoalkyl” refers to an alkyl substituted with amino. The term “mercapto” refers to the group —SH. The term “thioalkoxy” refers to an —S-alkyl group.

The term “alkylene” refers to divalent alkyl (ie, —R—), such as —CH ₂ —, —CH ₂ CH ₂ —, and —CH ₂ CH ₂ CH ₂ —. The term “alkylenedioxo” refers to a divalent molecular species of the structure —O—R—O—, where R represents alkylene.

  The term “aryl” refers to an aromatic monocyclic, bicyclic, or tricyclic hydrocarbon ring system in which any substitutable ring atom can be replaced by a substituent. Examples of aryl moieties include, but are not limited to, phenyl, naphthyl, and anthracenyl.

  As used herein, the term “cycloalkyl” refers to a saturated cyclic, bicyclic, tricyclic, or polycyclic having from 3 to 12 carbons that can be substituted with any substituent ring atom. Contains a cyclic hydrocarbon group. The cycloalkyl groups described herein can also contain fused rings. Fused rings are rings that share a common carbon-carbon bond. Examples of cycloalkyl moieties include, but are not limited to, cyclohexyl, adamantyl, and norbornyl.

  The term “heterocyclyl” refers to a non-aromatic 3 to 10 membered monocyclic, 8 to 12 membered bicyclic, or 11 to 14 membered tricyclic ring system, in which case 1 to 3 heterocycles. A ring having 1 to 6 heteroatoms in the case of atoms, 2 rings, or 1 to 9 heteroatoms in the case of 3 rings, wherein said heteroatoms are selected from O, N or S A system (eg 1 to 3, 1 to 6, or 1 to 9 hetero atoms of N, O or S, respectively, if carbon and monocyclic, bicyclic or tricyclic) and can be substituted A ring system in which any ring atom can be substituted by a substituent. The heterocyclyl groups described herein can also contain fused rings. Fused rings are rings that share a common carbon-carbon bond. Examples of heterocyclyl include, but are not limited to, tetrahydrofuranyl, tetrahydropyranyl, piperidinyl, morpholino, pyrrolinyl and pyrrolidinyl.

  The term “heteroaryl” refers to an aromatic 5- to 8-membered monocyclic, 8- to 12-membered bicyclic, or 11- to 14-membered tricyclic ring system, in the case of monocyclic, 1 to 3 heterocycles. A ring having 1 to 6 heteroatoms in the case of atoms, 2 rings, or 1 to 9 heteroatoms in the case of 3 rings, wherein said heteroatoms are selected from O, N or S A system (eg 1 to 3, 1 to 6, or 1 to 9 hetero atoms of N, O or S, respectively, if carbon and monocyclic, bicyclic or tricyclic) and can be substituted A ring system in which any ring atom can be substituted by a substituent.

  The term “oxo” forms an carbonyl when bound to carbon, forms an N-oxide when bound to nitrogen, and forms an sulfoxide or sulfone when bound to sulfur. Point to.

The term “acyl” refers to an alkylcarbonyl, cycloalkylcarbonyl, arylcarbonyl, heterocyclylcarbonyl, or heteroarylcarbonyl substituent, any of which may be further substituted with a substituent.

The term “substituent” refers to a group that is “substituted” for any atom of the group on an alkyl, cycloalkyl, alkenyl, alkynyl, heterocyclyl, heterocycloalkenyl, cycloalkenyl, aryl, or heteroaryl group. Suitable substituents include, but are not a limit, alkyl, alkenyl, alkynyl, alkoxy, halo, hydroxy, cyano, nitro, amino, SO 3 _H, sulphate, phosphate, perfluoroalkyl, perfluoroalkoxy, methylenedi Oxy, ethylenedioxy, carboxyl, oxo, thiooxo, imino (alkyl, aryl, aralkyl), S (O) _n alkyl (n is 0 to 2), S (O) _n aryl (n is 0 to 2), S (O) _n heteroaryl (n is 0-2), S (O) _n heterocyclyl (n is 0-2), amine (mono-, di-, alkyl, cycloalkyl, aralkyl, heteroaralkyl, and combinations thereof ), Ester (alkyl, aralkyl, heteroaralkyl), amide (mono-, di-, alkyl, aralkyl, Teloaralkyl, and combinations thereof), sulfonamides (mono-, di-, alkyl, aralkyl, heteroaralkyl, and combinations thereof), unsubstituted aryl, unsubstituted heteroaryl, unsubstituted heterocyclyl, and unsubstituted cycloalkyl. is there. In one aspect, the substituents on the group are independently any one or a subset of any of the foregoing substituents.

The terms “adeninyl, cytosynyl, guaninyl, thyminyl, and urasilyl” and the like refer to the groups adenine, cytosine, guanine, thymine, and uracil.
As used herein, an “unusual” nucleobase can include any one of the following:
2-methyladeninyl,
N6-methyladeninyl,
2-methylthio-N6-methyladeninyl,
N6-isopentenyl adenyl,
2-methylthio-N6-isopentenyladenyl,
N6- (cis-hydroxyisopentenyl) adenyl,
2-methylthio-N6- (cis-hydroxyisopentenyl) adeninyl,
N6-glycinylcarbamoyl adeninyl,
N6-threonylcarbamoyl adeninyl,
2-methylthio-N6-threonylcarbamoyl adeninyl,
N6-methyl-N6-threonylcarbamoyl adeninyl,
N6-hydroxynorvalylcarbamoyl adeninyl,
2-methylthio-N6-hydroxynorvalylcarbamoyl adeninyl,
N6, N6-dimethyladeninyl,
3-methylcytosinyl,
5-methylcytosinyl,
2-thiocytosinyl,
5-formylcytosinyl,

N4-methylcytosinyl,
5-hydroxymethylcytosinyl,
1-methylguaninyl,
N2-methylguaninyl,
7-methylguaninyl,
N2, N2-dimethylguaninyl,

N2,7-dimethylguaninyl,
N2, N2,7-trimethylguaninyl,
1-methylguaninyl,
7-cyano-7-deazaguaninyl,
7-aminomethyl-7-deazaguaninyl,
Pseudouracil,
Dihydrourasilyl,
5-methylurasilyl,
1-methyl pseudourasilyl,
2-thiourasilyl,
4-thiourasilyl,
2-thiothyminyl 5-methyl-2-thiourasilyl,
3- (3-amino-3-carboxypropyl) urasilyl,
5-hydroxyurasilyl, 5-methoxyurasilyl,
Urasilyl 5-oxyacetic acid,
Urasilyl 5-oxyacetic acid methyl ester,
5- (carboxyhydroxymethyl) urasilyl,
5- (carboxyhydroxymethyl) urasilylmethyl ester,
5-methoxycarbonylmethylurasilyl,
5-methoxycarbonylmethyl-2-thiourasilyl,
5-aminomethyl-2-thiourasilyl,
5-methylaminomethylurasilyl,
5-methylaminomethyl-2-thiourasilyl,
5-methylaminomethyl-2-selenourasilyl,
5-carbamoylmethylurasilyl,
5-carboxymethylaminomethylurasilyl,
5-carboxymethylaminomethyl-2-thiourasilyl,
3-methylurasilyl,
1-methyl-3- (3-amino-3-carboxypropyl) pseudourasilyl,
5-carboxymethylurasilyl,
5-methyldihydrourasilyl, or 3-methyl pseudourasilyl.

Palindromic RNA, such as an iRNA agent, is a palindromic structure as described herein, and US Provisional Application No. 60 / 452,682, filed Mar. 7, 2003, both incorporated herein by reference; U.S. Provisional Application No. 60 / 462,894, filed on April 14, 2003; and International Application No. It is possible to have those described in one or more of PCT / US04 / 07070. The iRNA agents of the invention can target more than one RNA region. For example, an iRNA agent can include first and second sequences that are sufficiently complementary to hybridize to each other. The first sequence may be complementary to the first target RNA region and the second sequence may be complementary to the second target RNA region. The first and second sequences of the iRNA agent are on different RNA strands, and mismatches between the first and second sequences are 50%, 40%, 30%, 20%, 10%, 5%, Alternatively, it can be less than 1%. The first and second sequences of the iRNA agent are on the same RNA strand, and in related embodiments, more than 50%, 60%, 70%, 80%, 90%, 95% of the iRNA agent, or 1 % May be in the form of two molecules. The first and second sequences of the iRNA agent may be completely complementary to each other.

  The first target RNA region may be encoded by the first gene and the second target RNA region may be encoded by the second gene, or the first target RNA region and the second target RNA region may be It may be a different region of RNA from one gene. The first and second sequences can differ by at least one nucleotide.

The first target RNA region and the second target RNA region are present on the transcript encoded by the first and second sequence variants, eg, the first and second alleles of one gene. Also good. Sequence variations may be, for example, mutations or polymorphisms. It is also possible for the first target RNA region to contain nucleotide substitutions, insertions or deletions relative to the second target RNA region, or for the second target RNA region to be abrupt of the first target region. It can also be a mutant or a mutant.

  The first target RNA region and the second target RNA region can include viral or human RNA regions. The first target RNA region and the second target RNA region can be present on the mutant transcript of the oncogene or can contain different mutations in the transcript of the tumor suppressor gene It is. Furthermore, the first target RNA region and the second target RNA region may correspond to a genetic variation hot spot.

  The composition of the present invention can comprise a mixture of iRNA agent molecules. For example, an iRNA agent can include a first sequence and a second sequence that are sufficiently complementary to hybridize to each other, wherein the first sequence is complementary to a first target RNA region; The second sequence is complementary to the second target RNA region. The mixture can also include at least one other type of iRNA agent that includes third and fourth sequences that are sufficiently complementary to hybridize to each other, wherein the third sequence comprises a third sequence. Complementary to the target RNA region and the fourth sequence is complementary to the fourth target RNA region. Further, the first or second sequence may be sufficiently complementary to the third or fourth sequence to be able to hybridize to each other. The first and second sequences can be on the same or different RNA strands, and the third and fourth sequences can be on the same RNA strand or on different RNA strands. May be present.

  The target RNA region may be a mutant sequence of viral RNA or human RNA, and in some embodiments, at least two target RNA regions are present on a mutant transcript of an oncogene or tumor suppressor gene Yes. The target RNA region may correspond to a genetic hot spot.

  Methods for making iRNA agent compositions include RNA regions of target genes (eg, viral genes or human genes, or oncogenes or tumor suppressor genes, eg, p53), which are highly diverse or sudden (eg, in humans). Obtaining or providing information about a region having a mutation frequency can be included. In addition, information about multiple RNA targets within the region can be obtained or provided, where each RNA target corresponds to a different variant or mutant of the gene (eg, p53 248Q and / Or a region containing a codon encoding p53 249S). The first sequence is complementary to a first target of a plurality of mutant RNA targets (eg, a target encoding 249Q) and the second sequence is a second target of the plurality of mutant RNA targets (eg, The iRNA agent can be constructed such that it is complementary to a target that encodes 249S) and can be sufficiently complementary for the first and second sequences to hybridize.

  For example, to identify common mutations in a target gene, sequence analysis can be used to identify regions of the target gene that have a high degree of diversity or mutation frequency. A region of a target gene having a high degree of diversity or mutation frequency can be identified by obtaining or providing genotype information about the target gene from a population.

  By providing an iRNA agent having first and second sequences that are sufficiently complementary to hybridize with each other, it is possible to modulate, eg, down-regulate or silence, the expression of a target gene. Furthermore, the first sequence may be complementary to the first target RNA region, and the second sequence may be complementary to the second target RNA region.

The iRNA agent can include a first sequence that is complementary to the first mutant RNA target region and a second sequence that is complementary to the second mutant RNA target region. The first and second mutant RNA target regions may correspond to first and second mutants or mutants of a target gene, such as a viral gene, a tumor suppressor gene or an oncogene. The first and second variant RNA target regions may include allelic variations, mutations (eg, point mutations), or polymorphisms of the target gene. The first and second mutant RNA target regions may correspond to genetic hot spots.

It is also possible to provide multiple iRNA agents (eg, panels or banks).
Double-stranded structure other than standard Watson-Crick RNA, eg, an iRNA agent, can form a non-standard Watson-Crick pairing with another monomer, eg, a monomer on another strand (eg, As described herein, and US Provisional Application No. 60 / 465,665, filed April 25, 2003, and International Application No. PCT / US04 /, filed March 8, 2004. 07070 (both of which are described in both of which are hereby incorporated by reference).

  The use of “standard Watson-Crick pairing” between the double stranded monomers can be used to control (and often promote) melting of all or part of the double stranded. . An iRNA agent can include monomers at selected or constrained positions so that the second in the iRNA agent duplex (eg, between two separate molecules of a double-stranded iRNA agent). One level of stability and a second level of stability in the duplex between the sequence of the iRNA agent and another sequence molecule (eg, a target sequence or off-target (non-target) sequence in a subject). Bring. In some cases, the second duplex has a relatively high level of stability, for example, in the duplex between the antisense sequence of the iRNA agent and the target mRNA. In this case, the selection of one or more monomers, the position of the monomer in the iRNA agent, and the target sequence (sometimes referred to herein as a selection parameter or constraint parameter) is compared to the iRNA agent duplex. Whilst having a low free energy of association (not wishing to be bound by mechanism or theory, this is believed to contribute to effectiveness by promoting dissociation of double-stranded iRNA agents for RISC) The duplex formed between the target-directed antisense sequence and its target sequence has a relatively high free energy of association (not wishing to be bound by mechanism or theory, It is believed to contribute to efficacy by promoting the association of the antisense sequence with the target RNA).

  In other cases, the second duplex has a relatively low level of stability, eg, in the duplex between the sense sequence of the iRNA agent and the off-target mRNA. In this case, the selection of one or more monomers, the position of the monomer in the iRNA agent, and the off-target sequence is such that the iRNA agent duplex has a relatively high free energy of association while the target-oriented sense sequence. The duplex formed between and the off-target sequence has a relatively low free energy of association (not desired to be bound by mechanism or theory, but formed from the sense strand and the off-target sequence It is believed to contribute to effectiveness by promoting double-strand dissociation and to reduce the level of silencing off-target sequences).

Thus, the property of having a first stability with respect to the duplex within the iRNA agent and a second stability with respect to the duplex formed between the sequence derived from the iRNA agent and another RNA, eg, the target mRNA. Are unique in the structure of the iRNA agent. As described above, this property is a careful selection of one or more monomers at a selected position or constrained position, a position in the duplex to set the selected position or constrained position. And selection of the sequence of the target sequence (eg, a specific region of the target gene to be targeted). An iRNA agent sequence that meets these requirements may be referred to herein as a constrained sequence. The constraint parameters or selection parameters can be achieved, for example, by inspection or by computer-aided methods. Through the use of parameters, the target sequence and specific monomers can be selected so as to obtain the desired result, for example with respect to duplex stability or relative stability.

  Accordingly, in another aspect, the invention features an iRNA agent that includes a first sequence that targets a first target region and a second sequence that targets a second target region. The first and second sequences are sufficient to hybridize to each other, for example, under physiological conditions (eg, under physiological conditions but not in contact with a helicase or other unwinding enzyme). Have the same complementarity. In the double stranded region of the iRNA agent, at a selected or constrained position, the first target region has a first monomer and the second target region has a second monomer. The first monomer and the second monomer occupy complementary positions or corresponding positions. One monomer, and preferably both monomers contribute to the duplex between the first sequence and the second sequence, the stability of the pairing of the monomers is the first sequence or the second sequence Selected to be different from the stability of the pairing between the target sequence and the target sequence.

  Usually, the monomer has a dissociation lower than the free energy and Tm of dissociation that would be retained by the pairing of the monomer and its complementary monomer in the duplex between the iRNA agent sequence and the target RNA duplex. Are selected such that the monomers form a pairing in the iRNA agent duplex with a free energy of and a low Tm (selection of the target sequence may be required as well).

  The constraints imposed on the monomer can be applied to selected sites or to more than one selected site. For example, in an iRNA agent duplex, the restriction can be applied to sites of 2 or more but less than 3, less than 4, less than 5, less than 6, or less than 7.

  Restriction sites or selection sites can exist at multiple positions in the iRNA agent duplex. For example, the restriction site or selection site can be located within the 3rd, 4th, 5th or 6th position from one of the 3 'end or 5' end of the double stranded sequence. The restriction site or selection site may be present in the center of the double-stranded region. For example, the restriction site or selection site is 4th or more, 5th or more, 6th or more, or 7 from the end of the double-stranded region. The position may be higher than the position.

  In some embodiments, the double stranded region of the iRNA agent has a mismatch in addition to the selection site or restriction site (s). Preferably, the double-stranded region of the iRNA agent comprises no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 bases that do not form or hybridize with standard Watson-Crick pairs. Have. The overhang is described in detail elsewhere herein, but is preferably about 2 nucleotides long. The overhang may be complementary to the targeted gene sequence or may be another sequence. TT is a preferred arrangement of protrusions. The first iRNA agent sequence and the second iRNA agent sequence can also be linked by, for example, an additional base to form a hairpin, or by other non-base linkers.

Monomers are substantially unpaired if the first monomer and the second monomer are naturally occurring ribonucleotides or modified ribonucleotides having a naturally occurring base and occupy complementary sites. It also does not have a general level of H-bonds or forms a non-standard Watson-Crick pairing to form a non-standard H-bond pattern (usually more than that seen with a standard Watson-Crick pairing) Has a low free energy of dissociation or is otherwise less than the preselected value of the free energy of the association, for example, lower than the free energy of the standard pairing association To match). If one (or both) of the sequence of the iRNA agent forms a duplex with the target, the first (or second) monomer will have a base in a complementary position on the target and a standard Watson-Crick pair Or form a non-standard Watson-Crick pair with a higher free energy of dissociation and a higher Tm than found in pairing in iRNA agents. The classic Watson-Crick pair is as follows: AT, GC and AU. Non-standard Watson-Crick pairs are known in the art and can include UU, GG, GA _trans , GA _cis and GU.

  The selection of monomers in one or both of the sequences may result in the monomers not pairing or forming a pair with the corresponding monomer in the other sequence, which pair minimizes stability (eg, one sequence The H bond formed between the monomer of the selected site and the monomer of the corresponding site of the other sequence is more stable than the H bond formed by the monomer of one (or both) sequence and each target sequence. Is inferior). The choice of monomer in one or both strands is also made to promote stability in one or both of the duplexes created by the strand and its target sequence. For example, selection of one or more monomers and target sequence can be such that no H-bond is formed in the iRNA agent duplex or a non-standard pairing is formed at the selected or constrained position, Or otherwise paired to give a free energy of association that is less than a preselected value of the free energy of association or lower than the free energy of a standard pairing association, for example ( If the sequences (or both) form a duplex with each target, the pairing at the selected or constrained site can be a standard Watson-Crick pair.

  By including such monomers, one or more of the following effects: destabilizing the iRNA agent duplex, sense sequences and unintended target sequences (sometimes referred to as off-target sequences) Will be destabilized, and the interaction between the sequence and the intended target will not be destabilized.

Give an example.
The monomer at the selected site of the first sequence contains A (or a modified base that pairs with T), and the monomer at the selected position of the second sequence does not pair or forms a non-standard pairing. Selected from monomers (eg, G). These are useful in applications where the target sequence of the first sequence has T at the selected position. In embodiments where the target duplex is stabilized together, the target sequence of the second strand has a monomer that forms a standard Watson-Crick pair with the monomer selected for the selected position of the second strand. Useful for.

  The monomer at the selected site of the first sequence contains U (or a modified base that pairs with A) and the monomer at the selected position of the second sequence does not pair or forms a non-standard pairing Selected from monomers (eg, U or G). These are useful in applications where the target sequence of the first sequence has T at the selected position. In embodiments where the target duplex is stabilized together, the target sequence of the second strand has a monomer that forms a standard Watson-Crick pair with the monomer selected for the selected position of the second strand. Useful for.

The monomer at the selected site of the first sequence contains G (or a modified base that pairs with C) and the monomer at the selected position of the second sequence does not pair or forms a non-standard pairing Selected from monomers (eg, G, A _cis , A _trans , or U). These are useful in applications where the target sequence of the first sequence has T at the selected position. In embodiments where the target duplex is stabilized together, the target sequence for the second strand has a monomer that forms a standard Watson-Crick pair with the monomer selected for the selected position of the second strand. Useful for.

The monomer at the selected site of the first sequence contains C (or a modified base that pairs with G), and the monomer at the selected position of the second sequence does not pair or forms a non-standard pairing Selected from the monomers to be used. These are useful in applications where the target sequence of the first sequence has T at the selected position. In embodiments where the target duplex is stabilized together, the target sequence for the second strand has a monomer that forms a standard Watson-Crick pair with the monomer selected for the selected position of the second strand. Useful for.

  Selection of the non-naturally occurring monomer or modified monomer (s) indicates the free energy of the first dissociation when the non-naturally occurring monomer or modified monomer is placed at a selected or constrained position of the iRNA agent; And if one (or both) of them pair with a naturally occurring monomer, the pair exhibits a second dissociation free energy (usually the second dissociation free energy is the first monomer and the second dissociation energy). Higher than the free energy of dissociation of the pairing of the two monomers). For example, if the first monomer and the second monomer occupy complementary positions, the first monomer and the second monomer do not pair and do not have a substantial level of H-bonds, or One of the monomers forms a weaker bond than it does with the naturally occurring monomer, reducing the stability of the duplex, but when the duplex dissociates, at least one strand is In the duplex with the target, the selected monomer promotes stability (eg, the monomer is more stable than the naturally occurring monomer in the target sequence and the pair formed in the iRNA agent. Forming a pair).

Examples of such pairs are 2-amino A, and either U or T 2-thiopyrimidine analogs.
When placed at complementary positions in the iRNA agent, these monomers rarely pair and stability is minimal. However, a duplex is formed between 2-amino A and the naturally occurring target U, or between 2-thio U and the naturally occurring target A, or 2-thio T And a naturally occurring target A, a duplex is formed, has a relatively high free energy of dissociation, and is more stable. This is shown in FIG.

  The pair shown in FIG. 1 (2-amino A and 2-sU and T) is exemplary. In another embodiment, the monomer at the selected position of the sense strand can be a universal pairing component. Universally paired materials form some level of H-bonds with two or more, preferably all naturally occurring monomers. An example of a universal pairing moiety is a monomer containing 3-nitropyrrole. (Other candidates for universal base analogs can be found, for example, in Loakes, 2001, NAR 29: 2437-2447 (incorporated herein by reference). The following universal base sections can be found :) In these cases, the monomer at the corresponding position of the antisense strand can be chosen according to its ability to form a duplex with the target, eg A, U, G or C can be mentioned.

The iRNA agents of the invention can include the following:
Preferably, a sense sequence that does not target a sequence present in the subject, and an antisense sequence that targets a target gene in the subject. The sense and antisense sequences are sufficiently complementary to hybridize to each other, for example, under physiological conditions (eg, under physiological conditions but not in contact with a helicase or other unwinding enzyme). Have. In the double stranded region of the iRNA agent, for selected or constrained positions, the monomers are selected to satisfy:
The sense sequence monomers are paired such that the monomers do not pair or minimize stability with the corresponding monomers of the antisense strand (e.g., the selected site monomer and antisense strand in the sense sequence). The H bond formed between the monomer at the corresponding site of the antisense sequence and its standard Watson-Crick partner (if the monomer in the antisense strand contains a modified base, the modified base Selected to be less stable than the H-bond formed by the natural analog of and its standard Watson-Crick partner);
The monomer at the corresponding position of the antisense strand maximizes the stability of the duplex that the monomer forms with the target sequence, eg, the monomer is standard with the monomer at the corresponding position on the target strand. Be selected to form a Watson-Crick pair;
Optionally, the sense sequence monomers are paired such that they do not pair or minimize the stability of the corresponding monomer of the antisense strand with the off-target sequence.

  By including such a monomer, one or more of the following effects: destabilizing the iRNA agent duplex, sense sequence and unintended target sequence (sometimes referred to as off-target sequence) Will be destabilized, and double-stranded interactions between the antisense sequence and the intended target will not be destabilized.

  The constraints imposed on the monomer can be applied to selected sites or to more than one selected site. For example, in an iRNA agent duplex, the restriction can be applied to sites of 2 or more but less than 3, less than 4, less than 5, less than 6, or less than 7.

  Restriction sites or selection sites can exist at multiple positions in the iRNA agent duplex. For example, the restriction site or selection site can be located within the 3rd, 4th, 5th or 6th position from one of the 3 'end or 5' end of the double stranded sequence. The restriction site or selection site may be present in the center of the double-stranded region. For example, the restriction site or selection site is 4th or more, 5th or more, 6th or more from the end of the double-stranded region. Or it may be the 7th or higher position.

  In some embodiments, the double stranded region of the iRNA agent has a mismatch in addition to the selection site or restriction site (s). Preferably, the double-stranded region of the iRNA agent comprises no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 bases that do not form or hybridize with standard Watson-Crick pairs. Have. The overhang is described in detail elsewhere herein, but is preferably about 2 nucleotides long. The overhang may be complementary to the targeted gene sequence or may be another sequence. TT is a preferred arrangement of protrusions. The first iRNA agent sequence and the second iRNA agent sequence can also be linked by, for example, an additional base to form a hairpin, or by other non-base linkers.

Monomers are substantially unpaired if the first monomer and the second monomer are naturally occurring ribonucleotides or modified ribonucleotides having a naturally occurring base and occupy complementary sites. It also does not have a general level of H-bonds or forms a non-standard Watson-Crick pairing to form a non-standard H-bond pattern (usually more than that seen with a standard Watson-Crick pairing) Has a low free energy of dissociation or is otherwise less than the preselected value of the free energy of the association, for example, lower than the free energy of the standard pairing association To match). If one (or both) of the sequence of the iRNA agent forms a duplex with the target, the first (or second) monomer will have a base in a complementary position on the target and a standard Watson-Crick pair Or form a non-standard Watson-Crick pair with a higher free energy of dissociation and a higher Tm than found in pairing in iRNA agents. The classic Watson-Crick pair is as follows: AT, GC and AU. Non-standard Watson-Crick pairs are known in the art and can include UU, GG, GA _trans , GA _cis and GU.

The selection of monomers in one or both of the sequences may result in the monomers not pairing or forming a pair with the corresponding monomer in the other sequence, which pair minimizes stability (eg, one sequence The H bond formed between the monomer of the selected site and the monomer of the corresponding site of the other sequence is more stable than the H bond formed by the monomer of one (or both) sequence and each target sequence. Is inferior). The choice of monomer in one or both strands is also made to promote stability in one or both of the duplexes created by the strand and its target sequence. For example, selection of one or more monomers and target sequence can be such that no H-bond is formed in the iRNA agent duplex or a non-standard pairing is formed at the selected or constrained position, Or otherwise paired to give a free energy of association that is less than a preselected value of the free energy of association or lower than the free energy of a standard pairing association, for example ( If the sequences (or both) form a duplex with each target, the pairing at the selected or constrained site can be a standard Watson-Crick pair.

  By including such monomers, one or more of the following effects: destabilizing the iRNA agent duplex, sense sequences and unintended target sequences (sometimes referred to as off-target sequences) Will be destabilized, and the interaction between the sequence and the intended target will not be destabilized.

Give an example.
The monomer at the selected site of the first sequence contains A (or a modified base that pairs with T), and the monomer at the selected position of the second sequence does not pair or forms a non-standard pairing. Selected from monomers (eg, G). These are useful in applications where the target sequence of the first sequence has T at the selected position. In embodiments where the target duplex is stabilized together, the target sequence of the second strand has a monomer that forms a standard Watson-Crick pair with the monomer selected for the selected position of the second strand. Useful for.

  The monomer at the selected site of the first sequence contains U (or a modified base that pairs with A) and the monomer at the selected position of the second sequence does not pair or forms a non-standard pairing Selected from monomers (eg, U or G). These are useful in applications where the target sequence of the first sequence has T at the selected position. In embodiments where the target duplex is stabilized together, the target sequence of the second strand has a monomer that forms a standard Watson-Crick pair with the monomer selected for the selected position of the second strand. Useful for.

The monomer at the selected site of the first sequence contains G (or a modified base that pairs with C) and the monomer at the selected position of the second sequence does not pair or forms a non-standard pairing Selected from monomers (eg, G, A _cis , A _trans , or U). These are useful in applications where the target sequence of the first sequence has T at the selected position. In embodiments where the target duplex is stabilized together, the target sequence for the second strand has a monomer that forms a standard Watson-Crick pair with the monomer selected for the selected position of the second strand. Useful for.

  The monomer at the selected site of the first sequence contains C (or a modified base that pairs with G), and the monomer at the selected position of the second sequence does not pair or forms a non-standard pairing Selected from the monomers to be used. These are useful in applications where the target sequence of the first sequence has T at the selected position. In embodiments where the target duplex is stabilized together, the target sequence for the second strand has a monomer that forms a standard Watson-Crick pair with the monomer selected for the selected position of the second strand. Useful for.

Selection of the non-naturally occurring monomer or modified monomer (s) indicates the free energy of the first dissociation when the non-naturally occurring monomer or modified monomer is placed at a selected or constrained position of the iRNA agent; And if one (or both) of them pair with a naturally occurring monomer, the pair exhibits a second dissociation free energy (usually the second dissociation free energy is the first monomer and the second dissociation energy). Higher than the free energy of dissociation of the pairing of the two monomers). For example, if the first monomer and the second monomer occupy complementary positions, the first monomer and the second monomer do not pair and do not have a substantial level of H-bonds, or One of the monomers forms a weaker bond than it does with the naturally occurring monomer, reducing the stability of the duplex, but when the duplex dissociates, at least one strand is In the duplex with the target, the selected monomer promotes stability (eg, the monomer is more stable than the naturally occurring monomer in the target sequence and the pair formed in the iRNA agent. Forming a pair).

Examples of such pairs are 2-amino A, and either U or T 2-thiopyrimidine analogs.
When placed at complementary positions in the iRNA agent, these monomers rarely pair and stability is minimal. However, a duplex is formed between 2-amino A and the naturally occurring target U, or between 2-thio U and the naturally occurring target A, or 2-thio T And a naturally occurring target A, a duplex is formed, has a relatively high free energy of dissociation, and is more stable.

  The monomer at the selected position of the sense strand can be a universal pairing moiety. Universally paired materials form some level of H-bonds with two or more, preferably all naturally occurring monomers. An example of a universal pairing moiety is a monomer containing 3-nitropyrrole. (Other candidates for universal base analogs can be found, for example, in Loakes, 2001, NAR 29: 2437-2447 (incorporated herein by reference). The following universal base sections can be found :) In these cases, the monomer at the corresponding position of the antisense strand can be chosen according to its ability to form a duplex with the target, eg A, U, G or C can be mentioned.

The iRNA agents of the invention can include the following:
Preferably, a sense sequence that does not target a sequence present in the subject, and an antisense sequence that targets a target gene in the subject. The sense and antisense sequences are sufficiently complementary to hybridize to each other, for example, under physiological conditions (eg, under physiological conditions but not in contact with a helicase or other unwinding enzyme). Have. In the double stranded region of the iRNA agent, for selected or constrained positions, the monomers are selected to satisfy:
The sense sequence monomers are paired such that the monomers do not pair or minimize stability with the corresponding monomers of the antisense strand (e.g., the selected site monomer and antisense strand in the sense sequence). The H bond formed between the monomer at the corresponding site of the antisense sequence and its standard Watson-Crick partner (if the monomer in the antisense strand contains a modified base, the modified base Selected to be less stable than the H-bond formed by the natural analog of and its standard Watson-Crick partner);
The monomer at the corresponding position of the antisense strand maximizes the stability of the duplex that the monomer forms with the target sequence, eg, the monomer is standard with the monomer at the corresponding position on the target strand. Be selected to form a Watson-Crick pair;
Optionally, the sense sequence monomers are paired such that they do not pair or minimize the stability of the corresponding monomer of the antisense strand with the off-target sequence.

By including such a monomer, one or more of the following effects: destabilizing the iRNA agent duplex, sense sequence and unintended target sequence (sometimes referred to as off-target sequence) Will be destabilized, and double-stranded interactions between the antisense sequence and the intended target will not be destabilized.

  The constraints imposed on the monomer can be applied to selected sites or to more than one selected site. For example, in an iRNA agent duplex, the restriction can be applied to sites of 2 or more but less than 3, less than 4, less than 5, less than 6, or less than 7.

  Restriction sites or selection sites can exist at multiple positions in the iRNA agent duplex. For example, the restriction site or selection site can be located within the 3rd, 4th, 5th or 6th position from one of the 3 'end or 5' end of the double stranded sequence. The restriction site or selection site may be present in the center of the double-stranded region. For example, the restriction site or selection site is 4th or more, 5th or more, 6th or more from the end of the double-stranded region. Or it may be the 7th or higher position.

iRNA agents can be selected to target a wide range of genes, including any of the genes described herein.
In a preferred embodiment, the iRNA agent has the configuration described herein (configuration configuration is the overall length, the length of the double stranded region, the presence of overhangs, the number, position or length. , Refers to one or more of the single-stranded forms relative to the double-stranded forms).

