JP5229888B2 - Protein A mutant protein and antibody capture agent with improved easy dissociation in weakly acidic region - Google Patents

Description

  The present invention relates to a novel and improved protein of the extracellular domain of protein A, which is an antibody-binding protein, a nucleic acid encoding the protein, and an antibody capturing agent utilizing the antibody binding property of the protein.

  Protein A, which is a protein derived from Staphylococcus aureus, is known to have a specific binding activity to the Fc region of immunoglobulin G, which is a kind of antibody (Non-patent Documents 1 and 2). Protein A is a multi-domain membrane protein composed of a plurality of domains, and shows a binding activity to a protein having an Fc region of immunoglobulin G (hereinafter referred to as antibody binding activity). (Non-Patent Document 2). For example, in the case of protein A derived from NCTC8325 strain shown in FIGS. 1 and 3, five domains of E, D, A, B, and C show antibody binding activity. These are small proteins of less than 60 amino acids, and high homology is observed between their amino acid sequences (FIG. 2). Further, it is known that the antibody binding activity is maintained even when protein A is cleaved and each domain alone is isolated (Non-patent Document 3). On the other hand, the Z domain is an artificial protein synthesized based on the sequence of the B domain (Non-patent Document 3), and differs from the B domain in two amino acid residues (FIG. 2). It is known that the two-substitution of Ala1Val and Gly29Ala does not lose the antibody binding property, but the structure is stabilized, and the heat denaturation temperature becomes 90 ° C. or higher (Non-patent Document 3).

  Protein A extracellular domain (E, D, A, B, C) and Z domain are currently on the market for many products utilizing their selective antibody binding activity (for example, for antibody purification). Affinity chromatography carriers (Patent Documents 1 and 2), test reagents for detecting antibodies, research reagents, etc.). It is known that the binding force between the extracellular domain of protein A and the antibody is high in the neutral region and low in the strongly acidic region (Non-patent Document 4). Therefore, for the purpose of antibody isolation, recovery, and purification, first, a sample solution containing an antibody such as serum is neutralized, and a water-insoluble solid phase such as beads immobilized with the extracellular domain of protein A is immobilized. The antibody is selectively adsorbed by contacting with a phase support. Thereafter, the solution is washed with a neutral solution at pH 7 to remove components other than antibodies. Finally, it is common to add a strongly acidic solution of pH 3.0 to desorb the antibody from the immobilized protein A and elute together with the strongly acidic solution (Patent Documents 1 and 2). Thereby, the antibody can be isolated, recovered and purified with high purity.

  However, when an antibody is placed in a strongly acidic solution having a pH of about 3.0, it may deteriorate due to denaturation aggregation or the like, and depending on the type of antibody, the original function may be lost (Non-patent Document 4). In order to prevent this, elution is attempted in a weakly acidic region at a pH higher than pH 3.0. However, since the binding force between the extracellular domain of protein A and the antibody is strong, the antibody is eluted from protein A in the weakly acidic region. Therefore, a sufficient recovery amount cannot be obtained.

U.S. Patent No. 3995018 JP 63-258500 A Forsgren A and Sjoquist J (1966) "Protein A" from S. Aureus. J Immunol. 97, 822-827. Boyle M. D.P., Ed. (1990) Bacterial Immunoglobulin Binding Proteins. Academic Press, Inc., San Diego, CA, USA. Tashiro M, Montelione GT. (1995) Structures of bacterial immunoglobulin-bindingdomains and their complexes with immunoglobulins. Curr Opin Struct Biol. 5, 471-481. Gagnon P. (1996) Purification Tools for Monoclonal Antibodies, Validated Biosystems Inc., Tucson, AZ, USA.

  The present invention is to solve the above-mentioned problems in the prior art, and more specifically, compared with the extracellular domain of wild-type protein A without impairing high antibody binding activity in the neutral range. The purpose of this invention is to provide an improved protein with reduced binding to the Fc region of immunoglobulin in a weakly acidic region, and to make it possible to easily capture and recover the antibody without denaturing it using this improved protein. It is what.

  In order to prevent the antibody from being deteriorated by a strong acid when the antibody is acid-eluted from the solid support on which the extracellular domain of protein A is immobilized, the present inventor elutes the antibody from the solid support with a weakly acidic solution. As a result of diligent research, it was determined that the amino acid sequence of the extracellular domain of protein A should be modified, and as a result of intensive research, the immunity of the modified protein in the neutral region was determined using the three-dimensional coordinate data of the extracellular domain of protein A and the antibody. Sequence of a novel protein A variant that has a binding ability to the globulin Fc region equal to or higher than that of wild type protein A, and that the antibody binding ability of the modified protein in the weakly acidic region is greatly reduced compared to wild type protein A Designed. Then, it was confirmed that the mutant protein synthesized based on these designs had the intended physical properties, and the present invention was completed.

That is, the present invention is as follows.
1) A variant protein of the E domain protein of protein A consisting of the amino acid sequence represented by SEQ ID NO: 1, having any one of the following amino acid sequences (a) to (c), and immunoglobulin G The mutant protein having binding activity in the weakly acidic region with respect to the Fc region of immunoglobulin G compared to the wild-type E domain of protein A and having binding activity in the Fc region of
(A) In the amino acid sequence represented by SEQ ID NO: 1, at least one amino acid residue of Asp6, Gln10, Asn11, Tyr14, Gln15, Leu17, Asn18, Ala24, Arg27, Asn28, Gln32, Lys35 is histidine Amino acid sequence substituted with a residue.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b).

2) A variant protein of the D domain protein of protein A consisting of the amino acid sequence shown in SEQ ID NO: 2, which has any of the following amino acid sequences (a) to (c), and immunoglobulin G The mutant protein according to claim 1, which has a binding activity in the Fc region of and a reduced weakly acidic binding activity to the Fc region of immunoglobulin G compared to the wild-type D domain of protein A.
(A) In the amino acid sequence represented by SEQ ID NO: 2, at least one amino acid residue of Asn6, Gln10, Ser11, Tyr14, Glu15, Leu17, Asn18, Glu24, Arg27, Asn28, Gln32, Lys35 is histidine Amino acid sequence substituted with a residue.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b).

