JP5686284B2 - Composition and therapeutic agent for treatment of central myelination dysfunction - Google Patents

Description

  The present invention relates to a composition and a therapeutic agent for treating central myelination dysfunction caused by hyperfunction of PLP1 protein.

  Congenital cerebral white matter dysplasia is a group of diseases in which myelination of white matter in the central nervous system including the cerebrum is congenitally incomplete (hypoplasia) due to genetic factors. Congenital cerebral white matter dysplasia is caused by genetic abnormalities such as components of the myelin sheath and factors necessary for myelination, resulting in extensive and significant reduction or cessation of myelination of the central nervous system. Features.

  Pelizaeus-Merzbacher disease (hereinafter referred to as PMD), a congenital cerebral white matter dysplasia, is a disease reported by Pelizius in 1855 and Merzbacher in 1910 (non-patented) Reference 1).

  PMD is a dysmyelinating disease and is characterized by extensive myelination of the cerebral white matter. Proteolipid protein 1 (PLP1) gene present on the X chromosome is known as one of the causes of this myelination failure. Abnormalities such as duplication, mutation and deletion of the PLP1 gene and other abnormalities of unknown cause cause myelination dysfunction due to oligodendrocytes, which are glial cells specific to the central nerve, and develop PMD (for example, Non-patent documents 1 and 2).

  PMD patients develop psychiatric disorders that are strong in mind, language, and movement. Specific illnesses include head tremor, nystagmus, wobbling during walking, language disorders, optic nerve atrophy, progressive movement disorders, psychomotor developmental regression, etc. Is seen. In particular, when it develops in early childhood, it becomes severe and there are strong disabilities in mind, language, and movement.

  The incidence of PMD is, in medical books, for example, ALD (adrenoleukodystrophy) as well as MLD (leucodystrophy), although it is said that there is a considerable number when it actually starts communication between patients Therefore, at least in Japan, the number of potential patients is almost the same as ALD.

Duncan ID, Journal of the Neurological Science, 228: 204-205 (2005) Inoue K, Neurogenetics, 6 (1): 1-16 (2005)

  However, to date, there is no effective therapeutic agent and method for PMD, and only symptomatic treatment has been performed.

  This invention is made | formed in view of this problem, Comprising: It aims at providing the effective therapeutic composition and therapeutic agent with respect to the central nerve myelination dysfunction caused by the hyperfunction of PLP1 protein.

  The therapeutic composition according to the first aspect of the present invention is a therapeutic composition for dysplasia of the central nerve myelination caused by hyperfunction of PLP1 protein, and contains active Cdk5.

  The therapeutic composition according to the second aspect of the present invention is a therapeutic composition for central nerve myelination caused by enhancement of PLP1 protein function, comprising a Cdk5 activating protein. To do.

  The Cdk5 activating protein is preferably p35.

  The therapeutic composition according to the third aspect of the present invention is a therapeutic composition for central nerve myelination dysplasia caused by enhancement of the function of PLP1 protein, and is characterized by containing paxillin.

  Moreover, the therapeutic agent for central nerve myelination dysfunction according to the fourth aspect of the present invention is characterized by containing the therapeutic composition according to any one of claims 1 to 4.

  The central nerve myelination dysfunction is preferably Pelizaeus-Merzbach disease (PMD).

  ADVANTAGE OF THE INVENTION According to this invention, the drug target molecule | numerator with respect to central nerve myelination dysfunction produced by the hyperfunction of PLP1 protein becomes clear for the first time, and the effective therapeutic composition and therapeutic agent with respect to the central nerve myelination dysfunction are obtained. Therefore, patients suffering from intractable central nerve myelination can maintain a high quality of life in the process of growing from children to adults. The physical, mental, and economic burden can be reduced by greatly shortening the time spent for long-term illness and hospitalization or hospital visits. Social benefits from the reduction of human and physical health resources are also significant. The advantages of the present invention are immeasurable.

It is a fluorescence photograph figure which shows that myelination differentiation inhibition by PLP1 gene transfer is reversed by Cdk5. It is statistical data which shows that inhibition of myelin differentiation by PLP1 gene introduction is reversed by Cdk5. It is a figure which shows the western blotting by which Cdk5 reverses the myelination differentiation inhibition by PLP1 gene transfer. It is statistical data which shows that inhibition of myelination by PLP1 gene introduction is reversed by Cdk5 activation molecule p35. It is statistical data which shows that myxin differentiation inhibition by PLP1 gene introduction is reversed by Paxillin which is a Cdk5 downstream factor.

