JP5527950B2 - Method for producing mating transfer transformant and minicell used in the method - Google Patents

Description

  The present invention relates to a method for producing a conjugative transfer transformant having proliferation ability, which comprises transferring at least a part of the genomes of two donors to a receptor by conjugation, and a minicell used in the method.

  Microorganisms play various roles in nature and in vivo. For example, enterobacteria can convert persistent polysaccharides ingested by the host into short-chain fatty acids to supply energy sources to the host, or kill pathogenic bacteria that have entered from the outside and propagate in the intestine. It helps to maintain the homeostasis of the host by preventing it. It is estimated that there are more than 500 types of human intestinal bacteria, and they coexist in the intestine to form a bioflora (intestinal flora). However, among the bacteria that are resident in the intestinal flora, the number of bacteria that can be cultured at present is about 20 to 30%, and the characteristics and roles of the remaining difficult-to-culture bacteria have not yet been elucidated. In addition to enterobacteria, microorganisms such as extreme environmental microorganisms, marine microorganisms, and dormant dormant microorganisms are expected to have molecular mechanisms different from those on the ground, and the expression of unknown enzymes Most of them are difficult to cultivate.

  In nature, there are also microorganisms that are toxic to the human body. Examples of the toxic microorganism include Salmonella thyphi strain and Escherichia coli O-157 strain. In particular, food poisoning caused by Escherichia coli O-157 is frequent every year. Infants, children, and elderly people with low resistance may die if infected with E. coli O-157. Therefore, it is desired to develop a prophylactic agent and a therapeutic agent that are effective immediately against infectious diseases caused by toxic microorganisms such as Escherichia coli O-157 strain. However, research facilities that can culture toxic microorganisms are limited, and the current situation is that the development of infectious disease preventive and therapeutic agents for toxic microorganisms has not progressed.

Up to now, it has been attempted to modify the existing culture method to grow difficult-to-cultivate microorganisms to such an extent that their roles can be observed and to grow toxic microorganisms in a detoxified state. However, the above trial requires a lot of time and labor because the composition of the medium is complicated and the culture conditions are composed of many parameters. Therefore, instead of directly culturing difficult-to-cultivate microorganisms and toxic microorganisms, gene recombination methods using expression vectors, homologous recombination methods using easily culturable microorganisms or non-toxic microorganisms, or conjugation transfer methods, etc. An attempt has been made to study the structures and functions of difficult-to-cultivate microorganisms and toxic microorganisms using transformants obtained by incorporating a part of these genomes into other microorganisms (for example, Patent Document 1). ~ 4).
Japanese Patent Laid-Open No. 10-75793 JP-A-6-30781 JP-A-9-70292 Special table 2008-510794 gazette

  However, when the operon of a source microorganism such as a difficult-to-culture microorganism or a toxic microorganism is long or when the gene of the source microorganism spans multiple loci on the genome, the gene is divided or Various transformants must be prepared, and the transformation range per one transformant is limited. Furthermore, conventional homologous recombination methods and conjugation transfer methods are inefficient because of the low frequency of multigene hybridization. In view of the above situation, since the present inventors cannot expect synthesis of intermediate products and branched products in a system involving a large number of biochemical reactions in a method using a conventional transformant, I thought it would be difficult to elucidate the molecular mechanism.

  Therefore, the present invention provides a method for producing a transformant in which the genome of a target microorganism is incorporated together with the genome of another easily culturable microorganism, and materials used in the method, in order to elucidate the molecular mechanism of the target microorganism. It was an issue to be solved.

  As a result of various studies, the present inventors have isolated minicells from minicell-producing bacteria cultured in the presence of a nucleic acid cleaving agent, and then two types of donors in which the direction of conjugation transmission and the introduction part have a specific relationship. By successfully conjugating and transmitting a part of the genome of the gene to the minicell, a conjugative transfer transformant having a proliferative ability in which many genes of the donor were transferred was successfully produced. Furthermore, the present inventors have confirmed that the genetic characteristics of the mating transfer transformant are not minicells but are derived from two donors from which the genome is transmitted. The present inventors have succeeded in selectively producing a mating transfer transformant having a large amount of the genome of the other donor by including phage DNA in one of the genomes of the two donors. The present invention has been completed based on the above findings.

Therefore, according to the present invention, a step of culturing a minicell-producing bacterium having a vector to which RNA polymerase is attached under a nucleic acid cleavage condition to obtain a nucleic acid-cleaved minicell-producing bacterium and a culture containing the minicell;
Separating the minicells from the culture; and at least a donor A genome in which the direction of conjugation transmission is clockwise and the introduction of conjugation transmission is located within 10 minutes from the zero point in a counterclockwise direction. With some
At least a portion of the donor B genome in which the direction of conjugation transmission is counterclockwise and the introduction of conjugation transmission is located within 10 minutes clockwise from the zero point,
There is provided a method for producing a conjugation transfer transformant, comprising the step of obtaining a conjugation transfer transformant having proliferation ability by conjugating and transmitting to the minicell in a minimal medium.

A preferred embodiment of the present invention, the minicell producing strain F ^- a cell, and the donor A and the donor B is Hfr cells.

  In a preferred embodiment of the present invention, the minicell-producing bacterium is Escherichia coli, Salmonella, Bacillus, Lactobacillus, or Campylobacter.

  In a preferred embodiment of the present invention, the donor A and the donor B are each independently Escherichia coli, Salmonella bacteria, Bacillus bacteria, Pseudomonas bacteria, or Propionibacterium bacteria.

  In a preferred embodiment of the present invention, the culture under the nucleic acid cleavage condition is at least one selected from the group consisting of culture in the presence of a nucleic acid cleavage agent, culture under ultraviolet irradiation, and culture under radiation irradiation. is there.

  In a preferred embodiment of the present invention, the nucleic acid cleaving agent is at least one selected from the group consisting of mitomycin C, naldixine acid, bleomycin hydrochloride, pepromycin sulfate, dinostatin stimamarer, and idarubicin hydrochloride.

  In a preferred embodiment of the present invention, the donor A is a donor in which the junction transmission introduction portion is located within 5 minutes counterclockwise from the zero point, and the donor B has a junction transmission introduction portion. A donor located within 5 minutes clockwise from the zero point.

  In a preferred embodiment of the present invention, at least part of the donor A genome or at least part of the donor B genome comprises phage DNA.

  According to another aspect of the present invention, there is provided a minicell having a vector to which an RNA polymerase is attached, derived from a nucleic acid-cleaved minicell producing bacterium.

  According to the production method of the present invention, a part of the genomes of the two donors can be transmitted to the minicell by conjugation transmission to produce a conjugation transmission transformant having a proliferation ability. Further, by selectively producing a conjugative transfer transformant containing a part of the genome of a microorganism such as a difficult-to-culture microorganism and a toxic microorganism by the production method of the present invention, an intermediate metabolite produced by the microorganism, It is possible to investigate branched metabolites, and further to elucidate the molecular mechanism of the microorganism. That is, according to the production method of the present invention, it is possible to elucidate the role and function of microorganisms that are resident in nature and in living bodies in the resident environment.