3) A variant protein of the A domain protein of protein A consisting of the amino acid sequence represented by SEQ ID NO: 3, which has any of the following amino acid sequences (a) to (c), and immunoglobulin G The mutant protein having binding activity in the weakly acidic region with respect to the Fc region of immunoglobulin G compared to the wild-type A domain of protein A and having binding activity in the Fc region of
(A) In the amino acid sequence represented by SEQ ID NO: 3, at least one amino acid residue of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Asn18, Glu24, Arg27, Asn28, Gln32, Lys35 is histidine Amino acid sequence substituted with a residue.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b).

4) A variant protein of the B domain protein of protein A consisting of the amino acid sequence represented by SEQ ID NO: 4, having any of the following amino acid sequences (a) to (c), and immunoglobulin G The mutant protein (a) shown in SEQ ID NO: 4 has binding activity in the Fc region of and a reduced binding activity in the weakly acidic region to the Fc region of immunoglobulin G compared to the wild-type B domain of protein A. An amino acid sequence obtained by substituting one or more amino acid residues of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Glu24, Arg27, Asn28, Gln32, and Lys35 with a histidine residue.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b).

5) A variant protein of the C domain protein of protein A consisting of the amino acid sequence represented by SEQ ID NO: 5, which has any of the following amino acid sequences (a) to (c), and immunoglobulin G The mutant protein having a binding activity in the weakly acidic region with respect to the Fc region of immunoglobulin G as compared with the wild-type C domain of protein A (a) An amino acid sequence obtained by substituting one or more amino acid residues of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Glu24, Arg27, Asn28, Gln32, and Lys35 with a histidine residue.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b).

6) A variant protein of the Z domain protein of protein A consisting of the amino acid sequence represented by SEQ ID NO: 6, which has any one of the following amino acid sequences (a) to (c), and immunoglobulin G The mutant protein having binding activity in the weakly acidic region with respect to the Fc region of immunoglobulin G compared to the wild-type Z domain of protein A and having binding activity in the Fc region of
(A) In the amino acid sequence represented by SEQ ID NO: 6, one or more amino acid residues of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Glu24, Arg27, Asn28, Gln32, and Lys35 are substituted with histidine residues. Amino acid sequence replaced with.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b).

7) The mutant protein according to 1) above, comprising the amino acid sequence of any of the following (a) to (c): (a) the amino acid sequence represented by any of SEQ ID NOs: 7 to 9;
(B) An amino acid sequence in which one or several amino acid residues are inserted or added in the amino acid sequence of (a).
(C) An amino acid sequence obtained by deleting or replacing one or several amino acid residues other than the histidine residue substitution site in the amino acid sequence of (a) or (b).

8) The mutant protein according to 2), comprising the amino acid sequence of any one of the following (a) to (c): (a) the amino acid sequence represented by any one of SEQ ID NOs: 10 to 12.
(B) An amino acid sequence in which one or several amino acid residues are inserted or added in the amino acid sequence of (a).
(C) An amino acid sequence obtained by deleting or replacing one or several amino acid residues other than the histidine residue substitution site in the amino acid sequence of (a) or (b).

9) The mutant protein according to 3) above, comprising the amino acid sequence of any of the following (a) to (c): (a) the amino acid sequence represented by any of SEQ ID NOs: 13 to 15;
(B) An amino acid sequence in which one or several amino acid residues are inserted or added in the amino acid sequence of (a).
(C) An amino acid sequence obtained by deleting or replacing one or several amino acid residues other than the histidine residue substitution site in the amino acid sequence of (a) or (b).

10) The mutant protein according to 4) above, comprising the amino acid sequence of any of the following (a) to (c): (a) the amino acid sequence represented by any of SEQ ID NOs: 16 to 18;
(B) An amino acid sequence in which one or several amino acid residues are inserted or added in the amino acid sequence of (a).
(C) An amino acid sequence obtained by deleting or replacing one or several amino acid residues other than the histidine residue substitution site in the amino acid sequence of (a) or (b).

11) The mutant protein according to 5) above, comprising the amino acid sequence of any of the following (a) to (c): (a) the amino acid sequence represented by any one of SEQ ID NOs: 19 to 21;
(B) An amino acid sequence in which one or several amino acid residues are inserted or added in the amino acid sequence of (a).
(C) An amino acid sequence obtained by deleting or replacing one or several amino acid residues other than the histidine residue substitution site in the amino acid sequence of (a) or (b).

12) The mutant protein according to 6) above, comprising the amino acid sequence of any of the following (a) to (c): (a) the amino acid sequence represented by any of SEQ ID NOs: 22 to 24;
(B) An amino acid sequence in which one or several amino acid residues are inserted or added in the amino acid sequence of (a).
(C) An amino acid sequence obtained by deleting or replacing one or several amino acid residues other than the histidine residue substitution site in the amino acid sequence of (a) or (b).

13) A protein comprising an amino acid sequence in which the amino acid sequence of the protein according to any one of 1) to 12) above and a linker peptide or an amino acid sequence of a linker protein are alternately arranged.

14) A fusion protein comprising an amino acid sequence obtained by linking the amino acid sequence of the protein according to any one of 1) to 13) above and the amino acid sequence of another protein.

15) A protein with a spacer comprising the amino acid sequence of the protein according to any one of 1) to 14) above and the amino acid sequence of a spacer for immobilizing the protein on a water-insoluble solid phase support.

16) A nucleic acid encoding the protein according to any one of 1) to 15) above.

17) A nucleic acid comprising the base sequence represented by any of SEQ ID NOs: 26 to 28.

18) It hybridizes with a nucleic acid comprising a sequence complementary to the base sequence of the nucleic acid described in 16) or 17) under stringent conditions, has a binding activity to the Fc region of immunoglobulin G, and is a wild type A nucleic acid encoding a mutant protein having a reduced binding activity in a weakly acidic region with respect to the Fc region of immunoglobulin G as compared with the antibody-binding domain of protein A.

19) A recombinant vector containing the nucleic acid according to any one of 16) to 18) above.

20) A transformant introduced with the recombinant vector according to 19) above.

21) An immobilized protein, wherein the protein according to any one of 1) to 15) above is immobilized on a water-insoluble solid support.

22) An antibody, an immunoglobulin G, or a protein capture agent having an Fc region of immunoglobulin G, which comprises the protein according to any one of 1) to 15) above.

23) A capturing agent for a protein having an antibody, immunoglobulin G, or immunoglobulin G Fc region, which comprises the immobilized protein according to 21) above.