  For example, an iRNA agent can be less than 30 nucleotides in length, such as 21-23 nucleotides in length. Preferably, the iRNA is 21 nucleotides long and there are about 19 pairs of double-stranded regions. In one embodiment, the iRNA is 21 nucleotides long and the double-stranded region of the iRNA is 19 nucleotides long. In another embodiment, the iRNA is greater than 30 nucleotides in length.

  In some embodiments, the double stranded region of the iRNA agent has a mismatch in addition to the selection site or restriction site (s). Preferably, the double-stranded region of the iRNA agent comprises no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 bases that do not form or hybridize with standard Watson-Crick pairs. Have. The overhang is described in detail elsewhere herein, but is preferably about 2 nucleotides long. The overhang may be complementary to the targeted gene sequence or may be another sequence. TT is a preferred arrangement of protrusions. The first iRNA agent sequence and the second iRNA agent sequence can also be linked by, for example, an additional base to form a hairpin, or by other non-base linkers.

The one or more selected partners or constrained partners are both naturally occurring ribonucleotides or modified ribonucleotides having naturally occurring bases, and the iRNA agent If it occupies a complementary site in the duplex, it does not pair, has no substantial level of H-bonds, or forms a non-standard Watson-Crick pair to form a non-standard pattern of H-bonds (Does this non-standard Watson-Crick pair usually have a lower free energy of dissociation than is seen with Watson-Crick pairs or is otherwise less than the free energy of association of a preselected value? Or pairing to give a free energy of meeting that is lower than the free energy of a standard pairing meeting, for example) It is possible to sea urchin use. If one of the sequences of the iRNA agent, usually the antisense sequence, forms a duplex with another sequence, usually the sequence present in the subject, and generally the target sequence, the monomer is in a complementary position on the target Or a non-standard Watson-Crick pair with a higher free energy of dissociation and a higher Tm than found in pairing in iRNA agents. Optionally, if the other sequence of the iRNA agent, usually the sense sequence, forms a duplex with another sequence, usually the sequence present in the subject, and generally the off-target sequence, the monomer is on the off-target sequence. Cannot form standard Watson-Crick pairs with bases at complementary positions, eg, monomers form non-standard Watson-Crick pairs with lower free energy of dissociation and lower Tm .

Give an example.
The monomer at the selected site in the antisense strand contains A (or a modified base that pairs with T) and the corresponding monomer in the target is T, and the sense strand does not pair or forms a non-standard pair Selected from bases (eg G);
The monomer at the selected site in the antisense strand contains U (or a modified base that pairs with A) and the corresponding monomer in the target is A, and the sense strand does not pair or forms a non-standard pair Selected from bases (e.g. U or G);
The monomer at the selected site in the antisense strand contains C (or a modified base that pairs with G) and the corresponding monomer in the target is G and the sense strand does not pair or forms a non-standard pair A base selected from (eg, G, A _cis , A _trans or U); or
The monomer at the selected site in the antisense strand contains G (or a modified base that pairs with C) and the corresponding monomer in the target is C, and the sense strand does not pair or forms a non-standard pair Selected from bases

  In another embodiment, the non-naturally occurring monomer or modified monomer (s) exhibits a first free energy of dissociation when the monomer occupies a complementary position in the iRNA agent, and one of them ( Or both) pair with a naturally occurring monomer, the pair exhibits a second dissociation free energy (usually the second dissociation free energy is that of the first monomer and the second monomer). Higher than the free energy of pairing dissociation). For example, if the first monomer and the second monomer occupy complementary positions, the first monomer and the second monomer do not pair and do not have a substantial level of H bonds, or the monomer One of which forms a weaker bond than does with a naturally occurring monomer, reducing the stability of its duplex, but when the duplex dissociates, at least one strand will bind the target and the duplex. And the selected monomer promotes stability in the duplex with the target (eg, the monomer forms a more stable pair with the naturally occurring monomer in the target sequence than the pair formed in the iRNA agent. To do).

  An example of such a pair is 2-amino A and either U or T 2-thiopyrimidine analogs. As mentioned above, when placed at complementary positions in the iRNA agent, these monomers are hardly paired and have minimal stability. However, a duplex is formed between 2-amino A and the naturally occurring target U, or a duplex is between 2-thio U and the naturally occurring target A, Or formed between 2-thio T and the naturally occurring target A, has a relatively high free energy of dissociation, and is more stable.

  The monomer at the selected position of the sense strand can be a universal pairing moiety. Universally paired materials form some level of H-bonds with two or more, preferably all naturally occurring monomers. An example of a universal pairing moiety is a monomer containing 3-nitropyrrole. Other candidates for universal base analogs can be found, for example, in Loakes, 2001, NAR 29: 2437-2447 (incorporated herein by reference). In these cases, the monomer at the corresponding position of the antisense strand can be selected according to its ability to form a duplex with the target, for example A, U, G or C.

In another aspect, the invention features an iRNA agent that includes:
A sense sequence that preferably does not target sequences present in the subject, and an antisense sequence that targets multiple target genes in the subject (where the target sequence is only one or a few, eg, 5 Hereinafter, 4 or less, 3 or less, or 2 or less positions are different). The sense and antisense sequences are sufficiently complementary to hybridize to each other, eg, under physiological conditions (eg, under physiological conditions but not in contact with a helicase or other unwinding enzyme). Have The sequence of the antisense strand of the iRNA agent forms H bonds with at least two different target sequences for one, some or all of the positions corresponding to positions that differ in sequence between the target sequences. Selected to contain monomers. In preferred examples, the antisense sequence is a universal monomer or indiscriminately pairing monomer, such as 5-nitropyrrole, 2-amino A, 2-thio U or 2-thio T, or referred to herein. Includes monomers including other universal bases.

  In a preferred embodiment, the iRNA agent targets a repetitive sequence in a single gene, multiple genes or viral genome (eg, HCV genome) (repeated sequences that differ from each other in only one site or a small number of sites).

One embodiment is shown in FIGS.
In another aspect, the invention determines the stability of the pairings between monomers at selected or constrained positions in the iRNA agent duplex, eg, by measurement or calculation, and preferably sequences derived from the iRNA agent And determining the stability of the corresponding pairing in the duplex between another RNA (eg target sequence). The results of the determination can be compared. Thus, the analyzed iRNA agent can be used to develop a further modified RNA agent, or can be administered to a subject. Such an analysis can be subsequently performed to refine or design an optimized iRNA agent.

  In another aspect, the invention features a kit that includes one or more of the iRNAs described herein below, a sterile container enclosing the iRNA agent, and instructions for use.

  In another aspect, an iRNA agent that contains a constrained sequence made by the methods described herein is featured. The iRNA agent can target one or more genes referred to herein.

  For example, an iRNA agent having a constrained or selected site as described herein can be used in any of the methods described herein. Thus, for example, an iRNA agent having a restriction site or selection site as described herein may be used to silence a target, eg, in any of the methods described herein, and It can be used to target any of the genes described, or to treat any of the disorders described herein. For example, an iRNA agent having a constrained or selected site as described herein can be incorporated into any formulation or preparation, eg, a pharmaceutical or sterile preparation described herein. For example, an iRNA agent having a constrained site or a selected site described herein can be administered by any of the routes of administration described herein.

The term “standard Watson-Crick pairing” as used herein refers to the second monomer at the corresponding position of the first monomer and the second sequence of the double-stranded first sequence. Pairing with a monomer in which one or more of the following is true: (1) essentially no pairing exists between the two monomers, for example a monomer There is no significant level of H-bonds in between, or the bond between monomers does not make any significant contribution to duplex stability, (2) the monomer has a naturally occurring base A non-standard monomer pair, i.e., other than AT, AU or GC, and the monomer forms H bonds between the monomers, but generally the H bond pattern formed is Weaker than bonds formed by standard pairing Alternatively (3) at least one of the monomers includes a non-naturally occurring base and the H bond formed between the monomers is preferably a standard pairing, ie AT, AU, G- Weaker than bonds formed by one or more of C.

The term “off-target” as used herein refers to a sequence other than the sequence to be silenced.
Universal base: “wild card”; shape-based complementarity (“replication of base pairs between difluorotoluene and adenine at double-stranded multiple sites: confirmation by“ reverse ”sequencing (Bi-stranded, multisite replication of a base pair between difluorotoluene and adenine: confirmation by 'inverse' sequencing.) ", Liu, Dee; Moran, S; Cool, ET ), Chem. Biol., 1997, Vol. 4, pages 919-926)

("Importance of terminal base pair hydrogen-bonding in 3'-end proofreading by the Klenow fragment of DNA polymerase I."), (Morales, J. C .; Cooles, E. C., Kool, ET, Biochemistry, 2000, Vol. 39, pp. 2626-2632)
(“Selective and stable DNA base pairing without hydrogen bonds.”, Matray, T. J .; Matray, T. J; Kool, E. T.), J. Am. Chem. Soc., 1998, 120, 6191-6192)

("Difluorotoluene, a nonpolar isostere for thymine, codes specifically and efficiently for adenine in DNA replication.", Moran, S; Ren, R.X.-F; Ramney Ibuy, S; Cool, E. T. J. Am. Chem. Soc., 1997, 119, 2056-
(Page 2057)
("Structure and base pairing properties of replicable nonpolar isostere for deoxyadenosine."), Gukukian, KM; Morales, TK M .; Morales, JC; Kool, ET), Org. Chem., 1998, 63, 9653-9656)

  ("Universal bases for hybridization, replication and chain termination."), Burger, M; W. W .; Ogawa, A. K .; McMin, D.L. Schulz, P. G .; Romesberg, F. E. (Berger, M .; WuY; Ogawa, AK; McMinn, D. L .; Schultz, P. G .; Romesberg, F .; E.), Nucleic Acids Res., 2000, 28, 2911-2914)

  (1. “Efforts toward expansion of the genetic alphabet: Information storage and replication with unnatural hydrophobic base pairs”, Ogawa, A.K. Wu Wai; McMin, D.L .; Riu, J .; Schulz, P. G .; Romesberg, F. E. (Ogawa, AK; WuY; McMinn, D. L.) Liu, J .; Schultz, PG; Romesberg, FE), J. Am. Chem. Soc., 2000, 122, 3274-3287. Rational design of an unnatural base pair with increased kinetic selectivity. ”Ogawa, AK; W. Burger, M. Schulz, P. G .; Romesberg, F. E. (Ogawa, AK; Wu Y .; Berger, M .; Schultz, PG; Romesberg, F .; E.), J. Am. Chem. Soc., 2000, Vol. 122, pages 8803-8804)

  ("Efforts toward expansion of the genetic alphabet: replication of DNA with three base pairs."), Tae, E.L .; Woo. Schulz, P. G .; Lomesberg, F. E. (Tae, E. L .; Wu Y; Xia, G .; Schultz, P. G .; Romesberg, F. E.), J. Am. Chem. Soc., 2001, Vol. 123, pages 7439-7440)

(1. “Effects toward expansion of the genetic alphabet: Optimization of interbase hydrophobic interactions”), Wu Wai; Ogawa, A. K .; Burger, M; McMin, D.L .; Schulz, P. G .; Lomesberg, F. E. (WuY; Ogawa, AK; Berger, M .; McMinn, D.L .; Schultz Roesberg, FE), J. Am. Chem. Soc., 2000, 122, 7621-7632 2. “Efforts to expand the genetic alphabet: a very stable self Efforts toward expansion of the genetic alphabet: DNA polymerase recognitionof a highly stable, self-pairing hydrophobic base.) ", McMin, D.L .; Ogawa, A.K .; Woo Wai; Liu, J .; Schulz, P. G .; Romesberg, F.E. Ogawa, AK; WuY; Liu, J .; Schultz, PG; Romesberg, FE), J. Am.Chem.Soc., 1999, (Vol. 121, 11585-11586)
("A stable DNA duplex containing a non-hydrogen-bonding and non-shape complementary base couple : Interstrand stacking as the stability determining factor.), Borotzchi, C .; Haverley, A .; Royman, C. (Herbertli, A .; Leumann, C, J.), Angew. , 2001, 40, 3012-3014)
("2,2'-Bipyridine Ligandoside: A novel building block for modifying DNA with intra-duplex metal complexes. Weitzmann, H .; Tor, Y., J. Am. Chem. Soc., 2001, Vol. 123, pages 3375-3376)], Weitzmann, H .;

  ("Minor groove hydration is critical to the stability of DNA duplexes.", Ran, Tee .; Macrouglin, L.W., Lan, T. McLaughlin, LB), J. Am. Chem. Soc., 2000, 122, 6512-6513)

  (“Effects of the universal base 3-nitropyrrole on the selectivity of neighboring natural bases.”, Oliver, J.S .; Parker, Kay Sags, J. W. (Oliver, JS; Parker, KA; Suggs, JW), Organic Lett., 2001, Vol. 3, pp. 1977-1980. “Effects of the 1- (2′-deoxy-β ---- (2′-deoxy-β-D-ribofuranosyl) -3-nitropyrrole residue on DNA duplex and triplex stability” D-ribofuranosyl) -3-nitropyrrol residue on the stability of DNA duplexes and triplexes.), Amosoba, Oh ,; George J .; Fresco, J. A. (Amosova, O .; Geo) ge J .; Fresco, JR), Nucleic Acids Res., 1997, 25, 1930-1934. 3. “Universal nucleosides: 1- (2′-deoxy-β-D-ribofuranosyl)”. -3-Synthesis, structure and deoxyribonucleic acid sequencing with a universal nucleosides: 1- (2'-deoxy-β-D-ribofuranosyl) -3-nitropyrrol. Zum, P .; Toma, P. H .; Andrews, P. C .; Nichols, R. (Bergstorm, D .; Zhang, P .; Toma, P. H .; Andrews, PC; Nichols, R.), J. Am. Chem. Soc., 1995, 117, 1201- 209 pages)

  (Model studies directed toward a general triplex DNA recognition scheme: a novel DNA base that binds a CG base-pair in an organic solvent.), Zimmermann, SC; Zimmerman, SC; Schmitt, P., J. Am. Chem. Soc., 1995, No. 117, 10769-10770)

  ("Universal photocleavable DNA base: nitropiperonyl 2'-deoxyriboside"), J. Org. Chem., 2001, 66, 2067-2071. )

  ("Recognition of a single guanine bulge by 2-acylamino-1,8-naphthyridine.", Nakatani, K .; Sand, S .; Cyto (Nakatani, K .; Sando, S .; Saito, I.), J. Am. Chem. Soc., 2000, Vol. 122, pp. 2172-2177. B. “By photooxidation of GC doublets Specific binding of 2-amino-1,8-naphthyridine into single guanine bulge as evidenced by photooxidation of GC doublet. , Nakatani, K .; Sand, S .; Yoshida, K .; Saito, I. (Nakatani, K .; Sando, S .; Yoshida, K .; Sait) o, I.), Bioorg.Med.Chem.Lett., 2001, Volume 11, pages 335-337)

  Other universal bases can have the following formula:

(Where
Q is N or CR ⁴⁴ ;
Q ′ is N or CR ⁴⁵ ;
Q ″ is N or CR ⁴⁷ ,
Q ″ ′ is N or CR ⁴⁹ ,
Q ^iv is N or CR ⁵⁰ ,
R ⁴⁴ is hydrogen, halo, hydroxy, nitro, protected hydroxy, NH ₂ , NHR ^b , or NR ^b R ^c , C ₁ -C ₆ alkyl, C ₆ -C ₁₀ aryl, C ₆ -C ₁₀ heteroaryl, C _{3 to} C ₈ heterocyclyl or together with R ⁴⁵ to form —OCH ₂ O—,
R ⁴⁵ is hydrogen, halo, hydroxy, nitro, protected hydroxy, NH ₂ , NHR ^b , or NR ^b R ^c , C ₁ -C ₆ alkyl, C ₆ -C ₁₀ aryl, C ₆ -C ₁₀ heteroaryl, C _{3 to} C ₈ heterocyclyl or together with R ⁴⁴ or R ⁴⁶ to form —OCH ₂ O—;
R ⁴⁶ is hydrogen, halo, hydroxy, nitro, protected hydroxy, NH ₂ , NHR ^b , or NR ^b R ^c , C ₁ -C ₆ alkyl, C ₆ -C ₁₀ aryl, C ₆ -C ₁₀ heteroaryl, C _{3 to} C ₈ heterocyclyl or together with R ⁴⁵ or R ⁴⁷ to form —OCH ₂ O—,
R ⁴⁷ is hydrogen, halo, hydroxy, nitro, protected hydroxy, NH ₂ , NHR ^b , or NR ^b R ^c , C ₁ -C ₆ alkyl, C ₆ -C ₁₀ aryl, C ₆ -C ₁₀ heteroaryl, C _{3 to} C ₈ heterocyclyl or together with R ⁴⁶ or R ⁴⁸ to form —OCH ₂ O—,
R ⁴⁸ is hydrogen, halo, hydroxy, nitro, protected hydroxy, NH ₂ , NHR ^b , or NR ^b R ^c , C ₁ -C ₆ alkyl, C ₆ -C ₁₀ aryl, C ₆ -C ₁₀ heteroaryl, C _{3 to} C ₈ heterocyclyl or together with R ⁴⁷ to form —OCH ₂ O—,
^{R 49, R 50, R 51} , R 52, R 53, R 54, R 57, R 58, R 59, R 60, R 61, R 62, R 63, R 64, R 65, R 66, R 67 , R ⁶⁸ , R ⁶⁹ , R ⁷⁰ , R ⁷¹ and R ⁷² are each independently hydrogen, halo, hydroxy, nitro, protected hydroxy, NH ₂ , NHR ^b , or NR ^b R ^c , C ₁ -C ₆ alkyl. C ₂ -C ₆ alkynyl, C ₆ -C ₁₀ aryl, C ₆ -C ₁₀ heteroaryl, C ₃ -C ₈ heterocyclyl, NC (O) R ¹⁷ , or NC (O) R ⁰ ,
R ⁵⁵ is hydrogen, halo, hydroxy, nitro, protected hydroxy, NH ₂ , NHR ^b , or NR ^b R ^c , C ₁ -C ₆ alkyl, C ₂ -C ₆ alkynyl, C ₆ -C ₁₀ aryl, C ₆ -C _{10 heteroaryl,} C 3 -C ₈ heterocyclyl, NC ^{(O) R 17,} or NC (O) or is ^{R 0,} or ^{R 56} and together form a fused aromatic ring, fused aromatic rings May be optionally substituted,
R ⁵⁶ is hydrogen, halo, hydroxy, nitro, protected hydroxy, NH ₂ , NHR ^b , or NR ^b R ^c , C ₁ -C ₆ alkyl, C ₂ -C ₆ alkynyl, C ₆ -C ₁₀ aryl, C ₆ -C _{10 heteroaryl,} C 3 -C ₈ heterocyclyl, NC ^{(O) R 17,} or NC (O) or is ^{R 0,} or ^{R 55} and together form a fused aromatic ring, fused aromatic rings May be optionally substituted,
R ¹⁷ is halo, NH ₂ , NHR ^b , or NR ^b R ^c ;
R ^b is a C ₁ -C ₆ alkyl or nitrogen protecting group,
R ^C is C ₁ -C ₆ alkyl;
R ⁰ is optionally halo, hydroxy, nitro, protected hydroxy, NH ₂ , NHR ^b , or NR ^b R ^c , C ₁ -C ₆ alkyl, C ₂ -C ₆ alkynyl, C ₆ -C ₁₀ aryl, C ₆ -C _{10 heteroaryl,} C 3 -C ₈ heterocyclyl, NC ^{(O) R 17,} or alkyl substituted with NC (O) ^{R 0.} )
Examples of universal bases include:

Asymmetrically modified RNA, such as iRNA agents, is described in International Application No. PCT / US04 / 07070 (filed March 8, 2004, as described herein), which is incorporated herein by reference. Can be modified asymmetrically as described in US Pat.

  Furthermore, the present invention includes iRNA agents having asymmetric modifications and other components described herein. For example, the invention may be directed to an iRNA agent described herein, eg, an iRNA agent having a palindromic structure, an iRNA agent having a non-standard pairing, a gene described herein (eg, active in the liver) An iRNA agent that targets a gene), an iRNA agent having a configuration or structure as described herein, an iRNA associated with a drug delivery module as described herein, as described herein Or an iRNA agent formulated as described herein, which also incorporates an asymmetric modification.

An asymmetrically modified iRNA agent is an iRNA agent having a modification in which one strand is not present on the other strand. An asymmetric modification is a modification that is found on one strand but not on the other strand. Any modification, eg, any modification described herein, can exist as an asymmetric modification. Asymmetric modification can confer any desirable property associated with the modification, such as those discussed herein. For example, an asymmetric modification can result in resistance to degradation, a change in half-life, can direct an iRNA agent to a specific target (eg, a specific tissue), its complement of strands or It can also modulate (eg, increase or decrease) affinity for the target sequence, or interfere with or promote modification of the terminal portion (eg, modification by a kinase or other enzyme involved in the pathway of the RISC mechanism). it can. Specifying one modification as having one property does not mean that the modification has no other property (eg, a modification referred to as a modification that promotes stabilization may be targeted Can also be enhanced).

  While not wishing to be bound by theory or any particular mechanistic model, asymmetric modifications can allow iRNA agents to be optimized in terms of different or “asymmetric” functions of the sense and antisense strands It is thought that. For example, both strands may be modified to increase nuclease resistance, but these changes may be selected with respect to the sense strand since RISC activity may be inhibited. In addition, some modifications, such as targeting moieties, can add large bulky groups that can interfere with the cleavage activity of the RISC complex, for example, so such modifications are preferably located on the sense strand. . Thus, targeting moieties, particularly bulky targeting moieties (eg, cholesterol) are preferentially added to the sense strand. In one embodiment, there is an asymmetric modification, eg, a phosphorothioate modification, in the antisense strand that replaces the backbone phosphate with S, and a 2 'modification, eg, 2'OMe, is present in the sense strand. The targeting moiety can be present at either (or both) the 5 'or 3' end of the sense strand of the iRNA agent. In a preferred example, the backbone P is replaced with S in the antisense strand, 2′OMe is present in the sense strand, and a targeting moiety is added to either the 5 ′ or 3 ′ end of the sense strand of the iRNA agent. The

  In a preferred embodiment, the asymmetrically modified iRNA agent has a modification on the sense strand that is not found on the antisense strand, and the antisense strand has a modification that is not found on the sense strand.

  Each chain may include one or more asymmetric modifications. By way of example, one strand can include a first asymmetric modification that imparts a first property to an iRNA agent, while the other strand imparts a second property to the iRNA. Can have a second asymmetric modification. For example, one strand, eg, the sense strand, can have a modification such that the iRNA agent targets the tissue, and the other strand, eg, the antisense strand, has a modification that promotes hybridization with the target gene sequence. Have.

  In some embodiments, both strands can be modified to optimize the same properties, for example, to increase resistance to nucleolysis, but the reason that the modification further affects other properties, for example. Thus, different modifications are selected for the sense strand and the antisense strand. For example, these modifications are chosen for the sense strand because some changes can affect RISC activity.

In certain embodiments, one strand has an asymmetric 2 ′ modification, such as a 2′OMe modification, and the other strand has an asymmetric modification of the phosphate backbone, such as a phosphorothioate modification. Thus, in one embodiment, the antisense strand has an asymmetric 2'OMe modification and the sense strand has an asymmetric phosphorothioate modification (or vice versa). In a particularly preferred embodiment, the iRNA agent of the invention comprises an asymmetric 2′-O alkyl, preferably 2′-OMe modification on the sense strand and an asymmetric backbone P-modification on the antisense strand, preferably Has phosphorothioate modification. There can be one or multiple 2'-OMe modifications, for example at least 2, 3, 4, 5 or 6 subunits of the sense strand can be 2'-OMe modified . There can be one or many phosphorothioate modifications, for example at least 2, 3, 4, 5 or 6 subunits of the antisense strand can be phosphorothioate modified. It is preferred to have an iRNA agent where there are multiple 2'-OMe modifications on the sense strand and multiple phosphorothioate modifications on the antisense strand. All subunits on one or both strands can be modified as described above. A particularly preferred embodiment of multiple asymmetric modifications on both strands is a double-stranded region of about 20-21 subunits, preferably 19 subunits in length, and one or two subunits in length. Has two 3 'protrusions.

  Asymmetric modifications are useful to promote resistance to degradation by nucleases such as endonucleases. An iRNA agent can include one or more asymmetric modifications that promote resistance to degradation. In a preferred embodiment, the modification on the antisense strand is a modification that does not interfere with target silencing, eg, a modification that does not interfere with target cleavage. Most if not all sites on the strand are somewhat vulnerable to degradation by endonucleases. A relatively weak site can be identified and an asymmetric modification that inhibits degradation can be inserted. In many cases it is desirable to provide an asymmetric modification of the UA site in the iRNA agent, and in some cases it is desirable to provide an asymmetric modification to the UA sequences on both strands. Examples of modifications that inhibit endonuclease degradation can be found herein. Particularly suitable modifications include 2′-position modifications (eg, particularly the addition of a 2′OMe moiety to U on the sense strand), backbone modifications (eg, phosphates particularly for U or A or both on the antisense strand). Replacing backbone O with S (eg, by providing a phosphorothioate modification), replacing U with a C5 amino linker, replacing A with G (sequence changes are located on the sense strand, antisense And preferably modifications at the 2 ′, 6 ′, 7 ′ or 8 ′ positions. Preferred embodiments are embodiments in which one or more of these modifications are present on the sense strand but not on the antisense strand, or in which the antisense strand has fewer such modifications. It is.

  Asymmetric modifications can be used to inhibit degradation by exonucleases. Asymmetric modifications can include those in which only one strand is modified, as well as those in which both are modified. In a preferred embodiment, the modification on the antisense strand is a modification that does not interfere with target silencing, eg, a modification that does not interfere with target cleavage. Some embodiments have asymmetric modifications on the sense strand, for example at the 3 'overhang, for example at the 3' end, and on the antisense strand, for example at the 3 'overhang, for example at the 3' end. When components of different sizes are introduced by modification, the larger one is preferably present on the sense strand. When a component having a different charge is introduced by modification, it is preferable that a portion having a larger charge is present on the sense strand.

Examples of modifications that inhibit degradation by exonucleases can be found herein. Particularly suitable modifications include 2′-position modifications (eg providing a 2′OMe moiety to the 3 ′ overhang, eg the 3 ′ end (the 3 ′ end is the 3 ′ position of the molecule as indicated by the context) Atom, or the most 3 ′ component, eg, the most 3 ′ P or 2 ′ position)), eg, replacing P with S (eg, providing phosphorothioate modification) or 3 ′ overhangs eg Backbone modification by use of methylated P at the 3 ′ end, combinations of 2 ′ modifications (eg providing a 2′OMe moiety and replacing, for example, P with S (eg providing a phosphorothioate modification) or a 3 ′ overhang In combination with backbone modification by the use of methylated P at the 3 ′ end of the moiety), modification with 3 ′ alkyl, modification of the 3 ′ overhang with eg abasic pyrrolidine at the 3 ′ end, naproxe , 3 'terminus of a modified and the like by components that inhibit ibuprofen or other degradation. Preferred embodiments are those in which one or more of these modifications are present on the sense strand but not on the antisense strand, or the antisense strand has fewer such modifications. is there.

  Modifications that affect targeting, such as those described herein, can be provided as asymmetric modifications. Targeted modifications that can inhibit silencing, for example by inhibiting target cleavage, can be provided as asymmetric modifications of the sense strand. A component that alters biodistribution (eg, cholesterol) can be provided as one or more (eg, two) asymmetric modifications in the sense strand. Targeted modifications that introduce components with relatively large molecular weights (eg, greater than 400, 500, or 1,000 daltons), or charged components (eg, two or more positive charges or one negative charge) The targeting modification that introduces the (constituting moiety) can be placed on the sense strand.

  Modifications that modulate (eg, increase or decrease) the affinity of a strand for its complement or target, such as those described herein, can be provided as asymmetric modifications. These modifications include 5 methyl U, 5 methyl C, pseudouridine, locked nucleic acid, 2thio U and 2-amino-A. In some embodiments, one or more of these are provided on the antisense strand.

  An iRNA agent has a defined structure with a sense strand and an antisense strand, often with short single-stranded overhangs, for example 2 or 3 nucleotides, at one or both 3 'ends. Asymmetric modifications can be used to optimize the activity of such structures, eg, by selectively positioning within the iRNA. For example, the terminal region of an iRNA agent defined by the 5 'end of the sense strand and the 3' end of the antisense strand is important for function. This region can include a terminal 2, 3 or 4 nucleotide pair and an optional 3 'overhang. In a preferred embodiment, the following: modifications to the sense strand 5 ′ end that inhibit kinase activation of the sense strand (eg, binding to complexes targeting the kinase molecule, or protection against degradation by 5 ′ exonuclease) One of the strands, which promotes a “tight” structure at this end of the molecule by enhancing the binding between the sense and antisense strands, Asymmetric modifications that result in one or more of the sense strand modifications are used.

  The terminal region of the iRNA agent defined by the 3 'end of the sense strand and the 5' end of the antisense strand is also important for function. This region can include a terminal 2, 3 or 4 nucleotide pair and an optional 3 'overhang. Preferred embodiments promote the “open” structure at this end of the molecule by reducing the bond between the sense and antisense strands, preferably the asymmetric of one strand, preferably the sense strand Includes modifications. Such modifications include placing a complex that targets the molecule, or modifications that promote nuclease resistance in this region of the sense strand. Modification of the antisense strand that inhibits kinase activation is avoided in preferred embodiments.

Exemplary modifications that are placed asymmetrically in the sense strand include the following:
(A) backbone modification (e.g. modification of backbone P) wherein P is replaced by S, or P substituted with alkyl or allyl (e.g. Me), and dithioate (SP = S) These modifications can be used to promote nuclease resistance;
(B) 2′-O alkyl (eg, 2′-OMe), 3′-O alkyl (eg, 3′-OMe) (modified at least one of the terminal and internal positions); Can be used to enhance the binding of the sense strand to the antisense strand, and the 3 ′ modification is at the 5 ′ end of the sense strand to avoid sense strand activation by RISC. Can be used;
(C) 2′-5 ′ linkages (by 2′-H, 2′-OH and 2′-OMe, and by P═O or P═S); these modifications promote nuclease resistance Or can be used to inhibit the binding of the sense strand to the antisense strand, or can be used at the 5 ′ end of the sense strand to avoid sense strand activation by RISC;
(D) L sugars (eg, 2′L-ribose with 2′-H, 2′-OH and 2′-OMe, L-arabinose); these modifications are to promote nuclease resistance or antisense Can be used to inhibit the binding of the sense strand to the strand, or can be used at the 5 ′ end of the sense strand to avoid sense strand activation by RISC;
(E) modified sugars (eg, locked nucleic acid (LNA), hexose nucleic acid (HNA) and cyclohexene nucleic acid (CeNA)); these modifications are to promote nuclease resistance or to attach the sense strand to the antisense strand Can be used to inhibit or can be used at the 5 ′ end of the sense strand to avoid sense strand activation by RISC;
(F) Nucleobase modifications (eg, C-5 modified pyrimidines, N-2 modified purines, N-7 modified purines, N-6 modified purines); these modifications may be used to promote nuclease resistance or antisense Can be used to facilitate binding of the sense strand to the strand;
(G) cationic and zwitterionic groups (preferably at the end); these modifications can be used to promote nuclease resistance;
(H) complex groups (preferably in terminal positions), eg naproxen, biotin, cholesterol, ibuprofen, folic acid, peptides and carbohydrates; these modifications are to promote nuclease resistance or to target molecules Can also be used at the 5 ′ end of the sense strand to avoid activation of the sense strand by RISC.

Exemplary modifications placed asymmetrically on the antisense strand include the following:
(A) backbone modification (e.g. modification of backbone P) wherein P is replaced by S, or P substituted with alkyl or allyl (e.g. Me), and dithioate (SP = S) Including;
(B) 2′-O alkyl (eg, 2′-OMe) (terminal position modified);
(C) 2′-5 ′ linkages (by 2′-H, 2′-OH and 2′-OMe (eg end modification at the 3 ′ end); preferably 3 ′ by P═O or P═S. Terminal modifications); these modifications are preferably excluded from the 5′-terminal region since they can interfere with RISC enzyme activity, such as kinase activity;
(D) L sugars (eg L-ribose with 2′-H, 2′-OH and 2′-OMe, L-arabinose); eg terminal modification at the 3 ′ end; eg P═O or P═ Preferably modifications at the 3 ′ end with S; these modifications are preferably excluded from the 5 ′ end region as they may interfere with kinase activity;
(E) modified sugars (eg, LNA, HNA and CeNA); these modifications may contribute to undesired enhancement of pairing between the sense and antisense strands, but often in the 5 ′ region Since it is preferred to have a “loose” structure, it is further preferably excluded from the 5 ′ end region, since the modification may interfere with kinase activity;
(F) nucleobase modifications (eg, C-5 modified pyrimidines, N-2 modified purines, N-7 modified purines, N-6 modified purines);
(G) a cationic group and a zwitterionic group (preferably at the end);
Cationic group and zwitterionic group at 2 ′ position of sugar, 3 ′ position of sugar; nucleobase modification (for example, C-5 modified pyrimidine, N-2 modified purine, N-7 modified purine, N-6 modified purine ) As a cationic group and a zwitterionic group;
Complex groups (preferably in the terminal position), such as naproxen, biotin, cholesterol, ibuprofen, folic acid, peptides and carbohydrates, although bulky groups or groups that generally inhibit RISC activity are less preferred It should be.