  According to the production method of the present invention, for example, by using an Escherichia coli O157 strain and another E. coli strain as donors, a new conjugate transfer transformant having the trait of the O157 strain and not having the O157 antigen. Can be manufactured. The conjugation transfer transformant lacks a gene involved in the O157 antigen synthesis pathway, does not synthesize the O157 antigen even after repeated growth, and may produce an intermediate product of the O157 antigen. is there. Furthermore, the conjugative transfer transformant may degrade or convert the intermediate product of the O157 antigen to other substances. Therefore, since the biochemical synthesis pathway and degradation or branching mechanism of the O157 antigen are important information for detoxification of the O157 antigen, the above-described conjugate transfer transformant is produced by the production method of the present invention. The significance of research is very high.

  A conjugative transfer transformant is produced from the intestinal bacteria group of the living body by the production method of the present invention, and then the conjugative transfer transformant is again returned to the living body to establish the intestinal flora. Can also be given. The established junction transfer transformant can expand the role and function in the intestinal flora of humans or domestic animals, and can contribute to maintaining and improving the balance of the intestinal flora. In particular, the conventional transformation method using a plasmid requires an antibiotic to maintain the transformation and can only be used in a laboratory environment. Furthermore, even if a transformant produced by a conventional transformation method was introduced into the intestinal flora, it was not originally present in the intestinal flora, so that the intestinal flora was disturbed, and It can lead to excretion or destruction of the intestinal flora and can cause serious illness. On the other hand, the conjugation transfer transformant produced by the production method of the present invention contains many genes of wild strains present in the intestinal flora, and thus is highly likely to be established in the intestinal flora.

Hereinafter, embodiments of the present invention will be described in detail.
The method for producing the conjugative transfer transformant of the present invention is a method comprising the following steps:
A step of culturing a minicell-producing bacterium having a vector to which RNA polymerase is attached under a nucleic acid cleavage condition to obtain a nucleic acid-cleaved minicell-producing bacterium and a culture containing the minicell;
Separating the minicells from the culture; and at least a donor A genome in which the direction of conjugation transmission is clockwise and the introduction of conjugation transmission is located within 10 minutes from the zero point in a counterclockwise direction. With some
At least a portion of the donor B genome in which the direction of conjugation transmission is counterclockwise and the introduction of conjugation transmission is located within 10 minutes clockwise from the zero point,
A step of obtaining a conjugative transfer transformant having a proliferation ability by conjugating and transmitting to the minicell in a minimal medium.

(1) Step of obtaining a culture containing minicell-producing bacteria and minicells The step of obtaining a culture containing minicell-producing bacteria and minicells (hereinafter sometimes referred to as “first step”) is a vector to which RNA polymerase is attached. In this step, a minicell-producing bacterium and a culture containing the minicell are obtained by culturing the minicell-producing bacterium having a nucleic acid under a nucleic acid cleavage condition.

  As used herein, “minicell-producing bacteria” means a strain having an expression system that induces the production of minicells, and “minicells” are small cells that do not have most of the genomic DNA and have no self-proliferating ability. means. Examples of genes involved in an expression system that induces minicell production include a minA gene and a minB gene. A minicell-producing bacterium can be produced by causing a mutation in at least one gene selected from the group consisting of a wild-type minA gene, a minB gene, and a gene involved in an expression system that induces production of other minicells. Examples of the minicell-producing bacteria include Escherichia coli such as ME8077, χ1411, and P678-54, Salmonella sp. Such as χ1313, and Bacillus genus such as CU403 divIV-B1. sp.), Lactobacilli higardii LHC11 strain, Lactobacilli higardii LHC12 strain and other Lactobacillus bacteria (lactobacilli sp.), Campylobacter jejuni MDUWO1210 strain and other Campylobacter bacteria (Propionibacterium sp.). In the method of the present invention, E. coli minicell-producing bacteria may be E. coli. E. coli ME8077 strain is preferably used. In order to produce minicells from minicell-producing bacteria, the cells can be cultured under conditions that allow normal growth of the minicell-producing bacteria. For example, when the minicell-producing bacteria are Escherichia coli, the minicell-producing bacteria are cultured in an LB liquid medium. Thus, minicells can be produced by the minicell-producing bacteria. The produced minicells can be confirmed by microscopic observation by distinguishing them from minicell-producing bacteria due to the difference in body length. For example, the long axis of the minicell is 0.2 to 0.3 times as long as the minicell-producing bacteria. In addition to body length, for example, by using a nucleic acid stain such as DAPI [4 ′, 6-diamino-2-phenylindole], the minicell is a minicell in which nucleic acid is stained as a cell body that is not stained with the nucleic acid stain. It can be confirmed separately from the producing bacteria.

  In the first step, the minicell-producing bacterium has a vector to which RNA polymerases such as RNA polymerase I and RNA polymerase II are attached. A vector to which RNA polymerase is attached is an expression vector to which RNA polymerase is attached and capable of autonomous replication. The fact that RNA polymerase adheres to DNA is reported, for example, in the literature of Shepherd N, Dennis P, Bremer H. Cytoplasmic RNA Polymerase in Escherichia coli. J Bacteriol. 2001 183 (8): 2527-34. Therefore, the mode and conditions of adhesion between the RNA polymerase and the vector are not particularly limited. For example, the RNA polymerase expressed from the minicell-producing bacterium comes into contact with the vector and is immobilized in accordance with the growth of the minicell-producing bacterium. Can be done.

  Specific examples of vectors include pTSMb1, pRSETA, pCR8, pBR322, pBluescriptIISK (+), pUC18, pCR2.1, pLEX, pJL3, pSW1, pSE280, pSE420, pHY300PLK, pBBR122 (including Salmonella bacterium). However, when expressed in E. coli, pTSMb1, pBR322, pUC18 and the like are preferably used. For example, the pTSMb1 vector has p15A as a replication origin and exists in 10 to 15 copies per cell. On the pTSMb1 vector, there are a kanamycin resistance gene, a LacI gene, a cI857 gene, and a fluorescent protein GFP gene. In the pTSMb1 vector, LacI gene expression is controlled by the Ps1-con promoter and suppressed by the cI857 protein. In the pTSMb1 vector, the expression of the cI857 gene and the gfp gene is controlled by the Ptrc promoter and suppressed by the LacI protein. In the pTSMb1 vector, since the LacI and cI857 genes are arranged in a toggle switch state, the presence of LacI and cI genes on the chromosome is detected and the expression of the gfp gene is regulated.

  The vector may contain a selectable marker. In particular, a selection marker can be used as an indicator for confirming the presence of a vector in a minicell-producing bacterium. Selectable markers include, for example, genes lacking their complement such as dihydrofolate reductase (DHFR) and Schizosaccharomyces pombe TPI genes, ampicillin, kanamycin, tetracycline, chloramphenicol, neomycin, hygromycin And resistance genes for drugs such as A vector is formed by ligating a promoter, optionally a terminator, an enhancer, etc., and methods for inserting them into the vector are generally known to those skilled in the art (for example, Molecular Cloning: A laboratory Mannual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY., 1989, Current Protocols in Molecular Biology, Supplement 1-38, John Wiley & Sons (1987-1997), Bio Experiment Illustrated, Volumes 1-7, Shujunsha, Etc.).