According to the present invention, each wild type domain (E, D, A, B, or protein A) consisting of the amino acid sequence represented by SEQ ID NOs: 1 to 6 while maintaining the original antibody binding activity in the neutral range. C), or a mutant protein that greatly reduces the binding ability to the Fc region of immunoglobulin G in a weakly acidic region as compared to the original Z domain. Furthermore, it becomes possible to more easily elute an antibody captured using an antibody supplement comprising these mutant proteins in a weakly acidic region without denaturation.
On the other hand, wild-type protein A extracellular domain is currently marketed as an affinity chromatography carrier for antibody purification and a test reagent for antibody detection, and is widely used in various fields of life science. In addition, with the recent development of antibody-related industries including antibody drugs, the demand for these products has increased dramatically. Therefore, in many products containing protein A extracellular domain, it is possible to reduce the deterioration of the antibody due to acid elution by substituting the improved protein as in the present invention with the wild type, and a wide range of handling antibodies. In the technical field, it greatly contributes to the technological development.

  Protein A, which is a protein derived from Staphylococcus aureus, is known to have specific binding activity to the Fc region of immunoglobulin G, which is a kind of antibody (Reference Document 1, Reference Document 2). It is a protein that is useful for purification and removal of antibodies using and for diagnosis, treatment, testing, etc. using antibodies. Protein A is a multi-domain membrane protein composed of a plurality of domains, and shows a binding activity to a protein having an Fc region of immunoglobulin G (hereinafter referred to as antibody binding activity). (Reference Document 2). For example, in the case of protein A derived from Staphlococcus aureus subsp. Aureus NCTC8325 strain shown in FIG. 1, FIG. 3, and [SEQ ID NO: 29], antibody binding activity is shown by five of E, D, A, B, and C. Is a domain. These are all small proteins of less than 60 amino acids, and high homology is observed between their amino acid sequences (FIG. 2). In addition, it is known that antibody binding activity is maintained even if protein A is cleaved to isolate each domain alone (Reference 3). On the other hand, the Z domain is an artificial protein synthesized based on the sequence of the B domain (Non-patent Document 3), and differs from the B domain in two amino acid residues (FIG. 2). It is known that the two-substitution of Ala1Val and Gly29Ala does not lose the antibody binding property, but the structure is stabilized, and the heat denaturation temperature becomes 90 ° C. or higher (Non-patent Document 3).

  The improved protein of the present invention comprises an amino acid sequence artificially designed based on the amino acid sequence of the above protein A, and is a wild-type protein without impairing high antibody binding activity in the neutral range. Compared to the extracellular domain of protein A, the antibody binding activity in the weakly acidic region is weak, and the antibody can be eluted in a weakly acidic solution.

Embodiments of the improved protein of the present invention are shown in the following (a) to (f).
(A) Protein A E domain mutant protein.
The protein A E domain mutant protein of the present invention has binding activity to the F region of immunoglobulin G and binds to the F region of immunoglobulin G in a weakly acidic region as compared to the wild type E domain of protein A. The mutant protein having reduced activity,
a) In the amino acid sequence shown in SEQ ID NO: 1, at least one amino acid residue of Asp6, Gln10, Asn11, Tyr14, Gln15, Leu17, Asn18, Ala24, Arg27, Asn28, Gln32, Lys35 is left as a histidine residue. Or b) an amino acid sequence in which one or several amino acid residues are further inserted or added to the mutation-introduced amino acid sequence of a) above, or c) In the mutagenized amino acid sequence of a) or b), it consists of an amino acid sequence in which one or several amino acid residues other than the histidine substitution site are deleted or substituted.

(A) Protein A D-domain mutant protein The protein A D-domain mutant protein of the present invention has an activity of binding to the Fc region of immunoglobulin G and is an immunoglobulin compared to the wild-type D domain of protein A. The mutant protein having a reduced binding activity in a weakly acidic region to the Fc region of G,
a) In the amino acid sequence shown in SEQ ID NO: 2, at least one amino acid residue of Asn6, Gln10, Ser11, Tyr14, Glu15, Leu17, Asn18, Glu24, Arg27, Asn28, Gln32, Lys35 is left as a histidine residue. Or b) an amino acid sequence in which one or several amino acid residues are further inserted or added to the mutagenized amino acid sequence of a) above, or c) In the mutagenized amino acid sequence of a) or b), it consists of an amino acid sequence in which one or several amino acid residues other than the histidine substitution site are deleted or substituted.

(C) Protein A A domain mutant protein The protein A A domain mutant protein of the present invention has binding activity to the Fc region of immunoglobulin G and is an immunoglobulin compared to the wild type A domain of protein A. The mutant protein having a reduced binding activity in a weakly acidic region to the Fc region of G,
a) In the amino acid sequence shown in SEQ ID NO: 3, at least one amino acid residue of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Asn18, Glu24, Arg27, Asn28, Gln32, Lys35 is left as a histidine residue. Or a) an amino acid sequence in which one or several amino acid residues are inserted or added in the mutation-introduced amino acid sequence of a) above, or c) a) above Or b) a mutation-introduced amino acid sequence consisting of an amino acid sequence in which one or several amino acid residues other than the substituted histidine residue are deleted or substituted.

(D) Protein B B Domain Mutant Protein The protein B B domain mutant protein of the present invention has binding activity to the Fc region of immunoglobulin G and is an immunoglobulin compared to the wild type B domain of protein A. The mutant protein having a reduced binding activity in a weakly acidic region to the Fc region of G,
a) at least one of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Glu24, Arg27, Asn28, Gln32, and Lys35 in the B domain protein of protein A consisting of the amino acid sequence shown in SEQ ID NO: 4 It consists of an amino acid sequence in which an amino acid residue is substituted with a histidine residue, or b) consists of an amino acid sequence in which one or several amino acid residues are inserted or added in the mutagenized amino acid sequence of a) above, Or c) in the amino acid sequence of a) or b) above, which consists of an amino acid sequence in which one or several amino acid residues other than the substituted histidine residue are deleted or substituted.