  Hereinafter, embodiments of the present invention will be specifically described with reference to the accompanying drawings. However, the embodiments are for facilitating understanding of the principle of the present invention, and the scope of the present invention is as follows. The present invention is not limited to the embodiments, and other embodiments in which those skilled in the art appropriately replace the configurations of the following embodiments are also included in the scope of the present invention.

  The composition for treatment of central nerve myelination dysfunction caused by enhancement of PLP1 protein function according to the present embodiment contains active Cdk5 (Cyclin-dependent kinase 5, cyclin-dependent kinase 5). The active Cdk5 is specifically Myr-Cdk5.

  Cdk5 is a protein kinase that functions in the mammalian brain. Unlike typical Cdk (cyclin-dependent kinase), which controls cell growth, it is mainly active in neurons that have stopped dividing cells. Is seen.

  Moreover, the composition for treatment of central nerve myelination dysfunction caused by the hyperfunction of PLP1 protein according to this embodiment contains a Cdk5 activating protein. Examples of the Cdk5 activating protein include p35 and p39.

  Cdk5 is activated by an activation subunit specifically expressed in the brain, p35 or p39, which is different from cyclin, and functions throughout the life of mammals from the formation of the brain to death, and performs various neural activities. Adjust. When Cdk5 is knocked out, the layer structure of the brain is reversed or the memory cannot be erased.

  Moreover, the composition for treatment of central nerve myelination dysfunction caused by the enhancement of PLP1 protein function according to the present embodiment contains paxillin. Coexpression of paxillin, a downstream factor of Cdk5, also restores myelination failure induced by PLP1.

  The therapeutic agent for central nerve myelination dysplasia according to the present embodiment contains the above-described therapeutic composition. Any of the above-mentioned therapeutic compositions for central nerve myelination, or a combination of two or more thereof, is a pharmaceutically acceptable carrier, diluent, vaginal formulation and the like well known to those skilled in the art The dosage form can be formed using additives for the preparation. The form is not particularly specified as long as it is a dosage form suitable for treatment. For example, as an oral preparation, tablet, capsule, granule, powder, syrup, intestinal solvent, sustained-release capsule, cashew, chewing tablet, drop, pill Alternatively, it may be formulated into liquid preparations for internal use, confectionery tablets, sustained release tablets, sustained release granules and the like. Moreover, it may be formulated into an injection, and examples thereof include solution injections, emulsion injections, and solid injections. In the therapeutic agent according to the present embodiment, a different pharmaceutical composition can be blended in addition to the additive for pharmaceutical preparation.

  The disease to which the therapeutic agent for central nerve myelination dysplasia is administered is not limited as long as it is a disease in which myelination is dysplastic in the central nerve due to hyperfunction of PLP1 protein in humans or non-human vertebrates. PMD. Here, enhancement of the function of the PLP1 protein may be due to overexpression of the PLP1 protein, or may be due to enhancement of the activity of the protein itself.

  PMD has a part in common with MLD, Krabbe disease, etc., which are symptomatically the same leukodystrophy, and has six types (type I classic type, type II congenital type, type III, I and II intermediate types, type IV adults, type V), and types that frequently occur are type I and type II.

  Type I classic is characterized by white matter and extensive myelination that develops within the first few months of life and pathologically leaves tiger-like medulla. Slow characteristic nystagmus appears in the first few months, followed by motor development delay, intention tremor, ataxia, chorea-like or acetose-like involuntary movement. Often accompanied by spastic paralysis of the lower limbs, optic atrophy, dysarthria, and convulsions may also be observed. The degree of motor dysfunction is stronger than intelligence impairment.

  Type II congenital type develops early in life and shows a more severe clinical course than classical type. Pathologically, the white matter myelin of the entire brain is almost completely deficient, hardly changes even with aging, and passes without being formed until death. Slight digestion is observed only in the cranial nerve root and spinal nerve.

  The therapeutic agent according to this embodiment is effective for any of the above-mentioned disease types. The administration method and dose of the therapeutic agent for central nerve myelination dysplasia to a patient can be appropriately selected by those skilled in the art according to the purpose of administration, dosage form, patient condition and the like.