  In the first step, minicell-producing bacteria are cultured under nucleic acid cleavage conditions. Culture under nucleic acid cleavage conditions is, for example, culture in the presence of a nucleic acid cleaving agent, under ultraviolet irradiation or irradiation, or a combination thereof, and minicell production due to damage to the genomic DNA of the minicell producing bacteria This is a culture in which a DNA repair system of fungi is induced.

  Examples of the DNA repair system include the SOS cascade (response) of E. coli. The SOS cascade starts with the activation of the Escherichia coli RecA protein, with single-stranded DNA resulting from DNA damage as the first signal. When RecA protein binds to single-stranded DNA, LexA repressor protein bound to the SOS box (operator site) is inactivated. As a result, transcription of the SOS gene is initiated and DNA polymerase V and RecA protein are generated, repairing the DNA damage site. The SOS cascade is a system in which an appropriate base is inserted into a DNA damage site for repair, and is said to be an error-prone repair.

  A nucleic acid cleaving agent is an agent that damages DNA, for example, through cross-linking to double-stranded DNA. Therefore, in the first step, when minicell-producing bacteria are cultured in the presence of a nucleic acid cleaving agent at a predetermined concentration, the genomic DNA of the minicell-producing bacteria is cleaved by the action of the nucleic acid cleaving agent, and a part of the genomic DNA is separated. Damage such as fragmentation into strands and duplexes. In this case, in order to repair the damaged genomic DNA in the minicell-producing bacterium, one or more enzymes involved in DNA repair are expressed, and the DNA repair system is activated. That is, in the first step, when minicell-producing bacteria are cultured in the presence of a predetermined concentration of nucleic acid cleaving agent, they have genomic DNA fragmented into single strands and double strands and activate the DNA repair system. A minicell-producing bacterium is obtained.

  As described above, the nucleic acid cleaving agent is not particularly limited as long as it is a drug that fragments a part of genomic DNA and activates the DNA repair system. For example, mitomycin C, naldixic acid, bleomycin hydrochloride, pepromycin sulfate, Examples include dinostatin stimamarer, idarubicin hydrochloride and the like, and these may be used alone or in combination. Mitomycin C is preferably used as a drug that induces the SOS cascade of E. coli. The concentration of the nucleic acid cleaving agent can be appropriately set by those skilled in the art as long as it is not lethal to the minicell-producing bacterium and can digest the genomic DNA to activate the DNA repair system. For example, when mitomycin C is used as the nucleic acid cleaving agent, the concentration of mitomycin C is preferably 5 to 100 ng / ml, more preferably 10 to 50 ng / ml, further preferably 15 to 30 ng / ml, and 20 ± 5 ng / ml. Is even more preferred. In culturing minicell-producing bacteria, a nucleic acid cleaving agent may be contained in the medium from the beginning of the culture, or a nucleic acid cleaving agent may be added separately at a predetermined time from the start of culture.

  The minicell-producing bacterium can be cultured in a generally known medium, culture method, and culture conditions depending on the species of the minicell-producing bacterium. As a medium used for culturing minicell-producing bacteria, any of a natural medium and a synthetic medium may be used as long as it contains moderate amounts of nutrients according to the carbon source, nitrogen source, inorganic substance, and bacterial species.

  The carbon source of the medium may be anything that can be assimilated by the minicell-producing bacteria, such as glucose, maltose, fructose, mannose, trehalose, sucrose, mannitol, sorbitol, starch, dextrin, molasses and other carbohydrates, citric acid, etc. And organic acids such as succinic acid and fatty acids such as glycerin.

  Examples of the nitrogen source of the medium include various organic and inorganic nitrogen-containing compounds, and various inorganic salts. For example, various peptones such as corn steep liquor, soybean meal, soybean flour, peptone, polypeptone, and bactopeptone. And organic nitrogen sources such as ammonium chloride, ammonium sulfate, urea, ammonium nitrate, sodium nitrate, and ammonium phosphate. It goes without saying that amino acids such as glutamic acid and organic nitrogen sources such as urea also serve as carbon sources. Furthermore, nitrogen-containing natural products such as meat extract, yeast extract, dry yeast, casamino acid and soluble vegetable protein can also be used as a nitrogen source.

  As the inorganic substance of the medium, for example, calcium salt, magnesium salt, potassium salt, sodium salt, phosphate, manganese salt, zinc salt, iron salt, copper salt, molybdenum salt, cobalt salt and the like are appropriately used. Specifically, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, magnesium sulfate, ferrous sulfate, manganese sulfate, zinc sulfate, sodium chloride, potassium chloride, calcium chloride and the like are used. Further, amino acids and micronutrient vitamins such as biotin and thiamine are also used as necessary.

  Examples of the culture method include a solid culture method using a solid medium and the like, and a liquid culture method using aeration, shaking, stirring, and a combination thereof. When the liquid culture method is used, any of batch culture, fed-batch culture, continuous culture, and perfusion culture may be used. The culture temperature and pH may be appropriately selected under conditions suitable for growth of minicell-producing bacteria. For example, when the minicell-producing bacterium is Escherichia coli, the temperature is preferably 20 to 45 ° C., more preferably 30 to 40 ° C., still more preferably 37 ° C. ± 1 ° C., and the pH is preferably 5 to 9, more. Preferably it is 6-8, More preferably, it is 7.2 +/- 0.2, and it carries out aerobically on the conditions chosen from these temperature and pH. The culture time should just be the time more than the time when a minicell producing microbe begins to proliferate, Preferably it is 8 to 120 hours, More preferably, it is to the time which a minicell produces | generates to the maximum. The method for confirming the growth of the minicell-producing bacteria is not particularly limited. For example, the culture may be collected and observed with a microscope, or may be observed with absorbance. Furthermore, although there is no restriction | limiting in particular in the dissolved oxygen concentration during culture | cultivation, Usually, 0.5-20 ppm is preferable. For that purpose, it is only necessary to adjust the aeration amount, stir, or add oxygen to the aeration. When the minicell-producing bacterium is an anaerobic microorganism, it may be cultured by adding nitrogen or the like to the medium instead of air or oxygen.

  In the culture of minicell-producing bacteria, when a selection marker is contained in the vector, nutrients and antibiotics corresponding to the selection marker can be added to the medium at the beginning or during the culture. For example, when a kanamycin resistance gene is contained as a selection marker, a kanamycin solution prepared at an appropriate concentration can be added to the medium.

  By culturing the minicell-producing bacteria, a culture containing the minicell-producing bacteria and minicells can be obtained. Minicell-producing bacteria and cultures containing minicells are cultures produced by cultivating minicell-producing bacteria, and minicell-producing bacteria that have proliferated, minicells produced from minicell-producing bacteria, by-products produced by minicell-producing bacteria, It consists of a solid component such as an insoluble component of the medium, a liquid component excluding the solid component, and the like. However, a solid component obtained by removing a liquid component from a culture produced by culturing minicell-producing bacteria may be referred to as a culture containing minicell-producing bacteria and minicells.