  The 5'-OH of the antisense strand should be kept free to promote activity. In some preferred embodiments, modifications that promote nuclease resistance should be included at the 3 'end, particularly the 3' overhang.

  In another aspect, the invention features a method for optimizing, eg, stabilizing, an iRNA agent. The method involves selecting a sequence having activity, introducing one or more asymmetric modifications to the sequence, and the introduction of the asymmetric modification optimizes the properties of the iRNA agent. However, there is no reduction in activity.

  The decrease in activity may be a decrease that is less than a preselected level of decrease. In preferred embodiments, a decrease in activity means a decrease of less than 5%, 10%, 20%, 40% or 50% when compared to the same iRNA except that no modification is introduced. Activity can be measured, for example, in vivo or in vitro, and results in either are sufficient to demonstrate the required maintenance of activity.

  The property to be optimized can be any property described herein, particularly the property discussed in the section on asymmetric modification herein. The modification can be any asymmetric modification, for example the asymmetric modification described in the section on asymmetric modification herein. Particularly preferred asymmetric modifications are 2'-O alkyl modifications (eg 2'-OMe modifications), especially in the sense sequence, and backbone O modifications, especially phosphorothioate modifications, in the antisense strand.

  In a preferred embodiment, the sense sequence is selected to provide an asymmetric modification, while in other embodiments an antisense sequence is selected to provide an asymmetric modification. In some embodiments, both sense and antisense sequences are selected, each with one or more asymmetric modifications.

  A number of asymmetric modifications can be introduced into one or both of the sense and antisense sequences. The sequence can have at least 2, 4, 6, 8, or more modifications and can modify all or substantially all monomers of the sequence.

  Table 3 shows examples having strand I with selected modifications and strand II with selected modifications.

Z-X-Y Configuration Formats RNA, eg, iRNA agents, are described herein as well as co-pending and co-pending US Provisional Application No. 60/510, filed October 9,2003. , 246 (which is incorporated herein by reference), co-pending co-owned US Provisional Application No. 60 / 510,318, filed October 10, 2003 ( This is incorporated herein by reference) and is described in co-pending international application No. PCT / US04 / 07070, filed March 8, 2004, and co-pending application. It can have a Z-X-Y configuration pattern or structure such as

In addition, the present invention includes iRNA agents having a Z-X-Y structure and another component described herein. For example, the present invention provides an iRNA agent described herein, eg, an iRNA agent having a palindromic structure, an iRNA agent having a non-standard pairing, a gene described herein (eg, active in the kidney) IRNA agents that target genes), iRNAs combined with amphiphilic delivery agents described herein, iRNAs combined with drug delivery modules described herein, described herein Or an iRNA agent formulated as described herein, which also incorporates a Z-X-Y configuration format.

Thus, the iRNA agent comprises a first segment Z region, a second segment X region, and optionally a third region Y region:
Z-X-Y
Can have.

  It may be desirable to modify subunits in one or both of Z and / or Y on the one hand and X on the other hand. In some cases, subunits have the same modification or the same type of modification, but the modifications made at Z and / or Y are often different from the modifications made at X.

The Z region usually includes the end of the iRNA agent. The length of the Z region can vary, but it is usually 2 to 14, more preferably 2 to 10 subunits. Usually, the Z region is single-stranded (ie, the Z region does not base pair with a base of another strand), but in some embodiments it can self-associate to form, for example, a loop structure. Such a structure can be formed by folding the end of a chain to form an intrachain duplex. For example, two, three, four, five or more intra-strand base pairs can be generated with folded or connecting regions usually made of two or more unpaired subunits. This may occur at one end of the chain or at both ends. An exemplary embodiment of the Z region is a single stranded overhang, eg, a length of overhang as described elsewhere herein. Thus, the Z region may be a single strand at the 3 ′ or 5 ′ end, or may include a single strand at the 3 ′ or 5 ′ end. The Z region may be a sense strand or an antisense strand, but in the case of antisense, the region is preferably a 3-overhang. Typical inter-subunit bonds in the Z region, P = O, P = S , S-P = S, include P-NR ₂ and P-BR _2. There may also be intersubunit linkages of chiral P = X, where X is S, N or B (these intersubunit linkages are more Are discussed in detail). Other preferred Z region subunit modifications (also discussed elsewhere herein) include 3′-OR, 3′SR, 2′-OMe, 3′-OMe and 2′OH modifications and configurations. Mention may be made of moieties, bases in the α configuration, and 2 ′ arabino modifications.

The X region is often double-stranded with a single-stranded corresponding region in the case of a single-stranded iRNA agent or with a corresponding region of the other strand in the case of a double-stranded iRNA agent. There is no. The length of the X region can vary, but it is usually 10 to 45, more preferably 15 to 35 subunits. Particularly preferred region X includes 17, 18, 19, 29, 21, 22, 22, 23, 24 or 25 nucleotide pairs, although other suitable lengths are described herein. They are described elsewhere in the book and can be used. Exemplary X region subunits include 2'-OH subunits. In typical embodiments, intersubunit phosphate linkages are preferred, while no phosphorothioate or non-phosphate linkages are present. Other preferred modifications in the X region include modifications to improve binding (eg, nucleobase modifications), cationic nucleobase modifications, and C-5 modified pyrimidines (eg, allylamine). Some embodiments have 4 or more consecutive 2′OH subunits. The use of phosphorothioates may not be preferred, but can also be used when linking less than 4 consecutive 2'OH subunits. The Y region generally follows the parameters described for the Z region. However,
The X and Z regions do not have to be the same, and there can be different types and numbers of modifications, in fact, one is usually a 3 'overhang and one is usually a 5' overhang.

  In preferred embodiments, the iRNA agent is a Y and / or Z region each having a ribonucleoside substituted with 2′OH, eg, 2′-OMe or other alkyl, and 2′-OH remains unsubstituted. It has an X region containing at least 4 consecutive ribonucleoside subunits.

  The subunit binding of iRNA agents (binding between subunits) may be modified, for example, to promote resistance to degradation. Many examples of such modifications are disclosed herein, one example being a phosphorothioate linkage. These modifications can be imparted between the subunits of any of the regions X, Y and Z. However, it is preferred that those modifications be minimized, especially that consecutive modified bonds are avoided.

  In a preferred embodiment, the iRNA agent is a Y and Z region each having a ribonucleoside in which 2′OH is substituted with, for example, 2′-OMe, and at least 4 consecutive sequences in which 2′-OH remains unsubstituted. And an X region containing a subunit (eg, a ribonucleoside subunit).

  As mentioned above, subunit binding of iRNA agents may be modified, for example, to promote resistance to degradation. These modifications can be imparted between the subunits of any of the regions Y, X and Z. However, it is preferred that the modifications be minimized and in particular that consecutive modified bonds are avoided.

  Thus, in preferred embodiments, not all of the iRNA agent subunit linkages are modified, more preferably the maximum number of consecutive subunits linked by linkages other than phosphodiester linkages is 2, 3 Or four. Particularly preferred iRNA agents are wherein each subunit is bound by a modified bond (ie, a bond that has been modified to stabilize the bond against degradation when compared to the phosphodiester bond naturally found in RNA and DNA). It does not have 4 or more consecutive subunits, such as 2'-hydroxyl ribonucleoside subunits.

  It is particularly preferred to minimize the above modification in region X. Thus, in preferred embodiments, such modifications are minimized if each of the nucleoside subunit linkages in X is a phosphodiester linkage, or the subunit linkage in region X is modified. For example, the Y and / or Z regions can include intersubunit linkages that are stabilized against degradation, but such modifications are minimized in the X region, especially consecutive modifications are minimal. It can be suppressed to the limit. Thus, in a preferred embodiment, the maximum number of consecutive subunits bound other than phosphodiester bonds is 2, 3 or 4. Particularly preferred X regions are each linked by a modified bond (ie, a bond modified to stabilize the bond against degradation when compared to phosphodiester bonds found naturally in RNA and DNA). It does not have 4 or more consecutive subunits, such as 2'-hydroxyl ribonucleoside subunits.

  In preferred embodiments, Y and / or Z do not contain phosphorothioate linkages, but one or both may contain other modifications, such as other modifications of subunit linkages. In preferred embodiments, region X, or optionally all iRNA agents, has no more than 3 or no more than 4 subunits having the same 2 'moiety.

In preferred embodiments, region X, or in some cases all iRNA agents, have no more than 3 or no more than 4 subunits having the same subunit linkage.
In preferred embodiments, one or more phosphorothioate linkages (or other modifications of subunit linkages) are present in Y and / or Z, but such modified linkages are 2′-position modifications (eg, 2 ′ It does not join two adjacent subunits (eg, nucleosides) having a '-O-alkyl moiety). For example, all adjacent 2′-O-alkyl moieties in Y and / or Z are connected by bonds other than phosphorothioate bonds.

  In a preferred embodiment, each Y and / or Z independently has only one phosphorothioate linkage between subunits such as adjacent nucleosides with 2 ′ modification (eg, 2′-O-alkyl nucleosides). Have. If there is another set of subunits such as adjacent nucleosides with 2 ′ modifications (eg, 2′-O-alkyl nucleosides) in Y and / or Z, this second set is a bond other than a phosphorothioate bond. For example, by a modified bond other than a phosphorothioate bond.

  In a preferred embodiment, two or more of each of Y and / or Z independently join adjacent pairs of subunits such as nucleosides having a 2 ′ modification (eg, 2′-O-alkyl nucleosides). At least one pair of adjacent subunits of a subunit such as a nucleoside having a phosphorothioate linkage but having a 2 ′ modification (eg, a 2′-O-alkyl nucleoside) is a non-phosphorothioate linkage, eg, a phosphorothioate linkage It is bound by a modified bond.

  In a preferred embodiment, one of the above restrictions on adjacent subunits in Y and / or Z is combined with a restriction on subunits in X. For example, one or more phosphorothioate linkages (or other modifications of subunit linkages) are present in Y and / or Z, but such modified linkages are 2′-modified (eg, 2′-O— It does not join two adjacent subunits, such as a nucleoside with an alkyl moiety). For example, every adjacent 2'-O-alkyl moiety of Y and / or Z is connected by a bond other than a phosphorothioate bond. Further, the X region has 3 or less or 4 or less identical subunits (for example, a subunit having the same 2 ′ portion), or the X region contains 3 or less or 4 or less identical subunits. It has subunits with unit linkage.

  The Y region and / or the Z region can include at least one, preferably two, three, or four modifications disclosed herein. Such modifications are independent of any modification described herein (eg, nuclease resistant subunits, subunits having modified bases, subunits having modified intersubunit linkages, subunits having modified sugars). A unit and a subunit linked to another component (eg, a targeting moiety) can be selected. In preferred embodiments, there may be more than one such subunit, but in some embodiments, no more than 1, no more than 2, no more than 3, or no more than 4 such modifications are made. Or continuously. In a preferred embodiment, the frequency of modification varies between Y and / or Z and X, for example, the modification is present in one of Y and / or Z and X and not in the other.

The X region can include at least one, preferably 2, 3 or 4 modifications disclosed herein. Such modifications independently comprise any modification described herein (eg, nuclease resistant subunits, subunits having modified bases, subunits having modified intersubunit linkages, modified sugars). A subunit, and a subunit linked to another component (eg, a targeting moiety) can be selected. In preferred embodiments, there may be more than one such subunit, but in some embodiments, no more than 1, no more than 2, no more than 3, or no more than 4 such modifications are made. Or continuously.

  RRMS (described elsewhere herein) can be introduced at one or more sites in one or both strands of a double stranded iRNA agent. RRMS is in the Y and / or Z region at or near the 3 ′ or 5 ′ end of the sense strand (within 1, 2 or 3 positions from the end), or at or near the 3 ′ end of the antisense strand (end) 2 or within 3rd position). In some embodiments, it is preferred not to have an RRMS at or near the 5 'end of the antisense strand (within positions 1, 2 or 3 from the 5' end). It is also possible to place the RRMS in the X region, preferably in the sense strand or in the region of the antisense strand that is not critical for the binding of the antisense strand to the target.

Differential Modification of Duplex Stability at the End In one aspect, the invention features an iRNA agent that can have a differential modification of duplex stability at the end (DMTDS).

  Furthermore, the present invention encompasses iRNA agents having DMTDS and another component described herein. For example, the invention may be directed to an iRNA agent described herein, eg, an iRNA agent having a palindromic structure, an iRNA agent having a non-standard pairing, a gene described herein (eg, active in the liver) An iRNA agent that targets a gene), an iRNA agent having the configuration or structure described herein, an iRNA combined with an amphipathic delivery agent described herein, described herein An iRNA combined with a drug delivery module, an iRNA agent administered as described herein, or an iRNA agent formulated as described herein, wherein the iRNA agent also incorporates DMTDS Is included.

  iRNA agents are optimized by increasing the tendency of the duplex to dissociate or melt in the region of the 5 ′ end of the antisense strand duplex (reducing the free energy of duplex association) be able to. This can be accomplished, for example, by including a subunit in the region of the 5 'end of the antisense strand that increases the tendency of the duplex to dissociate or melt. It can also be achieved by binding to the 5 'terminal region a ligand that increases the tendency of the duplex to dissociate or melt. Without wishing to be bound by theory, the effect can be attributed to promoting the action of an enzyme such as helicase, eg, promoting the action of an enzyme proximate to the 5 'end of the antisense strand.

  We also reduce the tendency of the duplex to dissociate or melt (increase the free energy of association of the duplex) in the 3 ′ end region of the antisense strand duplex. I also discovered that it can be optimized. This can be achieved, for example, by including a subunit in the region of the 3 'end of the antisense strand that reduces the tendency of the duplex to dissociate or melt. It can also be achieved by binding to the 5'-terminal region a ligand that reduces the tendency of the duplex to dissociate or melt.

  Modifications that increase the tendency of the 5 ′ end of the duplex to dissociate are alone or other modifications described herein, such as modifications that reduce the tendency of the 3 ′ end of the duplex to dissociate. Can be used in combination. Similarly, modifications that reduce the tendency of the 3 ′ end of the duplex to dissociate increase the tendency of the 5 ′ end of the duplex to dissociate alone or with other modifications described herein, for example. Can be used in combination with the modification.

Decreased stability of double-stranded AS 5 ′ ends Subunit pairs can be ranked based on their tendency to promote dissociation or melting (eg, with respect to the free energy of association or dissociation of a particular pair) The simplest approach is to examine the pair for each individual pair, but the following similar or similar analysis can also be used): In terms of promoting dissociation,
A: U is preferred over G: C;
G: U is preferred over G: C;
I: C is preferred over G: C (I = inosine);
Mismatches such as non-standard or non-standard pairings (as described elsewhere herein) are standard (A: T, A: U, G: C) preferred over pairs;
Pairings involving universal bases are preferred over standard pairs.

  A typical ds iRNA agent can be illustrated as follows:

S represents the sense strand, AS represents the antisense strand, R ₁ represents an optional (and not preferred) 5 ′ sense strand overhang, and R ₂ represents an optional (but preferred) 3 ′ sense overhang. R ₃ represents an optional (but preferred) 3 ′ antisense overhang, R ₄ represents an optional (and not preferred) 5 ′ antisense overhang, and N represents a subunit. , [N] indicates that additional subunit pairs may be present, and P _x indicates the pair of sense strand N _x and antisense strand N _x . The protrusion is not shown in FIG. In some embodiments, as described elsewhere herein, the 3 ′ AS overhang corresponds to region Z, the double stranded region corresponds to region X, and the 3 ′ S chain overhang. Corresponds to the region Y. (The figure is not meant to imply the maximum or minimum length, and length guidance is provided elsewhere in this specification).

Pairs that reduce the tendency to form duplexes are preferably used at one or more positions of the duplex at the 5 ′ end of the AS strand. The terminal pair (the 5'-most pair with respect to the AS chain) is called P- _1, and the position of the subsequent pairing in the duplex (towards the 3 'direction when viewed from the AS chain) is , P- ₂ , P- ₃ , P- ₄ , P- _{5 and the} like. Preferable regions for applying a modification that regulates duplex formation are P- _{5 to} P- ₁ , more preferably P- _{4 to} P- ₁ , and still more preferably P- _{3 to} P- ₁ . Modification of P- ₁ is particularly preferred and may be used alone or in combination with modification (s) at other position (s) (eg, any of the positions identified above). At least one, more preferably 2, 3, 4, or 5 pairs present in one of the above-mentioned regions are independently the following groups:
A: U
G: U
I: C
It is preferably selected from mismatched pairs, such as non-standard pairs, ie pairs other than standard pairs, or pairs containing universal bases.

In preferred embodiments, the subunit changes required to achieve pairing that promote dissociation are made on the sense strand, while in some embodiments, the changes are made on the antisense strand.

In a preferred embodiment, at least two or three pairs in P- _{1 to} P- ₄ are pairs that promote dissociation.
In preferred embodiments, at least two or three pairs of P _{−1 to} P ₋₄ are A: U.

In a preferred embodiment, at least 2 or 3 pairs in P _{−1 to} P ₋₄ are G: U.
In a preferred embodiment, at least 2 or 3 pairs in P _{−1 to} P ₋₄ are I: C.

In a preferred embodiment, at least two or three pairs in P _{−1 to} P ₋₄ are mismatched pairs, for example non-standard pairs, ie pairs other than standard pairs.
In a preferred embodiment, at least two or three pairs in P- _{1 to} P- ₄ are pairs comprising universal bases.

Increased stability of the double-stranded AS 3 ′ end Subunit pairs can be ranked based on their propensity to promote stability and inhibit dissociation or melting (eg, specific pairings For the free energy of association or dissociation, the simplest approach is to examine the pairs for each individual pair, but the following similar or similar analysis can also be used): In terms of promoting duplex stability,
G: C is preferred over A: U;
Watson-Crick pairings (A: T, A: U, G: C) are preferred over non-standard pairs, ie, non-standard pairs
Analogs that increase stability are preferred over Watson-Crick pairings (A: T, A: U, G: C),
2-amino-A: U is preferred over A: U;
2-thio U or 5Me-thio-U: A is preferred to U: A,
G-clamp (an analog of C with 4 hydrogen bonds): G is preferred over C: G;
Guanazinium-G-clamp: G is preferred over C: G;
Pseudouridine: A is preferred to U: A,
Sugar modifications that enhance binding, such as 2 ′ modifications (eg, 2′F, ENA or LNA) are preferred over unmodified moieties and on one or both strands to enhance duplex stability. Can exist. Pairs that increase the tendency to form duplexes are preferably used at the 3 ′ end of the AS strand at one or more positions in the duplex. The terminal pair (as viewed from the AS strand 3'-most pair) is referred to as P _1, (5 viewed from the AS strand two pairs position of engagement of the chain followed by 'go toward the direction) , P ₂ , P ₃ , P ₄ , P ₅ etc. Preferable regions for carrying out modifications that regulate duplex formation are P _{5 to} P ₁ , more preferably P _{4 to} P ₁ , and even more preferably P _{3 to} P ₁ . Modification is particularly preferably at P _1, alone, or other location (s) (e.g., any of the positions identified above) may be used in combination with modification (s). At least one, more preferably 2, 3, 4 or 5 pairs present in the above-mentioned region are independently the following groups:
G: C
Pairs with analogs that increase stability over Watson-Crick pairings (A: T, A: U, G: C) 2-amino-A: U 2-thioU or 5Me-thio-U: A
G-clamp (analog of C with 4 hydrogen bonds): G
Guanazinium-G-Clamp: G
Pseudouridine: A
It is preferred that one or both subunits are selected from a pair having a sugar modification that enhances binding, such as a 2 ′ modification (eg, 2′F, ENA or LNA).

In preferred embodiments, at least two or three pairs in P- _{1 to} P- ₄ are pairs that promote duplex stability.
In a preferred embodiment, at least 2 or 3 pairs in P ₁ -P ₄ are G: C.

In preferred embodiments, at least two or three pairs in P ₁ -P ₄ are pairs with analogs that increase stability over Watson-Crick pairings.
In a preferred embodiment, at least 2 or 3 pairs in P _{1 to} P ₄ are 2-amino-A: U.

In a preferred _embodiment, at least 2, or 3, of the pairs in P 1 to P _4, 2-thio U or 5Me- thio -U: a A.
In a preferred _embodiment, at least 2, or 3, of the pairs in P 1 to P _4, G-clamps: a G.

In a preferred embodiment, at least two or three pairs in P _{1 to} P ₄ are guanidinium-G-clamp: G.
In a preferred embodiment, at least 2 or 3 pairs in P ₁ -P ₄ are pseudouridine: A.

In a preferred embodiment, at least two or three pairs in P ₁ -P ₄ are linked to a sugar modification, such as a 2 ′ modification (eg, 2′F, ENA or Pair with LNA).

G-clamps and guanidinium G-clamps are discussed in the following references. Holmes and Gait, “The Synthesis of 2′-O-Methyl G-Clamp”. Synthesis of 2′-O-methyl G-clamp containing oligonucleotides and their inhibition of HIV-1 Tat-TAR interaction. Containing Oligonucleotides and Their Inhibition of the HIV-1 Tat-TAR Interaction) ", Nucleotides, Nucleotides & Nucleic Acids, Vol. 22: 1259-1262, 2003, Holmes et al.,"2'-O-methyl. Stereoinhibition of human immunodeficiency virus type-1 Tat-dependent transactivation in vitro and in cells by oligonucleotides containing G-clamp ribonucleoside analogs -activation in vitro and in cells by oligonucl eotides containing 2'-O-methyl G-clamp ribonucleoside analogues), Nucleic Acids Research, 31: 2759-2768, 2003, Wilds et al. (Wilds, et al.), "Synthetic tricyclic cytosine analogues. : Structural basis for recognition of guanosine by a synthetic tricyclic cytosine analogue: Guanidinium G-clamp ", Helvetica Chimica Acta, 86: 966-978, 2003, Lajeev (Rajeev, et al.), “High-Affinity Peptide Nucleic Acid Oligomers Containing Tricyclic Cytosine Analogues”, Organic Letters, Vol. 4: 4395-4398. page 2002, Aushin et al. (Ausin, et al. ), “Synthesis of Amino- and Guanidino-GC
lamp PNA Monomers), Organic Letters, 4: 4073-4075, 2002, Maier et al., “Tricyclic cytosine analogs phenoxazine and 9- (2-aminoethoxy) phenoxazine. Nuclease resistance of oligonucleotides containing the tricyclic cytosineanalogues phenoxazine and 9- (2-aminoethoxy) -phenoxazine ("G-clamp") and origins of
their nuclease resistance properties) ", Biochemistry, Volume 41:
1323-7, 2002, Flanagan et al., “Cytosine analogs that confer enhanced potency against antisense oligonucleotides (A
cytosine analog that confers enhanced potency to antisense oligonucleotides) ”, Proceedings Of The National Academy Of
Sciences Of The United States Of America, 96: 3513-8, 1999.

Simultaneously reducing the stability of the double-stranded AS 5 ′ end and increasing the stability of the double-stranded AS 3 ′ end As noted above, the iRNA agent Modifications can be made to reduce stability and increase the stability of the double-stranded AS 3 ′ end. This combines a modification that decreases one or more stability at the AS 5 ′ end of the duplex with a modification that increases stability at the AS 3 ′ end of the duplex. Can be achieved. Accordingly, preferred embodiments include modifications at P- _{5 to} P- ₁ , more preferably P- _{4 to} P- ₁ , and even more preferably P- _{3 to} P- ₁ . Modification at P ₋₁ is particularly preferred and may be used alone or in combination with other positions (eg, the positions identified above). At least one, more preferably 2, 3, 4 or 5 pairs present in one of the above-mentioned regions at the AS 5 ′ end of the double-stranded region are independently selected from the following group: Preferably it is:
A: U
G: C
I: U
Mismatched pairs, such as non-standard pairs, ie pairs other than standard pairs, or pairs containing universal bases, and P _{5 to} P ₁ , more preferably P _{4 to} P ₁ , more preferably modifications at the P ₃ ~P _1. Modification at P ₁ is particularly preferred and may be used alone or in combination with other positions (eg, the positions identified above). At least one, more preferably 2, 3, 4 or 5 pairs present in one of the above-mentioned regions at the AS 3 ′ end of the double-stranded region are independently the following groups:
G: C
Pairs with analogs that increase stability over Watson-Crick pairings (A: T, A: U, G: C) 2-amino-A: U
2-thio U or 5Me-thio-U: A
G-clamp (analog of C with 4 hydrogen bonds): G Guanazinium-G-clamp: G
Pseudouridine: A
It is preferred that one or both subunits are selected from a pair having a sugar modification that enhances binding, such as a 2 ′ modification (eg, 2′F, ENA or LNA).

The invention also encompasses methods for selecting and making iRNA agents having DMTDS. For example, when screening target sequences for candidate sequences for use as iRNA agents, sequences having the DMTDS properties described herein, and the desired level of DMT
In order to confer DS, it is possible to select a sequence that can be modified, particularly with respect to the AS chain, with as few changes as possible.

The present invention also is to provide a candidate iRNA agent sequence, as well as to provide DMTDS iRNA _agent, at least one of the at least one P and / or _P 5 to P ₁ in P -5 _{to P -1} Includes modifying P.

  A DMTDS iRNA agent is used in any method described herein to treat any disorder described herein, eg, to silence any gene disclosed herein. , In any formulation described herein, and usually in the methods and compositions described elsewhere herein, or the methods and compositions described elsewhere herein. Can be used with. DMTDS iRNA agents may include other modifications described herein, such as binding targeting agents or modifications that enhance stability, such as inclusion of nuclease resistant monomers or self-association and Including single-stranded overhangs (eg, 3′AS overhangs and / or 3 ′S chain overhangs) that form a double-stranded structure can be incorporated.

Preferably, these iRNA agents have the configuration mode described herein.
Other Embodiments RNA, such as iRNA agents, can be produced in a cell in vivo, eg, from a template of foreign DNA that is delivered to the cell. For example, the DNA template can be inserted into a vector and used as a gene therapy vector. Gene therapy vectors are available, for example, by intravenous injection, topical administration (US Pat. No. 5,328,470), or stereotaxic injection (eg, Chen et al., Proc. Natl. Acad. Sci. USA).
91: pp. 3054-3057, see 1994). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent or can include a sustained release matrix in which the gene delivery vehicle is embedded. For example, a DNA template can include two transcription units, one that produces a transcript that includes the top of the iRNA agent strand and one that produces a transcript that includes the bottom of the iRNA agent. When the template is transcribed, an iRNA agent is produced and processed into sRNA agent fragments that mediate gene silencing.

In Vivo Delivery An iRNA agent can be linked, eg, non-covalent, to a polymer for efficient delivery of the iRNA agent to a subject (eg, a mammal such as a human). The iRNA agent can be complexed with, for example, cyclodextrin. Cyclodextrins have been used as delivery vehicles for therapeutic compounds. Cyclodextrins can form inclusion complexes with drugs that can fit within the hydrophobic cavities of cyclodextrins. In other examples, cyclodextrins form non-covalent bonds with other biologically active molecules such as oligonucleotides and their derivatives. The use of cyclodextrins creates water soluble drug delivery complexes that can be modified with targeting groups or other functional groups. The cyclodextrin cell delivery system for oligonucleotides described in US Pat. No. 5,691,316, which is hereby incorporated by reference, is suitable for use in the methods of the invention. In this system, the oligonucleotide is complexed non-covalently with the cyclodextrin, or the oligonucleotide is covalently bound to adamantine, which is subsequently non-covalently bound to the cyclodextrin.

Delivery molecules can include linear cyclodextrin copolymers or linear oxidized cyclodextrin copolymers that have at least one ligand attached to the cyclodextrin copolymer. Delivery systems such as those described in US Pat. No. 6,509,323 (incorporated herein by reference) are suitable for use in the present invention. The iRNA agent can be bound to a linear cyclodextrin copolymer and / or a linear oxidized cyclodextrin copolymer. One or both of the cyclodextrin copolymer or oxidized cyclodextrin copolymer can be cross-linked to another polymer and / or bound to a ligand.

  An iRNA delivery composition can use an “inclusion complex” which is a molecular compound having a characteristic structure of an adduct. In this structure, the “host molecule” spatially encapsulates at least a portion of another compound in the delivery vehicle. The encapsulated compound (“guest molecule”) is placed in the host molecule cavity without affecting the framework structure of the host molecule. A “host” is preferably a dextrin, but can be any molecule proposed in US Patent Publication No. 2003/0008818 (incorporated herein by reference).

  Cyclodextrins can interact with various ions and molecules, and the resulting inclusion compounds belong to the “host-guest” complex type. Within the host-guest relationship, the binding sites of the host molecule and guest molecule should be complementary in a stereoelectronic sense. The compositions of the present invention can contain at least one polymer and at least one therapeutic agent, usually in the form of a particulate composite of polymer and therapeutic agent (eg, iRNA agent). An iRNA agent can contain one or more complexing agents. At least one polymer of the particulate composite can interact with the complexing agent in a host-guest or guest-host interaction to form an inclusion complex between the polymer and the complexing agent. More specifically, the polymer and complexing agent can be used to introduce functionality into the composition. For example, at least one polymer of the particulate composite has a host function and forms an inclusion complex with a complexing agent having a guest function. As another example, at least one polymer of the particulate composite has a guest function and forms an inclusion complex with a complexing agent having a host function. The particulate composite polymer can also contain both host and guest functions and can form inclusion complexes with guest and host complexing agents. Functional polymers include, for example, cell targeting and / or contact with cells (eg, targeting to or contact with hepatocytes), cell-cell transport, and entry into and release from cells. At least one).

  In forming the particulate complex, the iRNA agent may or may not maintain its biological or therapeutic activity. When released from the therapeutic composition, specifically from the polymer of the particulate composite, the activity of the iRNA agent is restored. Thus, the particulate composite preferably protects the iRNA agent from loss of activity due to, for example, degradation and enhances bioavailability. Thus, the composition can be used to provide stability, particularly in storage or in solution, to an iRNA agent or any active chemical. The iRNA agent may be further modified with a ligand before or after forming the particulate composite or therapeutic composition. The ligand can provide additional functionality. For example, the ligand can be a targeting moiety.

Physiological Effects The iRNA agents described herein are designed such that therapeutic toxicity determination is made easier by complementation of the iRNA agent with both human and non-human animal sequences. be able to. In these methods, the RNA agent is fully complementary to a nucleic acid sequence from a human and at least one non-human animal, eg, a non-human mammal (eg, a rodent, ruminant or primate). It can consist of a sequence. For example, the non-human mammal can be a mouse, rat, dog, pig, goat, sheep, cow, monkey, pygmy chimpanzee, nami chimpanzee, rhesus monkey or cynomolgus monkey. The sequence of the iRNA agent can be complementary to sequences within non-human mammalian and human homologous genes, such as oncogenes or tumor suppressor genes. By determining the toxicity of an iRNA agent in a non-human mammal, the toxicity of the iRNA agent in a human can be estimated. For more severe toxicity testing, the iRNA agent can be complementary to humans and two or more (eg, two or three or more) non-human animals.

  The methods described herein are used to correlate with any physiological effect of an iRNA agent on a human, such as any undesirable effect, such as a toxic effect, or any desired effect, ie a desired effect. be able to.

Delivery Module RNA, eg, an iRNA agent described herein, is a drug delivery complex or module (eg, those described herein and co-pending co-owned March 12, 2003). US Provisional Application No. 60 / 454,265, filed on March 8, 2004, and International Application No. PCT / US04 / 07070, filed March 8, 2004, both of which are incorporated herein by reference. Can be used together with those described in).

  In addition, the present invention relates to iRNA agents described herein that are combined, bound, and delivered with such drug delivery complexes or modules, eg, palindromic structure iRNA agents, non-standard pairs. A iRNA agent that targets a gene described herein (eg, a gene that is active in the liver), a chemical modification described in the present invention (eg, a modification that enhances resistance to degradation) An iRNA agent, an iRNA agent having the configuration or structure described herein, an iRNA agent administered as described herein, or an iRNA agent formulated as described herein Is included.

  The iRNA agent can be complexed to a delivery agent characterized by a modular complex. The complex comprises (a) a condensing agent (eg, an agent capable of attracting (eg, binding) nucleic acids, eg, by ionic or electrostatic interactions), (b) a fusion agent (eg, cell membrane (eg, Agents capable of fusing and / or transported across the membrane), and (c) targeting groups, eg, substances that target cells or tissues (eg, Link to one or more (preferably two or more, more preferably all three) of lectins, glycoproteins, lipids or proteins (eg antibodies) that bind to specific cell types such as hepatocytes The carrier material can be included.