  In addition, the therapeutic agent according to the present embodiment is effective even for central nerve myelination dysfunction caused by any gene abnormality of duplication, mutation, and deletion of the PLP1 gene.

  In this example, first, oligodendrocytes causing myelination dysplasia were produced by overexpressing PLP1 as a model of a disease in which myelin dysplasia occurs in the central nerve due to enhancement of PLP1 protein function. Oligodendrocytes play a role in protecting nerve axons by forming a myelin sheath around neurons and increasing the conduction efficiency of nerve electrical signals.

  FBD-102b, a cell line of oligodendrocyte progenitor cells that are mouse brain myelinating cells, was used. Differentiation (differentiation from oligodendrocyte progenitor cells to mature oligodendrocytes with myelin processes) was induced using serum-free FBD-102b (J. Cell Sci. 2007, Vol.120, pp4355-4366) . When differentiated, FBD-102b cells form a myelinous membrane-derived process several times as long as the cell body (morphological change), accompanied by the expression of myelin-specific protein (biochemical change). Differentiated into dendrocytes.

On the other hand, PCR amplification was performed with ExTaqpolymerase (Takara Bio) using the human PLP1 gene FLJ45458 (TOYOBO) as a template and an oligonucleotide having the following sequence as a primer.
Primer S: ccgggatccatgggcttgttagagtgctgtgcaagatgtctg (SEQ ID NO: 1)
Primer AS: ccgggatcctcagaacttggtgcctcggcccatg (SEQ ID NO: 2)
RetroX-IRES-ZsGreen1 (Takara Bio, Kyoto, Japan) was used as a control vector, and the amplified human PLP1 gene was inserted downstream of IRES of pRetroX-IRES-ZsGreen1. Therefore, pRetroX-IRES-PLP1-ZsGreen1 expresses PLP1 and the fluorescent protein ZsGreen simultaneously. This was transfected into the oligodendrocytes obtained as described above, and PLP1 was overexpressed in FBD-102b cells to reproduce the most overlapping form of PMD. As shown in FIG. 1, FIG. 2, and FIG. 3, dysmyelination, that is, poor differentiation, was observed. That is, the formation / differentiation of myelin membrane dependent on PLP1 could be reproduced in vitro. PRetroX-IRES-ZsGreen1 contains a green fluorescent protein (GFP) gene, and cells expressing PLP1 emit green fluorescence.

  As a control, non-recombinant pRetroX-IRES-ZsGreen1 into which no PLP1 gene was introduced was transfected into oligodendrocytes in the same manner as described above.

  Myr-Cdk5 is an active Cdk5 (Cell 2007, Vol. 129, pp1065-1079) in which an amino acid sequence to be myristoylated is added to the N-terminus of human Cdk5. Addgene (Cambridge, MA, USA) From pWZL-Myr-FLAG-Cdk5 plasmid. This was transfected into oligodendrocytes as described above.

  Furthermore, pRetroX-IRES-PLP1-ZsGreen1 and pWZL-Myr-FLAG-Cdk5 were transfected into oligodendrocytes as described above.

  Each oligodendrocyte was fixed with 4% paraformaldehyde, and the myelin sheath was labeled with an anti-MBP antibody (Millipore, catalog number AB15542, diluted 100-fold) that recognizes MBP, a marker of myelination. As a secondary antibody, Alexa Fluor594 anti-mouse IgG (Molecular Probes, catalog number A-11005, diluted 500 times) was used. The results are shown in FIG.

  The transgenes in the row in the figure are, in order from the left, control vector only, pRetroX-IRES-PLP1-ZsGreen1, control vector and pWZL-Myr-FLAG-Cdk5, pRetroX-IRES-PLP1-ZsGreen1 and pWZL-Myr-FLAG-Cdk5 It is. As an index of morphological differentiation, according to the rules of this JCS paper, “more than 5 myelin processes are taken out from the cell body, and further, there are processes branched from the myelin process”. The vertical column in the figure shows the differentiation induction minus and plus, and the horizontal line in the figure shows the introduced gene. Gene transfer into cells was performed using LipofectaminePlus reagent (Invitrogen, Carlsbad, CA, USA). As shown in the green fluorescence photograph, differentiation was inhibited when the PLP1 gene was introduced into FBD-102b cells, and differentiation ability was restored when the PLP1 gene and Cdk5 were co-introduced. That is, when co-expression of active (myr, membrane-bound) Cdk5 kinase, it was found that the dysmyelination induced by PLP1 was recovered both morphologically and biochemically.