(2) Step of separating minicells The step of separating minicells (hereinafter also referred to as “second step”) is to separate minicells from a culture containing minicell-producing bacteria and minicells by a generally known method. It is a process to do. Examples of the method for separating the minicell include a density gradient centrifugation method and a filtration method, and the filtration method is preferably used. The method for separating minicells by filtration is not particularly limited as long as it is a method that can separate minicells from a culture containing minicells and minicells. For example, the pore diameter that permeates minicells and does not permeate minicells. The method of applying the culture containing a minicell producing microbe and a minicell to the filtration membrane of this is mentioned. In this case, the minicell is recovered as a filtrate. In the method of separating the minicells by the filtration method, two or more filtration membranes can be used. For example, a microcell-producing bacterium and a culture containing the minicell are filtered through a filter membrane having a pore size (for example, 2 to 10 μm) that can permeate the minicell-producing bacterium and the minicell, and then the filtrate obtained by filtration is used. By filtering through a filtration membrane having a pore size (for example, 0.5 to 1 μm) that permeates the minicell and does not permeate the microcell-producing bacteria, the minicell can be separated and recovered in the filtrate.

  The minicell collected in the filtrate can be collected as a precipitate by, for example, a centrifugation method in which the rotation speed, time, temperature, and the like are appropriately set. The minicell recovered by precipitation can be washed once or more with, for example, a minimal medium used in the joining described later. After the washing, the minicell can be recovered again by centrifugation or the like.

  As a method for confirming that the collected minicells do not contain minicell-producing bacteria, for example, the collected minicells are suspended in a minimal medium, and the minicell-producing bacteria grow on a part of the obtained minicell suspension medium. An example is a method of cultivating by spreading on an agar medium to be obtained and then confirming that no colonies are present.

(3) Step of obtaining a junction transfer transformant The step of obtaining a junction transfer transformant (hereinafter sometimes referred to as “third step”) is a donation in which the direction of the junction transfer and the introduction part are in a predetermined relationship. In this step, a part of the genome of the body A and the donor B is conjugatively transmitted to the minicell on a predetermined medium to obtain a conjugative transfer transformant having a proliferation ability.

As used herein, “conjugate transmission” means that genomic DNA and / or plasmid DNA is transferred from one cell (donor) to the other (acceptor) through contact between cells. To do. Typical conjugal transfer, for example, receptors that no donor and F factor having a F factor is transferred gene ^- conjugative transfer is Ageraru performed between the (F cells). Examples of donors having factor F include donors having factor F in the vector (F ⁺ cells), donors having factor F in the genome (Hfr cells), and after integration of factor F into the genome. The donor (F 'cell) etc. which were again integrated in the vector can be mentioned. Donor A and donor B used in the third step are preferably Hfr cells, and are independently Hfr such as Escherichia coli, Salmonella, Bacillus, Pseudomonas, and Propionibacterium. Bacteria are more preferred. Minicells used in the third step F ^- those produced from minicell-producing bacterium is a cell. In general, it is known that factor F varies depending on the genus and species of bacteria. However, factor F is recombinable between bacterial genera and species. Thus, for example, E. coli minicells producing bacteria F ^- If a cell can be a donor A and donor B with Salmonella bacteria and Bacillus bacteria is Hfr cells F factor has been incorporated in each E. coli. Previously, the F factor of Escherichia coli was inserted into the genomic DNA of Salmonella, and the genomic DNA of Salmonella was inserted into Escherichia coli (Johnson EM, Easterling SB, Baron LS., (1970), J Bacteriol 104: 668-73) and an example of using the phytopathogenic Erwinia bacterium instead of the Salmonella bacterium (Kotoujansky A, Lemattre M, Boistard P., (1982), J Bacteriol. 150: 122-31, Pugashetti BK, Chatterjee AK, Starr MP., (1978), Can J Microbiol. 24: 448-54) and examples using Bacillus bacteria (Aquino de Muro M, Priest FG., (2000), Res Microbiol. 151: 547-55) have been reported.

  The donor A and the donor B have a predetermined relationship between the direction of junction transmission and the introduction part. As used herein, “direction of conjugative transmission” means the direction in which the donor genome is transmitted to the acceptor, which depends on the direction in which the F-factor is integrated into the donor genome. It is speculated. The direction of junction transmission is divided into two types, clockwise and counterclockwise, based on a predetermined zero point (also called zero minute) on the genome. For example, in E. coli, the zero point is the thrA locus. Usually, among Hfr cells, the gene transfer direction of cells of the HfrH type is defined as clockwise.

  As used herein, “introduction of conjugative transmission” means a site for initiation of transmission on the genome of the donor, which is assumed to be determined by the site where the F factor is incorporated in the genome of the donor. Yes. The junction transfer introduction part is represented by “minute”, “kbp (base pair)”, or the like with reference to the zero point. For example, in the case of Escherichia coli, it is said that it usually takes about 100 minutes for the entire genome of the donor to be transferred to the acceptor in conjugation at 37 ° C. Therefore, in E. coli, the relative value (0 to 100 minutes) of the time for entering the receptor during conjugation transmission can be expressed as a gene locus based on the zero point. For general matters relating to conjugation, reference can be made to “Introduction to Microbiology, RY Stanier et al., Translated by Takahashi Satoshi et al. (1980), Baifukan, pp. 173-183”.

  The direction of joining transmission between donor A and donor B used in the third step is opposite to each other. For example, when the direction of joining transmission of donor A is clockwise, joining of donor B The direction of transmission is counterclockwise. Furthermore, when the direction of junction transmission of donor A is clockwise, the introduction portion of the junction transmission of donor A is preferably within 10 minutes, more preferably within 5 minutes from the zero point in the counterclockwise direction. is there. That is, when donor A is Escherichia coli, it means that the introduction part of donor A's conjugation transfer is preferably located between 90 and 100 minutes, more preferably between 95 and 100 minutes. When the direction of bonding transmission of the donor B is counterclockwise, the bonding transmission introducing portion is preferably located within 10 minutes, more preferably within 5 minutes from the 0 point in the clockwise direction. That is, when donor B is Escherichia coli, it means that the introduction part of donor B's conjugation transfer is preferably located between 0 and 10 minutes, more preferably between 0 and 5 minutes. As a specific example, donor A can include Escherichia coli RC30 strain in which the direction of conjugation transmission is clockwise and the introduction portion of the conjugation transmission is at a position of 96.8 minutes, and donor B has a direction of conjugation transmission. The Escherichia coli ME8162 strain can be mentioned which has a junction transfer introduction portion at a position of 2.7 minutes counterclockwise. In addition, since the size of the genomic DNA of E. coli is about 4.3 Mbp, the positions of 2.7 minutes, 5 minutes, 10 minutes, 95 minutes, and 96.8 minutes in the clockwise direction from the zero point of E. coli are: These correspond to positions of about 116 kbp, about 215 kbp, about 430 kbp, about 4085 kbp, and about 4162 kbp, respectively, in the clockwise direction from the zero point of E. coli.

Donor A and donor B can be obtained by screening from a microorganism depository or from the natural world. For example, as shown in (a) to (f) in FIG. 12, (a) F plasmid is isolated, (B) A desired foreign gene sequence is inserted into the F plasmid by ordinary genetic manipulation, (c) an antibiotic resistance gene is incorporated at a certain distance from the foreign gene sequence on the recombinant F plasmid, and (d) the recombinant F The vicinity of the center of the foreign gene sequence on the plasmid is cleaved with a restriction enzyme to obtain a single-stranded recombinant F plasmid, and (e) the F ⁻ strain and the single-stranded recombinant F plasmid are mixed in a single-stranded state. And (f) genetic engineering by selecting an F ⁻ strain into which a single-stranded recombinant F plasmid has been incorporated by homologous recombination with an antibiotic corresponding to the antibiotic resistance gene.