  An iRNA agent, eg, an iRNA agent or sRNA agent described herein, can be linked (eg, coupled or bound) to a modular complex. The iRNA agent can interact with the condensing agent of the complex, and the complex can be used to deliver the iRNA agent to a cell, for example, in vitro or in vivo. For example, the complex may be used to deliver an iRNA agent to a subject in need of delivery of the iRNA agent, eg, to a subject having a disorder (eg, a disorder described herein, such as a liver disease or disorder). It can be used to deliver iRNA agents.

  The fusing agent and condensing agent may be different agents or may be one and the same agent. For example, a polyamino chain, such as polyethyleneimine (PEI), can be a fusing agent and / or a condensing agent.

The delivery agent can be a modular complex. For example, the complex is:
(A) a condensing agent (eg, an agent capable of attracting (eg, binding) nucleic acids, eg, by ionic interactions),
(B) a fusion agent (eg, an agent capable of fusing and / or transported across the cell membrane (eg, endosomal membrane)), and (c) a targeting group, eg, a cell Or one or more (preferably two or more of the lectins, glycoproteins, lipids or proteins (eg antibodies) that bind to specific cell types such as hepatocytes, for example, that target the tissue , More preferably all three) targeting groups may include thyroid stimulating hormone, melanocyte stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent Lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, glycosylated poly Amino acid, polyvalent galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, neproxin, or RGD peptide or RDG peptide mimetic .

Carrier Material The carrier material of the modular complex described herein can be a base for attaching one or more of a condensing agent, a fusogenic agent and a targeting group. It is preferred that the carrier material lacks endogenous enzyme activity. The carrier material is preferably a biomolecule, preferably a polymer. A polymeric biological carrier is preferred. It is also preferred that the carrier molecule is biodegradable.

  The carrier material can be a protein (eg, human serum albumin (HSA), low density lipoprotein (LDL) or globulin), a carbohydrate (eg, dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid), or lipid It can be a naturally occurring substance such as The carrier molecule can also be a recombinant molecule such as a synthetic polymer (eg, a synthetic polyamino acid) or a synthetic molecule. Examples of polyamino acids include polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic anhydride copolymer, poly (L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride Copolymer, N- (2-hydroxypropyl) methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly (2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine ). Other useful carrier molecules can be identified by routine methods.

  The support material is (a) at least 1 Da in size, (b) has at least 5 charged groups, preferably 5 to 5,000 charged groups, (c) at least 1: 1 support material Present in the complex in a ratio of to fusion agent, (d) present in the complex in a ratio of at least 1: 1 carrier material to condensing agent, (e) at least 1: 1 carrier material to target One or more of being present in the complex in a ratio of the agent may be characterized.

Fusion Agents The modular complex fusion agents described herein can be agents that are responsive to a pH environment, eg, change charge in response to the pH environment. Upon encountering the pH of the endosome, the fusion agent can cause a physical change, such as a change in osmotic properties that disrupts the endosomal membrane or increases the permeability of the endosomal membrane. Preferably, the fusogenic agent changes charge (eg, becomes protonated) at a pH below the physiological range. For example, the fusogenic agent can become protonated at pH 4.5-6.5. The fusion agent can increase the intracellular concentration of the iRNA agent in the cell by acting to release the iRNA agent into the cytoplasm of the cell after the complex is taken up by the cell, for example by endocytosis. .

In one embodiment, the fusogenic agent can have a component (eg, an amino group) that undergoes, for example, a change in charge (eg, protonation) when exposed to a particular pH range. Changes in the charge of the fusion agent can induce changes (eg, osmotic pressure changes) in vesicles, eg, intracellular vesicles (eg, endosomes). For example, when the fusion agent is exposed to the endosomal pH environment, it causes a substantially sufficient solubility or osmotic pressure change to increase (preferably to rupture) the endosomal membrane.

  The fusogenic agent can be a polymer, preferably a polyamino chain (eg, polyethyleneimine (PEI)). PEI may be linear, branched, synthetic or natural. The PEI may be, for example, alkyl-substituted PEI or lipid-substituted PEI.

  In other embodiments, the fusogenic agent can be a polyhistidine, polyimidazole, polypyridine, polypropyleneimine, melittin or polyacetal material (eg, cationic polyacetal). In some embodiments, the fusion agent can have an α helix structure. The fusogenic agent can be a membrane disrupting agent (eg, melittin).

  The fusogenic agent can have one or more of the following characteristics: (a) size is at least 1 Da, (b) at least 10 charged groups, preferably 10-5,000 charged. Having a group, more preferably 50-1,000 charged groups, (c) present in the complex in a ratio of at least 1: 1 fusion agent to carrier material, (d) at least 1: 1. Present in the complex in a ratio of fusion agent to condensing agent; (e) present in the complex in a ratio of at least 1: 1 fusion agent to targeting agent.

  Other suitable fusion agents can be tested and identified by a specialist. The ability of a compound to respond to a pH environment (eg, change its charge in response to the pH environment) can be tested by routine methods, for example, in a cellular assay. For example, a test compound is combined with or contacted with a cell, causing the cell to take up the test compound, for example, by endocytosis. Subsequently, an endosome preparation can be made from the contacted cells, and the endosome preparation can be compared to an endosome preparation from a control cell. A change (eg, a decrease) in the endosomal fraction from the contact treated cells relative to the control cells indicates that the test compound can function as a fusion agent. Alternatively, contact treated cells and control cells can be evaluated, for example, by microscopy (eg, by light microscopy or electron microscopy) to determine differences in endosomal populations in the cells. The test compound may be labeled. In another type of assay, the modular complex described herein is constructed using one or more test or putative fusion agents. Modular complexes can also be constructed using labeled nucleic acids instead of iRNA. The ability of the fusogenic agent to respond to the pH environment (eg, change the charge in response to the pH environment) is such that once the modular complex is taken up by the cell, as described above, eg, by preparing an endosomal preparation, or It can be evaluated by microscopic techniques. A two-step assay can also be performed in which the first assay evaluates the ability of the test compound alone to respond to the pH environment (eg, change charge depending on the pH environment) The assay assesses the ability of the modular complex containing the test compound to respond to the pH environment (eg, change charge depending on the pH environment).

Condensing Agent The modular complex condensing agent described herein can interact with an iRNA agent (eg, attract, retain or bind to an iRNA agent) and (a) condense the iRNA agent ( For example, it can act to reduce the size or charge of the iRNA agent and / or (b) protect the iRNA agent (eg, protect the iRNA agent against degradation). A condensing agent can include a component (eg, a charged group) that can interact with a nucleic acid (eg, an iRNA agent), eg, by ionic interaction. The condensing agent is preferably a charged polymer (eg, a polycation chain). The condensing agent is polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of α or α It can be a helical peptide.

  The condensing agent may have the following characteristics: (a) having a size of at least 1 Da, (b) having at least 2 charged groups, preferably 2-100 charged groups, (c) Present in the complex in a ratio of condensing agent to carrier material of at least 1: 1, (d) present in the complex in a ratio of condensing agent to fusion agent of at least 1: 1, (e) at least 1 Be present in the complex at a ratio of 1 condensing agent to targeting agent.

  Other suitable condensing agents can be tested and identified by an expert, for example, by assessing the ability of a test agent to interact with a nucleic acid (eg, an iRNA agent). The ability of a test agent to interact with a nucleic acid (eg, an iRNA agent) (eg, condense or protect the iRNA agent) can be assessed by routine techniques. In one assay, a test agent is contacted with a nucleic acid, and the size and / or charge of the contacted nucleic acid is assessed by techniques suitable for detecting changes in molecular mass and / or charge. Such techniques include non-denaturing gel electrophoresis, immunological methods (eg immunoprecipitation), gel filtration, ionic interaction chromatography and the like. A test agent is identified as a condensing agent if it changes the mass and / or charge (preferably both) of the contacted nucleic acid compared to a control. A two-step assay can also be performed in which the first assay interacts with the nucleic acid of the test compound alone (eg, binds to the nucleic acid (eg, condenses the charge and / or mass of the nucleic acid)). The second assay interacts with the nucleic acid (eg, binds to the nucleic acid (eg condenses the charge and / or mass of the nucleic acid)) of the modular complex containing the test compound. Evaluate ability.

Amphiphilic Delivery Agents RNA, eg, iRNA agents described herein, are described herein, as well as pending co-owned US provisional application filed on March 13, 2003. With amphiphilic delivery complexes or modules, as described in 60 / 455,050 and International Application No. PCT / US04 / 07070 filed March 8, 2004, incorporated herein by reference. Can be used.

  In addition, the present invention relates to an iRNA agent as described herein, eg, Paris, combined, bound and delivered by such an amphiphilic delivery complex. An iRNA agent having a ndromic structure, an iRNA agent having a non-standard pairing, an iRNA agent that targets a gene described herein (eg, a gene that is active in the liver), a chemical modification described herein An iRNA agent having (eg, a modification that enhances resistance to degradation), an iRNA agent having a configuration or structure described herein, an iRNA agent administered as described herein, or a specification Includes iRNA agents formulated as described in the document.

  An amphiphilic molecule is a molecule having a hydrophobic region and a hydrophilic region. Such molecules can interact (eg, penetrate or disrupt) lipids (eg, the lipid bilayer of cells). Thus, an amphiphilic molecule can act as a delivery agent for associated (eg, bound) iRNA (eg, an iRNA or sRNA described herein). Preferred amphiphilic molecules to be used in the compositions described herein (eg, amphiphilic iRNA constructs described herein) are polymers. The polymer may have a secondary structure, such as a repetitive secondary structure.

An example of an amphiphilic polymer is an amphiphilic polypeptide, such as a polypeptide having a secondary structure such that the polypeptide has a hydrophilic surface and a hydrophobic surface. The design of amphiphilic peptide structures (eg, α helical polypeptides) is routine to those skilled in the art. For example, guidance is provided in the following reference: Grell et al. (2001) “Protein design and folding: Protein design and folding: template trapping. of self-assembled helical bundles) ", J Pept Sci 7 (3): 146-51; Chen et al. (2002)," Amino acid side chain conformations in amphiphilic α-helices " Determination of stereochemistry stability coefficients of amino acid side-chains in an amphipathic alpha-helix ”J Pept Re
s 59 (1): 18-33; Iwata et al. (1994)
“Design and synthesis of amphipathic 3 (10) -helical peptides and their interactions with phospholipid bilayers. Design and synthesis of amphipathic 3 (10) -helical peptides and their interaction with phospholipid bilayers and ion channel formation. J Biol Chem 269 (7): 4928-33; Cornut et al. (1994) “Amphipathic α-helical concept. Hemolysis higher than the hemolytic activity of melittin. The amphipathic alpha-helix concept. Application to the novel design of active amphipathic Leu and Lys peptides
The de novo design of ideally amphipathic Leu, Lys peptides with hemolytic activity higher than that of melittin) FEBS Lett 349 (1): 29-33; Negrete et al. (1998)
"Deciphering the structural code for proteins: helical propensities in domain classes and statistical multiresidue information in alpha-helices ) "Protein Sci Vol. 7 (6): 1368-79.

  Another example of an amphiphilic polymer is two or more amphiphilic subunits, such as cyclic moieties (eg, cyclic having one or more hydrophilic groups and one or more hydrophobic groups). A polymer composed of two or more subunits containing a moiety). For example, the subunit may contain a steroid (eg, cholic acid) or an aromatic moiety. Such components are preferably capable of exhibiting atropisomerism so that they can form opposing hydrophilic and hydrophobic surfaces when they are in the polymer structure.

  The ability of a putative amphipathic molecule to interact with a lipid membrane (eg, a cell membrane) can be tested by routine methods, such as a cell-free assay or a cell assay. For example, a test compound is combined with or contacted with a synthetic lipid bilayer, cell membrane fraction or cell so that the test compound interacts with the lipid bilayer, cell membrane or cell and penetrates the cell membrane or cell, or cell membrane Or evaluate for its ability to destroy cells. Test compounds can also be labeled to detect interactions with lipid bilayers, cell membranes or cells. In another type of assay, a test compound is linked to a reporter molecule or iRNA agent (eg, an iRNA or sRNA described herein) so that the reporter molecule or iRNA agent penetrates the lipid bilayer, cell membrane or cell. Evaluate ability. A two-step assay can also be performed, wherein the first assay evaluates the ability of the test compound alone to interact with a lipid bilayer, cell membrane or cell, and the second assay comprises: The ability of a construct comprising a test compound and a reporter or iRNA agent (eg, a construct described herein) to interact with a lipid bilayer, cell membrane or cell is assessed.

Amphiphilic polymers useful in the compositions described herein have at least 2, preferably at least 5, more preferably at least 10, 25, 50, 100, 200, 500, It has 1,000, 2,000, 50,000 or more subunits (eg amino acids or cyclic subunits). A single amphiphilic polymer is linked to one or more, eg 2, 3, 5, 10, or more iRNA agents (eg, iRNA or sRNA agents described herein). be able to. In some embodiments, the amphiphilic polymer can contain both amino acids and cyclic subunits (eg, aromatic subunits).

  The invention features a composition that includes an iRNA agent (eg, an iRNA or sRNA described herein) associated with an amphiphilic molecule. Such compositions are also referred to herein as “amphiphilic iRNA constructs”. Such compositions and constructs are useful for delivering or targeting iRNA agents, eg, delivering or targeting iRNA agents to cells. Without wishing to be bound by theory, such compositions and constructs increase the porosity of lipids (eg, the lipid bilayer of the cell) so that, for example, iRNA agents can enter cells. (Eg, permeate or disintegrate).

  In one aspect, the invention relates to a composition comprising an iRNA agent (eg, an iRNA agent or sRNA agent described herein) linked to an amphiphilic molecule. The iRNA agent and the amphiphilic molecule may be held in persistent contact with each other, either covalently or non-covalently.

The amphiphilic molecules of the composition or construct are preferably other than phospholipids, for example, other than micelles, membranes or membrane fragments.
The amphiphilic molecule of the composition or construct is preferably a polymer. The polymer may comprise two or more amphiphilic subunits. One or more hydrophilic groups and one or more hydrophobic groups may be present on the polymer. The polymer may have a repetitive secondary structure and first and second sides. The distribution of hydrophilic and hydrophobic groups along the repetitive secondary structure can be such that one side of the polymer is a hydrophilic side and the other side of the polymer is a hydrophobic side.

The amphipathic molecule can be a polypeptide, for example a polypeptide comprising an α-helical structure as its secondary structure.
In one embodiment, the amphiphilic polymer contains one or more cyclic moieties (eg, cyclic moieties having one or more hydrophilic groups and / or one or more hydrophobic groups). Including one or more subunits. In one embodiment, the polymer is a polymer having cyclic portions such that the cyclic portions alternately have hydrophobic groups and hydrophilic groups. For example, the subunit may contain a steroid (eg, cholic acid). In another example, the subunit may contain an aromatic moiety. The aromatic moiety can be one that can exhibit atropisomerism, such as 2,2′-bis (substituted) -1,1′-binaphthyl or 2,2′-bis (substituted) biphenyl. The subunit has the formula (M):

May include an aromatic moiety.
The invention features a composition that includes an iRNA agent (eg, an iRNA or sRNA described herein) associated with an amphiphilic molecule. Such a composition may be referred to herein as an “amphiphilic iRNA construct”. Such compositions and constructs are useful in the delivery or targeting of iRNA agents, eg, delivery or targeting of iRNA agents to cells. Without wishing to be bound by theory, such compositions and constructs increase the porosity of lipids (eg, the lipid bilayer of the cell) so that, for example, iRNA agents can enter cells. (E.g., permeate or break).

  In one aspect, the invention relates to a composition comprising an iRNA agent (eg, an iRNA agent or sRNA agent described herein) linked to an amphiphilic molecule. The iRNA agent and the amphiphilic molecule may be held in persistent contact with each other, either covalently or non-covalently.

The amphiphilic molecules of the composition or construct are preferably other than phospholipids, for example, other than micelles, membranes or membrane fragments.
The amphiphilic molecule of the composition or construct is preferably a polymer. The polymer may comprise two or more amphiphilic subunits. One or more hydrophilic groups and one or more hydrophobic groups may be present on the polymer. The polymer may have a repetitive secondary structure and first and second sides. The distribution of hydrophilic and hydrophobic groups along the repetitive secondary structure can be such that one side of the polymer is a hydrophilic side and the other side of the polymer is a hydrophobic side.

The amphipathic molecule can be a polypeptide, for example a polypeptide comprising an α-helical structure as its secondary structure.
In one embodiment, the amphiphilic polymer contains one or more cyclic moieties (eg, cyclic moieties having one or more hydrophilic groups and / or one or more hydrophobic groups). Including one or more subunits. In one embodiment, the polymer is a polymer having cyclic portions such that the cyclic portions alternately have hydrophobic groups and hydrophilic groups. For example, the subunit may contain a steroid (eg, cholic acid). In another example, the subunit may contain an aromatic moiety. The aromatic moiety can be one that can exhibit atropisomerism, such as 2,2′-bis (substituted) -1,1′-binaphthyl or 2,2′-bis (substituted) biphenyl.

  The subunit has the formula (M):

May include an aromatic moiety.
With respect to Formula M, R ₁ is C ₁ -C ₁₀₀ alkyl, optionally substituted with aryl, alkenyl, alkynyl, alkoxy, or halo, and / or optionally inserted with O, S, alkenyl, or alkynyl, C ₁ -C ₁₀₀ perfluoroalkyl, or oR _5.

R ₂ is hydroxy, nitro, sulfate, phosphoric acid, phosphate ester, sulfonic acid, OR ₆ , or optionally hydroxy, halo, nitro, arylsulfinyl or alkylsulfinyl, arylsulfonyl or alkylsulfonyl, sulfate, sulfonic acid, Substituted with phosphoric acid, phosphate ester, substituted or unsubstituted aryl, carboxyl, carboxylic acid, aminocarbonyl or alkoxycarbonyl and / or optionally O, NH, S, S (O), SO ₂ , alkenyl or _C 1 _{-C 100} alkyl alkynyl is inserted.

R ₃ is hydrogen or together with R ₄ forms a fused phenyl ring.
R ₄ is hydrogen or together with R ₃ forms a fused phenyl ring.
R ₅ is C ₁ -C ₁₀₀ alkyl, optionally substituted with aryl, alkenyl, alkynyl, alkoxy or halo and / or optionally inserted with O, S, alkenyl or alkynyl, or C _1- C ₁₀₀ perfluoroalkyl, R ₆ is optionally hydroxy, halo, nitro, arylsulfinyl or alkylsulfinyl, arylsulfonyl or alkylsulfonyl, sulfate, sulfonic acid, phosphoric acid, phosphate ester, substituted or unsubstituted aryl, carboxyl, carboxylic acid, or is substituted with aminocarbonyl or alkoxycarbonyl, and / or optionally O, NH, S, S ( O), SO 2, with _C 1 _{-C 100} alkyl, alkenyl or alkynyl is inserted is there.

Increasing dsRNA uptake into cells The methods of the invention can include administration of an iRNA agent, as well as a drug that affects the uptake of the iRNA agent into the cell. The drug can be administered before the iRNA agent is administered, after the iRNA agent is administered, or simultaneously with the administration of the iRNA agent. The drug can be covalently linked to the iRNA agent. The drug can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB. The drug can have a transient effect on the cells.

  The drug can increase the uptake of the iRNA agent into the cell, for example by disrupting the cytoskeleton of the cell, for example by disrupting the microtubules, microfilaments and / or intermediate filaments of the cell. The drug is, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine or myoservin. obtain.

  The drug can also increase the uptake of the iRNA agent into the cell, for example, by activating an inflammatory response. Exemplary drugs having such an action include tumor necrosis factor α (TNFα), interleukin-1β or γ interferon.

iRNA Complex An iRNA agent can be coupled (eg, covalently linked) to a second agent. For example, an iRNA agent used to treat a particular disorder can be coupled to a second therapeutic agent, eg, an agent other than an iRNA agent. The second therapeutic agent may be directed to treating the same disorder. For example, in the case of iRNA used to treat disorders characterized by unwanted cell proliferation (eg, cancer), the iRNA agent may be coupled to a second agent that has anti-cancer activity. Can do. For example, an iRNA agent is coupled to an agent that stimulates the immune system (eg, a CpG motif), or more commonly an agent that activates a toll-like receptor and / or increases production of γ-interferon. Can be made.

iRNA Production iRNA can be produced, for example, in large quantities by various methods. Exemplary methods include organic synthesis and RNA cleavage (eg, in vitro cleavage).

Organic Synthesis iRNA can be made by separately synthesizing each strand of a double-stranded RNA molecule. The component chains can then be annealed.

A large bioreactor (eg, OligoPilot ™ II, Pharmacia Biotec AB, Uppsala, Sweden) can be used to produce large quantities of specific RNA strands for a given iRNA. it can. The OligoPilot II reactor can efficiently couple nucleotides using only 1.5M excess of phosphoramidite nucleotides. Ribonucleotide amidites are used to make RNA strands. Standard monomer addition cycles can be used to synthesize 21-23 nucleotide strands for iRNA. Usually, the two complementary strands are produced separately and then annealed, eg after release from the solid support and deprotection.

  Organic synthesis can be used to produce separate iRNA species. The complementarity of the iRNA species to a specific target gene can be accurately specified. For example, the iRNA species can be complementary to a region containing a polymorphism, such as a single nucleotide polymorphism. Furthermore, the position of the polymorphism can be precisely defined. In some embodiments, the polymorphism is at least 4, 5, 7 or 9 nucleotides from an internal region, eg, one or both of the ends.

dsRNA Cleavage iRNAs can also be made by cleaving larger ds iRNAs. Cutting can be accomplished in vitro or in vivo. For example, to produce iRNA by in vitro cleavage, the following method can be used:
In vitro transcription. dsRNA is produced by transcribing nucleic acid (DNA) segments in both directions. For example, HiScribe ™ RNAi Transcription Kit (New England Biolabs) provides vectors and methods for producing dsRNA for nucleic acid segments cloned into the vector at positions flanked by T7 promoters on both sides To do. Separate templates are generated for T7 transcription of two complementary strands for dsRNA. The template is transcribed in vitro by the addition of T7 RNA polymerase to produce dsRNA. Similar methods using PCR and / or other RNA polymerases (eg, T3 polymerase or SP6 polymerase) can also be used. In one embodiment, the RNA produced by this method is carefully purified to remove endotoxins that may be contaminated in the recombinant enzyme preparation.

In vitro cutting.
dsRNA is cleaved in vitro to iRNA using, for example, Dicer or comparable RNAase III based activity. For example, dsRNA can be incubated in an in vitro extract from Drosophila or using purified components (eg, purified RNAase or RISC complex (RNA-induced silencing complex)). For example, Ketting et al. Genes Dev, Oct. 15, 2001, 15 (20): 2654-9 and Hammond Science, Aug. 10, 2001; 293 (5532): See pages 1146-50.

  Cleavage of dsRNA generally produces multiple iRNA species, each being a specific 21-23 nt fragment of the original dsRNA molecule. For example, there can be an iRNA comprising a sequence complementary to the overlapping region and adjacent region of the original dsRNA molecule.

  Regardless of the method of synthesis, the iRNA preparation can be prepared in a solution suitable for formulation (eg, an aqueous solution and / or an organic solution). For example, iRNA preparations can be precipitated and redissolved in pure doubly distilled distilled water and lyophilized. Subsequently, the dried iRNA can be resuspended in a solution suitable for the intended formulation process.

The synthesis of modified iRNA agents and nucleotide surrogate iRNA agents will be described later.
Formulation The iRNA agents described herein can be formulated for administration to a subject.

To simplify the description, the formulations, compositions and methods in this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these formulations, compositions and methods can be practiced with other iRNA agents, such as modified iRNA agents, and such practice is within the scope of the invention.

  It can be assumed that the formulated iRNA composition is in various states. In some examples, the composition is at least partially crystalline, uniformly crystalline, and / or anhydrous (eg, less than 80%, less than 50%, less than 30%, less than 20% or 10% moisture) Less). In another example, the iRNA is present in the aqueous phase, eg, in a solution containing water.

  The aqueous or crystalline composition can be incorporated into, for example, a delivery vehicle, such as a liposome (particularly with respect to the aqueous phase) or a particle (eg, microparticles as may be appropriate with respect to the crystalline composition). In general, iRNA compositions are formulated in a manner that is compatible with the intended method of administration (see below).

  In certain embodiments, the composition is prepared by the following methods: spray drying, freeze drying, vacuum drying, evaporation, fluid bed drying or a combination of these techniques, or sonication using liquids, freezing. Prepared by at least one of dry, condensation and other self-assembly.

An iRNA preparation can be formulated in combination with another agent, eg, another therapeutic agent or an agent that stabilizes iRNA (eg, a protein that is complexed with iRNA to form iRNP). . Further agents include, for example, chelating agents such as EDTA (for example, to remove divalent cations such as Mg ²⁺ ), salts, RNAase inhibitors (eg, broad specificity RNA such as RNAsin). Ase inhibitors) and the like.

  In one embodiment, the iRNA preparation includes another iRNA agent, eg, a second iRNA that can mediate RNAi with respect to a second gene or with respect to the same gene. Yet another preparation can include at least 3, 5, 10, 20, 50, 100 or more different iRNA species. Such iRNAs can mediate RNAi for a similar number of different genes.

  In one embodiment, the iRNA preparation includes at least a second therapeutic agent (eg, an agent other than RNA or DNA). For example, iRNA compositions for the treatment of viral diseases (eg, HIV) may include known antiviral agents (eg, protease inhibitors or reverse transcriptase inhibitors). In another example, an iRNA composition for treating cancer may further comprise a chemotherapeutic agent.

Exemplary formulations are discussed below.
Liposomes For simplicity of description, the formulations, compositions and methods in this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these formulations, compositions and methods can be practiced with other iRNA agents, such as modified iRNA agents, and such practice is within the scope of the invention. iRNA agents, such as double-stranded iRNA agents or sRNA agents (eg, precursors, eg, larger iRNA agents that can be processed into sRNA agents, or DNA, eg, iRNAs such as double-stranded iRNA agents Preparations of agents or sRNA agents, or DNA encoding their precursors, can be formulated to be delivered in membrane-like molecular assemblies (eg, liposomes or micelles). As used herein, the term “liposome” refers to a vehicle composed of amphipathic lipids arranged in at least one bilayer, eg, one bilayer or multiple bilayers. Liposomes include monolayer and multilayer vehicles having a membrane formed from a lipophilic substance and an aqueous interior. The aqueous portion contains the iRNA composition. A lipophilic substance separates the aqueous interior from the aqueous exterior and usually does not contain an iRNA composition, but in some instances,
An iRNA composition may be included. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Since liposome membranes are structurally similar to biological membranes, when a liposome is applied to a tissue, the liposome bilayer fuses with the cell membrane bilayer. As the fusion of liposomes and cells proceeds, the internal aqueous content containing iRNA is delivered to the cell where it can specifically bind to the target RNA and mediate RNAi. In some cases, the liposomes are also specifically targeted to induce iRNA, eg, to a particular cell type (eg, to liver cells) as described herein.

Liposomes containing iRNA can be prepared by various methods.
In one example, the lipid component of the liposome is dissolved in a detergent to form micelles with the lipid component. For example, the lipid component can be an amphiphilic cationic lipid or lipid complex. The detergent can have a high critical micelle concentration and can be nonionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate and lauroyl sarcosine. Subsequently, the iRNA preparation is added to the micelle containing the lipid component. Cationic groups on the lipid interact with the iRNA and condense around the iRNA to form liposomes. After condensation, the detergent is removed, for example by dialysis, to obtain a liposomal preparation of iRNA.

  If necessary, support compounds that facilitate condensation can be added during the condensation reaction, for example by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (eg, spermine or spermidine). The pH can also be adjusted to aid condensation.

  A further description of a method for producing a stable polynucleotide delivery vehicle that incorporates a polynucleotide / cationic lipid complex as a structural component of the delivery vehicle is described, for example, in WO 96/37194. Liposome formation is also described by Fergner, P .; L. (Felgner, PL et al.), Proc. Natl. Acad. Sci. USA 8: 7413-7417, 1987; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678, Bangham et al. Mol. Biol. 23: 238, 1965; Olson et al. Biochim. Biophys. Acta 557: 9, 1979; Szoka, et al. Proc. Natl. Acad. Sci. 75: 4194, 1978; Mayhew, et al. Biochim. Biophys. Acta 775: 169, 1984; Kim et al. Biochim. Biophys. Acta 728: 339, 1983 and Fukunaga et al. Endocrinol. 115: 757, 1984 can include one or more aspects of the exemplary method described. Commonly used techniques for preparing lipid aggregates with the appropriate size for use as a delivery vehicle include sonication and freeze thawing and extrusion (eg, Mayer et al. , Et al.) Biochim.Biophys.Acta 858: 161, 1986). Microfluidic manipulation can be used where consistently small (50-200 nm) and relatively uniform aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta 775: 169, 1984). These methods are readily adapted to package iRNA preparations into liposomes.

The pH-sensitive or negatively charged liposomes capture the nucleic acid molecule rather than complex with the nucleic acid molecule. Since both the nucleic acid molecule and the lipid are similarly charged, repulsion occurs rather than complex formation. Nevertheless, some nucleic acid molecules are entrapped within the aqueous interior of these liposomes. pH sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of foreign genes was detected in target cells (Zhou et al. Journal of Controlled Release, Vol. 19, (1992) pages 269-274).

  One of the major types of liposome compositions includes phospholipids other than naturally derived phosphatidylcholine. For example, neutral liposome compositions can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoyl phosphatidylglycerol, whereas anionic fusogenic liposomes are primarily formed from dioleoylphosphatidylethanolamine (DOPE). Another type of liposome composition is formed from phosphatidylcholine (PC) such as soy PC and egg PC. Another type is formed from a mixture of phospholipid and / or phosphatidylcholine and / or cholesterol.

  Examples of other methods of introducing liposomes into cells in vitro and in vivo include: US Pat. No. 5,283,185; US Pat. No. 5,171,678; International Publication No. 94/00569; Publication 93/24640; International Publication 91/16024; Felgner, J.A. Biol. Chem. 269: 2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90: 11307, 1993; Nabel, Human Gene Ther. 3: 649, 1992; Gershon, Biochem. 32: 7143, 1993 and Strauss, EMBO J. et al. Volume 11: 417, 1992.

  In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage of being able to fuse to the cell membrane. Non-cationic liposomes cannot be efficiently fused with the plasma membrane, but are taken up by macrophages in vivo and can be used to deliver iRNA to macrophages.

  Additional advantages of liposomes include that liposomes derived from natural phospholipids are biocompatible and biodegradable, that liposomes can incorporate a wide range of water-soluble and lipid-soluble drugs, and that liposomes are internal to the liposomes. Protecting the iRNA encapsulated in the compartment from metabolism and degradation (Rosoff, “Pharmaceutical Dosage Forms”, Lieberman, Rieger and Banker) (Ed.), 1988, Volume 1, p245). Important considerations in the preparation of liposomal formulations are the lipid surface charge, vehicle size and aqueous capacity of the liposomes.

  A positively charged synthetic cationic lipid, N- [1- (2,3-dioleyloxy) propyl] -N, N, N-trimethylammonium chloride (DOTMA), spontaneously interacts with nucleic acids. Can be used to form small liposomes that form lipid-nucleic acid complexes that can fuse with negatively charged lipids in the cell membrane of tissue culture cells, resulting in iRNA delivery (eg, DOTMA And for a description of its use with DNA, see Felgner, PL et al., Proc. Natl. Acad. Sci., USA 8: 7413-7417, 1987 and See U.S. Pat. No. 4,897,355).

The DOTMA analog 1,2-bis (oleoyloxy) -3- (trimethylammonia) propane (DOTAP) can be used in combination with phospholipids to form a vehicle that is complexed with DNA. . Lipofectin ™ (Bethesda Research Laboratories, Gaithersburg, Maryland, USA) is a positively-acting, complex that interacts spontaneously with negatively charged polynucleotides. It is an effective agent for delivering highly cationic nucleic acids comprising charged DOTMA liposomes into living tissue culture cells. When fully positively charged liposomes are used, the net charge on the resulting complex is also positive. The positively charged complex thus prepared spontaneously binds to the negatively charged cell surface, fuses with the plasma membrane, and efficiently delivers functional nucleic acids to, for example, tissue culture cells . Another commercially available cationic lipid, 1,2-bis (oleoyloxy) -3,3- (trimethylammonia) propane ("DOTAP") (Boeringer Mannheim, Indianapolis, Indiana, USA) ) Location) differs from DOTMA in that the oleoyl moiety is linked by an ester rather than an ether bond.

  Other reported cationic lipid components include, for example, 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”) (Transfectam ™), which is bound to one of two lipids. Conjugated to various moieties including carboxyspermine, including compounds such as Promega, Madison, Wisconsin, USA) and dipalmitoylphosphatidylethanolamine 5-carboxyspermylamide ("DPPES"). (See, eg, US Pat. No. 5,171,678).