(E) C domain mutant protein of protein A The C domain mutant protein of protein B of the present invention has binding activity to the Fc region of immunoglobulin G and is an immunoglobulin compared to the wild type C domain of protein A. The mutant protein having a reduced binding activity in a weakly acidic region to the Fc region of G,
a) In the amino acid sequence shown in SEQ ID NO: 5, one or more amino acid residues of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Glu24, Arg27, Asn28, Gln32, and Lys35 are used as histidine residues. It consists of a substituted amino acid sequence, or b) consists of an amino acid sequence in which one or several amino acid residues are inserted or added in the amino acid sequence of a) above, or c) of the above a) or b) The amino acid sequence consists of an amino acid sequence in which one or several amino acid residues other than the substituted histidine residue are deleted or substituted.

(F) Protein A Z-domain mutant protein The protein B C-domain mutant protein of the present invention has binding activity to the Fc region of immunoglobulin G and is an immunoglobulin compared to the wild-type Z domain of protein A. The mutant protein having a reduced binding activity in a weakly acidic region to the Fc region of G,
a) In the amino acid sequence shown by SEQ ID NO: 6, one or more amino acid residues of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Glu24, Arg27, Asn28, Gln32, and Lys35 are used as histidine residues. It consists of a substituted amino acid sequence, or b) it consists of an amino acid sequence in which one or several amino acid residues are inserted or added in the mutated amino acid sequence of a) above, or c) a above Or b) The amino acid sequence consists of an amino acid sequence in which one or several amino acid residues other than the substituted histidine residue are deleted or substituted.

1. Design of amino acid sequence of improved protein The mutant proteins of (a) to (f) above are designed based on the site to be mutated selected as follows and the amino acid residue that replaces the site, and are genetically engineered. Etc.
The site for introducing the mutation for designing the amino acid sequence of the improved protein of the present invention is the three-dimensional structure atomic coordinate data (reference document 4) of the complex in which the protein A / B domain and the immunoglobulin G Fc region are combined. It was selected using.
In order to reduce the antibody binding property of the extracellular domain of protein A in a weakly acidic region, the amino acid residues on the binding surface of the extracellular domain of protein A and the surrounding amino acid residues directly involved in the binding to the Fc region The group may be replaced from wild type to non-wild type. Therefore, first, in the complex in which the protein A / B domain and the Fc region of immunoglobulin G are bound, the amino acid residues of the protein A / B domain existing within a certain distance from the Fc region are identified, Candidate sites for mutation. Next, in order to minimize structural instability of the extracellular domain of protein A due to amino acid substitution, only amino acid residues exposed on the surface of the protein A / B domain are mutated among the above candidates. The target site was determined.

Therefore, specifically, as shown in the examples below, the wild-type amino acid sequence of the protein A / B domain is set by setting the above distance range to 6.5 angstroms or less and the exposed surface area ratio to 35% or more. Of (SEQ ID NO: 4), Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, His18, Glu24, Arg27, Asn28, Gln32, and Lys35 were selected as mutation target sites.
By the way, as described above, each extracellular domain of protein A has high sequence homology (FIG. 2), and in addition, the D, E, and Z domains whose steric structure has been experimentally clarified are B domains. Since there is almost no difference from the single structure (Refs. 5 to 8), the knowledge about the three-dimensional structure of the B domain-Fc complex also applies to the E, D, A, C, and Z domain-Fc complexes. it can. That is, although the three-dimensional structures of the E domain-Fc complex, D domain-Fc complex, A domain-Fc complex, C domain-Fc complex, and Z domain-Fc complex have not yet been clarified, Judging from the sequence homology of each extracellular domain and the similarity of the three-dimensional structure of the B, D, E, and Z domains alone, the E, D, A, C, and Z domain-Fc complexes are It can of course be analogized to form a homologous structure with the B domain-Fc complex. Therefore, it is highly expected that the 12 selected sites to be mutated are located in the same spatial arrangement in the E, D, A, C, and Z domain-Fc complexes as in the B domain-Fc complex. 6th, 10th, 11th, 14th, 15th, 17th, 18th, 24th, 27th, 28th, 28th, 32nd, and 35th derived from the three-dimensional structure of the B domain-Fc complex These 12 sites to be mutated can be selected as sites to be mutated not only in the B domain but also in the D, A, C, and Z domains. That is, 12 of Asp6, Gln10, Asn11, Tyr14, Gln15, Leu17, Asn18, Ala24, Arg27, Asn28, Gln32, and Lys35 in the wild-type amino acid sequence of the protein A / E domain (SEQ ID NO: 1) are protein A. -Twelve Asn6, Gln10, Ser11, Tyr14, Glu15, Leu17, Asn18, Glu24, Arg27, Asn28, Gln32, and Lys35 in the wild type amino acid sequence of the D domain (SEQ ID NO: 2) Twelve of the wild-type amino acid sequence (SEQ ID NO: 3), Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Asn18, Glu24, Arg27, Asn28, Gln32, Lys35, are the wild-type amino acid sequences of the protein A / C domain. (SEQ ID NO: 5) Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, His18, Glu24, Arg27, Asn28, Gln32, Lys35, and the protein A / Z domain amino acid sequence (SEQ ID NO: 6) ) Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, His18, Glu24, Twelve of Arg27, Asn28, Gln32, and Lys35 were selected as mutation target sites.

  On the other hand, histidine is the best amino acid residue that replaces the original amino acid residue of the site to be mutated. This is because the chemical state of histidine changes greatly due to the dissociation of protons in the side chain between the neutral region and the weakly acidic region, so that the antibody binding property of each domain of protein A varies between the neutral region and the weakly acidic region. This is because it can be changed greatly. Therefore, as shown in the Examples below, the improved protein of the present invention includes the following. That is, a protein A / E domain variant containing any one or more of Asp6His, Gln10His, Asn11His, Tyr14His, Gln15His, Leu17His, Asn18His, Ala24His, Arg27His, Asn28His, Gln32His, Lys35His, corresponding to the embodiment of (a) above And a protein A / D domain variant comprising any one or more of Asn6His, Gln10His, Ser11His, Tyr14His, Glu15His, Leu17His, Asn18His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His, corresponding to the embodiment of (a) above And a protein A / A domain variant comprising any one or more of Asn6His, Gln10His, Asn11His, Tyr14His, Glu15His, Leu17His, Asn18His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His, corresponding to the embodiment of (c) above , And a pro comprising at least one of Asn6His, Gln10His, Asn11His, Tyr14His, Glu15His, Leu17His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His In A / B domain mutant and protein A containing one or more of Asn6His, Gln10His, Asn11His, Tyr14His, Glu15His, Leu17His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His -Protein A / Z containing any one or more of C domain mutant and Asn6His, Gln10His, Asn11His, Tyr14His, Glu15His, Leu17His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His, corresponding to the embodiment of (f) above Domain variant. Here, since the wild-type amino acid residue at position 18 of the B, C, and Z domains is histidine, even if this is replaced with histidine, it does not change before and after the substitution, so B, C, And His18His is excluded in the Z domain.