  In the third step, donor A and donor B and the minicell are contacted in a minimal medium, preferably a liquid minimal medium, so that at least a portion of the donor A and donor B genomes are placed in the minicell. Transmit junction. As used herein, “at least part of the genome of donor A (or donor B)” means a gene near the zero point of donor A (or donor B) (for example, thrA gene in the case of E. coli). And preferably at least 10%, more preferably at least 20%, more preferably at least 30%, even more preferably at least 50% of the total genome of donor A (or donor B). However, it is desirable that the total of the genome of donor A and donor B transmitted to the minicell is approximately the same as the genome size of the minicell producing bacterium. For example, when donor A and donor B are Escherichia coli RC30 strain and Escherichia coli ME8162, respectively, the genomic DNA of R1 and R2 strains, which are minicells derived from Escherichia coli 8077 strain, is obtained from the results of electrophoresis (see FIG. 9). 24% are derived from RC30, 10% are derived from ME8162 strain, and the common part (the part where the origin of RC30 and ME8162 is indistinguishable) is 65%; the genomic DNA of R3 strain is 22% Is derived from RC30, 13% is derived from ME8162 strain, 65% is common part; R4 strain is 21% derived from RC30, 15% is derived from ME8162 strain, 64% is common part is there. As will be described later, since the ME8162 strain contains λ phage DNA, the genomic DNA of any of the R1 to R4 strains is predominantly derived from the RC30 strain than the ME8162 strain. Conceivable. Furthermore, the total genomic DNA amount of the R1 to R4 strains is about 4.6 Mbp, which is the same level as that of the minicell-producing bacteria, based on the electrophoresis result.

The “minimum medium” as used herein has the same meaning as that usually used, and refers to a synthetic medium having the simplest composition capable of growing minicell-producing bacteria. The minimal medium usually contains at least glucose, sodium chloride, inorganic phosphoric acid, inorganic nitrogen and metal, and vitamins, alkaline earth metal (Group 2 element) compounds, amino acids, etc. depending on the growth requirements of the minicell producing bacteria Can further be included. Examples of the minimal medium used when the minicell-producing bacterium is Escherichia coli include M9 minimal medium. M9 minimal medium can be prepared, for example, by the method described in Sambrook, J. et al. (1989). Usually, glucose, sodium chloride, Na ₂ HPO ₄ . It preferably contains 7H ₂ O, KH ₂ PO ₄ , NH ₄ Cl, MgSO ₄ , and more preferably contains CaCl ₂ and Thiamine. Specific examples of the M9 minimal medium include the M9 minimal medium having the medium composition described in the Examples. The concentration and pH of each component of the minimal medium can be appropriately selected according to the growth conditions of the minicell-producing bacteria.

  The temperature and time for joining transmission are not particularly limited as long as the temperature and time are suitable for joining. However, the temperature is preferably set to the culture temperature of the above-described minicell-producing bacteria, and the joining time is preferably 5 hours or more.

  The conjugation transfer transformant obtained by conjugation transfer is a minicell transformant into which at least part of the donor A and donor B genomes has been introduced by conjugation transfer. The growth ability of the conjugate transfer transformant can be confirmed as a colony by, for example, applying to a minimal agar plate medium and culturing.

  As a method for confirming that the conjugation transfer transformant is not donor A, donor B, minicell-producing bacteria, or mutants thereof, genomic DNA can be electrophoresed as described in the Examples. The method of comparing and the method of confirming the expression of fluorescent protein can be mentioned.

  In the third step, for example, if it is desired to limit the genome size of donor A (or donor B) to be conjugated, the phage DNA is located near the size of donor A (or donor B) to be limited. Can be lysed. For example, when phage DNA is lysogenized at a position 20 minutes from the zero point of donor A, and then phage DNA in the genome of donor A is conjugated to the minicell, the phage enters the lysis process, There is a high possibility that the produced conjugate transfer transformant will lyse and die. That is, a conjugation transfer transformant having phage DNA is not produced, and only a conjugation transfer transformant in which a genome of less than 20 minutes from the zero point of donor A is transferred to a minicell tends to be obtained. Therefore, in this case, it is possible to selectively produce a mating transfer transformant in which much of the donor B genome has been transferred.

  The phage can be appropriately selected depending on the type of donor, and is not particularly limited. For example, when the donor is E. coli, lambda (λ) phage is preferably used. Examples of other phages include, but are not limited to, T4 phage, T7 phage, and filamentous phage such as M13 phage and fd phage, depending on the type of donor.

  According to another aspect of the present invention, the minicell of the present invention is a minicell used in the method for producing the conjugative transfer transformant of the present invention, and is derived from a minicell producing bacterium that has been subjected to nucleic acid cleavage treatment, RNA polymerase Is a minicell having a vector attached thereto. Therefore, the minicell of the present invention comprises at least an RNA polymerase-adhered vector, a fragmented single-stranded genomic DNA of a minicell-producing bacterium, and a DNA repair system enzyme from the minicell-producing bacterium.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples.

1. Materials and Methods (1) Plasmid, Growth Conditions, and Compounds E. coli strain ME8077 (minA, minB, thr-1, leuB6, azi, lacY1, tsx, ara-13, gal-6, malA1, thi-1, xyl-7 , RpsL, mtl-2, tonA2, supE44) were used as minicell producing cells (JW Szostak et al., Nature, 409, 387-390 (2001)). E. coli strain ME8167 (lac, gal, xyl, mtl, malA, thi, (lamda) ⁺ ) and E. coli strain RC30 (CGSC # 6599) (lacZ58 (del) (M15), lacI22, e14-, relA1, spoT1, thi- 1) was used as a genomic donor and had HfrR5 (leuA-> tonA) and HfrH (valS <-attP4) (DS Tawfik et al., Nature Biotechnol., 16, 652-656 (1998), T. Oberholzer et al., Chem. Biol., 2, 677-682 (1995)). The indicator plasmid pTSMb1 had the lac-cI toggle switch, p15 origin and kanamycin resistance gene (T. Oberholzer et al., Biochem. Biophys. Res. Commun., 261, 238-241 (1999)). Unless otherwise noted, E. coli strains were grown aerobically in LB medium (Difco) at 37 ° C. M9 minimal medium was used for conjugation of minicells and Hfr strains as well as confirmation of E. coli genetic markers. Kanamycin and sugars were purchased from Wako Chemical Co., Ltd. Mitomycin C was purchased from Kyowa Hakko Kogyo Co., Ltd.

(2) Isolation and purification of minicells E. coli ME8077 was transformed with pTSMb1 and incubated for 12 hours at 37 ° C. in 40 ml LB liquid medium containing 100 μg / ml kanamycin and 20 ng / ml mitomycin C. The culture was filtered through a filter membrane (Millex-SV, Millipore; pore size 5.0 μm). The filtrate was also filtered twice with a filtration membrane (Millex-AA, Millipore; pore size 0.8 μm) to remove normal cells. Minicells filtrate centrifuged (10,000 rpm, 5 min, 4 ° C.) are recovered by, M9 washed with minimal medium, 20 [mu] l of M9 minimal medium _{(12.8g Na 2 HPO 4 .7H 2} O, 3g KH 2 PO ₄ , 0.5 g NaCl, 1 g NH ₄ Cl, 2 mM MgSO ₄ , 0.1 mM CaCl ₂ , 0.4% glucose, 0.005% Thiamine, H ₂ O 1 L, pH 7.0). . This 10 μl minicell fraction was smeared onto LB agar plates and checked for normal cell contamination by the presence or absence of colonies.

