KR20220122379A - Pharmaceutical composition for treating or improving neurogenic bladder comprising stem cells expressing brain-derived neurotrophic factors - Google Patents
Pharmaceutical composition for treating or improving neurogenic bladder comprising stem cells expressing brain-derived neurotrophic factors Download PDFInfo
- Publication number
- KR20220122379A KR20220122379A KR1020210026929A KR20210026929A KR20220122379A KR 20220122379 A KR20220122379 A KR 20220122379A KR 1020210026929 A KR1020210026929 A KR 1020210026929A KR 20210026929 A KR20210026929 A KR 20210026929A KR 20220122379 A KR20220122379 A KR 20220122379A
- Authority
- KR
- South Korea
- Prior art keywords
- stem cells
- leu
- arg
- pharmaceutical composition
- neurogenic
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
- A61K38/185—Nerve growth factor [NGF]; Brain derived neurotrophic factor [BDNF]; Ciliary neurotrophic factor [CNTF]; Glial derived neurotrophic factor [GDNF]; Neurotrophins, e.g. NT-3
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/10—Drugs for disorders of the urinary system of the bladder
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
Abstract
Description
본 발명은 뇌-유래 신경영양인자를 발현하는 줄기세포를 포함하는 신경인성 방광증의 치료 또는 개선용 약학 조성물에 관한 것이다.The present invention relates to a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy comprising stem cells expressing brain-derived neurotrophic factors.
배뇨를 조절하는 신경계 손상으로 인한 방광 및 요도 기능 장애를 신경인성 방광증(neurogenic bladder, NB)이라고 한다. 상기 NB의 원인은 여러가지가 있으며, 그 중 일부는 당뇨병, 뇌 혈관 사고, 뇌 손상, 척수 손상 및 신경 손상이 포함된다. 상기 신경인성 방광증의 주요 사망원인은 요로 감염, 상부 요로 손상 및 신부전과 같은 요로 합병증이다. 이러한 신경인성 방광증의 합병증을 예방하거나 지연시키는 여러가지 방법이 있기는 하나, 방광 자체를 복원하는 연구는 아직 초기 단계이다.Bladder and urethral dysfunction due to damage to the nervous system that controls urination is called neurogenic bladder (NB). There are several causes of NB, some of which include diabetes, cerebrovascular accident, brain injury, spinal cord injury, and nerve damage. The major causes of death in neurogenic cystopathy are urinary tract complications such as urinary tract infection, upper urinary tract injury, and renal failure. Although there are various methods to prevent or delay the complications of neurogenic cystopathy, the study of restoring the bladder itself is still in its infancy.
한편, 전 세계적으로 세포를 이용한 치료 방법이 개발되고 있으며, 성체줄기세포를 이용한 세포치료제에 대해 많은 연구가 진행 중이다. 성체줄기세포인 중간엽줄기세포(Mesenchymal Stem cell; MSC)는 뼈, 연골, 근육, 지방, 섬유아세포 등으로 분화할 수 있는 다능성(multipotent) 세포이다. 상기 MSC는 골수, 제대혈, 지방 등 다양한 성체조직에서 비교적 쉽게 얻을 수 있다. MSC는 염증 또는 손상 부위로 이동하는 특이성이 있어, 치료 약물을 전달하기 위한 전달체로서도 큰 장점이 있다. 또한, T 세포, B 세포, 수지상 세포 및 자연살해 세포와 같은 면역 세포의 기능을 억제하거나 활성화시켜, 인체의 면역기능을 조절할 수 있다. 그뿐 아니라, MSC는 시험관 내 (in vitro)에서 비교적 쉽게 배양할 수 있다는 장점이 있다. 이러한 특성으로 인해 MSC를 세포치료제로 이용하기 위한 연구가 활발히 진행되고 있다.Meanwhile, treatment methods using cells are being developed worldwide, and many studies are being conducted on cell therapy products using adult stem cells. Mesenchymal stem cells (MSCs), which are adult stem cells, are multipotent cells capable of differentiating into bone, cartilage, muscle, fat, fibroblast, and the like. The MSC can be obtained relatively easily from various adult tissues such as bone marrow, umbilical cord blood, and fat. MSCs have the specificity of moving to the site of inflammation or damage, and thus have a great advantage as a carrier for delivering therapeutic drugs. In addition, by inhibiting or activating the functions of immune cells such as T cells, B cells, dendritic cells and natural killer cells, it is possible to regulate the immune function of the human body. In addition, MSCs have the advantage that they can be cultured relatively easily in vitro. Due to these characteristics, studies for using MSC as a cell therapy are being actively conducted.
그러나, 이와 같은 MSC의 장점에도 불구하고, 세포 치료제로서 임상에 사용할 수 있는 등급의 MSC를 생산하는데 다음과 같은 문제가 있다. 첫째, MSC의 증식에는 한계가 있어, 이를 대량으로 생산하기 어렵다. 둘째, 수득한 MSC는 다양한 종류의 세포가 혼합되어 있어, 생산 시 동일한 효과를 유지하기 어렵다. 셋째, MSC만을 이용할 경우 치료 효과가 높지 않다. 마지막으로, 인체에 주입된 MSC가 체내에서 암세포로 될 가능성도 있다.However, despite the advantages of MSCs, there are the following problems in producing MSCs that can be clinically used as cell therapeutics. First, there is a limit to the proliferation of MSCs, and it is difficult to mass-produce them. Second, since the obtained MSCs are mixed with various types of cells, it is difficult to maintain the same effect during production. Third, when only MSC is used, the therapeutic effect is not high. Finally, there is a possibility that MSCs injected into the body can become cancer cells in the body.
다른 한편으로, 뇌유래-신경영양인자(brain-derived neurotrophic factor, BDNF)는 우리 몸의 뇌, 망막, 운동 신경세포, 신장, 침, 전립선 등에서 발현되며, 뇌의 해마(hippocampus), 대뇌 피질(cerebral cortex), 시상하부(hypothalamus), 기부 전뇌(basal forebrain) 등에서 발현된다. 상기 BDNF는 장기기억(long-term memory)에 있어서 중요한 부분을 차지하는데, 학습이 일어난 동물에서 BDNF mRNA는 뇌의 해마 부위에서 높은 수준으로 발현하게 된다. 이러한 해마부위에서 발현이 증가하는 것은 학습 수준도 연관되는 것으로 보고되었다.On the other hand, brain-derived neurotrophic factor (BDNF) is expressed in the brain, retina, motor neurons, kidneys, saliva, prostate, etc. cortex), hypothalamus, and basal forebrain. The BDNF occupies an important part in long-term memory, and BDNF mRNA is expressed at a high level in the hippocampus of the brain in an animal in which learning has taken place. It has been reported that the increase in expression in the hippocampus is also associated with the level of learning.
또한, BDNF는 신경세포의 생성을 촉진하는 뉴로트로핀에 대해 가장 우수한 활성을 보이는 물질이다. 실제로, BDNF가 유전적으로 완전히 제거된 쥐의 경우에는 출생 후 심각한 사망률을 보이며 소뇌, 후각 구근(olfactory bulb), 시각 피질(visual cortex)과 와우각(cochlear) 등에서 신경세포의 손실이 관찰된다. 반면에, 부분적으로 BDNF 유전자가 제거된 경우에는 뉴로트로핀의 발현이 감소하며 해마부위의 장기 강화(long-term potentiation, LTP)와 감각 및 통각 시스템의 변화가 관찰되며 행동학적인 문제와 더불어 정신학적인 문제까지 관찰된다.In addition, BDNF is a substance showing the most excellent activity for neurotrophin, which promotes the generation of nerve cells. In fact, mice in which BDNF has been completely genetically deleted show severe mortality after birth, and loss of neurons in the cerebellum, olfactory bulb, visual cortex, and cochlear is observed. On the other hand, when the BDNF gene is partially removed, neurotrophin expression is reduced, long-term potentiation (LTP) in the hippocampus and changes in sensory and nociceptive systems are observed. problem is also observed.
이러한 BDNF와 MSC에 대하여, 전구세포에서 BDNF의 발현이 손상된 신경 조직을 효과적으로 복구할 수 있으며, 상기 BDNF가 해당 신경에 의해 자극되는 근육의 단면적을 크게 증가시키는 것을 발견한 연구가 수행된 바 있다.For these BDNF and MSC, the expression of BDNF in progenitor cells can effectively repair damaged nerve tissue, and studies have been conducted to find that the BDNF greatly increases the cross-sectional area of the muscle stimulated by the corresponding nerve.
특히, 상기 BDNF를 발현하도록, 아데노 바이러스를 이용하여 중간엽 줄기세포를 형질전환시킨 연구가 수행된 바 있다(Kari Pollock et al., Molecular Therapy, vol.24 no.5: 965-977, 2016). 하지만, 상기 연구에서 사용된 중간엽 줄기세포는 조직에서 수득한 일반적인 중간엽 줄기세포로서 MSC의 증식에는 한계가 있어 대량 생산하기 어려운 문제점이 있다. 그뿐 아니라, BDNF 유전자의 발현 정도가 균일하지 않아, 생산 시 동일한 효과를 기대하기 어렵다.In particular, a study in which mesenchymal stem cells were transformed using adenovirus to express the BDNF has been conducted (Kari Pollock et al., Molecular Therapy, vol.24 no.5: 965-977, 2016). . However, the mesenchymal stem cells used in the above study are general mesenchymal stem cells obtained from tissues, and there is a limitation in the proliferation of MSCs, so it is difficult to mass-produce them. In addition, the expression level of the BDNF gene is not uniform, so it is difficult to expect the same effect during production.
한편, 대한민국 등록특허 제1585032호에서는 하이드로겔에서 배양한 중간엽 줄기세포를 함유하는 세포 치료제를 개시하고 있다. 상기 문헌에는 세포 치료제로 사용하기 위한 중간엽 줄기세포를 분리하는 공정에서 전처리 과정을 단축하여 바로 투여 가능한 조성물을 제공하고 있으나, 상기와 같은 중간엽 줄기세포의 문제점 및 이를 해소하기 위한 방안에 대해서는 전혀 언급하고 있지 않다. 따라서, 안전하고 효과적인 중간엽 줄기세포이자, 신경인성 방광증에 대해 높은 치료 효과를 나타내며, 안전하게 사용될 수 있는 중간엽 줄기세포 및 이를 이용한 세포 치료제에 대한 연구가 필요한 실정이다.Meanwhile, Korean Patent Registration No. 1585032 discloses a cell therapeutic agent containing mesenchymal stem cells cultured in a hydrogel. The literature provides a composition that can be administered immediately by shortening the pre-treatment process in the process of isolating mesenchymal stem cells for use as a cell therapeutic agent. not mentioned Therefore, it is a safe and effective mesenchymal stem cell, shows a high therapeutic effect on neurogenic cystopathy, and there is a need for research on mesenchymal stem cells that can be safely used and cell therapeutics using the same.
본 발명의 목적은 뇌-유래 신경영양인자 단백질을 발현하는 줄기세포를 포함하며, BDNF (Brain-derived neurotrophic factor), TrkB (receptor tyrosine kinase B), 및/또는 CREB (c-AMP-responsive element binding protein) 신호전달경로를 활성화시킴으로써 신경질환의 발병에 수반되는 방광 및 요도의 이상 질환(disorder)인 신경인성 방광증을 치료 또는 개선할 수 있는 약학 조성물을 제공하는 데 있다. An object of the present invention includes stem cells expressing brain-derived neurotrophic factor protein, BDNF (Brain-derived neurotrophic factor), TrkB (receptor tyrosine kinase B), and/or CREB (c-AMP-responsive element binding protein) ) To provide a pharmaceutical composition that can treat or improve neurogenic cystopathy, which is a disorder of the bladder and urethra accompanying the onset of neurological diseases by activating a signal transduction pathway.
상기 목적을 달성하기 위해, In order to achieve the above purpose,
본 발명은 뇌-유래 신경영양인자 단백질을 발현하는 줄기세포를 유효성분으로 포함하는 신경인성 방광증의 치료 또는 개선용 약학 조성물을 제공한다.The present invention provides a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy comprising stem cells expressing brain-derived neurotrophic factor protein as an active ingredient.
본 발명의 일 실시예에 있어서, 상기 줄기세포는 뇌-유래 신경영양인자 단백질을 코딩하는 유전자가 포함된 발현벡터로 형질감염된 것일 수 있다. In one embodiment of the present invention, the stem cells may be transfected with an expression vector containing a gene encoding a brain-derived neurotrophic factor protein.
바람직하게는, 상기 발현벡터는 렌티바이러스 벡터, 레트로바이러스 벡터, 리포좀, 양이온성 중합체, 전기천공법, 및 이들의 조합들로 이루어진 군으로부터 선택되는 것일 수 있다. Preferably, the expression vector may be selected from the group consisting of lentiviral vectors, retroviral vectors, liposomes, cationic polymers, electroporation, and combinations thereof.
본 발명의 일 실시예에 있어서, 상기 조성물은 BDNF (Brain-derived neurotrophic factor), TrkB (receptor tyrosine kinase B), 및/또는 CREB (c-AMP-responsive element binding protein) 신호전달경로를 활성화시키는 것일 수 있다.In one embodiment of the present invention, the composition is to activate BDNF (Brain-derived neurotrophic factor), TrkB (receptor tyrosine kinase B), and/or CREB (c-AMP-responsive element binding protein) signaling pathways can
본 발명의 일 실시예에 있어서, 상기 줄기세포는 간엽 줄기세포, 중간엽 줄기세포, 혈관내피전구세포, 신경 줄기세포, 및 이들의 조합들로 이루어진 군으로부터 선택될 수 있고, 바람직하게, 상기 줄기세포는 중간엽 줄기세포일 수 있다.In one embodiment of the present invention, the stem cells may be selected from the group consisting of mesenchymal stem cells, mesenchymal stem cells, vascular endothelial progenitor cells, neural stem cells, and combinations thereof, preferably, the stem cells The cell may be a mesenchymal stem cell.
더욱 바람직하게, 상기 중간엽 줄기세포는 불사화(immortalized)된 세포인 것일 수 있고, 상기 중간엽 줄기세포는 hTERT (human telomerase reverse transcriptase) 및/또는 c-Myc 유전자가 도입된 것일 수 있다.More preferably, the mesenchymal stem cells may be immortalized cells, and the mesenchymal stem cells may have human telomerase reverse transcriptase (hTERT) and/or c-Myc genes introduced thereto.
더욱 바람직하게, 상기 중간엽 줄기세포는 골수-유래 중간엽 줄기세포, 제대혈-유래 중간엽 줄기세포, 또는 지방-유래 중간엽 줄기세포인 것일 수 있으나, 이에 한정되는 것은 아니다. More preferably, the mesenchymal stem cells may be bone marrow-derived mesenchymal stem cells, umbilical cord blood-derived mesenchymal stem cells, or adipose-derived mesenchymal stem cells, but is not limited thereto.
본 발명의 일 실시예에 있어서, 상기 신경인성 방광증은 요절박, 절박성 요실금, 빈뇨, 야뇨, 배뇨곤란, 배뇨장애, 신우신염, 및 이들의 조합들로 이루어진 군으로부터 선택되는 하나 이상의 증상을 나타내는 것일 수 있다, 바람직하게는, 상기 신경인성 방광증은 신경질환의 발병에 수반되는 방광 및 요도의 이상 질환(disorder)일 수 있다.In one embodiment of the present invention, the neurogenic cystosis is one or more symptoms selected from the group consisting of urgency, urge incontinence, frequency, nocturia, dysuria, dysuria, pyelonephritis, and combinations thereof. It may be one, preferably, the neurogenic cystopathy may be a disorder of the bladder and urethra accompanying the onset of a neurological disease.
상기 신경질환은 뇌졸중, 알츠하이머병, 파킨슨병, 루게릭병, 뇌경색, 만성 뇌손상, 척수손상, 헌팅턴병, 렛트병, 허혈성 뇌질환, 외상성 뇌손상, 신생아 허혈성 뇌병증, 다발성 경화증, 척수이형성증, 척추디스크, 척추협착증, 및 이들의 조합들로 이루어진 군으로부터 선택되는 질환일 수 있다.The neurological diseases include stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, cerebral infarction, chronic brain injury, spinal cord injury, Huntington's disease, Rett's disease, ischemic brain disease, traumatic brain injury, neonatal ischemic encephalopathy, multiple sclerosis, myelodysplasia, vertebral disc, It may be a disease selected from the group consisting of spinal stenosis, and combinations thereof.
또한, 본 발명은 상기 뇌-유래 신경영양인자 단백질을 발현하는 줄기세포를 포함하는 신경인성 방광증 치료 또는 개선용 줄기세포 치료제를 제공한다.In addition, the present invention provides a stem cell therapeutic agent for the treatment or improvement of neurogenic cystopathy comprising stem cells expressing the brain-derived neurotrophic factor protein.
본 발명에 따른 줄기세포를 포함하는 약학 조성물은 BDNF/TrkB/CREB 신호전달경로를 활성화함으로써 신경 조직을 회복하는데 도움을 줄 수 있으며, BDNF를 더욱 많이 발현시킴으로써 손상된 신경 조직의 회복을 가속화시킬 수 있다. 또한, 세포 사멸을 감소시키고 근육 조직의 회복을 가속화함으로써 신경인성 방광증을 개선 및 치료하는 데 유용하게 활용될 수 있다.The pharmaceutical composition comprising the stem cell according to the present invention can help to restore nerve tissue by activating the BDNF/TrkB/CREB signaling pathway, and accelerate the recovery of damaged nerve tissue by expressing more BDNF. . In addition, it can be usefully used to improve and treat neurogenic cystopathy by reducing cell death and accelerating the recovery of muscle tissue.