  Another cationic lipid complex includes derivatization of lipids with cholesterol ("DC-Chol") formulated in liposomes in combination with DOPE (Gao, X. and Fang, L. (Gao). , X. and Huang, L.), Biochim. Biophys. Res. Commun., 179: 280, 1991). Lipopolylysine made by conjugating polylysine to DOPE has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065: 8, 1991). For certain cell lines, these liposomes conjugated with cationic lipids are said to exhibit lower toxicity and provide more efficient transfection than DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif., USA) and Lipofectamine (DOSPA) (Life Technology, Inc.). And Gaithersburg, Maryland, USA). Other cationic lipids suitable for oligonucleotide delivery are described in WO 98/39359 and WO 96/37194.

Liposomal formulations are particularly suitable for topical administration, and liposomes present several advantages over other formulations. Such advantages include reduced side effects associated with high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer iRNA to the skin. In some embodiments, liposomes are used to deliver iRNA to epithelial cells and also to enhance iRNA penetration into dermal tissue (eg, into the skin). For example, liposomes can be applied topically. Local delivery of drugs formulated as liposomes to the skin has been demonstrated (eg, Weiner et al., Journal of Drug Targeting, 1992, Vol. 2, pages 405-410 and Du Du Pressis et al., Annual Research, Vol. 18, 19
1992, pp. 259-265; Mannino, Earl. Jay. And Fold-Fogelite, S .; (Manno, RJ and Fold-Forgerite, S.), Biotechniques 6: 682-690, 1988; Itani, T. et al. Gene 56: 267-276 Page, 1987; Nicolau, C. et al. Meth. Enz. 149: 157-176, 1987; Straubinger, Earl. M. And Papajajopoulos, Dee. (Straubinger, RM and Papahadjopoulos, D.) Meth. Enz. 101: 512-527, 1983; Wang, See. Wye. And Juan, L. (Wang, CY and Huang, L.), Proc. Natl. Acad. Sci. USA 84: 7851-7855, 1987).

  Nonionic liposome systems have also been tested to determine the usefulness of the liposome system in delivering drugs to the skin, particularly in systems containing nonionic surfactants and cholesterol. Nonionic, including Novasome® I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome® II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) Liposome formulations have been used to deliver drugs to the dermis of mouse skin. Such formulations comprising iRNA are useful for treating dermatological disorders.

  Liposomes containing iRNA can be highly deformable. Such deformability can allow liposomes to penetrate through pores that are smaller than the average radius of the liposomes. For example, transferosome (registered trademark) is a kind of deformable liposome. Transferosomes can be made by adding a surface edge activator, usually a surfactant, to a standard liposome composition. Transferrosomes containing iRNA can be delivered by subcutaneous injection, eg, to deliver iRNA to keratinocytes in the skin. In order to pass through intact mammalian skin, the lipid vehicle must pass through a series of micropores, each less than 50 nm in diameter, under the influence of an appropriate transdermal gradient. Furthermore, due to the properties of the lipids, these transferosomes can be self-optimizing (eg adaptable to the shape of the pores in the skin), self-healing and often fragmented. Often reach the target and can be self-loading. An iRNA agent can include RRMS linked to a moiety that improves association with liposomes.

Surfactants For simplicity of description, the formulations, compositions and methods in this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these formulations, compositions and methods can be practiced with other iRNA agents, such as modified iRNA agents, and such practice is within the scope of the invention. Surfactants are widely applied in formulations such as emulsions (including microemulsions) and liposomes (see above). Compositions of iRNAs (or precursors, eg, larger dsRNAs that can be processed to iRNAs, or DNAs encoding iRNAs or precursors) can include a surfactant. In one embodiment, the iRNA is formulated as an emulsion containing a surfactant. The most common way to classify and rank the properties of many different types of surfactants (both natural and synthetic) is through the use of a hydrophilic / lipophilic balance (HLB). The nature of the hydrophilic group provides the most useful means to classify the various surfactants used in the formulation (Rieger, “Pharmaceutical Dosage Forms”, Mercer Decker). Incorporated (Marcel Dekker, Inc.), New York, NY, USA
1988, p285).

  If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants are widely applied in pharmaceutical products and can be used over a wide range of pH values. In general, their HLB values range from 2 to about 18, depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols and ethoxylated / propoxylated block polymers are also included in this class. Polyoxyethylene surfactants are the most common of the nonionic surfactants.

  When a surfactant molecule carries a negative charge, it is classified as anionic when dissolved or dispersed in water. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acylamides of amino acids, esters of sulfuric acids such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates (Acyl isethionate), acyl taurates and sulfosuccinates, and phosphates. The most important of the anionic surfactants are alkyl sulfates and soaps.

  When a surfactant molecule carries a positive charge, it is classified as cationic when dissolved or dispersed in water. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most commonly used of this type.

  A surfactant is classified as amphoteric if it has the ability to carry either a positive or negative charge. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

  The use of surfactants in drug products, formulations and emulsions has been reviewed (Rieger, “Pharmaceutical Dosage Forms”, Marcel Dekker, Inc.). ), New York, New York, 1988, p285).

Micelles and other membranous formulations For the sake of simplicity, the micelles and other formulations, compositions and methods in this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these micelles and other formulations, compositions and methods can be practiced with other iRNA agents, such as modified iRNA agents, and such practice is within the scope of the invention. is there. iRNA agents, eg, double-stranded iRNA agents or sRNA agents (eg, precursors, larger iRNA agents that can be processed into, eg, sRNA agents, or iRNA agents, eg, double-stranded iRNA agents or sRNA agents, or precursors thereof) The composition of the DNA encoding the body can be provided as a micelle formulation. A “micelle” as used herein is an amphiphilic molecule arranged in a spherical structure such that all the hydrophobic portions of the molecule are oriented inward and the hydrophilic portion is in contact with the surrounding aqueous phase. Defined as a specific type of molecular assembly. The opposite arrangement exists when the environment is hydrophobic.

Mixed micelle formulations suitable for delivery through the through coating with an aqueous solution of the iRNA composition, an alkali metal C ₈ -C ₂₂ alkali sulphate, may be prepared by mixing the micelle forming compounds. Examples of micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleate , Monolaurate, borage oil, evening primrose oil, menthol, trihydroxyoxocoranylglycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ether and the like Bodies, polidocanol alkyl ethers and their analogs, chenodeoxycholate, deoxycholate, and mixtures thereof. The micelle-forming compound can be added simultaneously with or after the addition of the alkali metal alkyl sulfate. Mixed micelles are formed by virtually any type of mixing process of the ingredients, although intense mixing is preferred to provide smaller size micelles.

  In one method, a first micelle composition containing an iRNA composition and at least an alkali metal alkyl sulfate is prepared. This first micelle composition is then mixed with at least three micelle forming compounds to form a mixed micelle composition. In another method, a micelle mixture is prepared by mixing an iRNA composition, an alkali metal alkyl sulfate and at least one micelle-forming compound, followed by addition of the remaining micelle-forming compound with vigorous mixing.

  Phenol and / or m-cresol may be added to the mixed micelle composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and / or m-cresol may be mixed with the micelle forming component. An isotonic agent such as glycerin may also be added after formation of the mixed micelle composition.

  To deliver the micelle formulation as a spray, the formulation can be placed in an aerosol dispenser, which is filled with a propellant. The propellant under pressure is in liquid form in the dispenser. The ratio of the components is adjusted so that there is one aqueous phase and propellant phase, i.e. there is one phase. If there are two phases, it is necessary to shake the dispenser before dispensing a portion of the contents, for example by means of a metering valve. The pharmaceutical dosage is injected from the metering valve with a fine spray.

  Preferred propellants are hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether. HFA 134a (1,1,1,2-tetrafluoroethane) is even more preferred.

  The specific concentration of the essential component can be determined by relatively direct experimentation. For absorption by the oral cavity, it is often desirable to increase the dosage by at least two or three times the dosage for administration by injection or administration via the gastrointestinal tract.

An iRNA agent can include an RRMS linked to a component that improves association with micelles or other membranous formulations.
Particles To simplify the description, the particles, formulations, compositions and methods in this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these particles, formulations, compositions and methods can be practiced with other iRNA agents, such as modified iRNA agents, and such practice is within the scope of the invention. In another embodiment, an iRNA agent, such as a double-stranded iRNA agent or sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or a double-stranded iRNA agent or sRNA agent, etc. preparations of iRNA agents or their precursor DNA) can be incorporated into particles (eg, microparticles). The microparticles can be produced by spray drying, but may be produced by other methods including freeze drying, evaporation, fluidized bed drying, vacuum drying or a combination of these techniques. See below for further explanation.

  Sustained release formulation. IRNA agents described herein, eg, double-stranded iRNA agents or sRNA agents (eg, larger iRNA agents that can be processed into precursors, eg, sRNA agents, or, eg, double-stranded iRNA agents or sRNA agents) Of iRNA agents or their precursor DNA) can be formulated for controlled release (eg, sustained release). Controlled release can be achieved by placing the iRNA in a structure or substance that delays its release. For example, iRNA can be placed in a porous matrix or in an erodible matrix, any of which allows for long-term release of iRNA.

  Polymer particles, such as polymer microparticles, can be used as a sustained release reservoir of iRNA that is taken up by cells only when released from the microparticles by biodegradation. Accordingly, the polymer particles of this embodiment should be large enough to prevent phagocytosis (eg, greater than 10 μm, preferably greater than 20 μm). Such particles are the same method for making smaller particles, but the mixing of the first emulsion and the second emulsion can be produced by a less powerful method. That is, the homogenization speed, vortex mixing speed, or sonication setting can be lowered to obtain particles of approximately 100 μm in diameter rather than 10 μm. The mixing time can also be varied.

  Larger microparticles are suspensions, powders or implants to be delivered by intramuscular, subcutaneous, intradermal, intravenous or intraperitoneal injection, by inhalation (intranasal or intrapulmonary), orally or by implantation. It can be formulated as a possible solid. These particles are useful for the delivery of any iRNA where sustained release over a relatively long period is desired. The degradation rate, and thus the release rate, varies with the polymer formulation.

  The microparticles preferably include pores, voids, indentations, defects or other interstitial cavities through which the liquid suspension medium freely penetrates or perfuses the particle boundaries. For example, porous spray-dried microspheres with indentations can be formed using a porous microstructure.

  Polymeric particles containing iRNA (eg, sRNA) can be made using, for example, a double emulsion technique. First, the polymer is dissolved in an organic solvent. A preferred polymer is a lactic acid / glycolic acid copolymer (PLGA) having a lactic acid / glycolic acid weight ratio of 65:35, 50:50 or 75:25. A sample of nucleic acid suspended in an aqueous solution is then added to the polymer solution and the two solutions are mixed to form a first emulsion. These solutions can be mixed by vortex mixing or shaking, and in a preferred method the mixture can be sonicated. Most preferred is any method that allows the nucleic acid to undergo minimal nicking, shearing or degradation forms of damage while still allowing the formation of a suitable emulsion. For example, acceptable results were obtained with a Vibra-cell ™ model VC-250 sonicator equipped with a 0.3175 centimeter (3.2 mm (1/8 inch)) microchip probe, setting no. 3 can be obtained.

Spray drying. iRNA agents, eg, double-stranded iRNA agents or sRNA agents (eg, larger iRNA agents that can be processed into precursors, eg, sRNA agents, or iRNA agents, eg, double-stranded iRNA agents or sRNA agents, or their The DNA encoding the precursor) can be prepared by spray drying. Spray dried iRNA may be administered to a subject or may be subjected to further formulation. A pharmaceutical composition of iRNA can be prepared by spray drying a homogeneous aqueous mixture containing iRNA under conditions sufficient to provide a dispersible powder composition (eg, a pharmaceutical composition). The material for spray drying can also include one or more pharmaceutically acceptable excipients or an amount of a physiologically acceptable water-soluble protein that enhances dispersibility. The spray-dried product can be a dispersible powder that includes the iRNA.

  Spray drying is a processing step that converts a liquid or slurry material into a dried particulate form. Spray drying can be used to provide powder material for various routes of administration, including inhalation. For example, M. Satchetti and M. M. In M. Sacchetti and M.M. Van Ort, “Inhalation Aerosols: Physical and Biological Basis for Therapy”, a. Je. See H. J. Hicky, Marcel Dekkar, New York, 1996.

  Spray drying can include atomizing a solution, emulsion or suspension to form a fine mist of droplets and drying the droplets. The mist can be fired into a drying chamber (eg, a container, tank, tube or coil) and the mist can be contacted with the drying gas in the chamber. The mist can include a solid or liquid pore former. The medium and the pore-forming agent evaporate from the droplets to the drying gas, solidify the droplets, and simultaneously form pores throughout the solidified product (solid). Subsequently, the solid (usually in powdered particle form) is separated and recovered from the drying gas.

  Spray drying involves combining a highly dispersed liquid and a sufficient volume of air (eg, hot air) to effect evaporation and drying of the liquid droplets. The preparation to be spray dried can be any solution, of course, a suspension, slurry, colloidal dispersion, or a paste that can be atomized using a selected spray drying apparatus. Typically, the feed is sprayed into a filtered warm air stream that evaporates the medium and conveys the dried product to a collector. The spent air is then exhausted with the medium. Several different types of devices may be used to provide the desired product. For example, commercially available spray dryers manufactured by Buchi Ltd. or Nipro Corp. can efficiently produce particles of the desired size.

  Spray dried powder particles are approximately spherical in shape, approximately uniform in size, and can often be indented. There may be some degree of irregularity depending on the drug incorporated and the spray drying conditions. In many cases, the dispersion stability of spray-dried microspheres appears to be more effective when using a swelling agent (or blowing agent) in the production of the microspheres. Particularly preferred embodiments may comprise an emulsion having a swelling agent as the dispersed phase or continuous phase (the other phase being aqueous in nature). The swelling agent is preferably dispersed using a surfactant solution, for example, using a commercially available microfluidizer at a pressure of about 5,000 to 15,000 psi. This processing step forms an emulsion, preferably stabilized by an incorporated surfactant, that contains submicron droplets of a water-immiscible blowing agent dispersed in an aqueous continuous phase. The formation of such dispersions using this and other techniques is common and known to those skilled in the art. Foaming agents are vaporized during the spray drying process, generally with fluorinated compounds (eg, perfluorohexane, perfluorooctyl bromide, perfluorodecalin, perfluorobutylethane) that leave a hollow, porous, aerodynamically light microsphere. Preferably there is. As will be discussed in more detail below, other suitable blowing agents include chloroform, freons and hydrocarbons. Nitrogen gas and carbon dioxide are also contemplated as suitable blowing agents.

The perforated microstructure is preferably formed using a foaming agent as described above, but it should be understood that in some cases, no foaming agent is required and the drug and surfactant (s) The aqueous dispersion is directly spray dried. In such cases, the formulation can be modified to process process conditions (eg, increased temperature) that generally lead to the formation of relatively porous microparticles with indentations. In addition, the drug may possess special physicochemical properties (eg, high crystallinity, high melting temperature, surface activity, etc.) that are particularly suitable for use in such techniques.

  The perforated microstructure may optionally be accompanied by or include one or more surfactants. Furthermore, miscible surfactants may optionally be combined with the medium liquid phase of the suspension. It will be appreciated by those skilled in the art that the use of surfactants can further increase dispersion stability, simplify the formulation procedure, or increase bioavailability upon administration. Of course, a surfactant activity comprising using one or more surfactants in the liquid phase and using one or more surfactants in conjunction with the porous microstructure. Combinations of agents are intended to be within the scope of the present invention. “With or including” means that the structural matrix or porous microstructure can incorporate a surfactant, adsorb a surfactant, absorb a surfactant, It can be coated with an agent or formed by a surfactant.

  Suitable surfactants for use include any compound or composition that facilitates the formation and maintenance of a stabilized respiratory dispersion by forming a layer at the interface between the structural matrix and the suspending medium. Is mentioned. The surfactant may be a single compound or any combination of compounds (eg in the case of cosurfactants). Particularly preferred surfactants are substantially insoluble in the propellant and are not fluorinated, saturated lipids and unsaturated lipids, nonionic detergents, nonionic block copolymers, ionic surfactants, As well as selected from the group consisting of combinations of such agents. In addition to the surfactants described above, suitable (ie, biocompatible) fluorinated surfactants are compatible with the techniques herein and provide the desired stabilized preparation. It should be emphasized that it can be used for:

Lipids, including phospholipids from both natural and synthetic sources, can be used at various concentrations to form a structural matrix. In general, compatible lipids include those with a gel to liquid crystal phase transition greater than about 40 ° C. Preferably, the incorporated lipid is a relatively long chain (ie, C ₆ -C ₂₂ ) saturated lipid, more preferably phospholipid. Examples of phospholipids useful in the disclosed stabilized preparations are egg phosphatidylcholine, dilauryl phosphatidylcholine, dioleyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, distelyl phosphatidylcholine, short chain phosphatidylcholine, phosphatidylethanolamine, dioleoylphosphatidylethanolamine , Phosphatidylserine, phosphatidylglycerol, phosphatidylinositol, glycolipid, ganglioside GM1, sphingomyelin, phosphatidic acid, cardiolipin, polymer chains containing lipids (eg polyethylene glycol, chitin, hyaluronic acid or polyvinylpyrrolidone), sulfonated monos containing lipids Sugars, disaccharides and polysaccharides, fatty acids (eg palmitic acid, stearic acid Fine oleate), cholesterol, and cholesterol esters and cholesterol hemisuccinate. Due to their excellent biocompatibility, phospholipids and combinations of phospholipids and poloxamers are particularly suitable for use in the stabilized dispersions disclosed herein.

Compatible nonionic detergents include sorbitan trioleate (Spans ™ 85), sorbitan sesquioleate, sorbitan monooleate, sorbitan monolaurate, polyoxyethylene (20) sorbitan monolaurate and polyoxyethylene ( 20) Sorbitan esters including sorbitan monooleate, oleyl polyoxyethylene (2) ether, stearyl polyoxyethylene (2) ether, lauryl polyoxyethylene (4) ether, glycerol ester, and sucrose ester. Other suitable non-ionic detergents are “McCutcheon's Emulsifiers a
nd Detergents "(Mc Publishing Co., Glen Rock, NJ, USA). Preferred block copolymers include polyoxyethylene and polyoxypropylene diblock and triblock copolymers (including Poloxamer 188 (Pluronic. RTM. F68), Poloxamer 407 (Pluronic. RTM. F-127) and Poloxamer 338). Can be mentioned. Ionic surfactants such as sodium sulfosuccinate and fatty acid soaps can also be utilized. In preferred embodiments, the microstructure may comprise oleic acid or an alkali salt thereof.

  In addition to the surfactants described above, cationic surfactants or lipids can be converted into iRNA agents, such as double-stranded iRNA agents or sRNA agents (eg, larger iRNA agents that can be processed into precursors, such as sRNA agents, or For example, iRNA agents such as double stranded iRNA agents or sRNA agents or DNA encoding their precursors). Examples of suitable cationic lipids include DOTMA, ie N-[-(2,3) -dioleyloxy) propyl] -N, N, N-trimethylammonium chloride, DOTAP, ie 1,2-dioleyloxy. -3- (trimethylammonio) propane, and DOTB, ie 1,2-dioleoyl-3- (4′-trimethylammonio) butanoyl-sn-glycerol. Polycationic amino acids such as polylysine, and polyarginine are also contemplated.

  For the spray treatment process, spray methods such as rotary atomization, pressure atomization and two-component atomization can be used. Examples of equipment used in these processing steps include “Palvis Mini Spray GA-32” and “Palvis Spray Dryer DL-41” manufactured by Yamato Chemical Co., or "Spray dryer CL-8", "spray dryer L-8", "spray dryer FL-12", "spray dryer FL-16" or "spray dryer FL-20" manufactured by Okawara Chemical Industries Co., Ltd. It can be used in connection with a spraying method using a plate sprayer.

  There are no particular restrictions on the gas used to dry the sprayed material, but it is recommended to use air, nitrogen or an inert gas. The inlet temperature of the gas used to dry the sprayed material is such that it does not cause thermal inactivation of the sprayed material. The temperature range can range from about 50 ° C to about 200 ° C, preferably from about 50 ° C to 100 ° C. The outlet temperature of the gas used to dry the sprayed material can be from about 0 ° C to about 150 ° C, preferably from 0 ° C to 90 ° C, more preferably from 0 ° C to 60 ° C.

  Spray drying is done under conditions that yield a homogeneously structured, substantially amorphous powder with respirable particle size, low moisture content, and flow characteristics that are ready for aerosolization. The particle size of the resulting powder is preferably particles having a diameter greater than about 98% having a diameter of about 10 μm or less, and about 90% of the mass being particles having a diameter of less than 5 μm. As another example, about 95% of the mass has particles less than 10 μm in diameter, and about 80% of the mass of the particles has a diameter less than 5 μm.

Dispersible pharmaceutical-based dry powders, including iRNA preparations, may optionally be combined with pharmaceutical carriers or excipients suitable for respiratory and pulmonary administration. Such a carrier may serve only as a bulking agent if it is desirable to reduce the iRNA concentration in the powder delivered to the patient, but provides a more efficient and reproducible delivery of the iRNA, and Enhanced stability of iRNA compositions to improve iRNA handling properties such as flowability and consistency to facilitate manufacturing and powder filling, and dispersion of powders in powder dispersion devices It may play a role in improving sex.

  Such carrier material may be combined with the drug before spray drying, ie by adding the carrier material to the purified bulk solution. As such, carrier particles are formed simultaneously with the drug particles, resulting in a homogeneous powder. Alternatively, the carrier may be prepared separately in a dry powder form and combined with the dry powder drug by blending. The powder carrier is usually crystalline (to avoid water absorption), but in some cases may be amorphous or a mixture of crystals and amorphous. The size of the carrier particles may be selected to improve the fluidity of the drug powder and is usually in the range of 25 μm to 100 μm. A preferred carrier material is crystalline lactose having a size in the above range.

  The powder prepared by any of the methods described above is recovered from the spray dryer in a conventional manner for subsequent use. For use as a pharmaceutical and other purposes, it is often desirable to disrupt all formed agglomerates by sieving or other conventional techniques. For pharmaceutical applications, dry powder formulations are usually measured into a single dose, which is sealed in a package. Such a package is particularly useful for dispersion in a dry powder inhaler, as detailed below. Alternatively, the powder may be packaged in multiple dose containers.

  Methods for spray drying hydrophobic and other drugs and ingredients are described in US Pat. Nos. 5,000,888, 5,026,550, 4,670,419, and 4,540,602. No. 4,486,435. Bloch and Speison (1983) Pharm. Acta. Helv 58: 14-22 teaches spray drying of hydrochlorothiazide and chlorthalidone (lipophilic drug) and hydrophilic adjuvant (pentaerythritol) in dioxane-water and 2-ethoxyethanol-water azeotropic solvents. doing. Numerous Japanese patent application abstracts, including JP 806766, JP 7242568, JP 7101848, JP 7101833, JP 7101882, JP 7101881 and JP 4036233, are hydrophilic-hydrophobic. It relates to the spray drying of product combinations. Other foreign patent applications related to spray drying a hydrophilic-hydrophobic product combination include FR 2594693, DE 2209477 and WO 88/07870.

Lyophilized iRNA agent, eg, a double-stranded iRNA agent or sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or an iRNA agent, eg, a double-stranded iRNA agent or sRNA agent, or Preparations of DNA encoding their precursors can be made by lyophilization. Freeze drying is a freeze-drying process in which water is sublimated from the composition after it has been frozen. A particular advantage associated with the lyophilization process is that relatively unstable biologics and pharmaceuticals in aqueous solution can be dried without increasing the temperature (thus eliminating harmful thermal effects). Subsequently, it can be stored in a dry state with few stability problems. In the context of the present invention, such techniques are particularly compatible with incorporating nucleic acids into a porous microstructure without compromising bioactivity. It is clear that methods for providing lyophilized particulate material are known in the art and do not require undue experimentation to provide a dispersion compatible microstructure in accordance with the teachings herein. Let's go. Thus, as long as the lyophilization process can be used to provide a microstructure having the desired porosity and size, the lyophilization process is consistent with the teachings herein and is clearly within the scope of the present invention. Is intended.

Targeting For simplicity of description, the formulations, compositions and methods in this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these formulations, compositions and methods can be practiced with other iRNA agents, such as modified iRNA agents, and such practice is within the scope of the invention.

  In some embodiments, an iRNA agent, eg, a double-stranded iRNA agent or sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or a double-stranded iRNA agent or sRNA agent, for example). IRNA agents or DNAs encoding their precursors) target specific cells. For example, a liposome or particle or other structure that includes an iRNA can also include a targeting moiety that recognizes a specific molecule on a target cell. The targeting moiety can be a molecule having specific affinity for the target cell. The targeting moiety can include an antibody to a protein found on the surface of the target cell, or a ligand for a molecule found on the surface of the target cell or a receptor binding portion of the ligand. For example, the targeting moiety can recognize liver cancer-specific or viral antigens and thus deliver iRNA to cancer cells or virus-infected cells. Examples of targeting moieties include antibodies (eg, IgM, IgG, IgA, IgD, etc., or functional portions thereof), ligands for cell surface receptors (eg, their ectodomains).

The target of the iRNA agent can be a hepatocyte using an antigen such as α-fetoprotein.
In one embodiment, the targeting moiety is bound to the liposome. For example, US Pat. No. 6,245,427 describes a method for targeting liposomes with proteins or peptides. In another example, the cationic lipid component of the liposome is derivatized with a targeting moiety. For example, WO 96/37194 describes converting N-glutaryldioleoylphosphatidylethanolamine to an N-hydroxysuccinimide active ester. The product was subsequently coupled to the RGD peptide.

Genes and Diseases In one aspect, the invention features a method of treating a subject at risk of unwanted cell growth, eg, malignant or non-malignant cell growth, or suffering from malignant or non-malignant cell growth. . The method is as follows:
Providing an iRNA agent, eg, an sRNA or iRNA agent described herein (eg, an iRNA having the structure described herein), wherein the iRNA is homologous to a gene that promotes unwanted cell proliferation Wherein the gene can be silenced, for example by cleavage,
administering an iRNA agent (eg, a sRNA or iRNA agent described herein) to a subject, preferably a human subject;
Thereby treating the subject.

  In preferred embodiments, the gene comprises a growth factor gene or growth factor receptor gene, a kinase (eg, protein tyrosine, serine or threonine kinase) gene, an adapter protein gene, a gene encoding a G protein superfamily molecule, or a transcription factor. It is a gene that encodes.

  In a preferred embodiment, the iRNA agent silences the PDGFβ gene and thus treats a subject having or at risk for a disorder characterized by unwanted PDGFβ expression (eg, testicular cancer and lung cancer). Can be used for

  In another preferred embodiment, the iRNA agent silences the Erb-B gene and thus targets a subject with or at risk for a disorder characterized by unwanted Erb-B expression (eg, breast cancer). Can be used to treat.

  In a preferred embodiment, the iRNA agent silences the Src gene and thus treats a subject having or at risk of having a disorder characterized by undesirable Src expression (eg, colon cancer). Can be used.

  In a preferred embodiment, the iRNA agent silences the CRK gene and thus treats a subject having or at risk for a disorder characterized by unwanted CRK expression (eg, colon cancer and lung cancer). Can be used for

  In a preferred embodiment, the iRNA agent silences the GRB2 gene and thus treats a subject having or at risk of having a disorder characterized by unwanted GRB2 expression (eg, squamous cell carcinoma) Can be used for

  In preferred embodiments, the iRNA agent silences the RAS gene and thus has a disorder characterized by unwanted RAS expression (eg, pancreatic cancer, colon cancer and lung cancer, and chronic leukemia), or Can be used to treat subjects at risk.

  In a preferred embodiment, the iRNA agent silences the MEKK gene and thus has or is at risk for a disorder characterized by unwanted MEKK expression (eg, squamous cell carcinoma, melanoma or leukemia). Can be used to treat a subject.

  In preferred embodiments, the iRNA agent silences the JNK gene and thus treats a subject having or at risk of having a disorder characterized by unwanted JNK expression (eg, pancreatic cancer or breast cancer). Can be used for

  In a preferred embodiment, the iRNA agent silences the RAF gene and thus treats a subject having or at risk of having a disorder characterized by unwanted RAF expression (eg, lung cancer or leukemia). Can be used.

  In a preferred embodiment, the iRNA agent silences the Erk1 / 2 gene and thus treats a subject having or at risk for a disorder characterized by unwanted Erk1 / 2 expression (eg, lung cancer). Can be used for

  In a preferred embodiment, the iRNA agent silences the PCNA (p21) gene, thus treating a subject having or at risk of having a disorder characterized by unwanted PCNA expression (eg, lung cancer). Can be used for

  In a preferred embodiment, the iRNA agent silences the MYB gene and thus has or is at risk for a disorder characterized by unwanted MYB expression (eg, colon cancer or chronic myeloid leukemia) Can be used to treat.

  In a preferred embodiment, the iRNA agent silences the c-MYC gene and thus has or is at risk for a disorder characterized by unwanted c-MYC expression (eg, Burkitt lymphoma or neuroblastoma). Can be used to treat sexual subjects.

  In preferred embodiments, the iRNA agent silences the JUN gene and thus has or is at risk for a disorder characterized by unwanted JUN expression (eg, ovarian cancer, prostate cancer or breast cancer). Can be used to treat a subject.

  In a preferred embodiment, the iRNA agent silences the FOS gene and thus targets a subject having or at risk of having a disorder characterized by unwanted FOS expression (eg, skin cancer or prostate cancer). Can be used to treat.

  In a preferred embodiment, the iRNA agent silences the BCL-2 gene and thus has a disorder characterized by unwanted BCL-2 expression (eg, lung cancer, prostate cancer or non-Hodgkin lymphoma), or Can be used to treat subjects at risk.

  In preferred embodiments, the iRNA agent silences the cyclin D gene and thus has or is at risk for disorders characterized by unwanted cyclin D expression (eg, esophageal and colon cancer). Can be used to treat a subject.

  In preferred embodiments, the iRNA agent silences the VEGF gene and thus targets subjects with or at risk for disorders characterized by undesirable VEGF expression (eg, esophageal and colon cancer). Can be used to treat.

  In a preferred embodiment, an iRNA agent silences the EGFR gene and is therefore used to treat a subject having or at risk for a disorder characterized by unwanted EGFR expression (eg, breast cancer). be able to.

  In another preferred embodiment, the iRNA agent silences the cyclin A gene and thus has or is at risk for disorders characterized by unwanted cyclin A expression (eg, lung cancer and cervical cancer). Can be used to treat a subject.

  In another preferred embodiment, the iRNA agent silences the cyclin E gene and thus targets a subject with or at risk of having a disorder characterized by unwanted cyclin E expression (eg, lung cancer and breast cancer). Can be used to treat.

  In another preferred embodiment, the iRNA agent silences the WNT-1 gene and thus has or is at risk for a disorder characterized by unwanted WNT-1 expression (eg, basal cell carcinoma). Can be used to treat a subject.

  In another preferred embodiment, the iRNA agent silences the β-catenin gene and thus has a disorder characterized by unwanted β-catenin expression (eg, adenocarcinoma or hepatocellular carcinoma), or It can be used to treat subjects at risk.

  In another preferred embodiment, the iRNA agent silences the c-MET gene and thus has or is at risk for a disorder characterized by unwanted c-MET expression (eg, hepatocellular carcinoma). Can be used to treat a subject.

  In another preferred embodiment, the iRNA agent silences the PKC gene and thus treats a subject having or at risk of having a disorder characterized by unwanted PKC expression (eg, breast cancer). Can be used.

  In a preferred embodiment, an iRNA agent silences the NFKB gene and is therefore used to treat a subject with or at risk for a disorder characterized by unwanted NFKB expression (eg, breast cancer). be able to.

  In a preferred embodiment, the iRNA agent silences the STAT3 gene and thus treats a subject having or at risk of having a disorder characterized by unwanted STAT3 expression (eg, prostate cancer). Can be used.

  In another preferred embodiment, the iRNA agent silences the survivin gene and thus has or is at risk for a disorder characterized by unwanted survivin expression (eg, cervical cancer or pancreatic cancer). Can be used to treat a subject.

  In another preferred embodiment, the iRNA agent silences the Her2 / Neu gene and thus targets a subject with or at risk of having a disorder characterized by undesirable Her2 / Neu expression (eg, breast cancer). Can be used to treat.

  In another preferred embodiment, the iRNA agent silences the topoisomerase I gene and thus has or is at risk for disorders characterized by undesirable topoisomerase I expression (eg, ovarian cancer and colon cancer). Can be used to treat certain subjects.

  In a preferred embodiment, the iRNA agent silences the topoisomerase IIα gene and thus targets a subject with or at risk for a disorder characterized by undesirable topoisomerase IIα expression (eg, breast and colon cancer). Can be used to treat.

  In a preferred embodiment, the iRNA agent silences a mutation in the p73 gene and thus has or is at risk for a disorder characterized by unwanted p73 expression (eg, colorectal adenocarcinoma) Can be used to treat.

  In a preferred embodiment, does the iRNA agent silence a mutation in the p21 (WAF1 / CIP1) gene and thus have a disorder characterized by unwanted p21 (WAF1 / CIP1) expression (eg, liver cancer)? Or can be used to treat a subject at risk.