(3) Joining conditions The ME8162 strain and the RC30 strain were incubated aerobically in an LB liquid medium at 37 ° C. When the optical density of the culture at 660 nm (OD ₆₆₀ ) reaches 0.1, the cultured cells are recovered by centrifugation (8,000 rpm, 1 min, 4 ° C.), washed with the same volume of M9 minimal medium, It was then suspended in the same volume of M9 minimal medium. 5 μl minicell fractions and 1 μl of each cell suspension were mixed and incubated at 37 ° C. for 5 hours. The mixture was then added to 100 μl M9 minimal medium and agitated on a vortex mixer for 3-5 minutes. The mixture was smeared on M9 agar plate minimal medium and incubated at 37 ° C.

(4) PCR amplification of 16S rDNA and green fluorescent protein (GFP) gene PCR amplification was performed with Gene Amp PCR System 9700 (Applied Biosystems) using EX Taq polymerase (Takara). Primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT) were used for amplification of 16S rDNA. Primers gfp-f (ATGAGTAAAGGAGAAGAACTTTT) and gfp-r (TTATTTGTATAGTTCATCCATGC) were used for amplification of the GFP gene.

(5) Analysis of GFP expression The cells were collected by centrifugation (8,000 rpm, 1 minute, 4 ° C.), washed with PBS buffer (75 mM sodium phosphate and 67 mM NaCl, pH 7.4), and GFP was measured. Suspended in PBS buffer. All GFP expression data was collected by using a Becton Dickinson FACSCalibur flow cytometer. Each fluorescence measurement of gene expression was obtained from 30,000 cells.

(6) E. coli genomic DNA pulse field gel electrophoresis (PFGE)
E. coli genomic DNA was prepared by the method of Walde et al. (P. Walde, et al., J. Am. Chem. Soc., 116, 7541-7547 (1994)). The E. coli strain was grown in 1 ml LB medium for 12 hours at 37 ° C. Cells were harvested by centrifugation (8,000 rpm, 1 min, 4 ° C.), washed with the same volume of PIV buffer (1M NaCl, 10 mM Tris = HCl (pH 7.6)) and in half volume of PIV buffer. Suspended. The cell suspension is mixed with the same volume of 1.6% Pulse Field Certified (PFC) agarose (BioRad) solution that has been preheated at 50 ° C. and immediately poured into a plug mold (BioRad). It was. The plug mold was maintained at 4 ° C. to allow the agarose to cure. The agarose gel block is removed from the plug template and 1 ml of EC buffer (6 mM Tris = HCl (pH 7.6), 1 M NaCl, 100 mM EDTA, 0.5% polyoxyethylene (20) cetyl ether (Brij-58). , 0.2% deoxycholate, 0.5% N-lauroyl sarcosine sodium). The agarose block in EC solution was then gently shaken for 15 minutes at room temperature. The agarose block was transferred to 1 ml EC buffer containing 1 mg / ml lysozyme and 20 μg / ml RNase and shaken gently at 37 ° C. overnight. The blocked agarose was then transferred to 1 ml of ES buffer (0.5 M EDTA (pH 9.0), 0.5% N-lauroyl sarcosine sodium) and gently shaken for 15 minutes at room temperature. The agarose block was transferred to 1.5 ml ES buffer containing 50 μg / ml proteinase K (Wako) and incubated at 50 ° C. for 36 hours. The agarose gel block was washed twice with 1.5 ml TE buffer, transferred to 1.5 ml TE buffer containing 1 mM PMSF and incubated for 1 hour at room temperature. The agarose gel block was washed twice with TE buffer and maintained at 4 ° C. as a genomic DNA gel block in TE buffer. The agarose gel block was washed with the appropriate buffer for AscI or PmeI restriction enzymes. The genomic DNA in the agarose gel block was then cleaved with 30 U AscI or PmeI for 24 hours at 37 ° C. The agarose gel block was washed twice with TE buffer after the enzymatic reaction. The agarose gel block was loaded onto 1% PFC agarose gel cells for PFGE. PFGE was performed using the CHEF MAPPER system (Bio-Rad) in 0.5X TBE buffer at 14 ° C according to instructions. For separation of fragments from 200 kb to 10 kb, the parameters are adjusted to a pulse time of 0.47-17.33 seconds, a ramping factor of -1.357, a voltage of 6 Vcm-1 and a runtime of 20.3 hours. It was. Lambda ladder (727.5-48.5 kb) DNA size markers and low range (194-2.03 kb) PFG markers were purchased from New England Bio (MA, USA).

2. Results Minicells are parts of bacterial cells that are produced by several bacteria with genetic mutations related to cell division (HI Adler et al., Proc. Natl. Acad. Sci. USA 57: 321- 326 (1967), JN Reeve, et al., J Bacteriol. 114: 860-73. (1973), RJ Sheehy et al., J Bacteriol. 114: 439-42. (1973)). Minicells have an electron transport system for obtaining energy at the cell membrane and a system for protein synthesis, and exhibit the same life activity as living cells except for biochemical reactions related to genomic DNA (HF Dvorak et al. 104: 543-8. (1970), KJ Roozen et al., J Bacteriol. 107: 21-33. (1971), NH Mendelson et al., J Bacteriol. 117: 1312-9. (1974)). Since the genome can be inserted into E. coli by a conjugation system between F ^- and Hfr strains, a system using E. coli minicells was constructed (Figure 1) (EA Birge et al., Bacterial and bacteriophage genetics. 4th Ed. Camper 11. (1981), JT Ou et al., Proc. Natl. Acad. Sci. USA 72: 3721-5 (1975)). During mating, the Hfr strain inserts a genomic DNA loop into the F ⁻ strain from the F plasmid oriT integrated into the genome.

  E. coli ME8077 with minA and minB mutations produces minicells. The size of a minicell is approximately one-fourth that of a normal cell. E. coli ME8077 is transformed with plasmid pTSMb1 and can maintain a high RNA polymerase concentration (N. Shepherd et al., J Bacteriol. 183: 2527-34 (2001)). Furthermore, pTSMb1 serves to discriminate whether the grown bacteria are derived from minicells after genome insertion by conjugation (H. Kobayashi et al., Proc. Natl. Acad. Sci. USA 101: 8414-8419). (2004)). At first, the minicell was purified from the culture solution by centrifugation (C. M. Koppelman et al., J Bacteriol. 183: 6144-7. (2001)). However, it took time and the minicell could not be completely separated from normal cells. Therefore, it was possible to purify the minicell within 30 minutes by repeating filtration with an appropriate membrane filter.