뿐만 아니라, 본 발명에 따른 줄기세포를 포함하는 약학 조성물은 대량 생산이 가능하고, 불사화된 중간엽 줄기세포를 사용함으로써 높은 세포 증식률을 가지며, 비정상적인 분화 및 증식 가능성이 낮아 안전성이 높다는 장점을 갖는다.In addition, the pharmaceutical composition comprising the stem cells according to the present invention can be mass-produced, has a high cell proliferation rate by using immortalized mesenchymal stem cells, and has the advantage of high safety due to low possibility of abnormal differentiation and proliferation. .
도 1a 및 1b는 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에 대한 BDNF(녹색) 및 MSC(적색)을 나타내는 면역형광 결과이다 (배율: ×200).
도 2는 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에 대한 BDNF 발현량을 나타낸 결과이다 (각 막대: 평균값(표준 편차); 및 BM-MSC와 비교한 경우 *P<0.01).
도 3은 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에 대한 BDNF의 positive rate을 나타낸 결과이다 (NB 그룹과 비교한 경우 *P<0.01; 및 NB+imMSCs 그룹과 비교한 경우 #P<0.01).
도 4a 및 4b는 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에 대한 방광계 검사 결과를 나타낸 결과이다.
도 5는 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에 대한 방광계 검사 결과에서, 평균 수축 간격을 나타낸 결과이다 (NB 그룹과 비교한 경우 *P<0.01; NB+imMSCs 그룹과 비교한 경우 #P<0.01).
도 6a 및 6b는 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에 대한 면역형광 염색 결과이다 (녹색: 신경; 파란색: 세포핵; 붉은 색: MSC; 및 배율: ×100).
도 7은 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에서 신경의 positive rate를 나타낸 결과이다 (BM-MSC와 비교한 경우 *P<0.01).
도 8a 및 8b는 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에서의 세포사멸을 나타낸 결과이다 (녹색: PARP; 청색: 세포핵; 적색: MSC; 및 배율: ×200).
도 9는 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에 대한 웨스턴 블롯 분석 결과이다.
도 10은 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에서 PARP의 positive rate를 나타낸 결과이다 (BM-MSC와 비교한 경우 *P<0.01).
도 11은 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에서 카스파아제-3/β-액틴(%)를 나타낸 웨스턴 블롯 정량 분석 결과이다 (BM-MSC와 비교한 경우 *P<0.01).
도 12는 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에서 α-평활근 액틴/β-액틴(%)를 나타낸 웨스턴 블롯 정량 분석 결과이다 (BM-MSC와 비교한 경우 *P<0.01).
도 13은 본 발명의 일 실시예에 따른 중간엽 줄기세포를 포함하는 각 그룹에서 BDNF, p-TrkB, TrkB, p-Akt, Akt, p-CREB 및 CREB에 대해 비교된 웨스턴 블롯 분석 결과이다.
도 14는 BDNF/β-액틴, p-TrkB/TrkB, p-Akt/Akt, p-CREB/CREB를 포함한 웨스턴 블롯 분석 결과이다 (BM-MSC와 비교한 경우 *P<0.01).1A and 1B are immunofluorescence results showing BDNF (green) and MSC (red) for each group including mesenchymal stem cells according to an embodiment of the present invention (magnification: ×200).
2 is a result showing the BDNF expression level for each group containing mesenchymal stem cells according to an embodiment of the present invention (each bar: mean value (standard deviation); and *P< when compared with BM-MSC 0.01).
3 is a result showing the positive rate of BDNF for each group containing mesenchymal stem cells according to an embodiment of the present invention (when compared to the NB group *P <0.01; and compared with the NB + imMSCs group if #P<0.01).
4A and 4B are results showing the results of a bladder test for each group including mesenchymal stem cells according to an embodiment of the present invention.
5 is a result showing the average contraction interval in the bladder test results for each group containing mesenchymal stem cells according to an embodiment of the present invention (when compared to the NB group *P<0.01; NB+imMSCs #P<0.01 when compared to group).
6A and 6B are results of immunofluorescence staining for each group including mesenchymal stem cells according to an embodiment of the present invention (green: nerve; blue: cell nucleus; red: MSC; and magnification: ×100).
7 is a result showing the positive rate of nerves in each group including mesenchymal stem cells according to an embodiment of the present invention (when compared with BM-MSC *P<0.01).
8A and 8B are results showing apoptosis in each group containing mesenchymal stem cells according to an embodiment of the present invention (green: PARP; blue: cell nucleus; red: MSC; and magnification: ×200).
9 is a Western blot analysis result for each group containing mesenchymal stem cells according to an embodiment of the present invention.
Figure 10 is a result showing the positive rate of PARP in each group containing mesenchymal stem cells according to an embodiment of the present invention (compared to BM-MSC *P<0.01).
11 is a Western blot quantitative analysis result showing caspase-3/β-actin (%) in each group containing mesenchymal stem cells according to an embodiment of the present invention (*P when compared with BM-MSC) <0.01).
12 is a Western blot quantitative analysis result showing α-smooth muscle actin/β-actin (%) in each group containing mesenchymal stem cells according to an embodiment of the present invention (*P when compared to BM-MSC) <0.01).
13 is a Western blot analysis result comparing BDNF, p-TrkB, TrkB, p-Akt, Akt, p-CREB and CREB in each group including mesenchymal stem cells according to an embodiment of the present invention.
14 is a Western blot analysis result including BDNF/β-actin, p-TrkB/TrkB, p-Akt/Akt, and p-CREB/CREB (*P<0.01 when compared to BM-MSC).
이하, 본 발명의 실시예와 도면을 참조하여 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail with reference to embodiments and drawings of the present invention.
이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위해 예시적으로 제시한 것일 뿐, 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가지는 자에 있어서 자명할 것이다.It will be apparent to those of ordinary skill in the art that these examples are only presented as examples to explain the present invention in more detail, and that the scope of the present invention is not limited by these examples. .
또한, 달리 정의하지 않는 한, 본 발명에서 사용되는 모든 기술적 및 과학적 용어는 본 발명이 속하는 기술 분야의 숙련자에 의해 통상적으로 이해되는 바와 동일한 의미를 가지며, 상충되는 경우에는, 정의를 포함하는 본 명세서의 기재가 우선할 것이다.In addition, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and in case of conflict, this specification, including definitions description will take precedence.
도면에서 제안된 발명을 명확하게 설명하기 위해서 설명과 관계없는 부분은 생략하였으며, 명세서 전체를 통하여 유사한 부분에 대해서는 유사한 도면 부호를 붙였다. 그리고, 어떤 부분이 어떤 구성 요소를 "포함"한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성 요소를 제외하는 것이 아니라 다른 구성 요소를 더 포함할 수 있는 것을 의미한다. 또한, 명세서에서 기술한 "부"란, 특정 기능을 수행하는 하나의 단위 또는 블록을 의미한다.In order to clearly explain the invention proposed in the drawings, parts irrelevant to the description are omitted, and similar reference numerals are attached to similar parts throughout the specification. And, when a part "includes" a certain component, this means that other components may be further included, rather than excluding other components, unless otherwise stated. In addition, the "unit" described in the specification means one unit or block that performs a specific function.
각 단계들에 있어 식별부호(제1, 제2, 등)는 설명의 편의를 위하여 사용되는 것으로 식별부호는 각 단계들의 순서를 설명하는 것이 아니며, 각 단계들은 문맥상 명백하게 특정 순서를 기재하지 않는 이상 명기된 순서와 다르게 실시될 수 있다. 즉, 각 단계들은 명기된 순서와 동일하게 실시될 수도 있고 실질적으로 동시에 실시될 수도 있으며 반대의 순서대로 실시될 수도 있다.In each step, the identification code (first, second, etc.) is used for convenience of description, and the identification code does not describe the order of each step, and each step does not clearly describe a specific order in context. It may be performed differently from the order specified above. That is, each step may be performed in the same order as specified, may be performed substantially simultaneously, or may be performed in the reverse order.
본 명세서에서 사용된 용어, "뇌-유래 신경영양인자(brain-derived neurotrophic factor, BDNF)" 단백질은 뇌에 가장 풍부하게 분포되어 있는 뉴로트로핀(neurotrophin)이다. 이는 신경원(neuron)의 성장을 촉진하고, 신경전달물질의 합성, 대사, 유리 및 신경원의 활성을 조절하는 것으로 알려져 있다. 또한, BDNF 단백질은 우울증 환자의 전두엽 피질 또는 해마에서 감소되고, 이의 농도를 증가시켜 우울증을 치료할 수 있음이 알려져 있다.As used herein, the term "brain-derived neurotrophic factor (BDNF)" protein is the most abundantly distributed neurotrophin in the brain. It is known to promote the growth of neurons, and to regulate the synthesis, metabolism, release and activity of neurotransmitters. In addition, it is known that BDNF protein is decreased in the prefrontal cortex or hippocampus of depressed patients, and can treat depression by increasing its concentration.
본 명세서에서 사용된 용어, "렌티바이러스 벡터"는 레트로바이러스의 일종이다. 상기 벡터는 렌티바이러스 트랜스퍼 벡터로 혼용하여 지칭되기도 한다. 상기 렌티바이러스 벡터는 감염 대상인 세포의 게놈 DNA에 삽입되어 안정되게 유전자를 발현시킨다. 또한, 상기 벡터는 분열세포 및 비분열세포에 유전자를 전달할 수 있다. 상기 벡터는 인체의 면역반응을 유도하지 않기 때문에 발현이 지속적이다. 또한, 종래에 사용되는 바이러스 벡터인 아데노바이러스 벡터에 비하여 큰 사이즈의 유전자도 전달 가능한 이점이 있다.As used herein, the term "lentiviral vector" is a type of retrovirus. The vector is also referred to as a lentiviral transfer vector interchangeably. The lentiviral vector is inserted into the genomic DNA of a cell to be infected to stably express the gene. In addition, the vector can deliver genes to dividing cells and non-dividing cells. Since the vector does not induce an immune response of the human body, its expression is continuous. In addition, there is an advantage in that a gene of a large size can be transferred as compared to an adenoviral vector, which is a viral vector used in the prior art.
본 명세서에서 사용된 용어, "중간엽 줄기세포(mesenchymal stem cell, MSC)"는 골세포, 연골세포 및 지방세포를 포함하는 다양한 세포로 분화될 수 있는 다분화능 기질세포를 말한다. 상기 중간엽 줄기세포는 뼈, 연골, 지방, 힘줄, 신경조직, 섬유 아세포 및 근육세포 등 구체적인 장기의 세포로 분화될 수 있다. 이들 세포는 지방조직, 골수, 말초신경 혈액, 제대혈, 골막, 진피, 중배엽-유래 조직 등으로부터 분리 또는 정제될 수 있다.As used herein, the term "mesenchymal stem cell (MSC)" refers to a multipotent stromal cell that can be differentiated into various cells including osteocytes, chondrocytes and adipocytes. The mesenchymal stem cells may be differentiated into cells of specific organs, such as bone, cartilage, fat, tendon, neural tissue, fibroblasts, and muscle cells. These cells can be isolated or purified from adipose tissue, bone marrow, peripheral nerve blood, umbilical cord blood, periosteum, dermis, mesoderm-derived tissue, and the like.
이하, 첨부된 도면을 참조하여 본 발명의 구현예 및 실시예를 상세히 설명한다. 그러나, 본 발명의 이러한 구현예 및 실시예와 도면은 이에 제한되지 않는다.Hereinafter, embodiments and embodiments of the present invention will be described in detail with reference to the accompanying drawings. However, these embodiments and examples and drawings of the present invention are not limited thereto.
본 발명의 일 실시 형태는, 뇌-유래 신경영양인자 단백질을 발현하는 줄기세포를 포함하는, 신경인성 방광증 치료 또는 개선용 약학 조성물에 관한 것이다.One embodiment of the present invention relates to a pharmaceutical composition for treating or improving neurogenic cystopathy, comprising stem cells expressing brain-derived neurotrophic factor protein.
본 발명은 다른 관점에서, 상기 뇌-유래 신경영양인자 단백질을 발현하는 줄기세포를 포함하는 신경인성 방광증 치료 또는 개선용 약학 조성물을 포함하는, 신경인성 방광증 치료 또는 개선용 줄기세포 치료제에 관한 것이다.In another aspect, the present invention relates to a stem cell therapeutic agent for treating or improving neurogenic cystopathy, comprising a pharmaceutical composition for treating or improving neurogenic cystopathy comprising stem cells expressing the brain-derived neurotrophic factor protein. .
본 발명에 따른 약학 조성물 및/또는 상기 약학 조성물을 포함하는 줄기세포 치료제는, BDNF/TrkB/CREB 신호전달경로를 활성화함으로써 신경 조직을 회복하는데 도움을 줄 수 있으며, BDNF를 더욱 많이 발현시킴으로써 손상된 신경 조직의 회복을 가속화시킬 수 있다. 또한, 본 발명에 따른 약학 조성물 및/또는 상기 약학 조성물을 포함하는 줄기세포 치료제는, 세포 사멸을 감소시키고 근육 조직의 회복을 가속화함으로써 신경인성 방광증을 개선 및 치료하는 데 유용하게 활용될 수 있다.The pharmaceutical composition according to the present invention and/or a stem cell therapeutic agent comprising the pharmaceutical composition can help to restore nerve tissue by activating the BDNF/TrkB/CREB signaling pathway, and by expressing more BDNF, damaged nerves It can accelerate tissue recovery. In addition, the pharmaceutical composition according to the present invention and/or a stem cell therapeutic agent comprising the pharmaceutical composition can be usefully used to improve and treat neurogenic cystopathy by reducing apoptosis and accelerating the recovery of muscle tissue. .
본 발명의 일 실시예에 있어서, 상기 뇌-유래 신경영양인자 단백질은 서열번호 1의 아미노산 서열을 갖는 폴리펩티드일 수 있으며, 상기 뇌-유래 신경영양인자 단백질을 코딩하는 유전자는 서열번호 2의 염기서열을 갖는 것일 수 있다. 예를 들어, 상기 약학 조성물은 서열번호 2의 염기서열을 갖는 유전자를 포함하는 발현벡터로 형질감염되어 서열번호 1의 뇌-유래 신경영양인자 단백질을 발현하는 줄기세포를 포함하는 것일 수 있다.In one embodiment of the present invention, the brain-derived neurotrophic factor protein may be a polypeptide having the amino acid sequence of SEQ ID NO: 1, and the gene encoding the brain-derived neurotrophic factor protein has the nucleotide sequence of SEQ ID NO: 2 it could be For example, the pharmaceutical composition may include stem cells transfected with an expression vector containing a gene having the nucleotide sequence of SEQ ID NO: 2 and expressing the brain-derived neurotrophic factor protein of SEQ ID NO: 1.
본 발명의 일 실시예에 있어서, 상기 발현벡터는 렌티바이러스 벡터, 레트로바이러스 벡터, 리포좀, 양이온성 중합체, 전기천공법, 및 이들의 조합들로 이루어진 군으로부터 선택되는 것을 특징으로 할 수 있으며, 바람직하게는 렌티바이러스 벡터일 수 있다.In one embodiment of the present invention, the expression vector may be selected from the group consisting of lentiviral vectors, retroviral vectors, liposomes, cationic polymers, electroporation, and combinations thereof, preferably For example, it may be a lentiviral vector.
본 발명의 일 실시예에 있어서, 상기 줄기세포는 간엽 줄기세포, 중간엽 줄기세포, 혈관내피전구세포, 신경 줄기세포, 및 이들의 조합들로 이루어진 군으로부터 선택되는 것일 수 있다. 예를 들어, 상기 중간엽 줄기세포는 골수-유래 중간엽 줄기세포, 제대혈-유래 중간엽 줄기세포, 또는 지방-유래 중간엽 줄기세포일 수 있으며, 바람직하게 상기 줄기세포는 골수-유래 중간엽 줄기세포인 것을 특징으로 할 수 있다.In one embodiment of the present invention, the stem cells may be selected from the group consisting of mesenchymal stem cells, mesenchymal stem cells, vascular endothelial progenitor cells, neural stem cells, and combinations thereof. For example, the mesenchymal stem cells may be bone marrow-derived mesenchymal stem cells, umbilical cord blood-derived mesenchymal stem cells, or adipose-derived mesenchymal stem cells, and preferably, the stem cells are bone marrow-derived mesenchymal stem cells. It may be characterized as a cell.