  In a preferred embodiment, the iRNA agent silences a mutation in the p27 (KIP1) gene and thus has or is at risk for a disorder characterized by unwanted p27 (KIP1) expression (eg, liver cancer). Can be used to treat sexual subjects.

  In preferred embodiments, iRNA agents silence mutations in tumor suppressor genes and can therefore be used in combination with chemotherapeutic agents as a method of promoting apoptotic activity.

In another aspect, the invention provides a method of treating a subject (eg, a human) at risk of or suffering from a disease or disorder (eg, cancer) that may benefit from inhibition of angiogenesis. It is characterized by. The method is as follows:
Providing an iRNA agent, eg, an iRNA agent having the structure described herein, wherein the iRNA agent is homologous to a gene that mediates angiogenesis and silences the gene, eg, by cleavage. What we can do
administering an iRNA agent to the subject;
Thereby treating the subject.

In another aspect, the invention features a method of treating a subject infected with a virus, or at risk of or suffering from a disorder or disease associated with a viral infection. The method is as follows:
providing an iRNA agent, eg, an iRNA agent having the structure described herein, wherein the iRNA agent is homologous to a viral gene or a cellular gene that mediates viral function (eg, entry or propagation); And the gene can be silenced, for example by cleavage,
administering an iRNA agent to a subject (preferably a human subject);
Thereby treating the subject.

  Accordingly, the present invention provides a method of treating a patient infected with human papillomavirus (HPV), or at risk of or suffering from a disorder mediated by HPV (eg, cervical cancer). provide. HPV is involved in 95% of cervical cancers, and thus antiviral therapy is an attractive method for treating these cancers and other symptoms of viral infections.

In a preferred embodiment, HPV gene expression is reduced. In another preferred embodiment, the HPV gene is one of the group E2, E6 or E7.
In a preferred embodiment, the expression of a human gene that is required for HPV replication is reduced.

  The invention also relates to a patient infected with human immunodeficiency virus (HIV) or at risk for or suffering from a disorder mediated by HIV (eg acquired immune deficiency syndrome (AIDS)) Provide a method of treating.

In a preferred embodiment, HIV gene expression is reduced. In another preferred embodiment, the HIV gene is CCR5, Gag or Rev.
In a preferred embodiment, the expression of a human gene that is required for HIV replication is reduced. In another preferred embodiment, the gene is CD4 or Tsg101.

  The present invention also treats patients infected with hepatitis B virus (HBV) or at risk for or suffering from disorders mediated by HBV (eg, cirrhosis and hepatocellular carcinoma). Provide a way to do it.

  In a preferred embodiment, the expression of the HBV gene is reduced. In another preferred embodiment, the targeted HBV gene encodes one of a group of HBV core protein tail region, pre-cregious (pre-c) region, or cregious (c) region. In another preferred embodiment, the targeted HBV-RNA sequence is comprised of a poly (A) tail.

In a preferred embodiment, the expression of a human gene that is required for HBV replication is reduced.
The present invention also provides a method for treating patients infected with hepatitis A virus (HAV), or at risk for or afflicted with a disorder mediated by HAV.

In a preferred embodiment, the expression of a human gene that is required for HAV replication is reduced.
The invention also provides a method of treating a patient infected with hepatitis C virus (HCV) or at risk for or suffering from a disorder mediated by HCV (eg, cirrhosis). .

In a preferred embodiment, the expression of the HCV gene is reduced.
In another preferred embodiment, the expression of a human gene that is required for HCV replication is reduced.

  The present invention also relates to a patient infected with any of the group of hepatitis virus strains including D, E, F, G or H, or the risk of injury mediated by any of these hepatitis strains. A method of treating a patient having or suffering from the disorder is provided.

In a preferred embodiment, the expression of a D, E, F, G or H hepatitis virus gene is reduced.
In another preferred embodiment, the expression of a human gene that is required for D, E, F, G or H hepatitis virus replication is reduced.

  The methods of the invention also include patients infected with respiratory syncytial virus (RSV), or disorders mediated by RSV (eg, lower respiratory tract infections in infants and childhood asthma, such as pneumonia and other complications in the elderly) To treat a patient at risk of or suffering from the disorder.

In a preferred embodiment, the expression of the RSV gene is reduced. In another preferred embodiment, the targeted HBV gene encodes one of the group of genes N, L or P.
In a preferred embodiment, the expression of a human gene that is required for RSV replication is reduced.

  The methods of the present invention can be used to treat life-threatening or visual impairment in patients infected with herpes simplex virus (HSV) or disorders mediated by HSV (eg, genital herpes and herpes simplex and primarily immunocompromised patients). To treat a patient at risk of or suffering from the disorder.

  In a preferred embodiment, the expression of the HSV gene is reduced. In another preferred embodiment, the targeted HSV gene encodes a DNA polymerase or DNA helicase-primase.

In a preferred embodiment, the expression of a human gene that is required for HSV replication is reduced.
The present invention is also at risk of a patient infected with herpes cytomegalovirus (CMV) or a disorder mediated by CMV (eg, pathological conditions in patients with congenital viral infection and immunodeficiency), or A method of treating a patient afflicted with the disorder is provided.

In a preferred embodiment, the expression of the CMV gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for CMV replication is reduced.
Is the method of the invention also at risk for patients infected with herpes epstein-barr virus (EBV) or disorders mediated by EBV (eg, NK / T-cell lymphoma, non-Hodgkin lymphoma and Hodgkin's disease)? Or a method of treating a patient afflicted with the disorder.

In a preferred embodiment, the expression of the EBV gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for EBV replication is reduced.
The methods of the invention also include patients infected with Kaposi's sarcoma-associated herpesvirus (KSHV) (also referred to as human herpesvirus type 8) or disorders mediated by KSHV (eg, Kaposi's sarcoma, multicentric Castleman's disease and AIDS). It is provided to treat patients at risk of or associated with the associated primary exudative lymphoma).

In a preferred embodiment, the expression of the KSHV gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for KSHV replication is reduced.
The invention also encompasses a method of treating a patient infected with the JC virus (JCV), or a disease or disorder associated with the virus (eg, progressive multifocal leukoencephalopathy (PML)).

In a preferred embodiment, the expression of the JCV gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for JCV replication is reduced.
The methods of the present invention also provide for treating patients who are infected with, or at risk for, a disorder mediated by a myxovirus (eg, influenza).

In a preferred embodiment, myxovirus gene expression is reduced.
In a preferred embodiment, the expression of a human gene that is required for myxovirus replication is reduced.

  The methods of the invention also provide for treating patients who are infected with rhinovirus, or at risk for or suffering from a disorder mediated by rhinovirus (eg, a cold).

In a preferred embodiment, rhinovirus gene expression is reduced.
In a preferred embodiment, the expression of a human gene that is required for rhinovirus replication is reduced.

  The methods of the invention also provide for treating patients who are infected with, or at risk of, a coronavirus-mediated disorder (eg, a cold).

In a preferred embodiment, coronavirus gene expression is reduced.
In a preferred embodiment, the expression of a human gene that is required for coronavirus replication is reduced.

  The method of the present invention also provides for treating patients infected with West Nile virus, a flavivirus, or at risk of or suffering from a disorder mediated by West Nile virus.

  In a preferred embodiment, West Nile virus gene expression is reduced. In another preferred embodiment, the West Nile virus gene is one of the group comprising E, NS3 or NS5.

In a preferred embodiment, the expression of a human gene that is required for West Nile virus replication is reduced.
The methods of the present invention are also at risk for a patient infected with the flavivirus St. Louis encephalitis virus, or a disorder or disease associated with the virus (eg, viral hemorrhagic fever or nervous system disease), or the disorder Alternatively, it is provided to treat a patient suffering from a disease.

  In a preferred embodiment, the expression of the St. Louis encephalitis virus gene is reduced. In a preferred embodiment, the expression of a human gene that is required for St. Louis encephalitis virus replication is reduced.

  The method of the invention is also at risk of being infected by a tick-borne encephalitis flavivirus, or a disorder mediated by tick-borne encephalitis virus (eg, viral hemorrhagic fever and nervous system disease), or It is provided to treat a patient suffering from a disorder.

In a preferred embodiment, the expression of the tick-borne encephalitis virus gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for tick-borne encephalitis virus replication is reduced.

The methods of the present invention also provide a method for treating patients infected with Murray Valley encephalitis flavivirus, which usually results in viral hemorrhagic fever and nervous system disease.
In a preferred embodiment, the expression of the Murray Valley encephalitis virus gene is reduced.

In a preferred embodiment, the expression of a human gene that is required for Murray Valley encephalitis virus replication is reduced.
The invention also encompasses a method of treating a patient infected with dengue flavivirus, or a disease or disorder associated with the virus (eg, dengue hemorrhagic fever).

In a preferred embodiment, dengue virus gene expression is reduced.
In a preferred embodiment, the expression of a human gene that is required for dengue virus replication is reduced.

  The methods of the present invention also include treating patients infected with simian virus 40 (SV40), or at risk of or afflicted with a disorder mediated by SV40 (eg, tumorigenesis). provide.

In a preferred embodiment, the expression of the SV40 gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for SV40 replication is reduced.
The invention also encompasses methods of treating patients infected with human T cell leukocyte virus (HTLV) or diseases or disorders associated with the virus (eg, leukemia and myelopathy).

In a preferred embodiment, the expression of the HTLV gene is reduced. In another preferred embodiment, the HTVL1 gene is a Tax transcriptional activator.
In a preferred embodiment, the expression of a human gene that is required for HTLV replication is reduced.

  The methods of the invention are also at risk of or suffering from a patient infected with Moloney murine leukemia virus (Mo-MuLV), or a disorder mediated by Mo-MuLV (eg, T-cell leukemia) Provide to treat the patient.

In a preferred embodiment, the expression of the Mo-MuLV gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for Mo-MuLV replication is reduced.

The method of the present invention also treats a patient infected with encephalomyocarditis virus (EMCV), or at risk for or suffering from a disorder mediated by EMCV (eg, myocarditis). I will provide a. EMCV can cause myocarditis in mice and pigs and can infect human cardiomyocytes. This virus is therefore a problem for patients who have undergone xenotransplantation.

In a preferred embodiment, the expression of the EMCV gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for EMCV replication is reduced.
The present invention also encompasses methods for treating patients infected with measles virus (MV), at risk of or afflicted with a disorder mediated by MV (eg, measles).

In a preferred embodiment, the expression of the MV gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for MV replication is reduced. The present invention also provides for the risk of or at risk for a patient infected with varicella-zoster virus (VZV), or a disorder mediated by VZV (eg, chicken pox or herpes zoster (also referred to as herpes zoster)). A method of treating an affected patient is included.

In a preferred embodiment, the expression of the VZV gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for VZV replication is reduced.
The invention also encompasses methods of treating a patient infected with an adenovirus, or at risk for or suffering from an adenovirus-mediated disorder (eg, respiratory tract infection).

In a preferred embodiment, the expression of adenoviral genes is reduced.
In a preferred embodiment, the expression of a human gene that is required for adenovirus replication is reduced.

  The invention also encompasses a method of treating a patient infected with yellow fever virus (YFV), or at risk for or suffering from a disorder mediated by YFV (eg, respiratory tract infection). .

In a preferred embodiment, the expression of the YFV gene is reduced. In another preferred embodiment, the preferred gene is one of the group comprising the E, NS2A or NS3 gene.
In a preferred embodiment, the expression of a human gene that is required for YFV replication is reduced.

  The methods of the present invention also provide for treating patients infected with poliovirus, or at risk for or suffering from a disorder mediated by poliovirus (eg, polio).

In a preferred embodiment, poliovirus gene expression is reduced.
In a preferred embodiment, the expression of a human gene that is required for poliovirus replication is reduced.

  The methods of the invention also provide for treating a patient infected with a poxvirus, or at risk for or suffering from a poxvirus-mediated disorder (eg, smallpox).

In a preferred embodiment, the expression of a poxvirus gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for poxvirus replication is reduced.

In another aspect, the invention features a method of treating a subject infected with a pathogen (eg, a pathogen such as a bacterium, amoeba, parasite, or fungus). The above method is as follows:
providing an iRNA agent, eg, an siRNA agent having the structure described herein, wherein the siRNA agent is homologous to a pathogen gene and can silence the same gene, eg, by cleavage of the pathogen gene; ,
administering an iRNA agent to a subject (preferably a human subject);
Thereby treating the subject.

The target gene may be involved in proliferation, cell wall synthesis, protein synthesis, transcription, energy metabolism (eg Krebs cycle) or toxin production.
Thus, the present invention provides a method of treating a patient infected with a malaria parasite that causes malaria.

In a preferred embodiment, the expression of the Plasmodium gene is reduced. In another preferred embodiment, the gene is apical membrane antigen 1 (AMA1).
In a preferred embodiment, the expression of a human gene that is required for Plasmodium replication is reduced.

  The invention also encompasses a method of treating a patient infected with Mycobacterium ulcerans, or a disease or disorder associated with this pathogen (eg, Buruli ulcer).

In a preferred embodiment, the expression of a Mycobacterium ulcerans gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for Mycobacterium ulcerans replication is reduced.

  The invention also encompasses a method of treating a patient infected with Mycobacterium tuberculosis, or a disease or disorder associated with this pathogen (eg, tuberculosis).

In a preferred embodiment, the expression of Mycobacterium tuberculosis gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for M. tuberculosis replication is reduced.

  The invention also encompasses a method of treating a patient infected with Mycobacterium leprae, or a disease or disorder associated with this pathogen (eg, leprosy).

In a preferred embodiment, the expression of the leprosy gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for the replication of leprosy is reduced.
The invention also encompasses methods of treating patients infected with the bacterium Staphylococcus aureus, or diseases or disorders associated with this pathogen (eg, skin and mucosal infections).

In a preferred embodiment, the expression of the S. aureus gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for S. aureus replication is reduced.

The invention also encompasses methods of treating a patient infected with the bacterial Streptococcus pneumoniae, or a disease or disorder associated with the pathogen (eg, pneumonia or childhood lower respiratory tract infection).

In a preferred embodiment, the expression of Streptococcus pneumoniae gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for S. pneumoniae replication is reduced.

  The invention also encompasses a method of treating a patient infected with the bacterium Streptococcus pyogenes, or a disease or disorder associated with this pathogen (eg, streptococcal pharyngitis or scarlet fever).

In a preferred embodiment, the expression of Streptococcus pyogenes gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for Streptococcus pyogenes replication is reduced.

  The invention also encompasses methods of treating a patient infected with the bacterial Chlamydia pneumoniae, or a disease or disorder associated with this pathogen (eg, pneumonia or childhood lower respiratory tract infection).

In a preferred embodiment, the expression of the pneumonia chlamydia gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for pneumoniae chlamydia replication is reduced.

  The invention also encompasses methods of treating a patient infected with the bacterial Mycoplasma pneumoniae, or a disease or disorder associated with this pathogen (eg, pneumonia or childhood lower respiratory tract infection).

In a preferred embodiment, the expression of pneumonia mycoplasma gene is reduced.
In a preferred embodiment, the expression of a human gene that is required for replication of pneumonia mycoplasma is reduced.

  Loss of heterozygosity (LOH) can result in hemizygosity for sequences, such as genes, in the LOH region. This can lead to significant genetic differences between normal cells and diseased cells (eg, cancer cells) and is useful between normal cells and diseased cells (eg, cancer cells). Provide differences. This difference can occur because genes or other sequences are heterozygous in euploid cells but hemizygous in cells with LOH. Regions of LOH often contain genes that promote unwanted growth when lost, such as tumor suppressor genes, and, for example, other genes (sometimes genes that are essential for normal functioning (eg, growth)). To contain another sequence. The methods of the present invention are in part by specifically cleaving or silencing one allele of an essential gene with an iRNA agent of the present invention. The iRNA agent is selected such that the iRNA agent targets one allele of an essential gene found in cells with LOH, but does not silence another allele present in cells that do not show LOH. The In effect, the iRNA agent distinguishes between the two alleles and selectively silences the selected allele. In essence, SNPs of essential genes affected by polymorphisms, such as LOH, are used as targets for diseases characterized by cells with LOH, such as cancer cells with LOH.

For example, one skilled in the art can identify essential genes that are in proximity to the tumor suppressor gene and are within the LOH region containing the tumor suppressor gene. A gene encoding the large subunit of human RNA polymerase II (POLR2A), a gene located in the vicinity of the tumor suppressor gene p53, is such a gene. Many such genes exist in the LOH region in cancer cells. Other genes present in the LOH region and lacking in many cancer cell types include replication protein A 70 kDa subunit, replication protein A32-kDa, ribonucleotide reductase, thymidylate synthase, TATA-related factor 2H, Includes the group comprising ribosomal protein S14, eukaryotic initiation factor 5A, alanyl tRNA synthetase, cysteinyl tRNA synthetase, NaK ATPase, α-1 subunit and transferrin receptor.

Accordingly, the invention features a method of treating a disorder characterized by LOH, such as cancer. The method is:
Optionally determining the genotype of the allele of the gene in the LOH region, preferably determining the genotype of both alleles of the gene in normal cells;
Providing an iRNA agent that selectively cleaves or silences an allele found in LOH cells;
Administering iRNA to a subject;
Thereby treating the disease.

The present invention also encompasses iRNA agents disclosed herein, eg, iRNA agents that can selectively silence (eg, cleave) one allele of a polymorphic gene.
In another aspect, the present invention provides a method of cleaving or silencing two or more genes with an iRNA agent. In these embodiments, the iRNA agent is selected to have sufficient homology to sequences found in more than one gene. For example, the sequence AAGCTGGCCCTGACATGGAGAT (SEQ ID NO: 6719) is conserved among murine lamin B1, lamin B2, keratin complex 2-gene 1 and lamin A / C. Thus, iRNA agents that target this sequence will effectively silence the entire gene population.

The present invention also encompasses iRNA agents disclosed herein that are capable of silencing more than one gene.
Delivery Routes For simplicity of explanation, the formulations, compositions and methods of this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these formulations, compositions and methods can be practiced with other iRNA agents, eg, modified iRNA agents, and such practice is within the scope of the invention. A composition comprising an iRNA can be delivered to a subject by various routes. Typical routes include intravenous, topical, rectal, transanal, vaginal, nasal, pulmonary and ocular routes.

  The iRNA molecules of the present invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically include one or more types of iRNA and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable carrier” refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic absorption compatible with pharmaceutical administration. It is intended to include retarders and the like. The use of such media and reagents for substances with pharmaceutically activity is well known in the art. It is envisioned that conventional media and reagents may be used in the composition unless any conventional media and reagents are incompatible with the active compound. Supplementary active compounds can also be included in the compositions.

The pharmaceutical compositions of the present invention can be administered in a variety of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topical (including ocular, vaginal, rectal, nasal, transdermal), oral or parenteral. Parenteral administration includes intravenous infusion, subcutaneous administration, intraperitoneal or intramuscular injection, or intrathecal or intracerebroventricular administration.

  The route and site of administration may be selected to increase targeting. For example, when targeting muscle cells, intramuscular injection into the muscle of interest would be a logical choice. Lung cells could also be targeted by administering an aerosol form of iRNA. Vascular endothelial cells can also be targeted by coating balloon catheters with iRNA and mechanically introducing DNA.

  Formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, water-soluble bases, powdered or oily bases, thickeners, and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.

  Compositions for oral administration include powders or granules, suspensions or solutions in water, syrups, elixirs or water-insoluble media, tablets, capsules, medicinal candy, or troches. In the case of tablets, usable carriers include lactose, sodium citrate and phosphate. Various tablet disintegrating substances such as starch and lubricants such as magnesium stearate, sodium lauryl sulfate and talc are commonly used in tablets. For oral administration in a capsule form, useful diluents are lactose and high molecular weight polyethylene glycols. When aqueous suspensions are required for oral use, the nucleic acid compositions of the invention can be combined with emulsifiers and suspending agents. If desired, certain sweetening and / or flavoring agents can be added.

Compositions for intrathecal or intracerebroventricular administration may include a sterile aqueous solution that may also contain buffers, diluents and other suitable additives.
Formulations for parenteral administration may contain a sterile aqueous solution that may also contain buffering agents, diluents and other suitable additives. Intraventricular injection can be facilitated by, for example, an intraventricular catheter attached to a reservoir. When used in the ventricle, the total concentration of solutes should be controlled so that the preparation is isotonic.

  For ophthalmic administration, ointments or droppable solutions can be delivered by eye delivery systems known to those skilled in the art, such as applicators or eye drop containers. Such compositions consist of hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose or mucomimetics such as poly (vinyl alcohol), preservatives such as sorbic acid, EDTA or benzylclonium chloride, and normal amounts of diluents. And / or a carrier.

Local delivery To simplify the description, the formulations, compositions and methods of this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these formulations, compositions and methods can be practiced with other iRNA agents, eg, modified iRNA agents, and such practice is within the scope of the invention. In preferred embodiments, an iRNA agent, such as a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or a double-stranded iRNA agent or sRNA agent, etc. iRNA agents or DNA encoding their precursors) are delivered to the subject via topical administration. “Topical administration” refers to delivery to a subject by contacting the formulation directly with the surface of the subject. Although the most common form of topical delivery is to the skin, the compositions disclosed herein are directed to another surface of the body, such as the surface of the eye, mucous membrane, body cavity, or body surface. It can also be applied directly. As noted above, the most common topical delivery is to the skin. The term includes several routes of administration, including but not limited to topical and transdermal. These modes of administration typically involve penetration of the skin's permeation barrier and efficient delivery to the target tissue or target layer. Topical administration can be used as a means by which the composition penetrates the epidermis and dermis and ultimately achieves systemic delivery. Topical administration can also be used as a means of selectively delivering oligonucleotides to the subject's epidermis or dermis, or to a particular layer thereof, or to the underlying tissue.

  As used herein, the term “skin” refers to the epidermis and / or dermis of an animal. Mammalian skin is composed of two main and distinct layers. The outer layer of the skin is called the epidermis. The epidermis consists of a stratum corneum, a granular layer, a spiny layer, and a basal layer, the stratum corneum is on the surface of the skin, and the basal layer is in the deepest part of the epidermis. The epidermis is 50 μm to 0.2 mm thick depending on the location of the body.

  Under the epidermis is the dermis, which is much thicker than the epidermis. The dermis is mainly composed of collagen in a bundle of fibers. This collagen bundle provides inter alia support for blood vessels, capillary lymph vessels, glands, nerve endings and immunologically active cells.

  One of the main functions of the skin as an organ is to control the entry of substances into the body. The main permeation barrier of the skin is provided by the stratum corneum, which is formed from a number of layers of cells of different differentiation states. The intercellular spaces in the stratum corneum are filled with various lipids arranged in a lattice-like structure that provides a seal so as to further increase the skin permeation barrier.

  The permeation barrier provided by the skin is largely impermeable to molecules having a molecular weight greater than about 750 Da. In order for large molecules to pass through the skin's permeation barrier, mechanisms other than normal osmosis must be used.

  Several factors determine the permeability of the skin to the substance administered. These factors include the characteristics of the administered skin, the characteristics of the delivery agent, the interaction between the drug and the delivery agent and both the drug and the skin, the dose of the administered drug, the form of treatment, the post-treatment measures Include. It is possible to formulate a composition that includes one or more penetration enhancers that allow the drug to penetrate into preselected layers to selectively target the epidermis and dermis Sometimes it is.

  Transdermal delivery is a useful route for the administration of lipid soluble therapeutic agents. Because the dermis is more permeable than the epidermis, absorption is faster through scratched, burned or peeled skin. Inflammation and other physiological conditions that increase blood flow to the skin also increase transdermal absorption. Absorption through this route can be increased by the use of oily vehicles (rubbing agents) or by the use of one or more penetration enhancers. Another efficient method of delivering the compositions disclosed herein via the transdermal route includes skin hydration and the use of controlled release topical patches. The transdermal route provides a potentially efficient means of delivering the compositions disclosed herein for systemic and / or topical treatment.

In addition, iontophoresis (moving ionic solutes through biological membranes under the influence of an electric field) (Lee et al., “Critical Reviews in Therapeutic Drug Carrier Systems) ", 163, 1991), phonophoresis or sonophoresis (use of ultrasound to increase the absorption of various therapeutic agents across biological membranes, particularly the skin and cornea) (Lee et al. ), "Review Review in Therapeutic Carrier Systems", page 166, 1991) and optimization of vehicle properties according to dosing status and retention at the site of administration (Lee et al.
al), “Review Review in Therapeutic Carrier Systems”, p. 168 (1991), can be a useful method to increase the transport of locally administered compositions across skin and mucosal sites.

  The provided compositions and methods can also be used to test the function of various proteins and genes in vitro in cultured or stored dermal tissue and in animals. Thus, the present invention can be applied to test the function of any gene. The methods of the invention can also be used therapeutically or prophylactically. For example, psoriasis, lichen planus, toxic epidermal necrosis, erythema multiforme, basal cell carcinoma, squamous cell carcinoma, melanoma, Paget's disease, Kaposi's sarcoma, pulmonary fibrosis, Lyme disease, and virus, It can be used for the treatment of animals known to suffer from diseases such as fungal and bacterial skin infections or animals suspected of suffering from the diseases.

Pulmonary Delivery To simplify the description, the formulations, compositions and methods in this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these formulations, compositions and methods can be practiced with other iRNA agents, eg, modified iRNA agents, and such practice is within the scope of the invention. iRNA agents, such as double-stranded iRNA agents, or sRNA agents (eg, larger iRNA agents that can be processed into precursors, eg, sRNA agents, or iRNA agents, eg, double-stranded iRNA agents or sRNA agents, or their The composition comprising the DNA encoding the precursor) can be administered to the subject by pulmonary delivery. The pulmonary delivery composition is delivered so that the patient can inhale the dispersion and the composition within the dispersion, preferably the iRNA, can reach the lung and be readily absorbed directly into the blood circulation through the alveolar region. Can be done. Pulmonary delivery can be effective for both systemic and local delivery to treat pulmonary diseases.

  Pulmonary delivery can be accomplished in a variety of ways, including the use of nebulized, aerosolized, micellized and dry powder based formulations. Delivery can be accomplished using a liquid nebulizer, an aerosol inhaler, and a dry powder spray device. A quantitative device is preferred. One advantage of using an atomizer or inhaler is that the possibility of contamination is minimized because the device is self-contained. Dry powder dispensing devices, for example, deliver drugs that can be easily formulated as a dry powder. The iRNA composition can be stably stored as a lyophilized or spray-dried powder, either alone or in combination with a suitable powder carrier. Delivery of a composition for inhalation, when incorporated into a device, a timer, administration that allows for dose tracking, monitoring compliance, and / or induction of administration to the patient during the period of aerosol drug administration It may be implemented via a dosing time measuring element such as a quantity measuring device, a time measuring device, or a time indicator.

  The term “powder” refers to a composition consisting of finely dispersed solid particles that are free flowing and can be easily dispersed in an inhaler and subsequently inhaled by the subject to reach the lungs. It is possible to penetrate into the alveoli. Therefore, it can be said that the powder is “for respiration”. The average particle diameter is preferably less than about 10 μm in diameter, and is preferably relatively uniformly distributed in a spherical shape. More preferably, the diameter is less than about 7.5 μm, and most preferably less than about 5.0 μm. Usually, the particle size distribution has a diameter of about 0.1 μm to about 5 μm, particularly preferably about 0.3 μm to about 5 μm.

  The term “dry” means that the composition has a moisture content of less than about 10% by weight (% w), typically less than about 5% w, preferably less than about 3% w. To do. The dry composition can be such that the particles are readily dispersible in an inhaler and form an aerosol.

The term “therapeutically effective amount” is the amount present in the composition needed to provide the desired level of drug to the subject to be treated in order to obtain the expected physiological response. The term “physiologically effective amount” is an amount that is delivered to a subject to achieve a desired symptom relief or therapeutic effect.

The term “pharmaceutically acceptable carrier” refers to a carrier that can be ingested by the lungs without the toxic effects that are significant adverse effects on the lungs.
The types of pharmaceutical excipients useful as carriers include stabilizers such as human serum albumin (HSA), fillers such as carbohydrates, amino acids and polypeptides, pH adjusters or buffers, salts such as sodium chloride, etc. Is mentioned. These carriers can be in crystalline or amorphous form, or a mixture of the two forms.

  Particularly useful fillers include compatible carbohydrates, polypeptides, amino acids, or combinations thereof. Suitable carbohydrates include monosaccharides such as galactose, D-mannose, sorbose, disaccharides such as lactose and trehalose, cyclodextrins such as 2-hydroxypropyl-β-cyclodextrin, and raffinose, maltodextrin, dextran, and the like. Examples include alditols such as polysaccharides, mannitol, and xylitol. A preferred group of carbohydrates includes lactose, trehalose, raffinose, maltodextrin and mannitol. Suitable polypeptides include aspartame. Amino acids include alanine and glycine, with glycine being preferred.

  Additives that are minor components of the compositions of the present invention may be included to improve the steric structure stability and powder dispersibility during spray drying. These additives include hydrophobic amino acids such as tryptophan, tyrosine, leucine and phenylalanine.

  Suitable pH adjusters or buffers include organic salts prepared from organic acids and bases, such as sodium citrate and sodium ascorbate, with sodium citrate being preferred.

  Transpulmonary administration of micellar iRNA preparations using tetrafluoroethane, heptafluoroethane, dimethylfluoropropane, tetrafluoropropane, butane, isobutane, dimethyl ether, and other non-CFC and CFC propellants Can be achieved with a metering atomizer.

Oral or nasal delivery To simplify the description, the formulations, compositions and methods in this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these formulations, compositions and methods can be practiced with other iRNA agents, eg, modified iRNA agents, and such practice is within the scope of the invention. Both oral and nasal membranes offer advantages over alternative routes of administration. For example, drugs administered through these membranes begin to act rapidly, provide medicinal levels of plasma concentrations, avoid first-pass effects of liver metabolism, and enter into an adverse gastrointestinal (GI) environment. Avoid drug exposure. A further advantage is that the membrane site can be easily accessed so that the drug can be easily administered, localized and removed.

  For oral delivery, the composition may be targeted to the oral cavity surface, for example, the sublingual mucosa (including the ventral surface of the tongue and the floor of the mouth) or the buccal mucosa constituting the inner surface of the buccal. Is possible. The sublingual mucosa is relatively permeable, resulting in rapid absorption and acceptable bioavailability for many drugs. Furthermore, the sublingual mucosa is convenient, acceptable and easily accessible.

The ability of molecules to permeate through the oral mucosa appears to be related to molecular size, lipid solubility and peptide protein ionization. Small molecules less than 1,000 daltons appear to pass rapidly through the mucosa. As the molecular size increases, the permeability decreases rapidly. Lipid soluble compounds are more permeable than molecules that are not lipid soluble. Maximum absorption occurs when the molecule is not ionized or is neutral in charge. Thus, charged molecules are the biggest challenge for absorption through the oral mucosa.

  In addition, the pharmaceutical composition of iRNA can be administered to the oral cavity by spraying the mixed micelle pharmaceutical preparation and the spray as described above from the metering sprayer into the human oral cavity instead of inhalation. In one embodiment, the nebulizer is first shaken prior to spraying the pharmaceutical formulation and propellant into the oral cavity.

Devices For simplicity of description, the devices, formulations, compositions and methods in this section are discussed primarily with respect to unmodified iRNA agents. However, it should be understood that these devices, formulations, compositions and methods can be practiced with other iRNA agents, eg, modified iRNA agents, and such practice is within the scope of the invention. iRNA agents, such as double-stranded iRNA agents, or sRNA agents (eg, larger iRNA agents that can be processed into precursors, eg, sRNA agents, or iRNA agents, eg, double-stranded iRNA agents or sRNA agents, or their The DNA encoding the precursor) can be placed on or in a device, such as, for example, a device that is implanted into the subject or otherwise placed in the subject. Typical devices include devices that are introduced into the vasculature (eg, devices that are inserted into the lumen of vascular tissue) or devices that contain stents, catheters, heart valves, and other vascular devices themselves. A device that forms part of a blood vessel may be mentioned. These devices, such as catheters or stents, can be placed in the blood vessels of the lung, heart or foot.

  Another device includes a device other than a vascular device, such as a peritoneum, or a device implanted in an organ or glandular tissue, such as an artificial organ. The device can release a therapeutic substance in addition to the iRNA, for example, the device can release insulin.

Other devices include artificial joints such as hip joints, and other orthopedic implants.
In one embodiment, a unit dose or a fixed dose of a composition comprising iRNA is dispensed by the implantation device. The device can include a sensor that monitors a parameter within the subject's body. For example, the device may comprise a pump, for example optionally linked to an electronic device.

  A tissue or cell or organ such as the liver is an iRNA agent, eg, a double-stranded iRNA agent or sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or a double-stranded iRNA, eg, Can be treated ex vivo with an iRNA agent, such as an agent or sRNA agent, or a DNA encoding a precursor thereof, and then administered or transplanted into a subject.