  ME8077 was cultured by adding mitomycin C at a low concentration. Mitomycin C is one of the antibiotics that activates the SOS cascade in E. coli. Since the genome inserted into the minicell from Hfr is linear, it was thought that it needs to be repaired to complete the circular genome. All enzymes in the SOS cascade facilitate DNA repair to reconstruct the genome. In addition, short single-stranded DNA produced by the action of mitomycin C served as a primer during DNA synthesis in the minicell. Finally, ME8077 minicells were prepared to retain pTSMb1, some SOS cascade protein and short single stranded DNA. Note that the cI857 protein derived from pTSMb1 is not degraded by the RecA protein. After filtering 40 ml of ME8077 culture, the minicells were collected by centrifugation and suspended in 20 μl of M9 minimal medium. When 10 μl of the minicell suspension was applied to the LB agar plate, no colonies were formed (data not shown).

Hfr strains ME8162 and RC30 (inserting the genome counterclockwise from 2.71 minutes (HfrR5) and clockwise from 96.8 minutes (HfrH)) were applied as genome-providing strains (FIG. 2). The conjugation was performed in M9 minimal medium containing 5% at 37 ° C. and 0.4% glucose as carbon source to insert the entire genome from the two Hfr strains. The presence of the E. coli genome and pTSMb1 was confirmed by PCR amplification of 16S rDNA on the genome and green fluorescent protein (GFP) gene on the plasmid (FIG. 3). Minicell production strain ME8077 holds genomic DNA and pTSMb1. Both 16S rDNA and GFP genes were confirmed by PCR. Only pTSMb1 is present in the purified minicell suspension. Only the GFP gene was confirmed. PCR results also showed that the minicell was completely purified by filtration and was a minicell with only pTSMb1. The 16srDNA and the gfp gene were confirmed in the minicell suspension purified by filtration after ME8126 and RC30 were joined. From these results, it was found that the genome was successfully inserted into the minicell using the junction of the F ⁻ strain and the Hfr strain.

  Conjugates were cultured on M9 minimal medium agar plates (M9GK) containing 0.4% glucose and 100 g / ml kanamycin at 37 ° C. for 4-5 days. These strains cannot grow on M9GK because the ME8077 strain is amino acid-requiring and the ME8162 and RC30 strains are kanamycin sensitive. Four colonies were obtained from 10 experiments and these 4 strains were named R1 to R4. When minicells were joined to either ME8162 or RC30, no colonies grew on M9GK agar plates. FIG. 4 shows the results of microscopic observations of ME8077, purified minicells, the first culture of the R strain and the stable culture of the R strain. The minicell produced by ME8077 had a spherical shape with a diameter of approximately 1 μm. At the first stage, the cell shape of R1-4 strains was short bacillus (2-3 × 2-4 μm). However, the R strain was very unstable and sometimes showed a long morphology and grew very slowly (data not shown). In order to stabilize the shape and characteristics of the R strain, culture was performed a few times, and then whether the R strain originated from ME8077 minicells and whether it had the genomes of ME8162 and RC30 were investigated.

There are three possibilities for the origin of the R strain, except for the synthesis of E. coli cells from minicells. The first is a spontaneous mutant strain of ME8077 that has become non-required for threonine and leucine, or a ME8162 (or RC30) strain that has acquired resistance to kanamycin. The second is a simple mating recombinant between the few F ⁻ cells remaining in the minicell suspension and the Hfr strain. The third is a transformant of strain ME8162 or RC30 with pTSMb1 that occurred during conjugation. In order to confirm the origin of the R strain, biochemical characteristics and genome were examined.

  Plasmid pTSMb1 transformed into ME8077 includes a kanamycin resistance gene, a lac-cI gene toggle switch and p15 ori. The gene toggle switch shows two stable states of GFP gene expression due to the lacI and cI genes on the genomic DNA. Since the ME8077 genome has a lacI gene and no cI gene, GFP cannot be expressed (OFF state). In contrast, in the genomes of ME8162 and RC30, there is a cI gene and no lacI gene, so GFP is expressed (ON state; FIGS. 5 and 6). All strains R1 to R4 showed GFP expression (on state) and carried the pTSMb1 plasmid (FIG. 11). Furthermore, the R strain did not have the ability to produce minicells. These results suggested that the R strain is not a spontaneous mutant of ME8077 that has become non-amino acid required. The GFP expression level of the R strain was slightly lower than ME8162 and RC30.

The R strain was examined for genetic markers in the ME8077 strain (galactose, xylose, mannitol, maltose and arabinose utilization, amino acid requirement and streptomycin resistance) (FIG. 7). R2, R3 and R4 showed the same genetic markers as RC30. R1 showed the same genetic marker as ME8162, except for the ability to assimilate maltose. In the minicell suspension used in the joining experiment, it is very difficult to confirm the number of ME8077 mixed normal cells. However, when the minicell suspension was applied on an LB agar plate without joining, or when it was applied after performing a joining experiment with either ME8167 or RC30 strain, no growing colonies were observed. . Therefore, even if normal cells are mixed, it is considered that there are a few or less. Therefore, a conjugation experiment was performed under the same conditions using the ME8077 strain and two Hfr strains, and an attempt was made to obtain a zygote having the same genetic marker as the R strain. As a result, none of the 243 conjugated recombinants grown on the M9GK agar medium showed the same genetic markers as the R strain, including GFP and minicell productivity (Table 1).

In addition, the two recombinants with altered genetic markers only changed at most 5 of the 8 genetic markers. Similar to previous reports, in simple conjugation experiments, the transfer of multiple genetic markers between F ^- and Hfr was less than 2% (RG Lioyd et al., Genetics. 139: 1123-1148 (1995)). Therefore, the R strain could not be obtained from a conjugated recombinant between ME8077 and ME8162 or RC30 due to biochemical properties.

  The growth curves of R1-4 strains at 37 ° C. were compared with ME8077, ME8162, and RC30 (FIG. 8). The doubling times for R1, R2, R3 and R4 were 0.59, 0.57, 0.57 and 0.45 h, respectively. The doubling time of the R strain in the logarithmic growth phase was within the normal range of E. coli. However, the turbidity at 660 nm in the stationary phase showed 1.5. The stationary phase turbidity was about 1/3 compared with ME8162, RC30 and ME8077. The R strain showed different growth characteristics from the strain that became the material.