본 발명의 일 실시예에 있어서, 상기 줄기세포는 골수-유래 중간엽 줄기세포일 수 있으며, 불사화된 것일 수 있다. 예를 들어, 상기 줄기세포는 불사화된 골수-유래 중간엽 줄기세포로서 불사화되지 않은 중간엽 줄기세포에 비해 높은 세포 증식률을 가지면서, 비정상적인 분화 및 증식 가능성이 낮아 안전하게 사용될 수 있으나, 이에 제한되지 않는다.In one embodiment of the present invention, the stem cells may be bone marrow-derived mesenchymal stem cells, and may be immortalized. For example, the stem cells are immortalized bone marrow-derived mesenchymal stem cells, which have a high cell proliferation rate compared to non-immortalized mesenchymal stem cells, and can be safely used due to the low possibility of abnormal differentiation and proliferation, but limited thereto. doesn't happen
본 발명의 일 실시예에 있어서, 상기 줄기세포는 골수-유래 중간엽 줄기세포일 수 있으며, hTERT 및/또는 c-Myc 유전자가 도입된 것일 수 있다. 상기 hTERT 및/또는 c-Myc는 줄기세포를 불사화시키는 유전자로서, 상기 hTERT 및/또는 c-Myc를 도입함에 따라 줄기세포를 불사화시켜 안전하게 사용할 수 있다. 일 실시예에 있어서, 상기 hTERT 및/또는 c-Myc 단백질은 각각 서열번호 3 및 서열번호 5의 아미노산 서열을 포함하는 폴리펩티드일 수 있으며, 상기 hTERT 및/또는 c-Myc 단백질을 코딩하는 유전자는 각각 서열번호 4 및 서열번호 6의 염기서열을 포함하는 폴리뉴클레오티드일 수 있다.In one embodiment of the present invention, the stem cells may be bone marrow-derived mesenchymal stem cells, and may be those into which hTERT and/or c-Myc genes are introduced. The hTERT and/or c-Myc is a gene that immortalizes stem cells, and can be safely used by immortalizing stem cells by introducing the hTERT and/or c-Myc. In one embodiment, the hTERT and/or c-Myc protein may be a polypeptide comprising the amino acid sequence of SEQ ID NO: 3 and SEQ ID NO: 5, respectively, and the genes encoding the hTERT and/or c-Myc protein are each It may be a polynucleotide comprising the nucleotide sequences of SEQ ID NO: 4 and SEQ ID NO: 6.
본 발명의 일 실시예에 있어서, 상기 약학 조성물은 BDNF, TrkB, 및/또는 CREB 신호전달경로를 활성화시키는 것일 수 있다. 예를 들어, 상기 약학 조성물은 BDNF, TrkB, 및/또는 CREB 신호전달경로를 활성화시킴으로써 신경 조직을 회복하는데 도움을 줄 수 있으며, BDNF를 더욱 많이 발현시킴으로써 손상된 신경 조직의 회복을 가속화시키고, 이에 따라 신경인성 방광증을 효과적으로 개선 또는 치료할 수 있다.In one embodiment of the present invention, the pharmaceutical composition may activate the BDNF, TrkB, and/or CREB signaling pathway. For example, the pharmaceutical composition may help repair nerve tissue by activating the BDNF, TrkB, and/or CREB signaling pathway, and accelerate the repair of damaged nerve tissue by expressing more BDNF, thus Neurogenic cystopathy can be effectively improved or treated.
본 발명의 일 실시예에 있어서, 신경인성 방광증은 요절박, 절박성 요실금, 빈뇨, 야뇨, 배뇨곤란, 배뇨장애, 신우신염, 및 이들의 조합들로 이루어진 군으로부터 선택되는 하나 이상의 증상을 나타낼 수 있으며, 신경질환이 발병됨에 따라 수반되는 방광 및 요도의 이상을 나타내는 질환을 의미할 수 있다. 예를 들어, 상기 신경질환은 뇌졸중, 알츠하이머병, 파킨슨병, 루게릭병, 뇌경색, 만성 뇌손상, 척수손상, 헌팅턴병, 렛트병, 허혈성 뇌질환, 외상성 뇌손상, 신생아 허혈성 뇌병증, 다발성 경화증, 척수이형성증, 척추디스크, 척추협착증, 및 이들의 조합들로 이루어진 군으로부터 선택되는 것일 수 있으나, 이에 제한되지 않는다.In one embodiment of the present invention, neurogenic cystopathy may exhibit one or more symptoms selected from the group consisting of urgency, urge incontinence, frequency, nocturia, dysuria, dysuria, pyelonephritis, and combinations thereof. And it may mean a disease showing abnormalities of the bladder and urethra accompanying the onset of neurological diseases. For example, the neurological disease may include stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, cerebral infarction, chronic brain injury, spinal cord injury, Huntington's disease, Rett's disease, ischemic brain disease, traumatic brain injury, neonatal ischemic encephalopathy, multiple sclerosis, myelodysplasia. , a spinal disc, spinal stenosis, and may be selected from the group consisting of combinations thereof, but is not limited thereto.
본 발명의 일 실시예에 있어서, 상기 약학 조성물 및/또는 이를 포함하는 줄기세포 치료제는, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 또는 멸균 주사용액의 형태로 제제화하여 사용될 수 있다. In one embodiment of the present invention, the pharmaceutical composition and/or the stem cell therapeutic agent containing the same is an oral dosage form such as powder, granule, tablet, capsule, suspension, emulsion, syrup, aerosol, etc. according to a conventional method, respectively. , it can be used in the form of external preparations, suppositories or sterile injection solutions.
본 발명의 일 실시예에 있어서, 상기 약학 조성물 및/또는 이를 포함하는 줄기세포 치료제를 제제화할 경우, 일반적으로 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 또는 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있으나, 이에 제한되지 않는다.In one embodiment of the present invention, when formulating the pharmaceutical composition and / or a stem cell therapeutic agent containing the same, a generally used filler, extender, binder, wetting agent, disintegrant, or a diluent or excipient such as a surfactant It may be prepared using, but is not limited to.
본 발명의 일 실시예에 있어서, 경구투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 또는 캡슐제 등이 포함되며, 이러한 고형 제제는 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트 (calcium carbonate), 수크로스 (sucrose), 락토오스 (lactose), 또는 젤라틴 등을 섞어 조제될 수 있다. 또한, 예를 들어, 단순한 부형제 이외에도 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있으나, 이에 제한되지 않는다. In one embodiment of the present invention, solid preparations for oral administration include tablets, pills, powders, granules, or capsules, and such solid preparations include at least one or more excipients, for example, starch, calcium carbonate ( calcium carbonate), sucrose, lactose, or gelatin may be mixed and prepared. In addition, for example, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used, but the present invention is not limited thereto.
본 발명의 일 실시예에 있어서, 경구투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있으나, 이에 제한되지 않는다. In one embodiment of the present invention, liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients, for example, wetting agents , sweeteners, fragrances, preservatives, and the like may be included, but are not limited thereto.
본 발명의 일 실시예에 있어서, 비경구 투여를 위한 제제로는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제 및 좌제가 포함될 수 있다. 예를 들어, 상기 비수성용제 또는 현탁제로는, 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있으나, 이에 제한되지 않는다. 예를 들어, 상기 좌제로는, 위텝솔 (witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있으나, 이에 제한되지 않는다.In one embodiment of the present invention, preparations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories. For example, the non-aqueous solvent or suspending agent may include, but is not limited to, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. For example, as the suppository, witepsol, macrogol, tween 61, cacao butter, laurin fat, glycerogelatin, etc. may be used, but is not limited thereto.
본 발명의 일 실시예에 있어서, 상기 약학 조성물 및/또는 이를 포함하는 줄기세포 치료제를 투여하는 개체는 포유동물, 구체적으로 인간일 수 있다. 또한, 상기 약학 조성물 및/또는 이를 포함하는 줄기세포 치료제의 투여 경로 및 투여량은 개체의 상태 및 부작용의 유무에 따라 다양한 방법 및 양으로 투여될 수 있고, 최적의 투여 방법 및 투여량은 통상의 기술자가 적절한 범위로 선택할 수 있다. In one embodiment of the present invention, the subject to which the pharmaceutical composition and / or the stem cell therapeutic agent containing the same is administered may be a mammal, specifically a human. In addition, the pharmaceutical composition and / or the administration route and dosage of the stem cell therapeutic agent comprising the same may be administered in various methods and amounts depending on the condition of the individual and the presence or absence of side effects, and the optimal administration method and dosage are conventional A technician can select within the appropriate range.
본 발명의 일 실시예에 있어서, 상기 약학 조성물 및/또는 이를 포함하는 줄기세포 치료제를 비경구적으로 투여하는 경우, 예를 들어, 피하, 눈, 복강 내, 근육 내, 구강, 직장, 안와 내, 뇌 내, 두개 내(intracranial), 척추 내, 뇌실 내, 수강막 내, 비 내, 정맥 내로 투여될 수 있으나, 이에 제한되지 않는다.In one embodiment of the present invention, when the pharmaceutical composition and / or the stem cell therapeutic agent containing the same is parenterally administered, for example, subcutaneously, eye, intraperitoneal, intramuscular, oral, rectal, orbital, It can be administered intracerebral, intracranial, intravertebral, intraventricular, intrathecal, intranasal, intravenous, but is not limited thereto.
본 발명의 일 실시예에 있어서, 상기 약학 조성물 및/또는 이를 포함하는 줄기세포 치료제의 투여는 1회 이상, 예를 들어 1회 내지 4회 투여될 수 있고, 구체적으로 2회로 나누어 투여될 수 있다. 이를 반복 투여 하는 경우에는 약 12 내지 약 48 시간, 약 24 내지 약 36 시간 간격, 약 1 주, 약 2 주 내지 약 4 주 간격으로 투여할 수 있고, 구체적으로는 약 24 시간 또는 약 1 주 이상의 간격으로 투여할 수 있다. 상기 투여는 렌티바이러스의 경우, 성인 기준 1 일 약 1.0×106 내지 약 1.0×1012 TU, 구체적으로 1.0×108 내지 1.0×1010 TU의 양으로 투여될 수 있다. 한편, 세포의 경우, 성인 기 준 1일 1.0×105 내지 1.0×1011 cells, 구체적으로 1.0×107 내지 1.0×109 cells의 양으로 투여될 수 있다. 투여량이 많은 경우에는 하루에 수 회에 걸쳐 투여될 수 있으나, 이에 제한되지 않는다.In one embodiment of the present invention, the pharmaceutical composition and / or the administration of the stem cell therapeutic agent comprising the same may be administered more than once, for example, 1 to 4 times, and specifically divided into two administered may be administered. . In the case of repeated administration, it may be administered at intervals of about 12 to about 48 hours, about 24 to about 36 hours, about 1 week, about 2 weeks to about 4 weeks, and specifically, about 24 hours or about 1 week or more. It can be administered at intervals. The administration may be administered in an amount of about 1.0×10 6 to about 1.0×10 12 TU, specifically 1.0×10 8 to 1.0×10 10 TU, per day for adults in the case of lentivirus. Meanwhile, cells may be administered in an amount of 1.0×10 5 to 1.0×10 11 cells, specifically 1.0×10 7 to 1.0×10 9 cells per day for adults. In the case of a large dose, it may be administered several times a day, but is not limited thereto.
이하, 구체적인 실시예와 비교예를 통하여 본 발명의 구성 및 그에 따른 효과를 보다 상세히 설명하고자 한다. 그러나, 본 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것이며, 본 발명의 범위가 이들 실시예에 제한되는 것은 아니다.Hereinafter, the configuration of the present invention and its effects will be described in more detail through specific examples and comparative examples. However, these examples are for explaining the present invention in more detail, and the scope of the present invention is not limited to these examples.
먼저, 실시예에서 수행된 모든 동물 실험은 가톨릭대학교 동물 관리 및 사용위원회(승인번호: CUMC-2016-0218-01)의 승인을 받았으며, 랫은 가톨릭대학교 이용위원회(IACUC)의 실험 동물 관리 지침에 따라 사육되었다. 수컷 Sprague-Dawley 랫(12 주령, 무게 약 370-400 g)은 한국 회사 (Orient Bio Co. Seongnam, Korea)에서 구입되었으며 다음 그룹으로 랜덤하게 분류하였다(n=32): 가짜 대조군 그룹(n=8), 대조군인 NB 그룹(n=8), NB 그룹에 불사화된 중간엽 줄기세포를 투여한 imMSCs 그룹(n=8), 및 NB 그룹에 본 발명에 따른 BDNF를 고발현하는 중간엽 줄기세포를 투여한 NB+imMSCs(BDNF) 그룹(n=8). 분류된 그룹들의 랫의 주요 골반 신경절(MPG)을 마취 하에 관찰한 뒤, 상기 NB 3 그룹의 양측 MPG을 손상시켰다. 대조군 그룹의 랫의 경우는 가짜 수술을 수행하였다. 수술 후, 랫은 단독으로 사육하였으며 음식과 물을 자유롭게 공급하였다.First, all animal experiments performed in the Examples were approved by the Catholic University Animal Care and Use Committee (approval number: CUMC-2016-0218-01), and rats are in accordance with the experimental animal care guidelines of the Catholic University Utilization Committee (IACUC). were bred according to Male Sprague-Dawley rats (12 weeks old, weighing about 370-400 g) were purchased from a Korean company (Orient Bio Co. Seongnam, Korea) and were randomly assigned to the following groups (n=32): a sham control group (n= 8), the NB group as a control group (n=8), the imMSCs group administered with immortalized mesenchymal stem cells to the NB group (n=8), and the mesenchymal stems highly expressing BDNF according to the present invention to the NB group NB+imMSCs (BDNF) group administered cells (n=8). After observing the major pelvic ganglion (MPG) of rats in the sorted groups under anesthesia, both MPGs of the
또한, 실시예에서 수행된 실험의 모든 데이터는 평균±표준 오차(SD)로 표시되었다. 자료는 SPSS 버전 22.0 소프트웨어 (IBM, Armonk, NY, USA)로 분석되었다. Student's t-test, one-way ANOVA 및 2×2 factorial ANOVA를 적절하게 사용하여 그룹 간의 차이가 유의한지 여부를 평가하였다. P <0.05는 통계적으로 유의한 것으로 간주되었다. 1차 항체는 BDNF (diluted 1:1000; Abcam, Cambridge, UK), TrkB (diluted 1:1000; Abcam, Cambridge, UK), p-TrkB (diluted 1:1000; Cell Signaling Technology, Danvers, MA, USA), CREB (diluted 1:500; Abcam, Cambridge, UK), p-CREB (diluted 1:500; Abcam, Cambridge, UK), AKT (diluted 1:200; Cell Signaling Technology, Danvers, MA, USA), p-AKT (diluted 1:200; Cell Signaling Technology, Danvers, MA, USA), Caspase-3 (diluted 1:500; Abcam, Cambridge, UK), α-SMA(α-smooth muscle actin, diluted 1:500; Abcam, Cambridge, UK), 및 β-actin (diluted 1:1000; Abcam, Cambridge, UK)를 포함하였다.In addition, all data of the experiments performed in the Examples were expressed as mean±standard error (SD). Data were analyzed with SPSS version 22.0 software (IBM, Armonk, NY, USA). Student's t-test, one-way ANOVA, and 2×2 factorial ANOVA were appropriately used to evaluate whether differences between groups were significant. Po0.05 was considered statistically significant. Primary antibodies were BDNF (diluted 1:1000; Abcam, Cambridge, UK), TrkB (diluted 1:1000; Abcam, Cambridge, UK), p-TrkB (diluted 1:1000; Cell Signaling Technology, Danvers, MA, USA) ), CREB (diluted 1:500; Abcam, Cambridge, UK), p-CREB (diluted 1:500; Abcam, Cambridge, UK), AKT (diluted 1:200; Cell Signaling Technology, Danvers, MA, USA), p-AKT (diluted 1:200; Cell Signaling Technology, Danvers, MA, USA), Caspase-3 (diluted 1:500; Abcam, Cambridge, UK), α-SMA (α-smooth muscle actin, diluted 1:500) ; Abcam, Cambridge, UK), and β-actin (diluted 1:1000; Abcam, Cambridge, UK).
또한, 실시예에서 가짜 대조군(sham control)은 정상적인 대조군 그룹이다. NB는 신경인성 방광증 그룹을 의미한다. NB+ImMSC(BDNF)는 본 발명에 따른 BDNF 고발현 중간엽 줄기세포를 주입한 그룹이며, imMSC는 빈 벡터로 형질감염된 중간엽 줄기세포를 주입한 그룹을 의미한다.Also, in the examples, the sham control is a normal control group. NB means neurogenic cystopathy group. NB+ImMSC (BDNF) refers to a group injected with BDNF high-expressing mesenchymal stem cells according to the present invention, and imMSC refers to a group injected with mesenchymal stem cells transfected with an empty vector.