  FIG. 2 shows the statistical data of FIG. P <0.01 and the maternal number n is 90 cells or more. As shown in FIG. 2, it is understood that inhibition of myelination by PLP1 gene introduction is reversed by Cdk5.

  Next, myelin differentiation was examined at the biochemical level by confirming the expression of myelin basic protein (MBP) by Western blot. The same gene transfer as in FIG. 1 was performed, and MBP antibody was used at a 1: 100 dilution of SMI94 from Covance (Emeryville, CA, USA). MBP is a myelin marker protein. In addition, ZsGreen antibody was used to confirm the expression of the control protein. This used Takara Bio's Z2474N at 1: 1000 dilution. FIG. 3 is a diagram showing a Western blot in which myelination differentiation inhibition by PLP1 gene introduction is reversed by Cdk5. As shown in FIG. 3, MBP expression in FBD-102b cells was inhibited when the PLP1 gene was introduced, and MBP expression was restored when the PLP1 gene and Cdk5 were co-introduced. The expression of the fluorescent protein ZsGreen between experiments is constant.

  Next, in place of the Cdk5 gene of FIG. 1, p35, which is a Cdk5 activator in oligodendrocyte precursor cells, was introduced (J. Cell Sci. 2007, Vol. 120, pp4355-4366). Mouse Cdk5 activator p35 was amplified from the total RNA of FBD-102b cells by RT-PCR and used for gene transfer.

  FIG. 4 is statistical data showing that inhibition of myelin differentiation by PLP1 gene introduction is reversed by Cdk5-activating molecule p35. Here, P <0.01, and the maternal number n is 90 cells or more. As shown in FIG. 4, when the PLP1 gene was introduced, differentiation of FBD-102b cells was inhibited, and when PLP1 gene and p35 were co-introduced, differentiation was recovered. That is, it was found that even when p35, which is an activator of Cdk5, was coexpressed, the myelination failure induced by PLP1 was recovered. Note that the titles in the figure are in the same order as in FIG.

  Next, Paxillin, which is a downstream factor of Cdk5 in oligodendrocyte progenitor cells, was introduced in place of the Cdk5 gene in FIG. 1 (J. Cell Sci. 2007, Vol. 120, pp4355-4366). Mouse Paxillin was isolated from the total RNA of N1E-115 cells by RT-PCR to prepare a pCMV-paxillin plasmid (Exp. CellRes. 2006, Vol.312, pp2954-2961).

  FIG. 5 is statistical data showing that inhibition of myelination by PLP1 gene introduction is reversed by Paxillin, a downstream factor of Cdk5. Here, P <0.01, and the maternal number n is 90 cells or more. As shown in FIG. 5, when the PLP1 gene was introduced, differentiation of FBD-102b cells was inhibited, and when PLP1 gene and Paxillin were co-introduced, differentiation was recovered. That is, it was found that even when paxillin, which is a downstream factor of Cdk5, was coexpressed, the myelination failure induced by PLP1 was recovered. Note that the titles in the figure are in the same order as in FIG.

  Since an effective therapeutic agent for PMD that is an intractable disease is obtained, a large number of patients with intractable disease can be rescued.

  Sequence number 1-2: Primer

Claims (6)

A composition for treating central myelination dysplasia caused by hyperfunction of PLP1 protein, comprising:
A therapeutic composition containing active Cdk5. A composition for treating central myelination dysplasia caused by hyperfunction of PLP1 protein, comprising:
A therapeutic composition containing a Cdk5 activating protein.   The therapeutic composition according to claim 2, wherein the Cdk5 activating protein is p35. A composition for treating central myelination dysplasia caused by hyperfunction of PLP1 protein, comprising:
A therapeutic composition containing paxillin.   A therapeutic agent for dysplasia of the central nerve myelin, comprising the therapeutic composition according to any one of claims 1 to 4.   The therapeutic agent for central nerve myelination dysfunction according to claim 5, wherein the central nerve myelination dysplasia is Pelizaeus-Merzbach disease (PMD).