  The genomes of R strain, ME8077, ME8162 and RC30 were examined. The genome of each strain was digested with PmeI or AscI restriction enzymes and then separated by pulse field electrophoresis (PFGE) (FIG. 9). The genome degradation patterns of ME8077, ME8162, and RC30 by PmeI and AscI were completely different from each other. For example, when digested with PmeI, the ME8077 strain did not have three bands of 194 kbp or more, but the ME8162 and RC30 strains had only two bands (a thick band and a thin band). Differences between ME8077, ME8162, and RC30 were evident in the AscI degradation pattern compared to PmeI. ME8077 was significantly different from the other two Hfr strains, especially at 9.42 kbp and 200 kbp. The degradation pattern of the R strain genome by PmeI or AscI showed a pattern in which ME8162 and RC30 were mixed, not ME8077. There were also some differences in the digestion pattern of the genome among the R strains. In the Pmel digestion of the genome, 220 to 125 kbp of all R strains showed the same pattern as the RC30 strain. However, the R3 and R4 strains showed the same pattern as the PmeI degradation of the ME8162 strain from 97 to 70 kbp and from 125 to 80 kbp. On the other hand, the R1 and R2 strains showed the same degradation pattern as the RC30 strain in the above region. The genomes of all R strains showed almost the same degradation pattern upon degradation with AscI. The two largest bands of 190 kbp and 165 kbp were the same as the RC30 strain. The degradation pattern of the R strain from 105 kbp to 93 kbp was similar to that of the ME8162 strain, but from 93 kbp to 72 kbp and from 23 kbp to 7.7 kbp was similar to RC30. The genomes of the four R strains were found to be closer to RC30 than ME8162 from the PFGE results. The ME8162 strain has a lambda phage lysate in the genome. Since activated RecA is present in the minicell, the lysate phage changes to the lysis cycle. As a result, minicells containing a large amount of ME8162 genome are considered to be highly lysed by phages. From the above results, it was found that the R strain genome was composed of a mixture of both ME8162 and RC30 genomes. The R strain was found not to be a spontaneous mutant of ME8162 or RC30, or a recombinant of pTSMb1. The R strain originated from a minicell isolated from ME8077 and had a new complex genome of ME8162 and RC30.

(Comparative Example 1)
Utilization of other minicell producing strains (χ1411 (CGSC6397) strain) was attempted by the same method as in the Examples. However, a synthetic bacterial colony could not be obtained by conjugation with the χ1411 minicell and ME8162 and RC30. As a result of microscopic observation, the χ1411 minicell was found to be slightly smaller than the ME8077 minicell. The size of the minicell may be one of the important factors for the regeneration of E. coli.

(Comparative Example 2)
Seven other E. coli Hfr strains (CGSC312, CGSC5778, CGSC2437, CGSC5816, CGSC5132, CGSC5350, CGSC4895) were examined as genome donors. The combinations of Hfr strains for which the conjugation experiments were performed were (1) CGSC312 + CGSC5778, (2) CGSC2437 + CGSC5816, (3) CGSC312 + CGSC5778 + CGSC2437 + CGSC5816, (4) CGSC2437 + CGSC5132 + CGSC5350, CGSC4895, 132C The gene insertion positions of the above seven strains in the genome map of E. coli are shown in FIG. In FIG. 10, the numerical value on the outer periphery of the circle indicates the position (minute) of the gene, and the numerical value on the inner periphery indicates the strain number. Strains with only numerical strain numbers indicate CGSC numbers. The genomic gene map is shown clockwise with a black arrow and counterclockwise with a red arrow.

As can be seen from FIG. 10, the seven Hfr strains differed from ME8162 and RC30 in the point and direction of genome insertion. However, regeneration of E. coli from minicells was not successful with Hfr strains other than ME8162 and RC30. Furthermore, a regenerated strain could not be obtained when it was joined with three or more Hfr strains including ME8162 and RC30. At the time of conjugation, the frequency of genome insertion from Hfr to the F ⁻ strain depends on the characteristics of each Hfr strain. Furthermore, in this experiment, since the conjugation time is as long as 5 hours, the Hfr strain proliferates and the problem of lethal conjugation occurs (RA Skurray et al., J Bacteriol. 113: 58-70. (1973)). The state of conjugation may affect regeneration from minicells to E. coli cells.

FIG. 1 is a schematic diagram of a method for producing a mating transfer transformant from a minicell, from a minicell of E. coli strain ME8077 purified by genome transfer of strains ME8167 and RC30 via conjugation of F ⁻ and Hfr strains. A method for producing a conjugate transfer transformant of FIG. 2 shows the direction of genome transmission and PO points (introduction part) of ME8167 strain and RC30 strain during mating. FIG. 3 shows the results of PCR amplification of the gfp gene and 16S rDNA of ME8162 strain with pTSMb1, purified minicell, and minicell after conjugation with Hfr strain. FIG. 4 shows the cell morphology of strain ME8077, minicells and mating transfer transformants. As described in the examples, minicells (indicators) were purified from strain ME8077, and all strains were incubated in LB medium at 37 ° C. Bar indicates 5 μm. FIG. 5 shows pTSMb1 which is an indicator plasmid. The genomic cI gene of ME8162 and RC30 strains suppresses lacI expression of pTSMb1 and leads to gfp expression, and the genomic lacI gene of ME8077 strain suppresses cI and gfp expression. FIG. 6 shows the results of gfp expression in the mating transfer transformant and the parent strain. FIG. 7 shows genetic markers of the mating transfer transformant and the parent strain. All strains were streaked on LB medium with antibiotics or M9 minimal medium with each saccharide as carbon source. FIG. 8 shows the growth of the mating transfer transformant and the parent strain. All strains were incubated aerobically at 37 ° C. Growth was measured at an optical density of 660 nm. FIG. 9 shows the PFGE results for PmeI and AscI of the E. coli genome. M1 and M2 are a low range PFG marker and a lambda ladder marker, respectively. FIG. 10 shows the gene insertion position of each Hfr strain in the chromosome map of E. coli. In the figure, the numerical value on the outer periphery of the circle indicates the position (minute) of the gene, the numerical value on the inner periphery indicates the strain number, and the strain having the numerical strain number only indicates the CGSC number. The genomic gene map is shown clockwise with a black arrow and counterclockwise with a red arrow. FIG. 11 shows the results of electrophoresis of plasmids of pTSMb1 and the mating transfer transformant. The plasmid was isolated from 6 ml of culture grown overnight using a miniprep kit (Qiagen, MD). The plasmid was cut with NheI or AgeI and separated by electrophoresis. FIG. 12 shows an outline of a production method using donor A and donor B using genetic engineering techniques.

Claims (4)

A step of culturing a minicell-producing bacterium having a vector to which RNA polymerase is attached under a nucleic acid cleavage condition to obtain a nucleic acid-cleaved minicell-producing bacterium and a culture containing the minicell;
Separating the minicells from the culture; and at least a donor A genome in which the direction of conjugation transmission is clockwise and the introduction of conjugation transmission is located within 10 minutes from the zero point in a counterclockwise direction. With some
At least a portion of the donor B genome in which the direction of conjugation transmission is counterclockwise and the introduction of conjugation transmission is located within 10 minutes clockwise from the zero point,
A method of producing the conjugative transfer transformant, comprising the step of conjugating and transmitting to the minicell in a minimal medium to obtain a conjugative transfer transformant having a proliferation ability,
The minicell producing bacterium having the vector to which the RNA polymerase is attached is E. coli strain ME8077 transformed with pTSMb1,
The donor A is E. coli strain ME8162;
A method wherein the donor B is E. coli RC30 strain. The culture under the nucleic acid cleavage conditions is at least one selected from the group consisting of culture in the presence of a nucleic acid cleavage agent, culture under ultraviolet irradiation, and culture under radiation irradiation. the method of. The method according to claim 2, wherein the nucleic acid cleaving agent is at least one selected from the group consisting of mitomycin C, naldixic acid, bleomycin hydrochloride, pepromycin sulfate, dinostatin stimamarer, and idarubicin hydrochloride. To be used in the method for producing a conjugative transfer transformant according to any one of claims 1 to 3, which has a pTSMb1 to which RNA polymerase is attached, derived from E. coli strain ME8077 having pTSMb1 subjected to nucleic acid cleavage treatment. The minicell.