  As is apparent from the above, the site to be selected is not limited to one in the design of the improved protein of the present invention. A point mutant or a multiple mutant obtained by appropriately selecting from a plurality of mutation target sites and combining them can be used as an improved protein. For example, Gln10His / Asn11His protein A / E domain double mutant (SEQ ID NO: 7) selected as positions 10 and 11 as mutation target sites, Asn11His / Leu17His protein selected as positions 11 and 17 The double mutant of the A / E domain (SEQ ID NO: 8) and the Gln15His / Leu17His protein A / E domain double mutant (SEQ ID NO: 9) selected at positions 15 and 17 are in the form of (a) above. It is an example of the improved protein of the present invention included. Gln10His / Ser11His protein A / D domain double mutant (SEQ ID NO: 10) selected at positions 10 and 11 and Ser11His / Leu17His protein A / D domain selected at positions 11 and 17 A double mutant (SEQ ID NO: 11), a Glu15His / Leu17His protein A / D domain double mutant (SEQ ID NO: 12) selected at positions 15 and 17 is an improvement of the present invention included in the above-mentioned embodiment (a) It is an example of type protein. Gln10His / Asn11His protein A / A domain double mutant (SEQ ID NO: 13) selected at positions 10 and 11 as mutation target sites, Asn11His / Leu17His protein A / A domain selected at positions 11 and 17 A double mutant (SEQ ID NO: 14), a Glu15His / Leu17His protein A / A domain double mutant (SEQ ID NO: 15) selected at positions 15 and 17 is an improvement of the present invention included in the above-mentioned embodiment (c) It is an example of type protein. Gln10His / Asn11His protein A / B domain double mutant (SEQ ID NO: 16) selected as positions 10 and 11 and Asn11His / Leu17His protein A / B domains selected as positions 11 and 17 A double mutant (SEQ ID NO: 17), a Glu15His / Leu17His protein A / B domain double mutant (SEQ ID NO: 18) selected at positions 15 and 17 is an improvement of the present invention included in the above-mentioned embodiment (d) It is an example of type protein. Gln10His / Asn11His protein A / C domain double mutant (SEQ ID NO: 19) selected at positions 10 and 11 as mutation target sites, Asn11His / Leu17His protein A / C domain selected at positions 11 and 17 A double mutant (SEQ ID NO: 20), a Glu15His / Leu17His protein A / C domain double mutant (SEQ ID NO: 21) selected at positions 15 and 17 is an improvement of the present invention included in the above-mentioned embodiment (e) It is an example of type protein. Gln10His / Asn11His protein A / Z domain double mutant (SEQ ID NO: 22) selected as positions 10 and 11 and Asn11His / Leu17His protein A / Z domain selected as positions 11 and 17 A double mutant (SEQ ID NO: 24), a Glu15His / Leu17His protein A / Z domain double mutant (SEQ ID NO: 24) selected at positions 15 and 17 is an improvement of the present invention included in the above-mentioned embodiment (f) It is an example of type protein. As described above, as shown in Examples below, in the improved protein of the present invention, a plurality of types of amino acid sequences can be designed.

The improved protein comprising the double mutants shown in SEQ ID NOs: 7 to 24 has binding activity to an antibody, an immunoglobulin G, or a protein having an Fc region of immunoglobulin G, and is a wild-type protein A As long as the binding activity in the weakly acidic region to the Fc region of immunoglobulin G is reduced compared to each extracellular domain protein, insertion or addition mutation or substitution of histidine residues in one or several amino acid residues One or several amino acid residues other than the group may be further deleted or substituted.
For example, when synthesizing the improved protein of the present invention in the form of a tagged protein such as a His tag or a fusion protein with another protein, the synthesis is performed between the tag and the improved protein after synthesis, or with another protein. There may be cases where 1 to several amino acid residues remain on the N-terminal side or the C-terminal side of the improved protein even when the protein is digested with a sequence-specific proteolytic enzyme. When the improved protein of the present invention is produced, methionine derived from the start codon may be added to the N-terminal side, but as shown in the examples described later, by adding these amino acid residues, Antibody binding does not change significantly. Further, as shown in Examples below, the addition of these amino acid residues does not lose the effect of the designed mutation. Therefore, the improved protein of the present invention naturally includes these mutations. In order to prepare such an improved protein without addition of amino acid residues, for example, an improved protein produced using Escherichia coli or the like is further added to an N-terminal using an enzyme such as methionylaminopeptidase. Can be obtained by selectively cleaving the amino acid residue (Reference 9) and separating and purifying the reaction mixture by chromatography or the like.

  The amino acid sequence of the improved protein of the present invention may be a tandem amino acid sequence in which the amino acid sequence and an arbitrary linker sequence are alternately repeated a plurality of times. For example, [amino acid sequence (a)]-linker sequence A- [amino acid sequence (a)]-linker sequence B- [amino acid sequence (a)] or [amino acid sequence (a)]-linker sequence C -[Amino acid sequence (b)]-linker sequence D-[amino acid sequence (c)]. This tandem amino acid sequence is set so that wild-type protein A has a repeating structure of a plurality of antibody binding domains via a linker sequence (FIGS. 1 and 3), and the wild-type protein A is cleaved. As is clear from the fact that the antibody-binding activity is maintained even if each domain alone is isolated (Ref. 3), the wild-type protein A repeats the local concentration of the antibody-binding domain that functions alone. The setting is effective from the viewpoint of increasing the antibody-binding effect by increasing the effect.