실시예 1. BDNF를 고발현하는 중간엽 줄기세포의 제조Example 1. Preparation of mesenchymal stem cells highly expressing BDNF
1차 골수-유래 중간엽 줄기세포(BM-MSCs)는 20% 소 태아 혈청 및 5 ng/ml 기본 섬유 아세포 성장인자(bFGF, Cell Signaling Technology, Danvers, US)가 보충된 저 포도당-함유 DMEM 배 (Gibco, US) 하에 5% CO2 및 37℃에서 배양되었으나, 조절된 BM-MSCs는 10% FBS로 배양되었다. BDNF를 고발현하는 골수-유래 중간엽 줄기세포를 생성하기 위해, c-myc, hTERT 및 테트라사이클린 트랜스 액티베이터(tTA) 및 BDNF 유전자를 합성하고, pBD 렌티바이러스 벡터(SL BIGEN, 성남, 한국)로 형질감염시켰다. 요약하면, BDNF의 레퍼런스 서열은 NP_733927.1이며, 벡터에 도입하기 위해 최적화된 DNA 서열을 준비하였다(Genscript, NJ, USA). 상기 도입된 염기서열의 올바른 리딩 프레임이 올바른지 확인하기 위해 DNA 염기 서열 분석을 수행하였다(Cosmogenetech, Seoul, Korea). 냉동 보존된 세포를 해동하고 웰 당 1×105 세포의 밀도로 12-웰 플레이트에 분주하였다. 48 시간 후, 상청액을 수확하고 BDNF 단백질 수준을 측정하였으며, BDNF의 적격 발현 수준은 약 400 ng/ml 이었다. 형질 감염된 BDNF 고발현 중간엽 줄기세포[imMSC(BDNF)]는 항생제에 의해 단일 클론으로 선택되었다. 선별된 imMSC(BDNF)는 제한 희석 방법에 의해 분리된 세포 집단이며, imMSC는 BDNF가 도입되지 않은 세포 집단이다. 최종 단일클론 세포는 BDNF 단백질 발현, 증식 속도 및 기타 MSC 표현형에 의해 선택되었다. 생체 내 주입 전, 조절된 imMSC를 조사하였다(불사화된 줄기 세포는 생체 내에서 종양을 유발할 가능성이 있기 때문에 증식을 중지하기 위해 투여 전에 조사하였음).Primary bone marrow-derived mesenchymal stem cells (BM-MSCs) were prepared in low glucose-containing DMEM embryos supplemented with 20% fetal bovine serum and 5 ng/ml basal fibroblast growth factor (bFGF, Cell Signaling Technology, Danvers, US). (Gibco, US) at 5% CO 2 and 37° C., but conditioned BM-MSCs were incubated with 10% FBS. To generate bone marrow-derived mesenchymal stem cells highly expressing BDNF, c-myc, hTERT and tetracycline transactivator (tTA) and BDNF genes were synthesized, and pBD lentiviral vector (SL BIGEN, Seongnam, Korea) was used. transfected. In summary, the reference sequence of BDNF is NP_733927.1, and an optimized DNA sequence was prepared for introduction into the vector (Genscript, NJ, USA). DNA sequencing was performed to confirm that the correct reading frame of the introduced nucleotide sequence was correct (Cosmogenetech, Seoul, Korea). Cryopreserved cells were thawed and seeded into 12-well plates at a density of 1×10 5 cells per well. After 48 hours, the supernatant was harvested and BDNF protein levels were measured, and the competent expression level of BDNF was about 400 ng/ml. Transfected BDNF high-expressing mesenchymal stem cells [imMSC(BDNF)] were selected as single clones by antibiotics. Selected imMSC (BDNF) is a cell population isolated by limiting dilution method, and imMSC is a cell population to which BDNF is not introduced. The final monoclonal cells were selected by BDNF protein expression, proliferation rate and other MSC phenotypes. Prior to in vivo injection, modulated imMSCs were irradiated (immortalized stem cells were irradiated prior to administration to stop proliferation because of their potential to induce tumors in vivo).
실시예 2. 신경인성 방광증 모델에서 BDNF를 고발현하는 중간엽 줄기세포를 이용한 치료Example 2. Treatment using mesenchymal stem cells expressing high BDNF in neurogenic cystopathy model
상기 NB+imMSCs 및 NB+imMSCs(BDNF) 그룹에서, 두 종류의 imMSCs(인산 완충 식염수에 희석된 1×106 MSCs)를 NB 유도 1 주 후 마취 하에 방광 양쪽 근육 조직(방광벽의 평활근 근처)에 주입하였다. NB 그룹의 랫에게 동일한 양의 생리 식염수를 주입하였다. 투여된 imMSC의 위치를 추적하기 위해, 제조업체의 프로토콜에 따라 형광 염료(Cell Tracker™ CM-DiI; Molecular Probes, Eugene, OR, USA)로 라벨링하였다.In the NB+imMSCs and NB+imMSCs (BDNF) groups, two types of imMSCs (1×10 6 MSCs diluted in phosphate buffered saline) were injected into the muscle tissue on both sides of the bladder (near the smooth muscle of the bladder wall) under anesthesia 1 week after NB induction. injected. The rats in the NB group were injected with the same amount of physiological saline. To track the location of administered imMSCs, they were labeled with a fluorescent dye (Cell Tracker™ CM-DiI; Molecular Probes, Eugene, OR, USA) according to the manufacturer's protocol.
실험예 1. ELISA 분석을 통한 BDNF의 고발현 확인Experimental Example 1. Confirmation of high expression of BDNF through ELISA analysis
상기 실시예에서 제조된 BM-MSCs(imMSCs) 및 imMSCs(BDNF)를 100 mm 페트리디쉬에 시딩하였다. 접착 후, 완전 성장 배지를 제거하고 세포를 PBS로 3 회 세척 하였다. 그 후 10 mL의 무 혈청 염기성 배지로 다시 채우고 37℃에서 5 % CO2로 3 일 동안 배양하였다. 수집한 배지는 3000 rpm, 4℃에서 15 분간 원심분리하였다. 수집한 상청액, imMSC 및 imMSC(BDNF) 조절 배지 (CM)를 사용하여 제조업체의 프로토콜에 따라 ELISA(R & D Systems Europe, Abingdon, 영국)에서 BDNF의 각 그룹을 검사하였다. 흡광도는 450 nm 마이크로 플레이트 리더(Synergy H1 M, Biotek, USA)에서 판독되었다. 각 클론에 대해 적어도 3 개의 분리된 세포 디쉬를 분석하였다.BM-MSCs (imMSCs) and imMSCs (BDNF) prepared in the above Example were seeded in 100 mm Petri dishes. After adhesion, complete growth medium was removed and cells were washed 3 times with PBS. Then, it was refilled with 10 mL of serum-free basic medium and incubated at 37° C. with 5% CO 2 for 3 days. The collected medium was centrifuged at 3000 rpm and 4° C. for 15 minutes. Each group of BDNF was tested in an ELISA (R&D Systems Europe, Abingdon, UK) using the collected supernatant, imMSC and imMSC(BDNF) conditioned medium (CM) according to the manufacturer's protocol. Absorbance was read on a 450 nm microplate reader (Synergy H1 M, Biotek, USA). At least three isolated cell dishes were analyzed for each clone.
각각의 그룹들에서 BDNF의 발현을 관찰하고, 동물실험 동안 BDNF의 국소적인 고발현을 확인하였으며, in vivo 및 in vitro 실험에서도 BDNF의 발현을 감지하였다. 상청액의 BDNF 농도는 세포 주입 전에 시험관 내에서 측정되었다.BDNF expression was observed in each group, local high expression of BDNF was confirmed during animal experiments, and BDNF expression was detected in in vivo and in vitro experiments. The BDNF concentration in the supernatant was measured in vitro prior to cell injection.
도 2에서 나타낸 바와 같이, ELISA 결과는 imMSCs(BDNF)가 in vitro 실험 결과에서 BDNF 발현을 증가시키는 것으로 나타났다 (P < 0.01). As shown in FIG. 2 , ELISA results showed that imMSCs (BDNF) increased BDNF expression in vitro (P < 0.01).
도 1의 (a) 내지 (d)에서, 대조군인 NB(n=8) 그룹에서의 BDNF의 발현이 조직에서 가장 낮다는 것을 발견했다. 또한, NB+imMSCs(n=8) 및 NB+imMSC (BDNF)(n=8) 그룹의 발현 수준은 NB 그룹보다 유의하게 높으며, 본 발명에 따른 NB+imMSC(BDNF) 그룹의 발현 수준은 NB+imMSCs 그룹의 발현보다 유의하게 높았다 (P < 0.01). 이것은 도 3의 정량적 결과에도 표시되었다. 1 (a) to (d), it was found that the expression of BDNF in the NB (n=8) group as a control group was the lowest in the tissue. In addition, the expression levels of the NB+imMSCs (n=8) and NB+imMSCs (BDNF) (n=8) groups were significantly higher than that of the NB group, and the expression levels of the NB+imMSCs (BDNF) group according to the present invention were NB The expression was significantly higher than that of the +imMSCs group (P < 0.01). This was also indicated in the quantitative results of FIG. 3 .
상기 결과로부터, in vivo 실험에서 imMSCs(BDNF)가 imMSC 에 비해 BDNF를 더욱 많이 발현하였음을 확인하였다.From the above results, it was confirmed that imMSCs (BDNF) expressed more BDNF than imMSCs in an in vivo experiment.
실험예 2. 방광계 검사(Cystometry)를 통한 방광 기능의 확인Experimental Example 2. Confirmation of bladder function through cystometry
모든 그룹들의 랫은 치료 후 방광 기능을 확인하기 위해 4 일째에 방광계 검사를 수행하였다. 랫은 1.2 mg/kg 우레탄 피하 주사로 마취되었다. 치골상 정중선 상부 개복술을 사용하여 방광을 노출시키고 폴리에틸렌 튜브에 연결된 25-게이지 바늘을 방광 원개(bladder dome)를 통해 방광에 삽입하였다. 상기 튜브를 3-방향 스톱콕을 통해 압력 변환기 및 Harvard 시린지 펌프에 연결하여 방광 내 압력을 기록하고 방광에 식염수를 주입하였다. 상기 방광을 비운 후, 0.04 mL/min의 속도로 식염수를 주입하여 방광계 검사를 수행하였다. 수축 간격 및 수축 압력(배뇨 중 최대 방광 압력)은 폴리그래프 (Grass 7D; Grass Institute Co, Quincy, MA, USA)를 이용하여 기록하였다. 비 공극 수축(Nonvoiding contraction, NVC)은 각 공극 수축 2 내지 4 분 전에 기록되었다. 비 공극 수축은 방광이 채워지는 동안의 기준 압력과 비교하여 > 4 cm H2O의 수축으로 정의되었다. All groups of rats were subjected to cystologic examination on day 4 to confirm bladder function after treatment. Rats were anesthetized with 1.2 mg/kg urethane subcutaneous injection. A suprapubic midline laparotomy was used to expose the bladder and a 25-gauge needle connected to a polyethylene tube was inserted through the bladder dome into the bladder. The tubing was connected to a pressure transducer and Harvard syringe pump via a 3-way stopcock to record the pressure in the bladder and saline was injected into the bladder. After emptying the bladder, saline was injected at a rate of 0.04 mL/min to perform a bladder test. The contraction interval and contraction pressure (maximum bladder pressure during urination) were recorded using a polygraph (Grass 7D; Grass Institute Co, Quincy, MA, USA). Nonvoiding contractions (NVCs) were recorded 2 to 4 minutes before each void contraction. Nasal contraction was defined as contraction of >4 cm H 2 O compared to baseline pressure during bladder filling.
도 4 내지 도 5에서 나타낸 바와 같이, 대조군인 NB 그룹의 평균 수축 간격은 다른 군보다 길었다(P <0.01). As shown in FIGS. 4 to 5 , the average contraction interval of the NB group as a control group was longer than that of the other groups (P <0.01).
또한, 도 5에 나타낸 바와 같이, NB+imMSC (BDNF)(n=8) 및 NB+imMSC(n=8) 그룹의 평균 수축 간격은 대조군인 NB(n=8) 그룹의 평균 수축 간격보다 짧았으며 (P < 0.01), 본 발명에 따른 NB+imMSCs(BDNF) 그룹의 평균 수축 간격은 NB+imMSCs 그룹보다 짧았다 (P < 0.01). In addition, as shown in Fig. 5, the mean contraction interval of the NB+imMSC (BDNF) (n=8) and NB+imMSC (n=8) groups was shorter than that of the control group, NB (n=8) group. and (P < 0.01), the mean contraction interval of the NB+imMSCs (BDNF) group according to the present invention was shorter than that of the NB+imMSCs group (P < 0.01).
상기 결과로부터, BDNF의 고발현 환경에서 imMSCs의 처리에 의하여 신경인성 방광증(NB)를 효과적으로 개선시킬 수 있음을 확인하였다. From the above results, it was confirmed that neurogenic cystopathy (NB) can be effectively improved by treatment of imMSCs in an environment of high BDNF expression.
실험예 3. 면역형광 염색(Immunofluorescent staining) 분석을 통한 신경 조직의 회복 확인Experimental Example 3. Confirmation of recovery of nerve tissue through immunofluorescent staining analysis
방광계 검사 후, 신경의 회복을 확인하기 위해, 먼저 MPG 및 PN(Pelvic Nerve, 골반 신경), 및 방광을 채취하였다. 채취된 MPG, PN, 및 방광을 4% 파라포름알데히드 하에 4°C에서 24 시간 동안 고정하여 파라핀 블록을 만들었다. 상기 1차 항체는 βIII-튜블린 (diluted 1:200; Abcam, Cambridge, UK), 뇌-유래 신경영양인자(BDNF diluted 1:100; Abcam, Cambridge, UK), 및 PARP(poly-ADP-ribose polymerase, diluted 1:500; Abcam, Cambridge, UK)가 사용되었다. 6-디아미디노-2-페닐인돌 (DAPI; Vector Laboratories, Inc., Burlingame, CA, USA)을 사용하여 핵을 염색하였다. 디지털 이미지는 Zeiss LSM 510 Meta 공초점 현미경 (Zeiss, Oberkochen, Germany)을 이용하여 수득되었다. 평균 세기는 ZEN 2012 (Zeiss)를 이용하여 계산되었다.After examination of the bladder system, to confirm nerve recovery, MPG and PN (Pelvic Nerve, pelvic nerve), and bladder were first collected. The harvested MPG, PN, and bladder were fixed in 4% paraformaldehyde at 4 °C for 24 h to make paraffin blocks. The primary antibody was βIII-tubulin (diluted 1:200; Abcam, Cambridge, UK), brain-derived neurotrophic factor (BDNF diluted 1:100; Abcam, Cambridge, UK), and poly-ADP-ribose polymerase (PARP). , diluted 1:500; Abcam, Cambridge, UK) was used. Nuclei were stained using 6-diamidino-2-phenylindole (DAPI; Vector Laboratories, Inc., Burlingame, CA, USA). Digital images were obtained using a Zeiss LSM 510 Meta confocal microscope (Zeiss, Oberkochen, Germany). The mean intensity was calculated using ZEN 2012 (Zeiss).
도 6 및 도 7에 나타낸 바와 같이, 정량적 분석은 대조군인 NB(n=8) 그룹에 비해 NB+imMSC(BDNF)(n=8) 및 NB+imMSC(n=8) 그룹이 유의한 신경학적 회복을 나타내고 있으며 (P < 0.01), 특히, 본 발명에 따른 NB+imMSCs(BDNF) 그룹의 회복율의 경우 NB+imMSCs 그룹의 회복율보다 높다는 것을 나타내었다 (P <0.01). 도 1의 (a) 내지 (d)에 나타낸 바와 같이, 본 발명에 따른 imMSC(BDNF)는 더 많은 BDNF를 발현하여 신경 손상 주위에 더 높은 BDNF 미세 환경을 형성하고, 신경 회복을 가속화할 수 있다.As shown in Figures 6 and 7, quantitative analysis showed that the NB+imMSC(BDNF) (n=8) and NB+imMSC (n=8) groups had significant neurological effects compared to the control group NB (n=8). It showed recovery (P < 0.01), and in particular, the recovery rate of the NB+imMSCs (BDNF) group according to the present invention was higher than that of the NB+imMSCs group (P <0.01). As shown in Fig. 1 (a) to (d), imMSC (BDNF) according to the present invention can express more BDNF to form a higher BDNF microenvironment around nerve damage and accelerate nerve recovery. .
실험예 4. 웨스턴 블럿(Western Blot) 분석을 통한 세포사멸의 감소 및 근육 조직의 회복 확인Experimental Example 4. Confirmation of reduction of apoptosis and recovery of muscle tissue through Western Blot analysis
상기 채취된 조직들은 에틸렌 디아민 테트라 아세트산(ethylene diamine tetra acetic acid)을 포함하지 않는 프로테아제 억제제 칵테일 및 포스파타제 억제제 칵테일(Roche Diagnostics GmbH)을 포함하는 차가운 RIPA 완충 용액(Cell Signaling Technology, Danvers, MA, USA)을 사용하여 균질화되었다. 미립자 덩어리는 4°C에서 15 분 동안 15,000 g으로 원심 분리하여 제거되었다. 상청액은 SDS-PAGE로 분석되었다.The harvested tissues were prepared in cold RIPA buffer solution (Cell Signaling Technology, Danvers, MA, USA) containing a protease inhibitor cocktail without ethylene diamine tetra acetic acid and a phosphatase inhibitor cocktail (Roche Diagnostics GmbH). was homogenized using Particulate clumps were removed by centrifugation at 15,000 g for 15 min at 4 °C. The supernatant was analyzed by SDS-PAGE.
MPG가 손상된 3 그룹의 NB 모델들에서, PARP 및 Caspase-3를 검출하여 MPG의 세포 사멸을 확인하였고, α-평활근 액틴 검출을 통해 각 그룹의 근육 조직 회복을 관찰하였다.In the three groups of NB models in which MPG was damaged, apoptosis of MPG was confirmed by detecting PARP and Caspase-3, and muscle tissue recovery of each group was observed by detecting α-smooth muscle actin.
도 8 내지 도 12는 MPG 세포의 세포사멸을 나타낸다. 도 8 내지 도 12에 나타낸 바와 같이, 줄기세포를 이용한 치료를 진행하지 않을 경우, 손상된 MPG의 세포 사멸은 여전히 높은 것을 확인할 수 있었다(P <0.01). 그러나, imMSCs 주입 후 세포사멸은 현저하게 감소하였으며, 본 발명에 따른 NB+imMSCs(BDNF)(n=8)의 세포사멸은 NB+imMSCs(n=8) 그룹의 세포사멸보다 낮게 나타났다 (P < 0.01). 상기 대조군인 NB(n=8) 그룹의 근육 조직 발현은 현저히 감소하였지만(P < 0.01), imMSC 주입 후 근육 조직은 유의하게 증가하였으며 (P <0.01), 본 발명에 따른 NB+imMSC(BDNF)(n=8) 그룹의 근육 조직은 상기 NB+imMSCs (n=8) 그룹의 근육 조직보다 빠르게 회복되었다 (P < 0.05). 8 to 12 show apoptosis of MPG cells. As shown in FIGS. 8 to 12 , when treatment using stem cells was not performed, it was confirmed that apoptosis of damaged MPG was still high (P <0.01). However, after injection of imMSCs, apoptosis was significantly reduced, and the apoptosis of NB+imMSCs(BDNF)(n=8) according to the present invention was lower than that of the NB+imMSCs(n=8) group (P < 0.01). The muscle tissue expression of the control group, NB (n=8) group, was significantly reduced (P < 0.01), but after imMSC injection, muscle tissue increased significantly (P < 0.01), and NB+imMSC (BDNF) according to the present invention The muscle tissue of the (n=8) group recovered faster than the muscle tissue of the NB+imMSCs (n=8) group (P < 0.05).