  The tissue can be self, homologous, or heterogeneous. For example, tissue (eg, liver) can be treated to reduce graft-versus-host disease. In another embodiment, the tissue is an allogeneic tissue and is treated to treat a disease characterized by unwanted gene expression in the tissue (such as the liver). In other examples, tissue containing hematopoietic cells, such as bone marrow hematopoietic cells, can be treated to inhibit undesirable cell proliferation.

The introduction of treated tissue, whether autologous or transplanted, can be combined with another treatment.
In some implementations, cells treated with iRNA, for example, prevent the cells from leaving the graft, but allow molecules in the body to reach the cells and are produced by the cells Is isolated from other cells by a semi-permeable porous barrier that allows it to enter the body. In one embodiment, the porous barrier is formed from alginic acid.

  In one embodiment, the contraceptive device (contraceptive device) is an iRNA agent, eg, a double-stranded iRNA agent or sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or, eg, two Coated with or containing iRNA agents, such as strand iRNA agents or sRNA agents, or DNA encoding their precursors). Typical devices include condoms, contraceptive pessaries, IUDs (implantable uterine devices), sponges, vaginal condoms, and birth control devices. In one embodiment, the iRNA is selected to inactivate sperm or egg. In other embodiments, the iRNA is selected to be complementary to viral or pathogen RNA, eg, STD RNA. In some examples, the iRNA composition can include a spermicide.

Dosage In one aspect, the invention features a method of administering an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent, to a subject (eg, a human subject). The method comprises an iRNA agent, eg, an sRNA agent, eg, a double-stranded sRNA agent, wherein (a) the double-stranded portion is 19-25 nucleotides (nt) long, preferably 21-23 nt, and (b) the target RNA Administering a unit dose of a double-stranded sRNA agent that is complementary to (eg, endogenous target RNA or pathogen target RNA) and optionally (c) comprises at least one 3 ′ overhang of 1-5 nucleotides in length Is included. In one embodiment, the unit dose is less than 1.4 mg / kg body weight, or 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, Less than 0.001, 0.0005, 0.0001, 0.00005 or 0.00001 mg and less than 200 nmol RNA agent (eg about 4.4 × 10 ¹⁶ copies) per kg body weight, or 1,500 per kg body weight Less than 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmol RNA agent.

  A defined amount can be an amount effective to treat or inhibit a disease or disorder, eg, a disease or disorder associated with a target RNA, such as RNA present in the liver. A unit dose can be administered, for example, by injection (eg, intravenous or intramuscular), inhalation administration, or topical administration. It is particularly preferred that the dose is less than 2, 1 or 0.1 mg / kg body weight.

  In a preferred embodiment, the unit dose is administered less frequently than once a day, for example less frequently than every 2, 4, 8 or 30 days. In other embodiments, the unit dose is not administered frequently (eg, not administered at a regular frequency). For example, a unit dose may be administered once.

  In one embodiment, the effective dose is administered in other conventional treatment modalities. In one embodiment, the subject has a viral infection and the treatment modality is an antiviral agent other than an iRNA agent (eg, other than a double-stranded iRNA agent or sRNA agent). In other embodiments, the subject is atherosclerosis and an effective dose of an iRNA agent (eg, a double stranded iRNA agent or sRNA agent) is combined with a surgical intervention, eg, a surgical intervention (eg, angioplasty). ) After.

In one embodiment, the subject is treated with an initial dose and one or more maintenance doses of an iRNA agent, such as a double-stranded iRNA agent or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, such as an sRNA agent, Alternatively, iRNA agents such as double-stranded iRNA agents or sRNA agents, or DNA encoding their precursors are administered. The maintenance dose is generally less than the initial dose (eg, ½ less than the initial dose). Maintenance dosing regimes include subjects in the range of 0.01 μg to 1.4 mg per kg body weight per day, such as 10, 1, 0.1, 0.01, 0.001, or 0.001 per kg body weight per day. Including treatment at a dose of 00001 mg. The maintenance dose is preferably administered no more than once every 5, 10, or 30 days. Furthermore, the treatment regimen can be sustained for a period of time that may vary depending on the nature of the individual disease, the severity of the disease and the overall condition of the patient. In preferred embodiments, the dose may be delivered no more than once per day, such as no more than once every 24, 36, 48 hours, such as no more than once every 5 or 8 days. Following treatment, the patient may be monitored for changes in the patient's condition and relief of symptoms of the disease state. If the patient does not respond significantly at the current dose level, the dose of the compound may be increased, or if alleviation of the symptoms of the disease state is observed, the disease state has been removed, or is undesirable The dose may be reduced if side effects are observed.

  An effective dose may be administered in a single dose or in two or more doses as desired or deemed appropriate under the particular circumstances. If desired, it may be desirable to implant a delivery device (eg, pump, semi-permanent stent (eg, intravenous, intraperitoneal, intracapsular or intra-articular)) or reservoir to facilitate repeated or frequent infusions.

  In one embodiment, the iRNA agent pharmaceutical composition includes multiple types of iRNA agents. In other embodiments, multiple types of iRNA agents have sequences that do not overlap and are not adjacent to another type of iRNA agent with respect to a naturally occurring target sequence. In other embodiments, multiple types of iRNA agents are specific for different naturally occurring target genes. In other embodiments, the iRNA agent is allele specific.

  In some cases, the patient is treated with an iRNA agent in conjunction with another treatment modality. For example, a patient being treated for liver disease is administered a target gene specific iRNA agent known to increase disease progression in combination with a known drug that inhibits the activity of the target gene product. May be. For example, patients undergoing treatment for liver cancer may be administered an iRNA agent specific for a target essential for tumor cell growth in combination with chemotherapy.

  Following successful treatment, it is desirable to administer maintenance therapy to prevent recurrence of the condition, in which the compound of the invention is administered at a maintenance dose of 0.01 μg to 100 g per kg body weight. (See US Pat. No. 6,107,094).

  The concentration of the iRNA agent composition is an amount that is sufficiently effective to treat or inhibit the disease or to modulate a physiological condition in humans. The concentration or amount of iRNA agent administered can depend on the parameters determined for the iRNA agent and the method of administration (eg, nasal, oral, pulmonary). For example, nasal formulations tend to require fairly low concentrations of some ingredients to avoid nasal irritation or burn-in. It may be desirable to dilute the oral formulation 10 to 100 times to provide a suitable nasal formulation.

Certain factors can effectively treat a subject, such as, but not limited to, the severity of the disease or disorder, prior treatment, the subject's normal health and / or age, and the presence of another disease. May affect the dose required. In addition, a therapeutically effective amount of an iRNA agent, such as a double-stranded iRNA agent or sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or a double-stranded iRNA agent or sRNA, for example). Treatment of a subject with an iRNA agent such as an agent or DNA encoding a precursor thereof can include a single treatment or, preferably, can include a series of treatments. In addition, it goes without saying that the effective dose of an iRNA agent such as an sRNA agent used for treatment may be increased or decreased over the course of individual treatment. It is possible to vary the dose and will be apparent from the results of a diagnostic assay as described herein. For example, a subject can be monitored after administration of an iRNA agent composition. Based on the monitoring information, additional amounts of the iRNA agent composition may be administered.

  Dosing depends on the severity and responsiveness of the condition to be treated, over the course of treatment lasting days to months, or until treatment is effective or a reduction in disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the patient's body. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimal doses can vary depending on the relative potency of individual compounds and are generally estimated based on EC50 found to be effective in in vitro and in vivo animal models. Is possible. In some embodiments, the animal model includes a transgenic animal that expresses a human gene, eg, a gene that produces a target RNA. A transgenic animal may be one that lacks the corresponding endogenous RNA. In other embodiments, the test composition includes an iRNA agent that is complementary, at least in an internal region, to a sequence conserved between the animal model target RNA and the human target RNA.

The inventors have found that the iRNA agents described herein can be administered in a number of ways to mammals, particularly large mammals such as non-human primates or humans.
In one embodiment, administration of the iRNA agent (eg, double-stranded iRNA agent, or sRNA agent) composition is parenteral, eg, intravenous (eg, as a bolus or as a diffusion infusion), intradermal, intraperitoneal, intramuscular, Intrathecal, intraventricular, intracranial, subcutaneous, transmucosal, buccal, sublingual, transendoscopic, transrectal, oral, vaginal, topical, transpulmonary, intranasal, urethra or ocular The Administration can be by the subject or by another person (eg, a health care provider). The agent can be provided in a fixed dose or in a dispensing container that delivers a fixed amount. The selected mode of delivery is described in more detail below.

The present invention provides methods, compositions and kits for rectal administration or rectal delivery of the iRNA agents described herein.
Thus, an iRNA agent described herein, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or, eg, a double-stranded iRNA agent or DNA encoding iRNA agents such as sRNA agents or their precursors), eg, therapeutically effective amounts of iRNA agents described herein, eg, double stranded regions of less than 40 nucleotides, preferably less than 30 nucleotides An iRNA agent having one or two 1 to 3 nucleotide long single stranded 3 'overhangs can be administered rectally (eg, introduced into the lower or upper colon via the rectum). This approach is particularly useful when treating inflammatory diseases, disorders characterized by undesirable cell proliferation, such as polyps or colon cancer.

  The drug is a flexible, camera-guided device similar to that used for dispensing devices, eg, colon examination or polyp removal, with a means for delivering the drug By introducing, it can be delivered to a site in the large intestine.

  Enema is used for rectal administration of iRNA agents. Enema iRNA agents can be dissolved in saline or buffered solutions. Suppositories can also be used for rectal administration, and the suppository can contain other ingredients, for example excipients such as cocoa butter or hydropropylmethylcellulose.

Any iRNA agent described herein can be administered orally, for example, in the form of a tablet, capsule, gel capsule, medicinal candy, troche or liquid syrup. Further, the composition can be applied topically to the oral cavity surface.

  Any iRNA agent described herein can be administered buccally. For example, the agent may be sprayed into the oral cavity or applied directly to the oral cavity surface, for example in liquid, solid or gel form. Such administration is particularly desirable for the treatment of inflammation in the oral cavity (eg, gums or tongue), for example, in one embodiment, the oral administration does not involve, for example, inhalation, such as dispensing containers, such as pharmaceutical compositions and nebulizers. It is carried out by spraying into the oral cavity from a metering spray container that dispenses the agent.

  Any iRNA agent described herein can be administered to ocular tissue. For example, the agent can be administered to the eye or adjacent tissue (eg, inside the eyelid). The medicament can be administered topically, for example by spraying, as drops, as an eyewash or as an ointment. Administration can be performed by the subject or by another person (eg, a health care provider). The agent can be provided in a fixed dose or in a container that delivers a fixed dose. The agent can also be administered inside the eye and can be introduced by a needle or another delivery device that can introduce the agent to a selected region or structure. Ocular treatment is particularly desirable for treating inflammation of the eye or adjacent tissue.

  Any iRNA agent described herein can be administered directly to the skin. For example, the agent can be locally administered or delivered to the skin layer, for example, by using a microneedle or series of microneedles that penetrate the skin but preferably do not penetrate the underlying muscle tissue. Administration of the iRNA agent composition can be local. Topical administration can, for example, deliver the composition to the dermis or epidermis of a subject. Topical administration may be in the form of transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Compositions for topical administration can be formulated as liposomes, micelles, emulsifiers or other lipid-soluble molecular aggregates. Transdermal administration can be administered using at least one penetration enhancing method such as iontophoresis, phonophoresis or sonophoresis.

  Any iRNA agent described herein can be administered to the pulmonary organ system. Transpulmonary administration can be accomplished by inhalation or by introducing a delivery device into the pulmonary organ system, for example by introducing a delivery device capable of dispensing the drug. The preferred method of pulmonary delivery uses inhalation. The drug can be provided in a container that delivers the drug (eg, a wet drug or a dry drug that is sufficiently small in shape to be inhalable). The device can deliver a fixed dose of drug. The subject or other person can administer the drug.

Pulmonary delivery is effective not only for diseases that directly affect lung tissue, but also for diseases that affect other tissues.
An iRNA agent can be formulated as a liquid or non-liquid (eg, powder, crystals), or an aerosol for pulmonary delivery.

  Any iRNA agent described herein can be administered nasally. Nasal administration can be accomplished by introducing a delivery device into the nose, for example by introducing a delivery device capable of dispensing the drug. The method of nasal delivery involves administering to the surface of the nasal cavity a spray, aerosol, solution, for example, by instillation or by topical administration. The drug can be provided in a container that delivers the drug (eg, a wet drug or a dry drug that is sufficiently small in shape to be inhalable). The device can deliver a fixed dose of drug. The subject or other person can administer the drug.

Nasal delivery is effective not only for diseases that directly affect nasal tissue, but also for diseases that affect other tissues. An iRNA agent can be formulated for liquid or non-liquid (eg, powder, crystal) or for nasal delivery.

  The iRNA agent may be packaged within a natural viral capsid, or may be packaged within a chemically or enzymatically produced artificial capsid or a structure derived therefrom.

  A dosage of a pharmaceutical composition comprising an iRNA agent can be administered to alleviate symptoms of a disease state (eg, cancer or heart disease). A subject can be treated with the pharmaceutical composition by any of the methods described above.

Gene expression in a subject can be modulated by administering a pharmaceutical composition comprising an iRNA agent.
A subject is a powdered form, eg, a quantity of an iRNA agent that is an aggregate of microparticles such as crystalline particles, eg, a double-stranded iRNA agent or an sRNA agent (eg, a larger iRNA that can be processed into a precursor, eg, an sRNA agent Agent) Can be treated by administering the composition. The composition can include a plurality of iRNA agents, eg, iRNA agents specific for one or more different endogenous target RNAs. The method can include other features described herein.

  The subject was prepared by a method involving spray drying (ie spraying a solution, emulsifier, or suspension and immediately exposing the droplets to a dry gas and collecting the resulting porous powder particles) It can be treated by administering an amount of an iRNA agent composition. The composition can include a plurality of iRNA agents, for example, iRNA agents specific for one or more different endogenous target RNAs. The method can include other features described herein.

  iRNA agents, such as double-stranded iRNA agents, or sRNA agents (eg, larger iRNA agents that can be processed into precursors, eg, sRNA agents, or iRNA agents, eg, double-stranded iRNA agents or sRNA agents, or their The DNA encoding the precursor) is in powder form, crystalline form or other finely divided form, with or without a carrier, eg, microparticles or nanoparticles suitable for inhalation or another pulmonary delivery Can be provided. This includes providing an aerosol preparation, eg, an aerosolized spray-dried composition. The aerosol composition can be provided in or dispensed by a metered delivery device.

  A subject may receive, for example, a spray-dried iRNA agent, such as a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, such as an sRNA agent, or a double-stranded iRNA agent, for example). Alternatively, a treatable condition can be treated by aerosolizing a composition of iRNA agents such as sRNA agents or DNA encoding their precursors and inhaling the aerosolized composition. The iRNA agent can be sRNA. The composition can include a plurality of iRNA agents, for example, iRNA agents specific for one or more different endogenous target RNAs. The method can include other features described herein.

  A subject is an effective / constant amount of an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or, eg, a double-stranded iRNA agent. Or an iRNA agent, such as an sRNA agent, or a DNA encoding their precursor), which can be treated by spray drying, freeze drying, vacuum drying, evaporation, Prepared by methods including fluid bed drying, or a combination of these techniques.

  In another aspect, the invention evaluates a parameter associated with abundant transcripts in a cell of interest, compares a parameter evaluated against a reference value, and the evaluated parameter is relative to a reference value. An iRNA agent (or a precursor such as a larger iRNA agent that can be processed into an sRNA agent, or an iRNA agent or a DNA encoding the precursor) when having a pre-selected correlation (eg, a large value) A method comprising administering to a subject. In one embodiment, the iRNA agent comprises a sequence that is complementary to the transcript being evaluated. For example, the parameter can be a direct measure of transcription level, a measure of protein level, a symptom or characteristic of a disease or disorder (eg, cell growth rate and / or tumor mass, viral load).

  In another aspect, the invention provides an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or a double-stranded iRNA agent or a first amount of a composition comprising an iRNA agent such as an sRNA agent or a DNA encoding a precursor thereof, wherein the iRNA agent comprises a strand that is substantially complementary to the target nucleic acid. Administering the composition to a subject and evaluating the activity associated with the protein encoded by the target nucleic acid and using the evaluation to determine whether a second amount should be administered. Features method. In a preferred embodiment, the method comprises administering a second amount of the composition, and the administration time or dose for the second amount is a function of the assessment. The method can include other features described herein.

  In another aspect, the invention features a method of administering to a subject a source of double-stranded iRNA agent (ds iRNA agent). The method comprises (a) a double-stranded region of 19-25 nucleotides in length, preferably 21-23 nucleotides, (b) is complementary to a target RNA (eg, endogenous RNA or pathogen RNA) and is optional Optionally (c) administering or implanting a source of a ds iRNA agent, eg, a sRNA agent comprising at least one 3 ′ overhang 1-5 nt long. In one embodiment, the source releases a ds iRNA agent over time, for example, the source is a controlled release or delayed release source, eg, a microparticle that gradually releases the ds iRNA agent. In other embodiments, the source is a pump, eg, a pump that includes a sensor, or a pump that can release one or more unit doses.

  In one aspect, the invention provides an iRNA agent comprising a nucleotide sequence complementary to a target RNA, eg, a substantially and / or exactly complementary nucleotide sequence, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a precursor Body, eg, a larger iRNA agent that can be processed into an sRNA agent, or an iRNA agent such as a double-stranded iRNA agent or sRNA agent or DNA encoding a precursor thereof). The target RNA can be a transcript of an endogenous human gene. In one embodiment, the iRNA agent is (a) 19-25 nucleotides long, preferably 21-23 nucleotides, (b) complementary to the endogenous target RNA, and optionally (c) at least one Including 3 ′ protrusion 1-5 nt length. In one embodiment, the pharmaceutical composition can be an emulsifier, microemulsion, cream, jelly or liposome.

  In one example, the pharmaceutical composition comprises an iRNA agent mixed with a topical delivery agent. The topical delivery agent can be a plurality of micro vehicles. The microvehicle can be a liposome. In a preferred embodiment, the liposome is a cationic liposome.

In another aspect, the pharmaceutical composition is an iRNA agent mixed with a topical penetration enhancer, such as a double stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, such as an sRNA agent, or For example, iRNA agents such as double-stranded iRNA agents or sRNA agents, or DNA encoding their precursors). In one embodiment, the topical penetration enhancer is a fatty acid. Fatty acids are arachidonic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicapric acid, tricapric acid, monoolein, dilaurin, glyceryl 1-monocapric acid , 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, or _{C 1-10} alkyl esters, monoglycerides, may be acceptable salt thereof diglyceride or pharmaceutically.

  In another embodiment, the topical penetration enhancer is a bile salt. The bile salts include cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, chenodeoxycholic acid, ursodeoxycholic acid, tauro-24,25- It may be sodium dihydro-fusidate, sodium glycodihydrofusidate, polyoxyethylene-9-lauryl ether or a pharmaceutically acceptable salt thereof.

  In another embodiment, the penetration enhancer is a chelating agent. The chelating agent can be EDTA, citric acid, salicylic acid, N-acyl derivatives of collagen, laureth-9, N-aminoacyl derivatives of β-diketones or mixtures thereof.

  In another embodiment, the penetration enhancer is a surfactant, such as an ionic or nonionic surfactant. The surfactant may be sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether, an emulsifier of a perfluoro compound or a mixture thereof.

  In another embodiment, the penetration enhancer may be selected from the group consisting of unsaturated cyclic ureas, 1-alkyl-alkones, 1-alkenylazacyclo-aracanones, steroidal anti-inflammatory agents and mixtures thereof. In yet another embodiment, the penetration enhancer can be a glycol, pyrrole, azone or terpenes.

  In one aspect, the invention provides an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or a form suitable for oral delivery, or A pharmaceutical composition comprising a DNA encoding an iRNA agent such as a double-stranded iRNA agent or sRNA agent or a precursor thereof. In one embodiment, oral delivery can be used to deliver iRNA agent compositions to cells or regions of the gastrointestinal tract, such as the small intestine, large intestine (eg, to treat colon cancer), and the like. The oral delivery form may be a tablet, capsule or gel capsule. In one embodiment, the iRNA agent of the pharmaceutical composition modulates cell adhesion protein expression, regulates cell growth rate, or has biological activity against eukaryotic pathogens or retroviruses. In another embodiment, the pharmaceutical composition includes an enteric material that substantially inhibits dissolution of the tablet, capsule or gel capsule in the mammalian stomach. In a preferred embodiment, the enteric material is a coating agent. The coating agent can be phthalic acetate, propylene glycol, sorbitan monooleate, cellulose trimellitate, hydroxypropylmethylcellulose phthalate or cellulose acetate phthalate.

  In another embodiment, the oral dosage form of the pharmaceutical composition includes a penetration enhancer. The penetration enhancer can be a bile salt or a fatty acid. The bile salt can be ursodeoxycholic acid, chenodeoxycholic acid and their salts. The fatty acid can be capric acid, lauric acid or their salts.

  In another embodiment, the oral dosage form of the pharmaceutical composition includes an excipient. In one example, the excipient is polyethylene glycol. In another example, the excipient is Precirol®.

  In another embodiment, the oral dosage form of the pharmaceutical composition includes a plasticizer. The plasticizer can be diethyl phthalate, triacetin dibutyl sebacate, dibutyl phthalate or triethyl citrate.

  In one aspect, the invention features a pharmaceutical composition that includes an iRNA agent and a delivery vehicle. In one embodiment, the iRNA agent is (a) 19-25 nucleotides long, preferably 21-23 nucleotides, (b) complementary to endogenous target RNA, and optionally (c) at least 1 Contains 3 'overhangs of 1-5 nucleotides in length.

  In one embodiment, the delivery vehicle is an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or, eg, a double-stranded iRNA agent or iRNA agents such as sRNA agents or DNA encoding their precursors) can be delivered to cells by local routes of administration. The delivery vehicle can be a micro vehicle. In one example, the microvehicle is a liposome. In a preferred embodiment, the liposome is a cationic liposome. In other examples, the microvehicle is a micelle. In one aspect, the invention provides an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or A pharmaceutical composition comprising a DNA encoding an iRNA agent such as a single-stranded iRNA agent or sRNA agent or a precursor thereof. In one embodiment, the injectable dosage form of the pharmaceutical composition comprises a sterile aqueous solution or dispersion and a sterile powder. In a preferred embodiment, the sterilizing solution may include a diluent such as water, saline, fixed oil, polyethylene glycol, glycerin or propylene glycol.

  In one aspect, the invention relates to an oral dosage form of an iRNA agent, such as a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, such as an sRNA agent, or, eg, double-stranded A pharmaceutical composition comprising iRNA agents such as iRNA agents or sRNA agents or DNA encoding their precursors. In one embodiment, the oral dosage form is selected from the group consisting of tablets, capsules and gel capsules. In another embodiment, the pharmaceutical composition comprises an enteric material that substantially inhibits dissolution of the tablet, capsule or gel capsule in the mammalian stomach. In a preferred embodiment, the enteric material is a coating agent. The coating agent can be phthalic acetate, propylene glycol, sorbitan monooleate, cellulose trimellitate, hydroxypropylmethylcellulose phthalate or cellulose acetate phthalate. In one embodiment, the oral dosage form of the pharmaceutical composition comprises a penetration enhancer, eg, a penetration enhancer as described herein.

  In one aspect, the invention provides an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or, eg, a double-stranded, in rectal dosage form. A pharmaceutical composition comprising iRNA agents such as iRNA agents or sRNA agents or DNA encoding their precursors. In one embodiment, the rectal dosage form is an enema. In another embodiment, the rectal dosage form is a suppository.

In one aspect, the invention provides an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or an A pharmaceutical composition comprising an iRNA agent, such as a strand iRNA agent or sRNA agent, or DNA encoding a precursor thereof. In one embodiment, the intravaginal dosage form is a suppository. In another embodiment, the intravaginal dosage form is a foam, cream or gel.

  In one aspect, the invention provides an iRNA agent, such as a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, such as an sRNA agent, or a pulmonary or nasal dosage form, or For example, a pharmaceutical composition comprising a DNA encoding an iRNA agent such as a double-stranded iRNA agent or sRNA agent or a precursor thereof. In one embodiment, the iRNA agent can be incorporated within a particle, eg, a microparticle such as a microsphere. The particles can be produced by spray drying, freeze drying, evaporation, fluid bed drying, vacuum drying or a combination of these techniques. Microspheres can be formulated as suspensions, powders or implantable solids.

  In one aspect, the invention provides a spray-dried iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA that can be processed into a precursor, eg, an sRNA agent, suitable for inhalation by the subject. A composition of an agent or an iRNA agent such as a double-stranded iRNA agent or sRNA agent or a DNA encoding a precursor thereof, which is suitable for treating a subject's condition by inhalation An amount of a therapeutically effective iRNA agent, (b) a pharmaceutically acceptable excipient selected from the group consisting of carbohydrates and amino acids, and (c) an optionally physiologically effective amount of dispersibility. A composition comprising an acceptable and water-soluble polypeptide.

  In one embodiment, the excipient is a carbohydrate. The carbohydrate may be selected from the group consisting of monosaccharides, disaccharides, trisaccharides and polysaccharides. In a preferred embodiment, the carbohydrate is a monosaccharide selected from the group consisting of dextrose, galactose, mannitol, D-mannose, sorbitol and sorbose. In another preferred embodiment, the carbohydrate is a disaccharide selected from the group consisting of lactose, maltose, sucrose and trehalose.

  In another embodiment, the excipient is an amino acid. In one embodiment, the amino acid is a hydrophobic amino acid. In a preferred embodiment, the hydrophobic amino acid is selected from the group consisting of alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan and valine. In yet another embodiment, the amino acid is a polar amino acid. In a preferred embodiment, the amino acid is selected from the group consisting of arginine, histidine, lysine, cysteine, glycine, glutamine, serine, threonine, tyrosine, aspartic acid and glutamic acid.

In one embodiment, the polypeptide that promotes dispersibility is selected from the group consisting of human serum albumin, α-lactalbumin, trypsinogen and polyalanine.
In one embodiment, the spray-dried iRNA agent composition comprises particles having a mass median diameter (MMD) of less than 10 μm (microns). In another embodiment, the spray dried iRNA agent composition comprises particles having a mass median diameter of less than 5 μm. In yet another embodiment, the spray-dried iRNA agent composition comprises particles having an aerodynamic mass median diameter (MMAD) of less than 5 μm.

In some other aspects, the invention provides for an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a larger iRNA agent that can be processed into a precursor, eg, an sRNA agent, or, eg, a double-stranded A kit comprising a suitable container containing a pharmaceutical formulation of iRNA agents such as iRNA agents or sRNA agents or DNA encoding their precursors) is provided. In certain embodiments, the individual components of the pharmaceutical formulation can be provided in a single container. As another example, it may be desirable to provide two or more separate containers for the components of the pharmaceutical formulation, eg, one container for the iRNA agent preparation and at least one other container for the carrier compound. The kit may be packaged in many different configurations, such as one or more containers contained in a single box. Different components may be used in combination, for example according to the instructions provided with the kit. The above components can be combined according to the methods described herein, for example, to prepare and administer a pharmaceutical composition. The kit can also include a delivery device.

  In another aspect, the invention features a device, eg, an implantable device, that can be processed into an iRNA agent, eg, a double-stranded iRNA agent, or an sRNA agent (eg, a precursor, eg, an sRNA agent). Distributing a composition comprising a larger iRNA agent or a DNA encoding an iRNA agent such as a double-stranded iRNA agent or sRNA agent or a precursor thereof, eg, an iRNA agent that silences an endogenous transcript Or it can be administered. In one embodiment, the device is coated with the composition. In another embodiment, an iRNA agent is placed in the device. In another embodiment, the device comprises a mechanism for dispensing a unit dose composition. In another embodiment, the device releases the composition continuously, for example by diffusion. Exemplary devices include stents, catheters, pumps, artificial organs or artificial organ parts (eg, artificial hearts, heart valves, etc.), and sutures.

  As used herein, the term “crystalline” refers to a solid having a crystalline structure or property, ie, a tertiary having planar surfaces intersecting at an angle and having a regular internal structure. Refers to the original particle structure. The composition of the present invention may have various crystal shapes. Crystal shapes can be prepared by various methods including, for example, spray drying.

  The invention is further illustrated by the following examples, which should not be construed as further limited by the examples.

[ApoB protein as a therapeutic target for lipid-related diseases]
Apolipoprotein B (apoB) is a candidate target gene for the development of novel therapeutics for lipid-related diseases.

  The methods described herein can be used to assess the efficacy of a particular siRNA as a therapeutic tool to treat lipid metabolism disorders that result in elevated apoB levels. The use of siRNA duplexes to selectively bind and inactivate target apoB mRNA is a method for treating the disorders.

Two methods:
i) Ex vivo by transfecting siRNA duplexes homologous to human apoB mRNA into a human liver cancer cell line (HepG2) and monitoring apoB protein and RNA using Western blotting and RT-PCR, respectively. Inhibition of apoB in the model. siRNA molecules that efficiently inhibit the expression of apoB
Test for similar effects in vivo.

ii) In vivo test using apoB transgenic mouse model (apoB100 transgenic mouse, C57BL / 6NTac-TgN (APOB100), order model number: 1004-T (hemizygous), B6 (control)). siRNA duplexes are designed to target apoB-100 transgenic mice, or CETP / apoB double transgenic mice expressing both cholesterol ester transfer protein (CETP) and apoB. The effect of siRNA on gene expression in vivo can be measured by monitoring HDL / LDL cholesterol levels in serum. From the results of this experiment, hypercholesterolemia, HDL / LDL
The therapeutic potential of siRNA for treating lipid related diseases including cholesterol imbalance, familial complex hyperlipidemia, and acquired hyperlipidemia would be suggested.

  Background Fats in the form of triglycerides are ideal for energy storage because they are highly reduced and anhydrous. Adipocytes are composed of a nucleus, a cell membrane, and triglycerides, and the function of adipocytes is to store triglycerides.

  The lipid part of human food is mainly composed of triglycerides and cholesterol (and its esters). They must be emulsified and digested to be absorbed. Specifically, when fat (triacylglycerol) is ingested, bile (bile acid, bile salt, and cholesterol) produced in the liver is secreted by the gallbladder. Pancreatic lipase digests triglycerides to fatty acids and also digests diacylglycerol and monoacylglycerol. Fatty acids are absorbed by the intestinal epithelial cells and re-synthesized into triacylglycerols when they enter the cell. These triglycerides and some cholesterol combine with apolipoproteins to produce chylomicrons. About 95% of chylomicrons are composed of triglycerides. Chylomicrons transport fatty acids to peripheral tissues. Any excess fat is stored in adipose tissue.

  Transport and removal of lipids from the blood to the cell and from the cell to the blood and liver is mediated by the lipoprotein transport protein. There are approximately 17 proteins of this type and can be divided into three groups: apolipoproteins, lipoprotein processing proteins, and lipoprotein receptors.

  Apolipoprotein coats lipoprotein particles and includes AI, A-II, A-IV, B, CI, CII, CIII, D, E, Apo (a) protein. Lipoprotein processing proteins include lipoprotein lipase, liver lipase, lecithin cholesterol acyltransferase and cholesterol ester transfer protein. Lipoprotein receptors include low density lipoprotein (LDL) receptor, chylomicron remnant receptor (LDL receptor-like protein or LDL receptor related protein-LRP) and scavenger receptor.

  (Lipoprotein metabolism) Triglycerides, cholesterol esters, and cholesterol absorbed into the small intestine do not dissolve in aqueous solvents, so they must be combined with the appropriate protein (apolipoprotein) so that they do not form huge oil droplets. . Lipoproteins resulting from binding undergo a type of metabolic action as they pass through the bloodstream and certain organs, particularly the liver.

  High density lipoprotein (HDL) is also synthesized in the liver and contains apoproteins A-1, A-2, C-1, and D. HDL collects cholesterol from peripheral tissues and blood vessels and returns it to the liver. LDL is taken up into endosomes by specific receptors on the cell surface, and endosomes fuse with lysosomes, where cholesterol esters are converted to free cholesterol. Apoproteins (including apoB-100) are digested to amino acids. The receptor protein is regenerated into the cell membrane.

  The free cholesterol formed by this process follows two fate. First, free cholesterol can migrate to the endoplasmic reticulum (ER) and inhibit the synthesis of HMG-CoA reductase, HMG-CoA reductase, and the synthesis of cell surface LDL receptors. In ER, cholesterol can also promote the degradation of HMG-CoA reductase. Free cholesterol can be converted by acyl CoA and acyl transferase (ACAT) into cholesterol esters to form oil droplets.

  ApoB is the main apolipoprotein of chylomicrons of very low density lipoprotein (VLDL, which carries most of plasma triglycerides) and low density lipoprotein (LDL, which carries most of plasma cholesterol). ApoB exists in human plasma as two isoforms, apoB-48 and apoB-100.