In addition, the improved protein of the present invention may be a fusion protein comprising a fused amino acid sequence in which amino acid sequences of any other proteins are linked. For example, [amino acid sequence (a)]-linker sequence E-protein A or protein B-linker sequence F- [amino acid sequence (a)]-linker sequence G-protein C-linker sequence H- [amino acid sequence (c )]. The fusion type amino acid sequence is set such that wild type protein A has a multi-domain structure in which an antibody binding domain and other domains are linked (FIGS. 1 and 3), and wild type protein A is cleaved. Even if each domain alone is isolated, the antibody binding activity is maintained (Ref. 3), that is, it has multiple functions including antibody binding activity by linking the antibody binding domain and a protein having another function. The setting is valid because it makes it possible.
Examples of other amino acid sequences used for such fusion proteins include the amino acid sequences of [SEQ ID NO: 30] and oxaloacetate decarboxylase alpha-subunit c-terminal domain (OXADαc) shown in FIG. In this case, the OXADαc-protein A mutant fusion protein in this case is responsible for a plurality of functions of avidin binding activity derived from the OXADαc region and antibody binding activity derived from the protein A variant region in a single molecule. Is possible as shown.
In the improved protein of the present invention, an amino acid sequence of a spacer for immobilization reaction may be added to the C-terminal, N-terminal, or central part. For example, [amino acid sequence (a)]-spacer sequence A, or spacer sequence B- [amino acid sequence (b)], or [amino acid sequence (c)]-spacer sequence C- [amino acid sequence (d)] Also good. The spacer is used for the purpose of improving the efficiency and promotion of the immobilization reaction and reducing steric hindrance with the immobilization support. The spacer amino acid sequence and chain length may be appropriately selected depending on the type of immobilization reaction used, and for example, GlyArgAlaCysGly (Reference Document 10), GlyGlyGlyGlyCysAlaAspAspAspAspAspAsp (Reference Document 11), and the like can be used. However, in the improved protein of the present invention, the amino acid sequence and chain length of the spacer used are not particularly limited.

2. Production of improved protein (1) Production of improved protein by genetic engineering techniques a. Gene Encoding Improved Protein In the present invention, a genetic engineering method can be used to produce the designed improved protein.
The gene used in such a method encodes the amino acid sequence of the protein shown in the above (a) to (f), or more specifically, a) is shown in any one of the above SEQ ID NOs: 7 to 24 A protein encoding an amino acid sequence, or b) a protein having an amino acid sequence in which one or several amino acid residues are inserted or added in the amino acid sequence represented by any of SEQ ID NOs: 7 to 24, and an antibody or Encoding immunoglobulin G or a protein having an Fc region of immunoglobulin G and having a binding activity that is lower in the weakly acidic region than in the neutral region; or c) SEQ ID NO: 7- An amino acid sequence in which one or several amino acid residues other than histidine residues are deleted or substituted in the amino acid sequence shown in any of 24 A protein having a binding activity to an antibody, an immunoglobulin G, or a protein having an Fc region of immunoglobulin G and having a binding activity in a weakly acidic region lower than that in a neutral region For example, more specifically, a nucleic acid comprising any one of the base sequences represented by [SEQ ID NO: 26] to [SEQ ID NO: 28].

The gene used in the present invention is a nucleic acid that hybridizes under stringent conditions with a nucleic acid comprising a sequence complementary to the base sequence of the above nucleic acid, and an antibody, immunoglobulin G, or immunoglobulin G. The above mutant type having binding activity in a weakly acidic region with respect to the Fc region of immunoglobulin G as compared with the corresponding wild-type protein A / extracellular domain protein, and having binding activity to the protein having the Fc region of Examples also include nucleic acids that encode proteins that are proteins. Here, stringent conditions refer to conditions in which a specific hybrid is formed and a non-specific hybrid is not formed. For example, it refers to conditions under which nucleic acids having high homology (homology is 60% or more, preferably 80% or more, more preferably 90% or more, most preferably 95% or more) hybridize. More specifically, the sodium concentration is 150 to 900 mM, preferably 600 to 900 mM, and the temperature is 60 to 68 ° C, preferably 65 ° C. For example, when hybridization conditions are 65 ° C. and washing conditions are 0.1 × SSC containing 0.1% SDS at 65 ° C. for 10 minutes, hybridization is performed by a conventional method such as Southern blotting or dot blot hybridization. When it is confirmed that the hybridization occurs, it can be said that the cells hybridize under stringent conditions.
Furthermore, the gene used in the present invention may be one in which a plurality of the above nucleic acids and the nucleic acid encoding any of the above linker sequences are alternately linked, or a nucleic acid encoding the amino acid sequence of any protein and the nucleic acid. May be designed to encode a fused amino acid sequence.

b. Gene, recombinant vector and transformant The gene of the present invention described above can be synthesized by chemical synthesis, PCR, cassette mutagenesis, site-directed mutagenesis, and the like. For example, a plurality of oligonucleotides up to about 100 bases having a complementary region of about 20 base pairs at the end are chemically synthesized, and the target gene is totally synthesized by combining these and performing the overlap extension method (Reference Document 12). be able to.
The recombinant vector of the present invention can be obtained by linking (inserting) a gene containing the above-described base sequence to an appropriate vector. The vector used in the present invention is not particularly limited as long as it can be replicated in the host or can integrate the target gene into the host genome. For example, bacteriophage, plasmid, cosmid, phagemid and the like can be mentioned.

As plasmid DNA, plasmids derived from actinomycetes (eg pK4, pRK401, pRF31 etc.), plasmids derived from E. coli (eg pBR322, pBR325, pUC118, pUC119, pUC18 etc.), plasmids derived from Bacillus subtilis (eg pUB110, pTP5 etc.) Yeast-derived plasmids (eg, YEp13, YEp24, YCp50, etc.) and the like, and phage DNAs include λ phage (λgt10, λgt11, λZAP, etc.). Furthermore, animal viruses such as retrovirus or vaccinia virus, and insect virus vectors such as baculovirus can also be used.
In order to insert a gene into a vector, first, a method in which purified DNA is cleaved with a suitable restriction enzyme, inserted into a restriction enzyme site or a multicloning site of a suitable vector DNA, and linked to the vector is employed. . The gene needs to be integrated into the vector so that the improved protein of the invention is expressed. Therefore, the vector of the present invention includes a promoter, a base sequence of a gene, a cis element such as an enhancer, a splicing signal, a poly A addition signal, a selection marker, a ribosome binding sequence (SD sequence), an initiation codon, a termination codon, if desired. Etc. can be connected. A tag sequence for facilitating purification of the protein to be produced can also be linked. As the tag sequence, a base sequence encoding a known tag such as His tag, GST tag, MBP tag, BioEase tag can be used.
Whether or not a gene has been inserted into a vector can be confirmed using a known genetic engineering technique. For example, in the case of a plasmid vector or the like, it can be confirmed by subcloning the vector using a competent cell, extracting the DNA, and then specifying the base sequence using a DNA sequencer. For other vectors that can be subcloned using bacteria or other hosts, the same technique can be used. In addition, vector selection using a selection marker such as a drug resistance gene is also effective.