상기 결과로부터, BDNF가 고발현될 경우 세포사멸이 크게 감소하고, 근육 조직의 회복이 가속화되었음을 확인하였다. From the above results, it was confirmed that when BDNF was highly expressed, apoptosis was greatly reduced, and recovery of muscle tissue was accelerated.
실험예 5. BDNF/TrkB/CREB 신호전달경로 활성화 확인Experimental Example 5. Confirmation of activation of BDNF/TrkB/CREB signaling pathway
BDNF/TrkB/CREB 신호전달경로의 향상은 신경조직의 회복에 있어 중요한 요소이다. 본 발명에 따른 치료 효과의 메커니즘을 확인하기 위해, 추출된 조직에서의 BDNF 발현, TrkB, Akt, 및 CREB 인산화 수준을 측정하였다. The enhancement of the BDNF/TrkB/CREB signaling pathway is an important factor in the recovery of nerve tissue. In order to confirm the mechanism of the therapeutic effect according to the present invention, BDNF expression, TrkB, Akt, and CREB phosphorylation levels in the extracted tissues were measured.
도 13 및 도 14에 나타낸 바와 같이, BDNF 발현은 도 1의 (a) 내지 (d)과 동일한 반면, TrkB, Akt, 및 CREB 인산화 수준은 상기 BN(n=8) 그룹에서 유의하게 감소하였다 (P < 0.01). imMSCs 처리 후, 상기 인산화 수준은 유의하게 증가하였으며, 본 발명에 따른 NB+imMSCs(BDNF)(n=8)의 인산화 수준은 상기 NB+imMSCs(n=8) 그룹의 인산화 수준보다 유의하게 높았다 (P < 0.01). As shown in FIGS. 13 and 14 , BDNF expression was the same as that of FIG. 1 (a) to (d), while TrkB, Akt, and CREB phosphorylation levels were significantly decreased in the BN (n=8) group ( P < 0.01). After treatment with imMSCs, the phosphorylation level was significantly increased, and the phosphorylation level of NB+imMSCs(BDNF)(n=8) according to the present invention was significantly higher than that of the NB+imMSCs(n=8) group ( P < 0.01).
상기 결과로부터, BDNF의 고발현이 손상된 신경 주변의 BDNF/TrkB/CREB 신호전달경로를 강화하여 신경 복구에 영향을 미칠 수 있음을 확인하였다. From the above results, it was confirmed that high expression of BDNF can affect nerve repair by enhancing the BDNF/TrkB/CREB signaling pathway around the damaged nerve.
본 발명에서, 먼저 신경인성 방광증 랫 모델을 확립하였고, 다음으로 BDNF를 고발현하는 불사화된 중간엽 줄기세포를 상기 랫에 주입하여 신경인성 방광증의 치료 효과를 확인하였다. MSC는 손상된 조직 주위에 클러스터됨으로써 조직의 기능을 복구한다. In the present invention, a rat model of neurogenic cystopathy was first established, and then, immortalized mesenchymal stem cells expressing high BDNF were injected into the rat to confirm the therapeutic effect of neurogenic cystopathy. MSCs restore tissue function by clustering around the damaged tissue.
종래 연구에서, 활성산소종(ROS)이 주사된 줄기세포는 독성이 있다고 보고되었다. 세포 사멸의 유도는 MSC를 빠르게 감소시킬 수 있는 ROS-유도 세포 독성의 주요 메커니즘이며, 결과적으로 표적 조직의 MSC 수가 계속 감소하게 되고 이에 의해 효과가 감소한다. 따라서, 본 발명에서는 줄기세포의 세포 사멸을 피하기 위해 불사화된 중간엽 줄기세포를 사용함으로써 안전성을 확립하였다.In previous studies, it has been reported that stem cells injected with reactive oxygen species (ROS) are toxic. Induction of apoptosis is a major mechanism of ROS-induced cytotoxicity that can rapidly reduce MSCs, and consequently the number of MSCs in target tissues continues to decrease, thereby reducing their effectiveness. Therefore, in the present invention, safety was established by using immortalized mesenchymal stem cells to avoid apoptosis of stem cells.
또한, 본 발명에서는 BDNF를 고발현하는 불사화된 중간엽 줄기세포가 일반적인 불사화 중간엽 줄기세포보다 더 많은 BDNF를 발현하도록 허용하는 유전자 전달 기술(gene transfer technique)을 사용하였다. 상기 imMSCs 주입 후, NB 랫의 평균 방광 내압이 유의하게 증가하고 방광에서 α-SMA의 발현이 유의하게 증가하는 것을 발견하였다. 동시에, 상기 NB 쥐 모델에서 MPG에 의해 손상된 신경 주변에 BDNF의 발현이 많을수록 신경 및 방광 근육 조직의 회복이 더 좋고 세포 사멸이 감소한다는 것을 발견하였다. 이러한 결과는 imMSC가 신경성 방광의 기능 회복 및 조직 복구에 좋은 영향을 미치는 반면, 더 높은 BDNF 발현은 더 나은 결과를 얻을 수 있음을 보여준다. 상기 BDNF는 고친화성 수용체 TrkB에 결합하여 Akt 및 CREB의 인산화를 유도함으로써 산화 스트레스로부터 신경 세포를 보호하고 복구하는 역할을 수행한다. 활성화된 TrkB는 PI3K/Akt, Ras/MAPK/ERK 및 CaM 신호 전달 경로를 포함한 여러 세포 내 표적과 상호 작용하고 인산화한다. 활성화된 Akt는 기질을 인산화하고 세포 사멸 인자 BAD 및 p53을 포함한 많은 키나아제의 활성에 영향을 준다. 중요한 핵 전사 인자(nuclear transcription factor)인 CREB의 활성화는 장기적인 기억 발달 뒤에 구조적 변화로 이어지는 신호 전달 단계의 핵심 단계인 것으로 보여진다. 흥미롭게도, 상기 BDNF는 Akt를 활성화하여 CREB 활성화를 유도하고 지속적인 CREB 신호를 생성하는 반면, 상기 CREB 신호 루프는 궁극적으로 BDNF의 유도를 제어하는 데 관여하였다. In addition, in the present invention, a gene transfer technique was used that allows immortalized mesenchymal stem cells that express high BDNF to express more BDNF than general immortalized mesenchymal stem cells. After the imMSCs injection, it was found that the mean intravesical pressure in NB rats significantly increased and the expression of α-SMA in the bladder significantly increased. At the same time, it was found that the higher the expression of BDNF around the nerve damaged by MPG in the NB mouse model, the better the recovery of nerve and bladder muscle tissue and the reduction of apoptosis. These results show that imMSCs have a good effect on functional recovery and tissue repair of neurogenic bladder, whereas higher BDNF expression can lead to better results. The BDNF functions to protect and repair neurons from oxidative stress by inducing phosphorylation of Akt and CREB by binding to the high affinity receptor TrkB. Activated TrkB interacts with and phosphorylates several intracellular targets, including PI3K/Akt, Ras/MAPK/ERK, and CaM signaling pathways. Activated Akt phosphorylates substrates and affects the activity of many kinases, including the apoptosis factors BAD and p53. Activation of CREB, an important nuclear transcription factor, appears to be a key step in the signaling step leading to structural changes following long-term memory development. Interestingly, the BDNF activates Akt to induce CREB activation and generates a persistent CREB signal, whereas the CREB signal loop was ultimately involved in controlling the induction of BDNF.
즉, 본 발명에 따르면, 신경이 손상된 랫 NB 모델에서 imMSC는 신경 조직 복구에 특정한 영향을 미친다. 상기 imMSC는 신경인성 방광증에서 기능 및 조직을 회복시키는 데 긍정적인 영향을 미칠 수 있다. 그와 동시에, 신경 손상 회복에 특별한 영향을 미치는 BDNF의 발현을 증가시킬 경우, 손상된 MPG를 보다 효과적으로 회복할 수 있음을 입증하였다. That is, according to the present invention, imMSC has a specific effect on nerve tissue repair in a rat NB model with nerve damage. The imMSC may have a positive effect on restoring function and tissue in neurogenic cystopathy. At the same time, it was demonstrated that the damaged MPG can be more effectively restored when the expression of BDNF, which has a special effect on nerve damage recovery, is increased.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. 예를 들어, 단일형으로 설명되어 있는 각 구성 요소는 분산되어 실시될 수도 있으며, 마찬가지로 분산된 것으로 설명되어 있는 구성 요소들도 결합된 형태로 실시될 수 있다.The foregoing description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. For example, each component described as a single type may be implemented in a distributed manner, and likewise components described as distributed may also be implemented in a combined form.
본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.The scope of the present invention is indicated by the following claims rather than the above detailed description, and all changes or modifications derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention. do.
<110> SLBIGEN Inc. CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> PHARMACEUTICAL COMPOSITION FOR TREATING OR IMPROVING NEUROGENIC BLADDER COMPRISING STEM CELLS EXPRESSING BRAIN-DERIVED NEUROTROPHIC FACTORS <130> 1068601 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 255 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of BDNF <400> 1 Met Phe His Gln Val Arg Arg Val Met Thr Ile Leu Phe Leu Thr Met 1 5 10 15 Val Ile Ser Tyr Phe Gly Cys Met Lys Ala Ala Pro Met Lys Glu Ala 20 25 30 Asn Ile Arg Gly Gln Gly Gly Leu Ala Tyr Pro Gly Val Arg Thr His 35 40 45 Gly Thr Leu Glu Ser Val Asn Gly Pro Lys Ala Gly Ser Arg Gly Leu 50 55 60 Thr Ser Leu Ala Asp Thr Phe Glu His Val Ile Glu Glu Leu Leu Asp 65 70 75 80 Glu Asp Gln Lys Val Arg Pro Asn Glu Glu Asn Asn Lys Asp Ala Asp 85 90 95 Leu Tyr Thr Ser Arg Val Met Leu Ser Ser Gln Val Pro Leu Glu Pro 100 105 110 Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys Asn Tyr Leu Asp Ala Ala 115 120 125 Asn Met Ser Met Arg Val Arg Arg His Ser Asp Pro Ala Arg Arg Gly 130 135 140 Glu Leu Ser Val Cys Asp Ser Ile Ser Glu Trp Val Thr Ala Ala Asp 145 150 155 160 Lys Lys Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu Glu 165 170 175 Lys Val Pro Val Ser Lys Gly Gln Leu Lys Gln Tyr Phe Tyr Glu Thr 180 185 190 Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Cys Arg Gly Ile Asp 195 200 205 Lys Arg His Trp Asn Ser Gln Cys Arg Thr Thr Gln Ser Tyr Val Arg 210 215 220 Ala Leu Thr Met Asp Ser Lys Lys Arg Ile Gly Trp Arg Phe Ile Arg 225 230 235 240 Ile Asp Thr Ser Cys Val Cys Thr Leu Thr Ile Lys Arg Gly Arg 245 250 255 <210> 2 <211> 768 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of BDNF <400> 2 atgttccacc aggtgagaag agtgatgacc atcctgttcc tgaccatggt gatcagctac 60 ttcggctgca tgaaggctgc ccctatgaag gaggccaaca tcagaggaca gggcggcctg 120 gcctaccccg gcgtgagaac ccacggcacc ctggagagcg tgaacggccc caaggccggc 180 agcagaggcc tgaccagcct ggccgacacc ttcgagcacg tgatcgagga gctgctggac 240 gaggaccaga aggtgagacc caacgaggag aacaacaagg acgccgacct gtacaccagc 300 agagtgatgc tgagcagcca ggtgcccctg gagcctcccc tgctgttcct gctggaggag 360 tacaagaact acctggacgc cgccaacatg agcatgagag tgagaagaca cagcgacccc 420 gccagaagag gcgagctgag cgtgtgcgac agcatcagcg agtgggtgac cgccgccgac 480 aagaagaccg ccgtggacat gagcggcggc accgtgaccg tgctggagaa ggtgcccgtg 540 agcaagggcc agctgaagca gtacttctac gagaccaagt gcaaccccat gggctacacc 600 aaggagggct gcagaggcat cgacaagaga cactggaaca gccagtgcag aaccacacag 660 agctacgtga gagccctgac catggacagc aagaagagaa tcggctggag attcatcaga 720 atcgacacca gctgcgtgtg caccctgacc atcaagagag gcagataa 768 <210> 3 <211> 1132 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hTERT <400> 3 Met Pro Arg Ala Pro Arg Cys Arg Ala Val Arg Ser Leu Leu Arg Ser 1 5 10 15 His Tyr Arg Glu Val Leu Pro Leu Ala Thr Phe Val Arg Arg Leu Gly 20 25 30 Pro Gln Gly Trp Arg Leu Val Gln Arg Gly Asp Pro Ala Ala Phe Arg 35 40 45 Ala Leu Val Ala Gln Cys Leu Val Cys Val Pro Trp Asp Ala Arg Pro 50 55 60 Pro Pro Ala Ala Pro Ser Phe Arg Gln Val Ser Cys Leu Lys Glu Leu 65 70 75 80 Val Ala Arg Val Leu Gln Arg Leu Cys Glu Arg Gly Ala Lys Asn Val 85 90 95 Leu Ala Phe Gly Phe Ala Leu Leu Asp Gly Ala Arg Gly Gly Pro Pro 100 105 110 Glu Ala Phe Thr Thr Ser Val Arg Ser Tyr Leu Pro Asn Thr Val Thr 115 120 125 Asp Ala Leu Arg Gly Ser Gly Ala Trp Gly Leu Leu Leu Arg Arg Val 130 135 140 Gly Asp Asp Val Leu Val His Leu Leu Ala Arg Cys Ala Leu Phe Val 145 150 155 160 Leu Val Ala Pro Ser Cys Ala Tyr Gln Val Cys Gly Pro Pro Leu Tyr 165 170 175 Gln Leu Gly Ala Ala Thr Gln Ala Arg Pro Pro Pro His Ala Ser Gly 180 185 190 Pro Arg Arg Arg Leu Gly Cys Glu Arg Ala Trp Asn His Ser Val Arg 195 200 205 Glu Ala Gly Val Pro Leu Gly Leu Pro Ala Pro Gly Ala Arg Arg Arg 210 215 220 Gly Gly Ser Ala Ser Arg Ser Leu Pro Leu Pro Lys Arg Pro Arg Arg 225 230 235 240 Gly Ala Ala Pro Glu Pro Glu Arg Thr Pro Val Gly Gln Gly Ser Trp 245 250 255 Ala His Pro Gly Arg Thr Arg Gly Pro Ser Asp Arg Gly Phe Cys Val 260 265 270 Val Ser Pro Ala Arg Pro Ala Glu Glu Ala Thr Ser Leu Glu Gly Ala 275 280 285 Leu Ser Gly Thr Arg His Ser His Pro Ser Val Gly Arg Gln His His 290 295 300 Ala Gly Pro Pro Ser Thr Ser Arg Pro Pro Arg Pro Trp Asp Thr Pro 305 310 315 320 Cys Pro Pro Val Tyr Ala Glu Thr Lys His Phe Leu Tyr Ser Ser Gly 325 330 335 Asp Lys Glu Gln Leu Arg Pro Ser Phe Leu Leu Ser Ser Leu Arg Pro 340 345 350 Ser Leu Thr Gly Ala Arg Arg Leu Val Glu Thr Ile Phe Leu Gly Ser 355 360 365 Arg Pro Trp Met Pro Gly Thr Pro Arg Arg Leu Pro Arg Leu Pro Gln 370 375 380 Arg Tyr Trp Gln Met Arg Pro Leu Phe Leu Glu Leu Leu Gly Asn His 385 390 395 400 Ala Gln Cys Pro Tyr Gly Val Leu Leu Lys Thr His Cys Pro Leu Arg 405 410 415 Ala Ala Val Thr Pro Ala Ala Gly Val Cys Ala Arg Glu Lys Pro Gln 420 425 430 Gly Ser Val Ala Ala Pro Glu Glu Glu Asp Thr Asp Pro Arg Arg Leu 435 440 445 Val Gln Leu Leu Arg Gln His Ser Ser Pro Trp Gln Val Tyr Gly Phe 450 455 460 Val Arg Ala Cys Leu Arg Arg Leu Val Pro Pro Gly Leu Trp Gly Ser 465 470 475 480 Arg His Asn Glu Arg Arg Phe Leu Arg Asn Thr Lys Lys Phe Ile Ser 485 490 495 Leu Gly Lys His Ala Lys Leu Ser Leu Gln Glu Leu Thr Trp Lys Met 500 505 510 Ser Val Arg Asp Cys Ala Trp Leu Arg Arg Ser Pro Gly Val Gly Cys 515 520 525 Val Pro Ala Ala Glu His Arg Leu Arg Glu Glu Ile Leu Ala Lys Phe 530 535 540 Leu His Trp Leu Met Ser Val Tyr Val Val Glu Leu Leu Arg Ser Phe 545 550 555 560 Phe Tyr Val Thr Glu Thr Thr Phe Gln Lys Asn Arg Leu Phe Phe Tyr 565 570 575 Arg Lys Ser Val Trp Ser Lys Leu Gln Ser Ile Gly Ile Arg Gln His 580 585 590 Leu Lys Arg Val Gln Leu Arg Glu Leu Ser Glu Ala Glu Val Arg Gln 595 600 605 His Arg Glu Ala Arg Pro Ala Leu Leu Thr Ser Arg Leu Arg Phe