  ApoB-100 is a major physiological ligand for the LDL receptor. The ApoB precursor is 4563 amino acids, and the mature form of apoB-100 has 4536 amino acid residues. The LDL binding domain of ApoB-100 has been proposed to be located at amino acid residues 3129-3532. ApoB-100 is synthesized in the liver, is essential for the assembly of very low density lipoprotein VLDL, and is required for the production of apoB-100 for transporting triglycerides (TG) and cholesterol from the liver to other tissues. is there. ApoB-100 does not interchange between lipoprotein particles like other lipoproteins, and is found in IDL and LDL particles. After apolipoproteins A, E, and C are removed, apoB is taken up into VLDL by hepatocytes. ApoB-48 is present in chylomicron and plays an essential role in intestinal absorption of dietary fat. ApoB-48 is synthesized in the small intestine. ApoB-48 consists of 48% of the N-terminus of apoB-100 and is produced by post-transcriptional modification that changes codon 2153 (C → U) of apoB-100 mRNA. Such changes are due to the apoBEC-1b enzyme expressed in the intestine. By this change, a stop codon is generated instead of a glutamine codon, so that apoB-48 is expressed in the intestine instead of apoB-100 (apoB-100 is expressed in the liver).

  There is also strong evidence that plasma apoB levels can be a better indicator of coronary artery disease (CAD) risk than total or LDL cholesterol levels. Clinical studies have shown measured values of apoB in hypertriglyceridemia, hypercholesterolemia, and healthy subjects.

Molecular genetics of lipid metabolism in human and mutagenic model mice Elevated plasma levels of LDL and apoB are associated with increased risk of atherosclerosis and coronary heart disease, the major causes of death . ApoB is an essential component of LDL particles. In addition to the role of apoB in lipoprotein metabolism, apoB has been implicated in male infertility and fetal development. In addition, two quantitative trait loci that regulate plasma apoB levels have been discovered using transgenic mouse models. Future experiments will advance the identification of human orthologous genes that encode regulators of plasma apoB levels. These loci are potential therapeutic targets for human disorders characterized by changes in plasma apoB levels. Such disorders include non-apoB associated forms of hypobetalipoproteinemia and familial combined hyperlipidemia. Identification of the above locus reveals potential new pathways involved in the regulation of apoB secretion and may reveal new therapeutic sites for pharmacological treatment.

Disease and clinical pharmacology Familial combined hyperlipidemia (FCHL) is estimated to occur in 1 out of 10 Americans. FCHL can cause early onset of heart disease.
(Familial hypercholesterolemia (high level apoB)) A common genetic lipid metabolism disorder. Familial hypercholesterolemia is characterized by elevated serum TC associated with premature death due to xanthoma, tendon xanthoma, nodular xanthoma, rapid atherosclerosis, and myocardial infarction (MI). Familial hypercholesterolemia is caused by a lack or failure of cellular LDL receptors, delayed LDL clearance, elevated plasma LDL levels, and LDL cholesterol in macrophages and blood vessels covering joints and pressure points. Accumulation of.

  Atherosclerosis (atherosclerosis (high level apoB)) Atherosclerosis is an arterial wall of cholesterol and fat caused by disturbances in lipid transport and clearance from blood to cells and from cells to blood and liver It develops as a deposit on.

  Clinical studies have shown that elevated total cholesterol (TC), low density lipoprotein cholesterol (LDL-C) and apoB promote human atherosclerosis. Similarly, a reduction in high density lipoprotein cholesterol (HDL-C) levels is associated with the development of atherosclerosis.

ApoB may be a factor in the genetic cause of high cholesterol.
Coronary artery disease (CAD) risk (high level apoB) Cardiovascular diseases such as coronary heart disease and cerebral infarction cause death and disability. The main risk factors include age, gender, increased blood levels of low density lipoprotein cholesterol, decreased levels of high density lipoprotein cholesterol, smoking, hypertension, and diabetes. New risk factors include elevated lipoprotein (a), remnant lipoprotein, and C-reactive protein. Dietary intake, exercise, and genetics also affect the risk of cardiovascular disease. Hypertension and age are the main risk factors for cerebral infarction.

  Abetalipoproteinemia is a human genetic disorder characterized by the almost complete absence of apoB-containing lipoproteins in plasma and is caused by mutations in the gene for microsomal triglyceride transfer protein (MTP).

  (Model of human atherosclerosis (lipoprotein A transgenic mice)) From numerous studies, elevated plasma levels of lipoprotein (a) (Lp (a)) are the main cause of coronary heart disease (CHD). It has been proven to be an independent risk factor. However, current therapies have little or no effect on the level of apo (a) and the homology between apo (a) and plasminogen is a barrier to drug development. . Lp (a) particles are composed of apo (a) and apoB-100 proteins and are found only in primates and hedgehogs. The development of LPA transgenic mice requires the creation of animals that express human apoB and apo (a) genes in order to achieve LP (a) association. A mouse model of atherosclerosis will facilitate the study of factors that affect the progression and progression of the disease, as well as the development of therapeutic or prophylactic agents. There are several strategies for gene therapy. For example, a deleted gene or a non-functional gene may be replaced, or undesirable gene activity may be inhibited.

Lipid metabolism and models of atherosclerosis DNX Transgenic Sciences has demonstrated that both CETP / ApoB and ApoB transgenic mice produce atherosclerotic plaques.

  (ApoB-100 overexpression model) ApoB-100 transgenic mice express high levels of human apoB-100. As a result, the serum level of LDL cholesterol increases in the mouse. After a 6-month high-fat diet, the mice develop significant foam cell accumulation in the subendothelium and medial media, as well as cholesterol crystals and fibrotic lesions.

  (Cholesterol ester transfer protein overexpression model) ApoB-100 transgenic mice express CETP, which is a human enzyme, resulting in a marked reduction in serum levels of HDL cholesterol.

  (ApoB-100 and CETP overexpression model) ApoB-100 transgenic mice express both CETP and apoB-100, and as a result, the mice show a human-like serum HDL / LDL distribution. After a 6-month high-fat diet, the mice develop significant foam cell accumulation in the subendothelium and medial media, as well as cholesterol crystals and fibrotic lesions.

  (ApoB transgenic mouse (order model number: 1004-T (hemizygous), B6 (control))) This mouse expresses human apoB-100 at a high level, so that the serum level of LDL cholesterol in this mouse To rise. This mouse is useful in identifying and evaluating compounds that reduce elevated LDL cholesterol levels and risk of atherosclerosis. When fed with a high-fat cholesterol diet, the mice produce significant foam cell accumulation in the subendothelium and medial media and have atherosclerotic lesions that are significantly more complex than control animals.

  (Double transgenic mouse CETP / ApoB100 (order model number: 1007-TT)) This mouse expresses both CETP and apoB-100, resulting in a human-like serum HDL / LDL distribution. The mice are useful for evaluating compounds for treating hypercholesterolemia or HDL / LDL cholesterol imbalance to reduce the risk of developing atherosclerosis. When fed with a high fat, high cholesterol diet, the mice produce significant foam cell accumulation in the subendothelium and medial media and have significantly more complex atherosclerotic lesions than control animals.

ApoE gene knockout mice Homozygous apoE knockout mice show intense hypercholesterolemia, mainly due to elevated levels of VLDL and IDL due to poor lipoprotein clearance from plasma. The mice develop atherosclerotic lesions that progress with age and are similar to human lesions (Zhang et al., Science, Vol. 258, p. 46-71, 199).
2 years; Plump et al., Cell, 71, p. 343-353; Nakashima et al., Arterioscler Throm. Volume 14, p. 133-140, 1994; Reddick et al., Arterioscler Thromb. Volume 14, p. 141-147, 1994). This mouse is a promising model for studying the effects of diet and drugs on atherosclerosis.

Low density lipoprotein receptor (LDLR) mediates lipoprotein clearance from plasma via recognition of apoB and apoE on the surface of lipoprotein particles. Humans lacking or few LDL receptors have familial hypercholesterolemia and develop CHD early.

  (ApoE knockout mouse (order model number: APOE-M)) The apoE knockout mouse was created by disrupting the apoE gene by gene targeting in embryonic stem cells. ApoE, a glycoprotein, is a very low density lipoprotein (VLDL) synthesized in the liver and a chylomicron structural component synthesized in the intestine. ApoE is also a member of a subclass of high density lipoprotein (HDL) involved in the action of transporting cholesterol between cells. One of the most important roles of apoE is to mediate the binding of apoE-containing chylomicron and VLDL particles to low density lipoprotein (LDL) receptors with high affinity. This allows specific uptake of the particles by the liver, but this uptake is necessary for transport preventing the accumulation of cholesterol-rich remnants in the plasma. If the apoE gene is homozygously inactivated, the animal will lack apoE in the serum. Although this mouse appears to develop normally, it exhibits 5 times the plasma cholesterol of normal serum and spontaneously develops atherosclerotic lesions. This is similar to the disease of people with apoE gene variants that cannot bind to the LDL receptor and at risk of early onset of atherosclerosis and elevated plasma triglyceride and cholesterol levels. There are also suggestions that apoE is also involved in immune system regulation, nerve regeneration and muscle differentiation. ApoE knockout mice can be used to study the role of apoE in lipid metabolism, atherogenesis, and nerve injury, and to explore interventional therapies that modify the process of atherogenesis.

  (Substituted mouse targeting Apo4 (order model number: 001549-M)) ApoE is a plasma protein involved in cholesterol transport, and three human isoforms (E2, E3 and E4) are atherosclerosis and Related to Alzheimer's disease. By gene targeting of 129ES cells, the coding sequence of mouse apoE was replaced with human APOE4 so as not to destroy the mouse regulatory sequences. E4 isoforms appear in approximately 14% of the human population and are associated with elevated plasma cholesterol levels and increased risk of coronary artery disease. This Taconic substitution model for apoE4 has normal plasma cholesterol and triglyceride levels, but the amount of various lipoprotein particles in the plasma is varied. In this model, cholesterol-rich lipoprotein particles (VLDL) have a slow plasma clearance, which is only half that of the replacement model for apoE3. Similar to the apoE3 model, apoE4 mice have altered levels of lipoproteins in plasma, and when fed with an atherogenic diet, they produce atheroma plaques. However, atherosclerosis is more severe in the apoE4 model, plaques are larger than the apoE3 model, and cholesterol apoE and apoB-48 levels are twice that of the apoE3 model. This replacement model for taconic apoE4, along with replacement mice for apoE2 and apoE3, provides an excellent tool for in vivo studies of human apoE isoforms.

  (CETP transgenic mouse (order model number: 1003-T)) This animal expresses CETP which is an enzyme in human plasma, and as a result, the mouse has a sharp decrease in HDL cholesterol in the serum. This mouse can be useful in identifying and evaluating compounds that increase the level of HDL cholesterol to reduce the risk of developing atherosclerosis.

(Foreign gene / promoter: human apolipoprotein AI) This mouse produces mouse HDL cholesterol particles containing human apolipoprotein AI. Foreign gene expression continues in both males and females (Rockefeller University, New York City, USA, Biochemical Genetics and Metabolism Labora
tory)).

(Mouse model of β-lipoproteinemia) β-lipoproteinemia is a human hereditary disease characterized by almost no apoB-containing lipoproteins in plasma, and is a microsomal triglyceride transfer protein (MTP). ) Caused by gene mutation. The mouse MTP gene (Mtp) was knocked out using gene targeting. In heterozygous knockout mice (Mtt ^+/− ), MTP mRNA, protein, and activity levels were reduced by 50% in both liver and intestine. Recent studies using heterozygous MTP knockout mice suggest that apoB secretion is reduced by the fact that MTP levels are half normal in the liver. The hypothesis that the decrease in apoB secretion in situations where MTP levels are half normal is due to a decrease in the MTP: apoB ratio in the endoplasmic reticulum, which reduced the number of apoB-MTP interactions. It was made. If this hypothesis is correct, MTP levels are half normal, which means that the secretion of lipoproteins in a situation where apoB synthesis is half normal (because the ratio of MTP to apoB is not unusually low). It will have little effect and will cause overexpression of reduced lipoprotein secretion in the context of apoB overexpression (because of the lower ratio of MTP to apoB). To test this hypothesis, heterozygotes in the context of normal levels of apoB synthesis, half normal levels of apoB synthesis (heterozygous Apo deficiency), and high levels of apoB synthesis (overexpression of the foreign gene human apoB) The effect of MTP deficiency on the metabolism of apoB was investigated. Unexpectedly, half the normal levels of MTP reduced plasma apoB-100 levels to the same extent (˜25-35%) for each apoB synthesis level. Furthermore, apoB secretion from primary cultured hepatocytes was reduced to the same extent for each apoB synthesis level. Therefore, these results indicate that the MTP concentration in the endoplasmic reticulum rather than the MTP: apoB ratio is an important determinant of lipoprotein secretion. Finally, heterozygous apoB knockout mutations were found to have lower apoB-100 levels in plasma than heterozygous MTP knockout alleles. Consistent with this result, the accumulation of triglycerides in the liver was greater in heterozygous apoB knockout mice than in heterozygous MTP knockout mice. Liver specific Mtt knockout mice were also generated using tissue specific Cre / loxP recombination techniques. Inactivation of the Mttp gene in the liver significantly reduced very low density lipoprotein (VLDL) triglycerides, and both VLDL / low density lipoprotein (LDL) and high density lipoprotein cholesterol levels were greatly reduced. A histological study of liver-specific knockout mice revealed moderate hepatic steatosis. Currently, the hypothesis that accumulation of triglycerides in the liver makes the liver more susceptible to injury from secondary factors (eg, lipopolysaccharide) is being tested.

(Human apoB (apolipoprotein B) transgenic mice show that the apoB locus has a causative role in male infertility) The fertility of apoB (apolipoprotein B) (+/−) mice, Recorded during backcrossing and test mating (for C57BL / 6J mice). In female apoB (+/−) mice and wild type female mice, no obvious fertility problems were observed, as demonstrated by the presence of vaginal plugs in female mice. Despite normal mating of apoB (+/−) mice, only 40% of backcross second generation animals produced offspring within the 4-month study period. Of the animals from which the offspring were born, litters were from <50% of the proven crosses. In contrast, all wild type mice tested had (6/6 or 100%) fertility. These data suggest a genetic effect on the phenotype of sterility, since a small number of heterozygous males were not infertile. In vivo fertilization was markedly reduced in male apoB (+/−) mice. 74% of the examined eggs were fertilized by sperm from wild type mice, whereas only 3% of the examined eggs were fertilized by sperm from apoB (+/−) mice. The number of sperm in apoB (+/−) mice was slightly but significantly reduced compared to controls. However, the percentage (%) of motile sperm was significantly reduced in apoB (+/−) mice compared to wild type control mice. In controls, 20% of apoB (+/−) mouse spermatozoa (ie 4.9% of the first 20% motile spermatozoa) remained motile after 6 hours of incubation, whereas in controls 45% of the motile spermatozoa (ie 33.6% of the first 69.5%) remained motile after the same time. In vitro fertilization was attempted 3 times using apoB (+/−) mice, but fertilized eggs were not obtained, whereas wild-type control mice showed a fertilization rate of 53%. However, apoB (+/−) mouse spermatozoa fertilized 84% of the eggs once the zona pellucida was removed. It was observed that many sperm from apoB (+/−) mice were bound to eggs with intact zona pellucida. However, these spermatozoa lose their motility when observed 4-6 hours after binding, and sperm from apoB (+/−) mice cannot penetrate the zona pellucida, but the interaction between sperm and egg. Was shown not to be direct. Sperm binding to egg cells without zona pellucida was not normal. In apoB (+/−) mice, sperm binding does not weaken even after the pronuclei are clearly formed, suggesting that the surface interaction between sperm and egg is abnormal due to apoB deficiency. It was.

  As a result of knocking out the mouse apoB gene, homozygotes resulted in embryonic lethality, and heterozygotes were protected from dietary hypercholesterolemia and abnormal growth of mice.

  (Model of insulin resistance, dyslipidemia and human apoB overexpression) It has been shown that a large amount of VLDL particles are assembled and secreted in the liver of apoB mice.

[Treatment of type 2 diabetes using iRNA]
(Introduction) Regulation of gluconeogenesis in the liver is an important process in the regulation of blood glucose levels. Pathological changes in glucose production in the liver are a major feature of type 2 diabetes. For example, fasting blood glucose found in patients with type 2 diabetes reflects the loss of inhibition of gluconeogenesis and glycogenolysis in the liver due to the insulin resistance underlying the disease. Extreme insulin resistance status can be observed, for example, in liver-specific insulin receptor knockout (“LIRKO”) mice. In this mouse, the expression of two rate-limiting enzymes of gluconeogenesis, phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase catalytic subunit (G6Pase) are elevated. Insulin is known to repress both PEPCK and G6Pase gene expression at the transcriptional level, but only a small part of the signal transduction involved in regulation of G6Pase and PEPCK gene expression by insulin is understood. PEPCK is involved in the very early stages of gluconeogenesis in the liver (synthesis of phosphoenolpyruvate from oxaloacetate), while G6Pase cleaves glucose-6-phosphate, the final stage of both gluconeogenesis and glycogenolysis To catalyze the reaction of phosphoric acid and free glucose. Free glucose is then delivered to the bloodstream.

  Pharmacological interventions in regulating the expression of PEPCK and G6Pase can be used to treat metabolic disorders associated with diabetes. In patients with type 2 diabetes, glucose production in the liver can be reduced by reducing PEPCK and G6Pase enzyme activity using iRNA.

(Target of iRNA)
Glucose-6-phosphatase (G6Pase)
G6Pase mRNA is expressed mainly in the liver and kidney, and in small amounts in the small intestine. Membrane-bound G6Pase is associated with the endoplasmic reticulum. Low activity has also been detected in skeletal muscle and astrocytes.

  G6Pase catalyzes the final steps of gluconeogenesis and glycogenolysis. The activity of this enzyme is several times higher in diabetic animals, and perhaps the same in diabetic humans. Fasting and diabetes increase G6Pase activity in the liver by 2-3 fold and G6Pase mRNA increases by 2-4 fold.

Phosphoenolpyruvate carboxykinase (PEPCK)
Overexpression of PEPCK in mice reveals symptoms of type 2 diabetes. Overexpression of PEPCK increases G6Pase mRNA and suppresses insulin to selectively reduce insulin receptor substrate (IRS) -2 protein, decrease phosphatidylinositol 3-kinase activity, and gene expression involved in gluconeogenesis Metabolic pattern that leads to a decrease in

Materials and Methods Animals: BKS. With a point mutation in the leptin receptor gene. Cg-m + / + Lepr db mice are used to examine the effect of iRNA on the targets listed above.

  BKS. Cg-m + / + Lepr db is available from the Jackson Laboratory (stock number 000642). The animal becomes obese at 3-4 weeks of age, plasma insulin rises at 10-14 days, blood sugar rises at 4-8 weeks, and blood sugar rises without restriction. Even if insulin is given from the outside, the glucose level in the blood cannot be controlled, and the gluconeogenic action is enhanced.

The following number of animals (male,> 12 weeks of age) may be tested with the following iRNA:
PEPCK, 2 sequences, 5 animals per sequence G6Pase, 2 sequences, 5 animals per sequence, 1 non-specific sequence, 5 animals 1 control group (injection only, no siRNA), animal 5 1 control group (no injection, no siRNA), 5 animals Reagents: As a necessary reagent, ideally Glucometer for quantification of glucose
Elite® XL (Bayer, Pittsburgh, PA, USA), and insulin quantification include insulin radioimmunoassay (RIA) kit (Amersham, Piscataway, NJ, USA).

Assay:
Enzyme activity is measured using the G6P enzyme assay and the PEPCK enzyme assay. Northern blotting is used to detect G6P and PEPCK mRNA levels. G6P and PEPCK protein levels are detected using techniques that use antibodies (eg, immunoblotting, immunofluorescence, etc.). Glycogen staining is used to detect liver glycogen levels. Perform histological analysis to analyze the tissue.

Genetic information:
G6Pase
GenBank® number: NM — 008061, mouse (mus musculus) glucose-6-phosphatase, catalytic (G6pc), mRNA . 2259, ORF 83. . 1156;
GenBank® number: U00445, mouse (Mus musculus) glucose-6-phosphatase mRNA, full length cds . 2259, ORF 83. . 1156
GenBank (registered trademark) number: BC013448
PEPCK
GenBank® number: NM — 010444, mouse (Mus musculus) phosphoenolpyruvate carboxykinase 1, cytoplasm (Pck1), mRNA . 2618, ORF 141. . 2009
iRNA administration:
The iRNA corresponding to the above gene may be administered to the mouse by hydrodynamic injection. One group of control animals may be treated with metformin as a positive control for reducing liver glucose levels.

(Experiment protocol)
Mice should be kept in a lighted facility from 7 am to 7 pm. The mouse may be allowed to freely eat food from 7 pm to 7 am and fast from 7 am to 7 pm.
Day 0: 7 pm: About 100 μl of blood may be drawn from the tail. The serum may be isolated and glucose, insulin, HbA1c (EDTA blood), glucagon, FFA, lactic acid, corticosterone, and serum triglyceride may be measured.
Day 1-7: Blood glucose may be measured every day at 8 am and 6 pm (approximately 3-5 μl; measured with a blood glucose meter (Haemoglucometer))
Day 8: Blood glucose may be measured daily at 8am and 6pm. iRNA may be injected between 10 am and 2 pm.
Day 9-20: Blood glucose may be measured daily at 8 am and 6 pm.
Day 21: The mice should be sacrificed after fasting for 10 hours. Blood may be isolated and glucose, insulin, HbA1c (EDTA blood), glucagon, FFA, lactic acid, corticosterone, and serum triglyceride may be measured. Liver tissue may be isolated and subjected to histological analysis, protein assay, RNA assay, glycogen quantification, and enzyme assay.

Inhibition by glucose-6-phosphatase iRNA in vivo
Using iRNA targeting the glucose-6-phosphatase (G6P) gene, i
The effect of G6P expression inhibition on glucose metabolism in vivo was examined.

  In vivo analysis of enzymes for glucose production in the liver was performed using 10 week old female mice (strain is BKS.Cg-m + / + Lepr db, Jackson Laboratory). Mice were raised in a lighted facility from 6:30 am to 6:30 pm. Mice were fed (free consumption) at night and fasted during the day.

  On the first day, approximately 100 μl of blood was collected from the test animals by puncturing the retroorbital venous plexus. On days 1-7, glucose in blood (about 3-5 μl) obtained from the tail vein was measured using a glucose meter (Elite (registered trademark) XL, Bayer). For blood glucose, samples were taken daily at 8 am and 6 pm.

  At approximately 2 pm on day 7, GL3 plasmid (10 μg) and siRNA (100 μg G6Pase-specific siRNA, non-specific Renilla siRNA, or siRNA free control) were simultaneously given to the animals by hydrodynamic injection. Delivered.

  On day 8, GL3 expression was analyzed and imaged by injecting luciferin (3 mg) after anesthesia with avertin ™. This was performed as a control to demonstrate successful hydrodynamic delivery.

On days 8-10, glucose in blood (about 3-5 μl) obtained from the tail vein was measured using a glucose meter (Elite (registered trademark) XL, Bayer).
On day 10, the mice were sacrificed after 10 hours of fasting. Blood and liver were isolated from sacrificed animals.

  Table 6 shows in blood for mice injected with GL3 plasmid and G6Pase iRNA (G6P4), or GL3 plasmid and non-specific Renilla iRNA (RL), or mice injected with GL3 plasmid without iRNA (no). The glucose levels (mg / dl) are listed. The day when the nucleic acid was injected is shaded.

Table 7 shows mice injected with GL3 plasmid and G6Pase iRNA (G6P4) or GL3 plasmid and non-specific Renilla iRNA (RL), mice injected with GL3 plasmid without iRNA (no), or injected The mean blood glucose levels (mg / dl) on days 1-6 or 7 are listed for mice that did not or failed injection.

  A, B, and C in FIG. 6 show blood levels on day 1-6 or 7 of mice injected without control or siRNA, mice injected with G6Pase RNA, or mice not injected, respectively. It is a graph which shows a glucose level. FIG. 7 is a graph showing the mean blood glucose levels of mice injected with G6Pase RNA (solid line), as well as mice injected without nonspecific Renilla iRNA (RL) or iRNA (no) (dotted line). .

  Table 8 lists mean blood glucose levels for mice injected with G6Pase RNA, or mice injected with non-specific Renilla iRNA (RL) and mice not injected with iRNA.

[Sequence of selected palindromic structure]
Tables 9-14 below show selected palindrome derived from the following genes: human ApoB, human glucose-6-phosphatase, rat glucose-6-phosphatase, β-catenin, and hepatitis C virus (HCV). An array of structures is presented.

In the table, SEQ ID NO: represents a sequence number, # represents a matching number, and B represents a matching base in the center.

In the table, SEQ ID NO: represents a sequence number.

In the table, SEQ ID NO: represents a sequence number.

In the table, SEQ ID NO: represents a sequence number.

In the table, SEQ ID NO: represents a sequence number.

In the table, SEQ ID NO: represents a sequence number.

In the table, SEQ ID NO: represents a sequence number.

In the table, SEQ ID NO: represents a sequence number.

  [SiRNA reduces mRNA levels in vivo] Male CMV-Luc mice (8-10 weeks old) obtained from Xenogen (Cranberry, NJ, USA) were treated with cholesterol-conjugated siRNA (see Table 17). Was administered.

  Animals (tail vein) were injected with 200-250 μl of test solution containing buffer or siRNA solution. A buffer solution was administered to the first group, and a cholesterol complex siRNA (ALN-3001) was administered to the second group at a dose of 50 mg / kg body weight. At 22 hours after injection, the animals were sacrificed and the livers were collected. The organs were rapidly frozen in dry ice and then crushed with a mortar and pestle.

  For analysis of luciferase mRNA (QuantiGene (trade name, Genospectra, Inc., Fremont, Calif., USA)), about 10 mg tissue powder was resuspended in tissue lysis buffer and manufactured Lysate samples were processed in triplicate using luciferase or GAPDH specific probes (designed with ProbeDesigner software (trade name, Genospectra, Inc., Fremont, Calif.)). Hybridized, processed for luminescence analysis, values for luciferase were normalized to GAPDH, and average values were plotted with error bars (corresponding to standard deviation of luciferase measurements).

  The results showed that the level of luciferase RNA in animals injected with cholesterol-conjugated siRNA was reduced by about 70% compared to animals injected with buffer (FIGS. 8A and 8B).

In Vitro Activity HeLa cells expressing luciferase were transfected with each siRNA listed in Table 18. ALN-1000 siRNA most efficiently reduced luciferase mRNA levels (~ 0.6 nM siRNA reduced mRNA levels to ~ 65% of original expression levels, 1.0 nM siRNA reduced mRNA levels to original expression levels) Reduced to ~ 20%). ALN-3001 siRNA was least effective (˜0.6 nM siRNA had little effect on mRNA levels, and 1.0 nM siRNA reduced mRNA levels to ˜40% of the original expression level).

Pharmacokinetics / biodistribution Pharmacokinetic analysis was performed in mice and rats. The test siRNA molecules were radiolabeled with ³³ P antisense strands by splint ligation. Labeled siRNA (50 mg / kg) was administered by tail vein injection and siRNA
The plasma levels of were measured by scintillation measurements periodically over a 24 hour period. Cholesterol complexed siRNA (ALN-3001) was found to circulate in mouse plasma for a longer time than uncomplexed siRNA (ALN-3000) (FIG. 9). From the RNAse protection assay, cholesterol-conjugated siRNA (ALN-3001) is detectable in mouse plasma 12 hours after injection, and unconjugated siRNA (ALN-3000) is detected in mouse plasma within 2 hours after injection. It was shown that it could not be detected. Similar results were observed in rats.

  At various time points (0.08-24 hours) after siRNA injection, mouse livers were collected and siRNA localized in the liver was quantified. Over the period examined, the amount of cholesterol complexed siRNA (ALN-3001) detected in the liver ranged from 14.3 to 3.55% of the total dose administered to mice. The amount of uncomplexed siRNA (ALN-3000) detected in the liver was lower and ranged from 3.91 to 1.75% of the total dose administered (Figure 10).

Detection of siRNA in various tissues Various tissues and organs (fat, heart, kidney, liver, and spleen) were collected from 2 CMV-Luc mice 22 hours after injection with 50 mg / kg ALN-3001 did. The antisense strand of siRNA was detected by RNAse protection assay. The liver contains the highest concentration of siRNA (˜8-10 μg siRNA per gram of tissue) and lower amounts in the spleen, heart and kidney (˜2-7 μg siRNA per gram of tissue) and fat The tissue contained the least amount of siRNA (<˜1 μg siRNA per gram of tissue) (FIG. 11).

Detection of glucose-6-phosphatase siRNA by RNAse protection assay Balbc mice were treated with U / U, 3′C / U, or 3′C / 3′C siRNA targeting glucose-6-phosphatase (G6Pase) (4 mg / kg) was injected (see Table 19). Administration was performed by hydrodynamic tail vein injection (hd) or non-hydrodynamic tail vein injection (iv) followed by detection of siRNA in the liver by RNAse protection assay.

  The uncomplexed siRNA delivered by hd (U / U) was detected by 15 minutes after injection (15 ′) (early measurement time point) and could be detected in the liver even 18 hours after injection (18 h). (FIG. 12).

Standard iv delivery delivered the highest concentration of 3′C / 3′C siRNA (bischolesterol complex) in the liver 1 hour after injection (1 h) (3′C, a monocholesterol complex). / Comparison with 3′U siRNA). Even 18 hours after injection (18 h), 3′C / 3′C siRNA and 3′C / U siRNA were still detectable in the liver, with higher levels in the bis complex compared to the monocomplex (FIG. 13).

[SiRNA reduces protein activity levels in vivo]
Male CMV-Luc mice were bred at Charles River Laboratories, Inc., Wilmington, Massachusetts, USA. Mice (6-7 weeks old) were administered cholesterol complex siRNA (see Tables 20-22).

  Animals (tail vein) were injected with 200-250 μl of test solution containing buffer or siRNA solution. A buffer solution was administered to the first group, and a cholesterol complex siRNA (ALN-3001) was administered to the second group at a dose of 75 mg / kg body weight. The animals were sacrificed 19-22 hours after injection and the livers were collected. The organs were rapidly frozen in dry ice and then crushed with a mortar and pestle.

To analyze luciferase mRNA, approximately 50 mg of tissue powder was resuspended in 0.5 ml of cell lysis buffer (Promega, Inc.). The sample was vortexed vigorously for 3 minutes, quickly frozen in liquid nitrogen and then thawed in a 37 ° C. hot water bath. This process step was repeated two more times. After final melting, the sample was vortexed for 3 minutes. Insoluble matter was removed by centrifuging for 4 minutes at full speed in a microcentrifuge (4 degrees). The supernatant was collected. 20-25 μl of each sample was pipetted into the assay tube in triplicate and left to reach room temperature. To measure activity, add 200 μl of “Bright Glow” assay reagent (Promega Incorporated) to the test sample and program the luminometer (Berthold Inc.) to record luminescence over 10 seconds did.

  In order to measure the total protein, the supernatant sample was diluted 30-fold, and 5 μl samples were measured in triplicate by a protein microassay (Bio-Rad) by Bradford method. Bovine serum albumin was used to generate a standard curve.

  Luciferase activity was determined as the average measured by the luminometer normalized to the average protein content. The average of the values normalized for the buffer treatment group and the siRNA treatment group of each experiment was calculated. For each experiment, the normalized Luc level of the siRNA treatment group is expressed as a percentage of the buffer control group (100%). Error bars indicate standard deviation.

  The results showed that the level of luciferase activity in animals injected with cholesterol-conjugated siRNA was reduced by approximately 55% compared to animals injected with buffer (FIG. 14).

[Other Embodiments]
Although the present invention has been particularly shown and described with respect to preferred embodiments, it will be understood by those skilled in the art that the present invention and forms thereof are within the scope of the invention covered by the appended claims. Various changes can be made to the details.

Claims (6)

An iRNA agent comprising a sense strand and an antisense strand, wherein one or more ribose substitution modification subunits (RRMS) comprising a ligand targeting the liver are incorporated into the sense strand, and the antisense strand comprises at least two have a phosphorothioate modification, the RRMS is hydroxyproline down,
The RRMS, said a 3 'end or near the sense strand 1 is disposed within or 3,
The iRNA targets a gene expressed in the liver selected from the group consisting of apoB gene, β-catenin gene, glucose-6-phosphatase gene, hepatitis C virus gene, and hepatitis B virus gene. to, iRNA agent. The iRNA agent of claim 1, wherein the sense strand and the antisense strand are independently 17-25 nucleotides in length. The iRNA agent of claim 1 or 2 , wherein the iRNA agent comprises a 17-23 pair long double stranded portion. The iRNA agent according to any one of claims 1 to 3 , wherein the iRNA agent comprises at least one 3 'overhang having a length of 2 to 3 nucleotides. The iRNA agent according to any one of claims 1 to 4 , wherein the ligand changes the distribution, target directivity, or life span of the iRNA agent into which the ligand is incorporated. The ligand, N - acetyl galactosamine or cholesterol, iRNA agent according to any one of claims 1-5.

Images