A transformant can be obtained by introducing the recombinant vector of the present invention into a host cell so that the improved protein of the present invention can be expressed. The host used for transformation is not particularly limited as long as it can express a protein or polypeptide. Examples include bacteria (E. coli, Bacillus subtilis, etc.), yeast, plant cells, animal cells (COS cells, CHO cells, etc.) and insect cells.
When a bacterium is used as a host, the recombinant vector is autonomously replicable in the bacterium, and at the same time, it is composed of a promoter, a ribosome binding sequence, a start codon, a nucleic acid encoding the improved protein of the present invention, and a transcription termination sequence. It is preferable. Examples of E. coli include Escherichia coli BL21, and examples of Bacillus subtilis include Bacillus subtilis. The method for introducing a recombinant vector into bacteria is not particularly limited as long as it is a method for introducing DNA into bacteria. Examples thereof include a heat shock method, a method using calcium ions, and an electroporation method.
When yeast is used as a host, for example, Saccharomyces cerevisiae, Schizosaccharomyces pombe and the like are used. The method for introducing a recombinant vector into yeast is not particularly limited as long as it is a method for introducing DNA into yeast, and examples thereof include an electroporation method, a spheroplast method, and a lithium acetate method.

When animal cells are used as hosts, monkey cells COS-7, Vero, Chinese hamster ovary cells (CHO cells), mouse L cells, rat GH3, human FL cells and the like are used. Examples of methods for introducing a recombinant vector into animal cells include an electroporation method, a calcium phosphate method, and a lipofection method.
When insect cells are used as hosts, Sf9 cells and the like are used. Examples of the method for introducing a recombinant vector into insect cells include the calcium phosphate method, lipofection method, electroporation method and the like.
Whether or not a gene has been introduced into the host can be confirmed by PCR, Southern hybridization, Northern hybridization, or the like. For example, DNA is prepared from the transformant, PCR is performed by designing a DNA-specific primer. Subsequently, the PCR amplification product is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, or the like, stained with ethidium bromide, SyberGreen solution, etc., and the amplification product is detected as a single band. You can confirm that it has been converted. Moreover, PCR can be performed using a primer previously labeled with a fluorescent dye or the like to detect an amplification product.

c. Obtaining Improved Protein by Transformant Culture When manufactured as a recombinant protein, the improved protein of the present invention can be obtained by culturing the aforementioned transformant and collecting it from the culture. The culture means any of culture supernatant, cultured cells, cultured cells, or disrupted cells or cells. The method for culturing the transformant of the present invention is carried out according to a usual method used for culturing a host.
A medium for culturing transformants obtained using microorganisms such as Escherichia coli and yeast as a host contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by the microorganisms, and efficiently cultures the transformants. As long as the medium can be used, either a natural medium or a synthetic medium may be used. Examples of the carbon source include carbohydrates such as glucose, fructose, sucrose, and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of the nitrogen source include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium salts of organic acids such as ammonium phosphate or other nitrogen-containing compounds, peptone, meat extract, corn steep liquor, and the like. Examples of the inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate. The culture is usually performed at 20 to 37 ° C. for 12 hours to 3 days under aerobic conditions such as shaking culture or aeration and agitation culture.
When the improved protein of the present invention is produced in cells or cells after culturing, the protein or cells are disrupted by sonication, repeated freeze-thawing, homogenizer treatment, etc. Collect. When the protein is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or the like. Thereafter, by using general biochemical methods used for protein isolation and purification, such as ammonium sulfate precipitation, gel chromatography, ion exchange chromatography, affinity chromatography, etc. alone or in appropriate combination, Thus, the improved protein of the present invention can be isolated and purified.

In addition, when using a so-called cell-free synthesis system in which only factors (enzymes, nucleic acids, ATP, amino acids, etc.) involved in protein biosynthesis reactions are mixed, the improved protein of the present invention can be obtained from a vector without using living cells. Can be synthesized in vitro (Ref. 13). Thereafter, the improved protein of the present invention can be isolated and purified from the mixed solution after the reaction, using the same purification method as described above.
In order to confirm whether the isolated and purified improved protein of the present invention is a protein having an intended amino acid sequence, a sample containing the protein is analyzed. As an analysis method, SDS-PAGE, Western blotting, mass spectrometry, amino acid analysis, amino acid sequencer and the like can be used (Reference Document 14).

(2) Production of improved protein by other methods The improved protein of the present invention can also be produced by an organic chemical method such as solid phase peptide synthesis. Protein production methods using such techniques are well known in the art and are briefly described below.
When a protein is chemically produced by a solid phase peptide synthesis method, the amino acid sequence of the improved protein of the present invention is preferably obtained by repeating the polycondensation reaction of the activated amino acid derivative using an automatic synthesizer. A protected polypeptide is synthesized on the resin. Next, the protective polypeptide is cleaved from the resin and the side chain protecting group is cleaved simultaneously. It is known that this cleavage reaction has an appropriate cocktail depending on the type of resin, protecting group, and amino acid composition (Reference Document 15). Thereafter, the crude protein is transferred from the organic solvent layer to the aqueous layer, and the target mutant protein is purified. As a purification method, reverse phase chromatography or the like can be used (Reference Document 16).