Ile 610 615 620 Pro Lys Pro Asp Gly Leu Arg Pro Ile Val Asn Met Asp Tyr Val Val 625 630 635 640 Gly Ala Arg Thr Phe Arg Arg Glu Lys Arg Ala Glu Arg Leu Thr Ser 645 650 655 Arg Val Lys Ala Leu Phe Ser Val Leu Asn Tyr Glu Arg Ala Arg Arg 660 665 670 Pro Gly Leu Leu Gly Ala Ser Val Leu Gly Leu Asp Asp Ile His Arg 675 680 685 Ala Trp Arg Thr Phe Val Leu Arg Val Arg Ala Gln Asp Pro Pro Pro 690 695 700 Glu Leu Tyr Phe Val Lys Val Asp Val Thr Gly Ala Tyr Asp Thr Ile 705 710 715 720 Pro Gln Asp Arg Leu Thr Glu Val Ile Ala Ser Ile Ile Lys Pro Gln 725 730 735 Asn Thr Tyr Cys Val Arg Arg Tyr Ala Val Val Gln Lys Ala Ala His 740 745 750 Gly His Val Arg Lys Ala Phe Lys Ser His Val Ser Thr Leu Thr Asp 755 760 765 Leu Gln Pro Tyr Met Arg Gln Phe Val Ala His Leu Gln Glu Thr Ser 770 775 780 Pro Leu Arg Asp Ala Val Val Ile Glu Gln Ser Ser Ser Leu Asn Glu 785 790 795 800 Ala Ser Ser Gly Leu Phe Asp Val Phe Leu Arg Phe Met Cys His His 805 810 815 Ala Val Arg Ile Arg Gly Lys Ser Tyr Val Gln Cys Gln Gly Ile Pro 820 825 830 Gln Gly Ser Ile Leu Ser Thr Leu Leu Cys Ser Leu Cys Tyr Gly Asp 835 840 845 Met Glu Asn Lys Leu Phe Ala Gly Ile Arg Arg Asp Gly Leu Leu Leu 850 855 860 Arg Leu Val Asp Asp Phe Leu Leu Val Thr Pro His Leu Thr His Ala 865 870 875 880 Lys Thr Phe Leu Arg Thr Leu Val Arg Gly Val Pro Glu Tyr Gly Cys 885 890 895 Val Val Asn Leu Arg Lys Thr Val Val Asn Phe Pro Val Glu Asp Glu 900 905 910 Ala Leu Gly Gly Thr Ala Phe Val Gln Met Pro Ala His Gly Leu Phe 915 920 925 Pro Trp Cys Gly Leu Leu Leu Asp Thr Arg Thr Leu Glu Val Gln Ser 930 935 940 Asp Tyr Ser Ser Tyr Ala Arg Thr Ser Ile Arg Ala Ser Leu Thr Phe 945 950 955 960 Asn Arg Gly Phe Lys Ala Gly Arg Asn Met Arg Arg Lys Leu Phe Gly 965 970 975 Val Leu Arg Leu Lys Cys His Ser Leu Phe Leu Asp Leu Gln Val Asn 980 985 990 Ser Leu Gln Thr Val Cys Thr Asn Ile Tyr Lys Ile Leu Leu Leu Gln 995 1000 1005 Ala Tyr Arg Phe His Ala Cys Val Leu Gln Leu Pro Phe His Gln Gln 1010 1015 1020 Val Trp Lys Asn Pro Thr Phe Phe Leu Arg Val Ile Ser Asp Thr Ala 1025 1030 1035 1040 Ser Leu Cys Tyr Ser Ile Leu Lys Ala Lys Asn Ala Gly Met Ser Leu 1045 1050 1055 Gly Ala Lys Gly Ala Ala Gly Pro Leu Pro Ser Glu Ala Val Gln Trp 1060 1065 1070 Leu Cys His Gln Ala Phe Leu Leu Lys Leu Thr Arg His Arg Val Thr 1075 1080 1085 Tyr Val Pro Leu Leu Gly Ser Leu Arg Thr Ala Gln Thr Gln Leu Ser 1090 1095 1100 Arg Lys Leu Pro Gly Thr Thr Leu Thr Ala Leu Glu Ala Ala Ala Asn 1105 1110 1115 1120 Pro Ala Leu Pro Ser Asp Phe Lys Thr Ile Leu Asp 1125 1130 <210> 4 <211> 3399 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of hTERT <400> 4 atgcccagag ctcccagatg cagagccgtg agaagcctgc tgagaagcca ctacagagag 60 gtgctgcccc tggccacctt cgtgagaaga ctgggacccc agggctggag actggtgcag 120 agaggcgacc ccgcagcctt tagagccctg gtggcccagt gcctggtgtg cgtgccctgg 180 gacgccagac ctcctcccgc tgcccccagc ttcagacagg tgagctgcct gaaggagctg 240 gtggccagag tgctccagag actgtgcgag agaggcgcca agaacgtgct ggcctttggc 300 ttcgccctgc tggatggagc cagaggcgga cctcccgagg ccttcaccac aagcgtgaga 360 agctacctgc ccaacaccgt gaccgatgcc ctgagaggct ccggcgcctg gggcctgctc 420 ctgagaagag tgggcgacga cgtgctggtg cacctgctgg ccagatgcgc cctgttcgtg 480 ctggtggctc ccagctgcgc ctaccaggtg tgcggacccc ctctgtacca gctgggagcc 540 gccacccagg caagaccccc tccccacgcc tctggaccca gaagaagact gggctgcgag 600 agagcctgga accacagcgt gagagaggct ggcgtgcccc tgggcctgcc cgcccctggc 660 gccagaagaa gaggcggcag cgccagcaga agcctgcccc tgcccaagag acccagacgc 720 ggcgccgctc ccgagcctga gagaacaccc gtgggccagg gcagctgggc ccaccccggc 780 agaaccagag gacccagcga cagaggcttc tgcgtggtga gccctgccag acccgccgag 840 gaggccacca gcctggaggg cgccctgagc ggcaccagac acagccaccc cagcgtgggc 900 agacagcacc acgccggccc tcctagcacc agcagacccc ccagaccttg ggacaccccc 960 tgcccccctg tgtacgccga gaccaagcac ttcctgtaca gcagcggcga caaggagcag 1020 ctgagaccca gcttcctgct gagctccctg agacccagcc tgaccggcgc cagaagactg 1080 gtggagacca tcttcctggg cagcagaccc tggatgcccg gcacccccag aagactgccc 1140 agactgcccc agagatactg gcagatgaga cccctgttcc tggagctgct gggcaaccac 1200 gcccagtgcc cctacggcgt gctgctgaag acccactgcc ccctgagagc tgccgtgacc 1260 cccgcagctg gcgtgtgcgc cagagagaag ccccagggca gcgtggccgc tcccgaggag 1320 gaggacaccg atcccagaag actggtgcag ctgctgagac agcacagcag cccctggcag 1380 gtgtacggct tcgtgagagc ctgcctgaga agactggtgc ctcccggcct gtggggcagc 1440 agacacaacg agagaagatt cctgagaaac accaagaagt tcatcagcct gggcaagcac 1500 gccaagctga gcctccagga gctgacatgg aagatgagcg tgagagactg cgcctggctg 1560 aggagaagcc ctggcgtggg ctgcgtgccc gccgccgagc acagactgag agaggagatc 1620 ctggccaagt ttctgcactg gctgatgagc gtgtacgtgg tggagctgct gagaagcttc 1680 ttctacgtga ccgagaccac attccagaag aacagactgt tcttttacag gaagagcgtg 1740 tggagcaagc tccagagcat cggcatcaga cagcacctga agagagtgca gctgagagag 1800 ctgagcgagg ccgaggtgag acagcacaga gaggccagac ccgccctgct gaccagcaga 1860 ctgagattca tccccaagcc cgatggcctg agacccatcg tgaacatgga ctacgtggtg 1920 ggagccagaa cctttagaag agagaagaga gccgagagac tgaccagcag agtgaaggcc 1980 ctgttcagcg tgctgaacta cgagagagcc agaagacccg gcctgctggg cgccagcgtg 2040 ctgggcctgg acgacatcca cagagcctgg agaaccttcg tgctgagagt gagagcccag 2100 gaccctcctc ccgagctgta cttcgtgaag gtggacgtga ccggcgccta cgacaccatc 2160 ccccaggaca gactgaccga ggtgatcgcc agcatcatca agccccagaa cacctactgc 2220 gtgagaagat acgccgtggt gcagaaggcc gcccacggcc acgtgagaaa ggccttcaag 2280 agccacgtga gcaccctgac cgacctccag ccctacatga gacagttcgt ggcccacctc 2340 caggagacca gccccctgag agatgccgtg gtgatcgagc agagctcttc cctgaacgag 2400 gcctccagcg gcctgttcga cgtgttcctg agattcatgt gccaccacgc cgtgagaatc 2460 agaggcaaga gctacgtgca gtgccagggc atcccccagg gcagcatcct gagcaccctg 2520 ctgtgcagcc tgtgctacgg cgacatggag aacaagctgt tcgctggcat cagaagagac 2580 ggcctgctgc tgagactggt ggacgacttc ctgctggtga ccccccacct gacccacgcc 2640 aagaccttcc tgagaaccct ggtgagaggc gtgcccgagt acggctgcgt ggtgaacctg 2700 agaaagaccg tggtgaactt tcccgtggag gacgaggccc tgggcggcac cgccttcgtg 2760 cagatgcccg cccacggcct gtttccctgg tgcggcctgc tcctcgacac cagaaccctg 2820 gaggtgcaga gcgactacag cagctacgca agaaccagca tcagagccag cctgaccttc 2880 aacagaggct tcaaggccgg cagaaacatg agaagaaagc tgttcggcgt gctgagactg 2940 aagtgccaca gcctgttcct ggacctccag gtgaacagcc tccagaccgt gtgcaccaac 3000 atctacaaga tcctgctgct ccaggcctac agattccacg cctgcgtgct ccagctgccc 3060 ttccaccagc aggtgtggaa gaatcccacc ttcttcctga gagtgatcag cgacaccgcc 3120 agcctgtgct acagcatcct gaaggccaag aatgccggca tgagcctggg cgccaagggc 3180 gccgctggac ccctgcccag cgaggccgtg cagtggctgt gccaccaggc cttcctgctg 3240 aagctgacca gacacagagt gacctacgtg cccctgctgg gcagcctgag aaccgcccag 3300 acccagctga gcagaaagct gcctggcaca accctgaccg ccctggaggc agccgcaaac 3360 cccgccctgc ccagcgactt caagaccatc ctggactag 3399 <210> 5 <211> 454 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of c-Myc <400> 5 Met Asp Phe Phe Arg Val Val Glu Asn Gln Gln Pro Pro Ala Thr Met 1 5 10 15 Pro Leu Asn Val Ser Phe Thr Asn Arg Asn Tyr Asp Leu Asp Tyr Asp 20 25 30 Ser Val Gln Pro Tyr Phe Tyr Cys Asp Glu Glu Glu Asn Phe Tyr Gln 35 40 45 Gln Gln Gln Gln Ser Glu Leu Gln Pro Pro Ala Pro Ser Glu Asp Ile 50 55 60 Trp Lys Lys Phe Glu Leu Leu Pro Thr Pro Pro Leu Ser Pro Ser Arg 65 70 75 80 Arg Ser Gly Leu Cys Ser Pro Ser Tyr Val Ala Val Thr Pro Phe Ser 85 90 95 Leu Arg Gly Asp Asn Asp Gly Gly Gly Gly Ser Phe Ser Thr Ala Asp 100 105 110 Gln Leu Glu Met Val Thr Glu Leu Leu Gly Gly Asp Met Val Asn Gln 115 120 125 Ser Phe Ile Cys Asp Pro Asp Asp Glu Thr Phe Ile Lys Asn Ile Ile 130 135 140 Ile Gln Asp Cys Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu Val 145 150 155 160 Ser Glu Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser Gly Ser 165 170 175 Pro Asn Pro Ala Arg Gly His Ser Val Cys Ser Thr Ser Ser Leu Tyr 180 185 190 Leu Gln Asp Leu Ser Ala Ala Ala Ser Glu Cys Ile Asp Pro Ser Val 195 200 205 Val Phe Pro Tyr Pro Leu Asn Asp Ser Ser Ser Pro Lys Ser Cys Ala 210 215 220 Ser Gln Asp Ser Ser Ala Phe Ser Pro Ser Ser Asp Ser Leu Leu Ser 225 230 235 240 Ser Thr Glu Ser Ser Pro Gln Gly Ser Pro Glu Pro Leu Val Leu His 245 250 255 Glu Glu Thr Pro Pro Thr Thr Ser Ser Asp Ser Glu Glu Glu Gln Glu 260 265 270 Asp Glu Glu Glu Ile Asp Val Val Ser Val Glu Lys Arg Gln Ala Pro 275 280 285 Gly Lys Arg Ser Glu Ser Gly Ser Pro Ser Ala Gly Gly His Ser Lys 290 295 300 Pro Pro His Ser Pro Leu Val Leu Lys Arg Cys His Val Ser Thr His 305 310 315 320 Gln His Asn Tyr Ala Ala Pro Pro Ser Thr Arg Lys Asp Tyr Pro Ala 325 330 335 Ala Lys Arg Val Lys Leu Asp Ser Val Arg Val Leu Arg Gln Ile Ser 340 345 350 Asn Asn Arg Lys Cys Thr Ser Pro Arg Ser Ser Asp Thr Glu Glu Asn 355 360 365 Val Lys Arg Arg Thr His Asn Val Leu Glu Arg Gln Arg Arg Asn Glu 370 375 380 Leu Lys Arg Ser Phe Phe Ala Leu Arg Asp Gln Ile Pro Glu Leu Glu 385 390 395 400 Asn Asn Glu Lys Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr Ala 405 410 415 Tyr Ile Leu Ser Val Gln Ala Glu Glu Gln Lys Leu Ile Ser Glu Glu 420 425 430 Asp Leu Leu Arg Lys Arg Arg Glu Gln Leu Lys His Lys Leu Glu Gln 435 440 445 Leu Arg Asn Ser Cys Ala 450 <210> 6 <211> 1365 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of c-Myc <400> 6 atggatttct ttcgcgtcgt cgagaaccag cagccacccg ccactatgcc tctgaacgtg 60 tcttttacta acaggaacta tgatctggat tacgacagcg tgcagcccta cttctattgc 120 gatgaggaag agaactttta tcagcagcag cagcagagcg agctgcagcc acctgcacct 180 tccgaagaca tttggaagaa attcgagctg ctgcctacac cacccctgtc tccaagtcgg 240 agaagcggcc tgtgttcacc cagctacgtg gccgtcactc ctttcagcct gaggggggac 300 aatgatggcg ggggaggctc cttttctaca gccgatcagc tggaaatggt gactgagctg 360 ctggggggag acatggtcaa ccagagcttc atttgcgatc ctgacgatga aacttttatc 420 aagaacatca tcatccagga ctgtatgtgg tcaggcttta gcgccgctgc aaagctggtg 480 tctgagaaac tggcaagtta tcaggccgct cggaaagata gtgggtcacc taacccagct 540 agaggacact ccgtgtgctc tacaagctcc ctgtacctgc aggacctgag cgcagccgct 600 tccgagtgta ttgatccctc cgtggtcttc ccctatcctc tgaatgactc tagttcaccc 660 aagagttgcg catcacagga cagctccgcc ttttcacctt ctagtgatag cctgctgtca 720 agcactgaat cctctccaca gggcagccca gagccactgg tgctgcatga agagacccct 780 ccaaccacaa gttcagattc cgaagaggaa caggaggacg aggaagagat cgatgtggtc 840 tctgtggaaa agcgccaggc tccaggaaaa cgaagcgagt ccggctctcc aagtgcagga 900 ggacactcca agccacctca ttctcccctg gtgctgaaaa ggtgccacgt ctccacccac 960 cagcataact acgcagcccc accctctaca cgaaaggact atccagctgc aaagcgcgtg 1020 aaactggata gcgtgagagt cctgaggcag atcagtaaca atcggaagtg tacttcaccc 1080 agaagctccg acaccgaaga gaacgtgaaa aggcgcaccc ataatgtcct ggaacgccag 1140 cgacggaatg agctgaagag gtccttcttt gccctgcgcg atcagattcc tgaactggag 1200 aacaatgaga aggctccaaa agtggtcatt ctgaagaaag ccacagctta catcctgtct 1260 gtgcaggccg aagagcagaa actgatcagt gaagaggacc tgctgagaaa acgcagggaa 1320 cagctgaaac ataaactgga acagctgaga aactcttgtg cttaa 1365 <110> SLBIGEN Inc. CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> PHARMACEUTICAL COMPOSITION FOR TREATING OR IMPROVING NEUROGENIC BLADDER COMPRISING STEM CELLS EXPRESSING BRAIN-DERIVED NEUROTROPHIC FACTORS <130> 1 <170> <160> 255 PatentIn 3.0 <130> 1068601 <160> 212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of BDNF <400> 1 Met Phe His Gln Val Arg Arg Val Met Thr Ile Leu Phe Leu Thr Met 1 5 10 15 Val Ile Ser Tyr Phe Gly Cys Met Lys Ala Ala Pro Met Lys Glu Ala 20 25 30 Asn Ile Arg Gly Gln Gly Gly Leu Ala Tyr Pro Gly Val Arg Thr His 35 40 45 Gly Thr Leu Glu Ser Val Asn Gly Pro Lys Ala Gly Ser Arg Gly Leu 50 55 60 Thr Ser Leu Ala Asp Thr Phe Glu His Val Ile Glu Glu Leu Leu Asp 65 70 75 80 Glu Asp Gln Lys Val Arg Pro Asn Glu Glu Asn Asn Lys Asp Ala Asp 85 90 95 Leu Tyr Thr Ser Arg Val Met Leu Ser Ser Gln Val Pro Leu Glu Pro 100 105 110 Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys Asn Tyr Leu Asp Ala Ala 115 120 125 Asn Met Ser Met Arg Val Arg Arg His Ser Asp Pro Ala Arg Arg Gly 130 135 140 Glu Leu Ser Val Cys Asp Ser Ile Ser Glu Trp Val Thr Ala Ala Asp 145 150 155 160 Lys Lys Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu Glu 165 170 175 Lys Val Pro Val Ser Lys Gly Gln Leu Lys Gln Tyr Phe Tyr Glu Thr 180 185 190 Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Cys Arg Gly Ile Asp 195 200 205 Lys Arg His Trp Asn Ser Gln Cys Arg Thr Thr Thr Gln Ser Tyr Val Arg 210 215 220 Ala Leu Thr Met Asp Ser Lys Lys Arg Ile Gly Trp Arg Phe Ile Arg 225 230 235 240 Ile Asp Thr Ser Cys Val Cys Thr Leu Thr Ile Lys Arg Gly Arg 245 250 255 <210> 2 <211> 768 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of BDNF <400> 2 atgttccacc aggtgagaag agtgatgacc atcctgttcc tgaccatggt gatcagctac 60 ttcggctgca tgaaggctgc ccctatgaag gaggccaaca tcagaggaca gggcggcctg 120 gcctaccccg gcgtgagaac ccacggcacc ctggagagcg tgaacggccc caaggccggc 180 agcagaggcc tgaccagcct ggccgacacc ttcgagcacg tgatcgagga gctgctggac 240 gaggaccaga aggtgagacc caacgaggag aacaacaagg acgccgacct gtacaccagc 300 agagtgatgc tgagcagcca ggtgcccctg gagcctcccc tgctgttcct gctggaggag 360 tacaagaact acctggacgc cgccaacatg agcatgagag tgagaagaca cagcgacccc 420 gccagaagag gcgagctgag cgtgtgcgac agcatcagcg agtgggtgac cgccgccgac 480 aagaagaccg ccgtggacat gagcggcggc accgtgaccg tgctggagaa ggtgcccgtg 540 agcaagggcc agctgaagca gtacttctac gagaccaagt gcaaccccat gggctacacc 600 aaggagggct gcagaggcat cgacaagaga cactggaaca gccagtgcag aaccacacag 660 agctacgtga gagccctgac catggacagc aagaagagaa tcggctggag attcatcaga 720 atcgacacca gctgcgtgtg caccctgacc atcaagagag gcagataa 768 <210> 3 <211> 1132 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hTERT <400> 3 Met Pro Arg Ala Pro Arg Cys Arg Ala Val Arg Ser Leu Leu Arg Ser 1 5 10 15 His Tyr Arg Glu Val Leu Pro Leu Ala Thr Phe Val Arg Arg Leu Gly 20 25 30 Pro Gln Gly Trp Arg Leu Val Gln Arg Gly Asp Pro Ala Ala Phe Arg 35 40 45 Ala Leu Val Ala Gln Cys Leu Val Cys Val Pro Trp Asp Ala Arg Pro 50 55 60 Pro Pro Ala Ala Pro Ser Phe Arg Gln Val Ser Cys Leu Lys Glu Leu 65 70 75 80 Val Ala Arg Val Leu Gln Arg Leu Cys Glu Arg Gly Ala Lys Asn Val 85 90 95 Leu Ala Phe Gly Phe Ala Leu Leu Asp Gly Ala Arg Gly Gly Pro Pro 100 105 110 Glu Ala Phe Thr Thr Ser Val Arg Ser Tyr Leu Pro Asn Thr Val Thr 115 120 125 Asp Ala Leu Arg Gly Ser Gly Ala Trp Gly Leu Leu Leu Arg Arg Val 130 135 140 Gly Asp Asp Val Leu Val His Leu Leu Ala Arg Cys Ala Leu Phe Val 145 150 155 160 Leu Val Ala Pro Ser Cys Ala Tyr Gln Val Cys Gly Pro Pro Leu Tyr 16 5 170 175 Gln Leu Gly Ala Ala Thr Gln Ala Arg Pro Pro His Ala Ser Gly 180 185 190 Pro Arg Arg Arg Leu Gly Cys Glu Arg Ala Trp Asn His Ser Val Arg 195 200 205 Glu Ala Gly Val Pro Leu Gly Leu Pro Ala Pro Gly Ala Arg Arg Arg 210 215 220 Gly Gly Ser Ala Ser Arg Ser Leu Pro Leu Pro Lys Arg Pro Arg Arg 225 230 235 240 Gly Ala Ala Pro Glu Pro Glu Arg Thr Pro Val Gly Gly Gly Ser Trp 245 250 255 Ala His Pro Gly Arg Thr Arg Gly Pro Ser Asp Arg Gly Phe Cys Val 260 265 270 Val Ser Pro Ala Arg Pro Ala Glu Glu Ala Thr Ser Leu Glu Gly Ala 275 280 285 Leu Ser Gly Thr Arg His Ser His Pro Ser Val Gly Arg Gln His His 290 295 300 Ala Gly Pro Pro Ser Thr Ser Arg Pro Pro Arg Pro Trp Asp Thr Pro 305 310 315 320 Cys Pro Pro Val Tyr Ala Glu Thr Lys His Phe Leu Tyr Ser Ser Gly 325 330 335 Asp Lys Glu Gln Leu Arg Pro Ser Phe Leu Leu Ser Ser Leu Arg Pro 340 345 350 Ser Leu Thr Gly Ala Arg Arg Leu Val Glu Thr Ile Phe Leu Gly Ser 355 360 365 Arg Pro Trp Met Pro Gly Thr Pro Arg Arg Leu Pro Arg Leu Pro Gln 370 375 380 Arg Tyr Trp Gln Met Arg Pro Leu Phe Leu Glu Leu Leu Gly Asn His 385 390 395 400 Ala Gln Cys Pro Tyr Gly Val Leu Leu Lys Thr His Cys Pro Leu Arg 405 410 415 Ala Ala Val Thr Pro Ala Ala Gly Val Cys Ala Arg Glu Lys Pro Gln 420 425 430 Gly Ser Val Ala Pro Glu Glu Glu Asp Thr Asp Pro Arg Arg Leu 435 440 445 Val Gln Leu Leu Arg Gln His Ser Ser Pro Trp Gln Val Tyr Gly Ph e 450 455 460 Val Arg Ala Cys Leu Arg Arg Leu Val Pro Pro Gly Leu Trp Gly Ser 465 470 475 480 Arg His Asn Glu Arg Arg Phe Leu Arg Asn Thr Lys Lys Phe Ile Ser 485 490 495 Leu Gly Lys His Ala Lys Leu Ser Leu Gln Glu Leu Thr Trp Lys Met 500 505 510 Ser Val Arg Asp Cys Ala Trp Leu Arg Arg Ser Pro Gly Val Gly Cys 515 520 525 Val Pro Ala Ala Glu His Arg Leu Arg Glu Glu Ile Leu Ala Lys Phe 530 535 540 Leu His Trp Leu Met Ser Val Tyr Val Val Glu Leu Leu Arg Ser Phe 545 550 555 560 Phe Tyr Val Thr Glu Thr Thr Phe Gln Lys Asn Arg Leu Phe Phe Tyr 565 570 575 Arg Lys Ser Val Trp Ser Lys Leu Gln Ser Ile Gly Ile Arg Gln His 580 585 590 Leu Lys Arg Val Gln Leu Arg Glu Leu Ser Glu Ala Gl u Val Arg Gln 595 600 605 His Arg Glu Ala Arg Pro Ala Leu Leu Thr Ser Arg Leu Arg Phe Ile 610 615 620 Pro Lys Pro Asp Gly Leu Arg Pro Ile Val Asn Met Asp Tyr Val Val 625 630 635 640 Gly Ala Arg Thr Phe Arg Arg Glu Lys Arg Ala Glu Arg Leu Thr Ser 645 650 655 Arg Val Lys Ala Leu Phe Ser Val Leu Asn Tyr Glu Arg Ala Arg Arg 660 665 670 Pro Gly Leu Leu Gly Ala Ser Val Leu Gly Leu Asp Asp Ile His Arg 675 680 685 Ala Trp Arg Thr Phe Val Leu Arg Val Arg Ala Gln Asp Pro Pro 690 695 700 Glu Leu Tyr Phe Val Lys Val Asp Val Thr Gly Ala Tyr Asp Thr Ile 705 710 715 720 Pro Gln Asp Arg Leu Thr Glu Val Ile Ala Ser Ile Ile Lys Pro Gln 725 730 735 Asn Thr Tyr Cys Val Arg Arg Tyr Ala Va l Val Gln Lys Ala Ala His 740 745 750 Gly His Val Arg Lys Ala Phe Lys Ser His Val Ser Thr Leu Thr Asp 755 760 765 Leu Gln Pro Tyr Met Arg Gln Phe Val Ala His Leu Gln Glu Thr Ser 770 775 780 Pro Leu Arg Asp Ala Val Val Ile Glu Gln Ser Ser Ser Leu Asn Glu 785 790 795 800 Ala Ser Ser Gly Leu Phe Asp Val Phe Leu Arg Phe Met Cys His His 805 810 815 Ala Val Arg Ile Arg Gly Lys Ser Tyr Val Gln Cys Gln Gly Ile Pro 820 825 830 Gln Gly Ser Ile Leu Ser Thr Leu Leu Cys Ser Leu Cys Tyr Gly Asp 835 840 845 Met Glu Asn Lys Leu Phe Ala Gly Ile Arg Arg Asp Gly Leu Leu Leu 850 855 860 Arg Leu Val Asp Asp Phe Leu Leu Val Thr Pro His Leu Thr His Ala 865 870 875 880 Lys Thr Phe Leu Arg Thr Le u Val Arg Gly Val Pro Glu Tyr Gly Cys 885 890 895 Val Val Asn Leu Arg Lys Thr Val Val Asn Phe Pro Val Glu Asp Glu 900 905 910 Ala Leu Gly Gly Thr Ala Phe Val Gln Met Pro Ala His Gly Leu Phe 915 920 925 Pro Trp Cys Gly Leu Leu Leu Asp Thr Arg Thr Leu Glu Val Gln Ser 930 935 940 Asp Tyr Ser Ser Tyr Ala Arg Thr Ser Ile Arg Ala Ser Leu Thr Phe 945 950 955 960 Asn Arg Gly Phe Lys Ala Gly Arg Asn Met Arg Arg Lys Leu Phe Gly 965 970 975 Val Leu Arg Leu Lys Cys His Ser Leu Phe Leu Asp Leu Gln Val Asn 980 985 990 Ser Leu Gln Thr Val Cys Thr Asn Ile Tyr Lys Ile Leu Leu Leu Gln 995 1000 1005 Ala Tyr Arg Phe His Ala Cys Val Leu Gln Leu Pro Phe His Gln Gln 1010 1015 1020 Val Trp Lys Asn Pro Thr Phe Phe Leu Arg Val Ile Ser Asp Thr Ala 1025 1030 1035 1040 Ser Leu C ys Tyr Ser Ile Leu Lys Ala Lys Asn Ala Gly Met Ser Leu 1045 1050 1055 Gly Ala Lys Gly Ala Ala Gly Pro Leu Pro Ser Glu Ala Val Gln Trp 1060 1065 1070 Leu Cys His Gln Ala Phe Leu Leu Leu Lys Leu Thr Arg His Arg Val Thr 1075 1080 1085 Tyr Val Pro Leu Leu Gly Ser Leu Arg Thr Ala Gln Thr Gln Leu Ser 1090 1095 1100 Arg Lys Leu Pro Gly Thr Thr Leu Thr Ala Leu Glu Ala Ala Ala Asn 1105 1110 1115 1120 Pro Ala Leu Pro Ser Asp Phe Lys Thr Ile Leu Asp 1125 1130 <210> 4 <211> 3399 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of hTERT <400> 4 atgcccagag ctcccagatg cagagccgtg agaagcctgc tgagaagccaga ctacagagag 60 gtggccacc cc 60 gtggccacc agggctggag actggtgcag 120 agaggcgacc ccgcagcctt tagagccctg gtggcccagt gcctggtgtg cgtgccctgg 180 gacgccagac ctcctcccgc tgcccccagc ttcagacagg tgagctgcct gaaggagctg 240 gtggccagag tgctccagag actgtgcgag agaggcgcca agaacgtgct ggcctttggc 300 ttcgccctgc tggatggagc cagaggcgga cctcccgagg ccttcaccac aagcgtgaga 360 agctacctgc ccaacaccgt gaccga tgcc ctgagaggct ccggcgcctg gggcctgctc 420 ctgagaagag tgggcgacga cgtgctggtg cacctgctgg ccagatgcgc cctgttcgtg 480 ctggtggctc ccagctgcgc ctaccaggtg tgcggacccc ctctgtacca gctgggagcc 540 gccacccagg caagaccccc tccccacgcc tctggaccca gaagaagact gggctgcgag 600 agagcctgga accacagcgt gagagaggct ggcgtgcccc tgggcctgcc cgcccctggc 660 gccagaagaa gaggcggcag cgccagcaga agcctgcccc tgcccaagag acccagacgc 720 ggcgccgctc ccgagcctga gagaacaccc gtgggccagg gcagctgggc ccaccccggc 780 agaaccagag gacccagcga cagaggcttc tgcgtggtga gccctgccag acccgccgag 840 gaggccacca gcctggaggg cgccctgagc ggcaccagac acagccaccc cagcgtgggc 900 agacagcacc acgccggccc tcctagcacc agcagacccc ccagaccttg ggacaccccc 960 tgcccccctg tgtacgccga gaccaagcac ttcctgtaca gcagcggcga caaggagcag 1020 ctgagaccca gcttcctgct gagctccctg agacccagcc tgaccggcgc cagaagactg 1080 gtggagacca tcttcctggg cagcagaccc tggatgcccg gcacccccag aagactgccc 1140 agactgcccc agagatactg gcagatgaga cccctgttcc tggagctgct gggcaaccac 1200 gcccagtgcc cctacggcgt gctgctgaag acccactgccccctgagagc tgccgtgacc 1260 cccgcagctg gcgtgtgcgc cagagagaag ccccagggca gcgtggccgc tcccgaggag 1320 gaggacaccg atcccagaag actggtgcag ctgctgagac agcacagcag cccctggcag 1380 gtgtacggct tcgtgagagc ctgcctgaga agactggtgc ctcccggcct gtggggcagc 1440 agacacaacg agagaagatt cctgagaaac accaagaagt tcatcagcct gggcaagcac 1500 gccaagctga gcctccagga gctgacatgg aagatgagcg tgagagactg cgcctggctg 1560 aggagaagcc ctggcgtggg ctgcgtgccc gccgccgagc acagactgag agaggagatc 1620 ctggccaagt ttctgcactg gctgatgagc gtgtacgtgg tggagctgct gagaagcttc 1680 ttctacgtga ccgagaccac attccagaag aacagactgt tcttttacag gaagagcgtg 1740 tggagcaagc tccagagcat cggcatcaga cagcacctga agagagtgca gctgagagag 1800 ctgagcgagg ccgaggtgag acagcacaga gaggccagac ccgccctgct gaccagcaga 1860 ctgagattca tccccaagcc cgatggcctg agacccatcg tgaacatgga ctacgtggtg 1920 ggagccagaa cctttagaag agagaagaga gccgagagac tgaccagcag agtgaaggcc 1980 ctgttcagcg tgctgaacta cgagagagcc agaagacccg gcctgctggg cgccagcgtg 2040 ctgggcctgg acgacatcca cagagcctgg agaaccttcg tgctga gagt gagagcccag 2100 gaccctcctc ccgagctgta cttcgtgaag gtggacgtga ccggcgccta cgacaccatc 2160 ccccaggaca gactgaccga ggtgatcgcc agcatcatca agccccagaa cacctactgc 2220 gtgagaagat acgccgtggt gcagaaggcc gcccacggcc acgtgagaaa ggccttcaag 2280 agccacgtga gcaccctgac cgacctccag ccctacatga gacagttcgt ggcccacctc 2340 caggagacca gccccctgag agatgccgtg gtgatcgagc agagctcttc cctgaacgag 2400 gcctccagcg gcctgttcga cgtgttcctg agattcatgt gccaccacgc cgtgagaatc 2460 agaggcaaga gctacgtgca gtgccagggc atcccccagg gcagcatcct gagcaccctg 2520 ctgtgcagcc tgtgctacgg cgacatggag aacaagctgt tcgctggcat cagaagagac 2580 ggcctgctgc tgagactggt ggacgacttc ctgctggtga ccccccacct gacccacgcc 2640 aagaccttcc tgagaaccct ggtgagaggc gtgcccgagt acggctgcgt ggtgaacctg 2700 agaaagaccg tggtgaactt tcccgtggag gacgaggccc tgggcggcac cgccttcgtg 2760 cagatgcccg cccacggcct gtttccctgg tgcggcctgc tcctcgacac cagaaccctg 2820 gaggtgcaga gcgactacag cagctacgca agaaccagca tcagagccag cctgaccttc 2880 aacagaggct tcaaggccgg cagaaacatg agaagaaagc tgttcggcgt g ctgagactg 2940 aagtgccaca gcctgttcct ggacctccag gtgaacagcc tccagaccgt gtgcaccaac 3000 atctacaaga tcctgctgct ccaggcctac agattccacg cctgcgtgct ccagctgccc 3060 ttccaccagc aggtgtggaa gaatcccacc ttcttcctga gagtgatcag cgacaccgcc 3120 agcctgtgct acagcatcct gaaggccaag aatgccggca tgagcctggg cgccaagggc 3180 gccgctggac ccctgcccag cgaggccgtg cagtggctgt gccaccaggc cttcctgctg 3240 aagctgacca gacacagagt gacctacgtg cccctgctgg gcagcctgag aaccgcccag 3300 acccagctga gcagaaagct gcctggcaca accctgaccg ccctggaggc agccgcaaac 3360 cccgccctgc ccagcgactt caagaccatc ctggactag 3399 <210> 5 <211> 454 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of c-Myc <400> 5 Met Asp Phe Phe Arg Val Val Glu Asn Gln Gln Pro Pro Ala Thr Met 1 5 10 15 Pro Leu Asn Val Ser Phe Thr Asn Arg Asn Tyr Asp Leu Asp Tyr Asp 20 25 30 Ser Val Gln Pro Tyr Phe Tyr Cys Asp Glu Glu Glu Asn Phe Tyr Gln 35 40 45 Gln Gln Gln Gln Ser Glu Leu Gln Pro Pro Ala Pro Ser Glu Asp Ile 50 55 60 Trp Lys Lys Phe Glu Leu Leu Pr o Thr Pro Pro Leu Ser Pro Ser Arg 65 70 75 80 Arg Ser Gly Leu Cys Ser Pro Ser Tyr Val Ala Val Thr Pro Phe Ser 85 90 95 Leu Arg Gly Asp Asn Asp Gly Gly Gly Gly Ser Phe Ser Thr Ala Asp 100 105 110 Gln Leu Glu Met Val Thr Glu Leu Leu Gly Gly Asp Met Val Asn Gln 115 120 125 Ser Phe Ile Cys Asp Pro Asp Asp Glu Thr Phe Ile Lys Asn Ile Ile 130 135 140 Ile Gln Asp Cys Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu Val 145 150 155 160 Ser Glu Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser Gly Ser 165 170 175 Pro Asn Pro Ala Arg Gly His Ser Val Cys Ser Thr Ser Ser Leu Tyr 180 185 190 Leu Gln Asp Leu Ser Ala Ala Ala Ser Glu Cys Ile Asp Pro Ser Val 195 200 205 Val Phe Pro Tyr Pro Leu Asn Asp Ser Ser Ser Pro Lys Ser Cys Ala 210 215 2 20 Ser Gln Asp Ser Ser Ala Phe Ser Pro Ser Ser Asp Ser Leu Leu Ser 225 230 235 240 Ser Thr Glu Ser Ser Pro Gln Gly Ser Pro Glu Pro Leu Val Leu His 245 250 255 Glu Glu Thr Pro Pro Thr Thr Ser Ser Asp Ser Glu Glu Glu Gin Glu 260 265 270 Asp Glu Glu Glu Ile Asp Val Val Ser Val Glu Lys Arg Gln Ala Pro 275 280 285 Gly Lys Arg Ser Glu Ser Gly Ser Pro Ser Ala Gly Gly His Ser Lys 290 295 300 Pro Pro His Ser Pro Leu Val Leu Lys Arg Cys His Val Ser Thr His 305 310 315 320 Gln His Asn Tyr Ala Ala Pro Ser Thr Arg Lys Asp Tyr Pro Ala 325 330 335 Ala Lys Arg Val Lys Leu Asp Ser Val Arg Val Leu Arg Gln Ile Ser 340 345 350 Asn Asn Arg Lys Cys Thr Ser Pro Arg Ser Ser Asp Thr Glu Glu Asn 355 360 365 Val Lys Arg Arg Thr His Asn Val Leu Glu Arg Gln Arg Arg Asn Glu 370 375 380 Leu Lys Arg Ser Phe Phe Ala Leu Arg Asp Gln Ile Pro Glu Leu Glu 385 390 395 400 Asn Asn Glu Lys Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr Ala 405 410 415 Tyr Ile Leu Ser Val Gln Ala Glu Glu Gln Lys Leu Ile Ser Glu Glu 420 425 430 Asp Leu Leu Arg Lys Arg Arg Glu Gln Leu Lys His Lys Leu Glu Gln 435 440 445 Leu Arg Asn Ser Cys Ala 450 <210> 6 <211> 1365 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of c-Myc <400> 6 atggatttct ttcgcgtcgt cgagaaccag cagccacccg ccactatgcc tctgaacgtg 60 tcttttacta acaggaacta tgatctggat tacgacagcg tgcagcccta cttctattgc 120 gatgaggaag agaactttta tcagcagcag cagcagagcg agctgcagcc acctgcacct 180 tccgaagaca tttggaagaa attcgagctg ctgcctacac cacccctgtc tccaagtcgg 240 agaagcggcc tgtgttcacc cagctacgtg gccgtcactc ctttcagcct gaggggggac 300 aatgatggcg ggggaggctc cttttctaca gccgatcagc tggaaatggt gactgagctg 360 ctggggggag acatggtcaa ccagagcttc atttgcgatc ctgacgatga aacttttatc 420 aagaacatca tcatccagga ctgtatgtgg tcaggcttta gcgccgctgc aaagctggtg 480 tctgagaaac tggcaagtta tcaggccgct cggaaagata gtgggtcacc taacccagct 540 agaggacact ccgtgtgctc tacaagctcc ctgtacctgc aggacctgag cgcagccgct 600 tccgagtgta ttgatccctc cgtggtcttc ccctatcctc tgaatgactc tagttcaccc 660 aagagttgcg catcacagga cagctccgcc ttttcacctt ctagtgatag cctgctgtca 720 agcactgaat cctctccaca gggcagccca gagccactgg tgctgcatga agagacccct 780 ccaaccacaa gttcagattc cgaagaggaa caggaggacg aggaagagat cgatgtggtc 840 tctgtggaaa agcgccaggc tccaggaaaa cgaagcgagt ccggctctcc aagtgcagga 900 ggacactcca agccacctca ttctcccctg gtgctgaaaa ggtgccacgt ctccacccac 960 cagcataact acgcagcccc accctctaca cgaaaggact atccagctgc aaagcgcgtg 1020 aaactggata gcgtgagagt cctgaggcag atcagtaaca atcggaagtg tacttcaccc 1080 agaagctccg acaccgaaga gaacgtgaaa aggcgcaccc ataatgtcct ggaacgccag 1140 cgacggaatg agctgaagag gtccttcttt gccctgcgcg atcagattcc tgaactggag 1200 aacaatgaga aggctccaaa agtggtcatt ctgaagaaag ccacagctta catcctgtct 1260 gtgcaggccg aagagcagaa actgatcagt gaagaggacc tgctgagaaa acg cagggaa 1320cagctgaaac ataaactgga acagctgaga aactcttgtg cttaa 1365
Claims (15)
A pharmaceutical composition for the treatment or improvement of neurogenic cystopathy comprising stem cells expressing brain-derived neurotrophic factor (BDNF) as an active ingredient.
상기 뇌-유래 신경영양인자 단백질은 서열번호 1의 아미노산 서열로 이루어진 폴리펩티드인 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
The method of claim 1,
The brain-derived neurotrophic factor protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy.
상기 줄기세포는 뇌-유래 신경영양인자 단백질을 코딩하는 유전자가 포함된 발현벡터로 형질감염된 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
The method of claim 1,
The stem cells are transfected with an expression vector containing a gene encoding a brain-derived neurotrophic factor protein, a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy.
상기 뇌-유래 신경영양인자 단백질을 코딩하는 유전자는 서열번호 2의 염기서열로 이루어진 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
4. The method of claim 3,
The gene encoding the brain-derived neurotrophic factor protein is composed of the nucleotide sequence of SEQ ID NO: 2, a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy.
상기 발현벡터는 렌티바이러스 벡터, 레트로바이러스 벡터, 리포좀, 양이온성 중합체, 전기천공법, 및 이들의 조합들로 이루어진 군으로부터 선택되는 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
4. The method of claim 3,
The expression vector is a lentiviral vector, a retroviral vector, a liposome, a cationic polymer, an electroporation method, and a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy, which is selected from the group consisting of.
상기 조성물은 BDNF (Brain-derived neurotrophic factor), TrkB (receptor tyrosine kinase B), 및/또는 CREB (c-AMP-responsive element binding protein) 신호전달경로를 활성화시키는 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
The method of claim 1,
The composition is BDNF (Brain-derived neurotrophic factor), TrkB (receptor tyrosine kinase B), and / or CREB (c-AMP-responsive element binding protein) to activate the signaling pathway, the treatment of neurogenic cystopathy or A pharmaceutical composition for improvement.
상기 줄기세포는 간엽 줄기세포, 중간엽 줄기세포, 혈관내피전구세포, 신경 줄기세포 및 이들의 조합들로 이루어진 군으로부터 선택되는 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
The method of claim 1,
The stem cells are selected from the group consisting of mesenchymal stem cells, mesenchymal stem cells, vascular endothelial progenitor cells, neural stem cells, and combinations thereof, a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy.
상기 줄기세포는 중간엽 줄기세포인 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
The method of claim 1,
The stem cells are mesenchymal stem cells, a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy.
상기 중간엽 줄기세포는 골수-유래 중간엽 줄기세포, 제대혈-유래 중간엽 줄기세포, 또는 지방-유래 중간엽 줄기세포인 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
9. The method of claim 8,
The mesenchymal stem cells are bone marrow-derived mesenchymal stem cells, umbilical cord blood-derived mesenchymal stem cells, or adipose-derived mesenchymal stem cells.
상기 중간엽 줄기세포는 불사화된 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
9. The method of claim 8,
The mesenchymal stem cells are immortalized, a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy.
상기 중간엽 줄기세포는 hTERT (human telomerase reverse transcriptase) 및/또는 c-Myc 유전자가 도입된 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
9. The method of claim 8,
The mesenchymal stem cells are hTERT (human telomerase reverse transcriptase) and / or c-Myc gene is introduced, a pharmaceutical composition for the treatment or improvement of neurogenic cystopathy.
상기 신경인성 방광증은 요절박, 절박성 요실금, 빈뇨, 야뇨, 배뇨곤란, 배뇨장애, 신우신염, 및 이들의 조합들로 이루어진 군으로부터 선택되는 하나 이상의 증상을 나타내는 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
The method of claim 1,
The neurogenic cystosis is one or more symptoms selected from the group consisting of urgency, urge incontinence, frequency, nocturia, dysuria, dysuria, pyelonephritis, and combinations thereof, treatment of neurogenic cystopathy or a pharmaceutical composition for improvement.
상기 신경인성 방광증은 신경질환의 발병에 수반되는 방광 및 요도의 이상(disorder) 질환인 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
The method of claim 1,
The neurogenic cystopathy is a disease of the bladder and urethra accompanying the onset of neurological disease, a pharmaceutical composition for the treatment or improvement of neurogenic cystosis.
상기 신경질환은 뇌졸중, 알츠하이머병, 파킨슨병, 루게릭병, 뇌경색, 만성 뇌손상, 척수손상, 헌팅턴병, 렛트병, 허혈성 뇌질환, 외상성 뇌손상, 신생아 허혈성 뇌병증, 다발성 경화증, 척수이형성증, 척추디스크, 척추협착증 및 이들의 조합들로 이루어진 군으로부터 선택되는 질환인 것인, 신경인성 방광증의 치료 또는 개선용 약학 조성물.
14. The method of claim 13,
The neurological diseases include stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, cerebral infarction, chronic brain injury, spinal cord injury, Huntington's disease, Rett's disease, ischemic brain disease, traumatic brain injury, neonatal ischemic encephalopathy, multiple sclerosis, myelodysplasia, vertebral disc, A pharmaceutical composition for the treatment or improvement of neurogenic cystopathy, which is a disease selected from the group consisting of spinal stenosis and combinations thereof.
A cell therapy composition for the prevention or treatment of neurogenic cystopathy comprising stem cells expressing brain-derived neurotrophic factor protein as an active ingredient.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020210026929A KR20220122379A (en) | 2021-02-26 | 2021-02-26 | Pharmaceutical composition for treating or improving neurogenic bladder comprising stem cells expressing brain-derived neurotrophic factors |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020210026929A KR20220122379A (en) | 2021-02-26 | 2021-02-26 | Pharmaceutical composition for treating or improving neurogenic bladder comprising stem cells expressing brain-derived neurotrophic factors |
Publications (1)
Publication Number | Publication Date |
---|---|
KR20220122379A true KR20220122379A (en) | 2022-09-02 |
Family
ID=83281009
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020210026929A KR20220122379A (en) | 2021-02-26 | 2021-02-26 | Pharmaceutical composition for treating or improving neurogenic bladder comprising stem cells expressing brain-derived neurotrophic factors |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR20220122379A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN117679493A (en) * | 2024-02-02 | 2024-03-12 | 北京大学第三医院(北京大学第三临床医学院) | Medicine for treating or preventing tendinosis through immune regulation and application thereof |
-
2021
- 2021-02-26 KR KR1020210026929A patent/KR20220122379A/en unknown
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN117679493A (en) * | 2024-02-02 | 2024-03-12 | 北京大学第三医院(北京大学第三临床医学院) | Medicine for treating or preventing tendinosis through immune regulation and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Wang et al. | Transplantation of neurotrophin-3-expressing bone mesenchymal stem cells improves recovery in a rat model of spinal cord injury | |
US20050169896A1 (en) | Bone marrow transplantation for treatment of stroke | |
Chen et al. | Therapeutic effects of intranigral transplantation of mesenchymal stem cells in rat models of Parkinson's disease | |
US20190224247A1 (en) | Methods and compositions for provision of angiogenic factors | |
Lee et al. | Human neural stem cells genetically modified to express human nerve growth factor (NGF) gene restore cognition in the mouse with ibotenic acid-induced cognitive dysfunction | |
US8017112B2 (en) | Transplantation of bone marrow stromal cells for treatment of neurodegenerative diseases | |
Ding et al. | Effects of nerve growth factor and Noggin‐modified bone marrow stromal cells on stroke in rats | |
Zhang et al. | Transplantation of bFGF-expressing neural stem cells promotes cell migration and functional recovery in rat brain after transient ischemic stroke | |
Isacson et al. | Future of cell and gene therapies for Parkinson's disease | |
Luo et al. | Promoting survival, migration, and integration of transplanted Schwann cells by over‐expressing polysialic acid | |
Wu et al. | Transplantation of neural stem cells expressing hypoxia-inducible factor-1α (HIF-1α) improves behavioral recovery in a rat stroke model | |
Abbaszadeh et al. | Human ciliary neurotrophic factor–overexpressing stable bone marrow stromal cells in the treatment of a rat model of traumatic spinal cord injury | |
US9028810B2 (en) | Composition for inducing migration of neural stem cells containing periostin as effective ingredient | |
Zhou et al. | Crosstalk between soluble PDGF‐BB and PDGFRβ promotes astrocytic activation and synaptic recovery in the hippocampus after subarachnoid hemorrhage | |
US20200190535A1 (en) | Adult stem cell line introduced with hepatocyte growth factor gene and neurogenic transcription factor gene with basic helix-loop-helix motif and uses thereof | |
US20210155663A1 (en) | Mesenchymal stem cells expressing brain-derived neurotrophic factor and use thereof | |
KR20220122379A (en) | Pharmaceutical composition for treating or improving neurogenic bladder comprising stem cells expressing brain-derived neurotrophic factors | |
Enomoto et al. | Migration and differentiation of neural progenitor cells from two different regions of embryonic central nervous system after transplantation into the intact spinal cord | |
Kubo et al. | Efficient generation of dopamine neuron-like cells from skin-derived precursors with a synthetic peptide derived from von Hippel-Lindau protein | |
KR102128003B1 (en) | Pharmaceutical composition for preventing or treating tendinopathy comprising isolated mitochondria | |
Hattori et al. | Intracranial transplantation of monocyte‐derived multipotential cells enhances recovery after ischemic stroke in rats | |
US20210310020A1 (en) | Adult Stem Cell Line Introduced with Hepatocyte Growth Factor Gene and Neurogenic Transcription Factor Gene with Basic Helix-Loop-Helix Motif and Uses Thereof | |
EP3227441B1 (en) | Camkk1 as a novel regenerative therapeutic | |
Stepanova et al. | Neurotrophin-3 enhances the effectiveness of cell therapy in chronic spinal cord injuries | |
RU2521225C2 (en) | Method for stimulating spinal cord regeneration with genetically modified human umbilical cord blood cells |