3. Immobilization of Improved Protein The improved protein of the present invention can be used as an antibody capture agent by utilizing its antibody binding property. The antibody capture agent can be used for purification and removal of antibodies, research using antibodies, diagnosis, treatment, testing, and the like.
The antibody capture agent of the present invention may be in any form as long as it contains the improved protein of the present invention. Preferably, the improved protein of the present invention is immobilized on a water-insoluble solid support. The form is appropriate. Examples of the water-insoluble carrier used include inorganic carriers such as glass beads and silica gel, synthetic polymers such as crosslinked polyvinyl alcohol, crosslinked polyacrylate, crosslinked polyacrylamide, and crosslinked polystyrene, crystalline cellulose, crosslinked cellulose, crosslinked agarose, and crosslinked dextran. Examples include organic carriers composed of polysaccharides, and organic-organic and organic-inorganic composite carriers obtained by a combination thereof. Among them, hydrophilic carriers have relatively little nonspecific adsorption, and antibodies or immunoglobulin G Alternatively, it is preferable because the protein having the Fc region of immunoglobulin G has good selectivity. The term “hydrophilic carrier” as used herein refers to a carrier having a contact angle with water of 60 ° or less when the compound constituting the carrier is formed into a flat plate shape. Such carriers include cellulose, chitosan, dextran and other polysaccharides, polyvinyl alcohol, saponified ethylene-vinyl acetate copolymer, polyacrylamide, polyacrylic acid, polymethacrylic acid, polymethyl methacrylate, polyacrylic acid grafting Representative examples include carriers made of polyethylene, polyacrylamide grafted polyethylene, glass and the like.
Commercially available products include porous cellulose gels GCL2000 and GC700, Sephacryl S-1000 covalently crosslinked with allyldextran and methylenebisacrylamide, acrylate-based carrier Toyopearl, agarose-based crosslinked carrier SepharoseCL4B, epoxy group For example, Eupergit C250L, which is polymethacrylamide activated by the above method, can be exemplified. However, the present invention is not limited to these carriers and activated carriers. Each of the above carriers may be used alone, or any two or more of them may be mixed. In addition, the water-insoluble carrier used in the present invention preferably has a large surface area in view of the purpose and method of use of the antibody capture agent, and has a large number of pores of an appropriate size, that is, is porous. preferable.

The form of the carrier can be any of beads, fibers, membranes (including hollow fibers), and any form can be selected. A bead shape is particularly preferably used because of easy preparation of a carrier having a specific exclusion limit molecular weight. A bead-shaped average particle size of 10 to 2500 μm is easy to use, and in particular, a range of 25 μm to 800 μm is preferable from the viewpoint of easy ligand immobilization reaction.
Furthermore, if a functional group that can be used for the ligand immobilization reaction is present on the surface of the carrier, it is convenient for immobilization of the ligand. Representative examples of these functional groups include hydroxyl groups, amino groups, aldehyde groups, carboxyl groups, thiol groups, silanol groups, amide groups, epoxy groups, succinimide groups, acid anhydride groups, and the like.
In immobilization of the improved protein to the carrier, the immobilization protein is immobilized via a hydrophilic spacer in order to improve the capture efficiency by reducing the steric hindrance of the improved protein and to suppress non-specific binding. It is more preferable. As the hydrophilic spacer, for example, a polyalkylene oxide derivative in which both ends are substituted with a carboxyl group, an amino group, an aldehyde group, an epoxy group or the like is preferably used.
The method of immobilizing the improved protein introduced into the carrier and the organic compound used as the spacer is not particularly limited, but generally illustrates a method employed when immobilizing a protein or peptide on the carrier. . The carrier is reacted with cyanogen bromide, epichlorohydrin, diglycidyl ether, tosyl chloride, tresyl chloride, hydrazine, etc. to activate the carrier (compounds that are immobilized as ligands from the functional groups that the carrier originally has reacted) A functional group that can be easily immobilized), reacting with a compound to be immobilized as a ligand, a method of immobilizing, or a system in which a compound to be immobilized as a carrier and a ligand exists, such as a condensation reagent such as carbodiimide, or glutaraldehyde In addition, there is an immobilization method by adding a reagent having a plurality of functional groups in the molecule to condense and crosslink, but the immobilization method does not easily desorb proteins from the carrier when the capture agent is sterilized or used. It is more preferable to apply.

4). Performance Confirmation Test of Improved Protein and Antibody Capture Agent The improved protein and antibody capture agent produced as described above can be selected by performing the following performance confirmation test. As shown, both the improved protein and the antibody capture material of the present invention had good performance.
(1) Antibody binding test The antibody binding of the improved protein of the present invention is confirmed using Western blotting, immunoprecipitation, pull-down assay, ELISA (Enzyme-Linked ImmunoSorbent Assay), surface plasmon resonance (SPR) method, etc. -Can be evaluated. In particular, since the SPR method can observe the interaction between living organisms over time in real time without labeling, the improved protein binding reaction can be quantitatively evaluated from a kinetic viewpoint.
Further, the antibody binding property of the improved protein immobilized on a water-insoluble solid phase support can be confirmed and evaluated by the above SPR method or liquid chromatography method. Among them, the liquid chromatography method can accurately evaluate the pH dependence on the antibody binding property.

(2) Thermal stability test of improved protein The thermal stability of the improved protein of the present invention is determined by circular dichroism (CD) spectrum, fluorescence spectrum, infrared spectroscopy, differential scanning calorimetry, after heating. The residual activity can be used for evaluation. In particular, the CD spectrum is a spectroscopic analysis method that sharply reflects changes in the secondary structure of proteins, so the change in conformation with temperature of the improved protein is observed, and the structural stability is quantified thermodynamically. Can be evaluated.
[References]
Reference 1; Forsgren A and Sjoquist J (1966) "Protein A" from S. Aureus. J Immunol. 97, 822-827.
Reference 2; Boyle MDP, Ed. (1990) Bacterial Immunoglobulin Binding Proteins. Academic Press, Inc., San Diego, CA, USA.
Reference 3; Tashiro M, Montelione GT. (1995) Structures of bacterial immunoglobulin-binding domains and their complexes with immunoglobulins. Curr Opin Struct Biol. 5, 471-481.
Reference 4; Deisenhofer J. (1981) Crystallographic refinement and atomic models of a human Fc fragment and its complex with fragment B of protein A from Staphylococcus aureus at 2.9- and 2.8-A resolution. Biochemistry. 20 (9), 2361- 2370.
Reference 5; Gouda H, Torigoe H, Saito A, Sato M, Arata Y, Shimada I. (1992) Three-dimensional solution structure of the B domain of staphylococcal protein A: comparisons of the solution and crystal structures. Biochemistry. 31 (40), 9665-9672.
Reference 6; Tashiro M .; Tejero R .; Zimmerman DE; Celda B .; Nilsson B .; Montelione GT (1997) High-resolution solution NMR structure of the Z domain of staphylococcal protein A. Journal of Molecular Biology, 272 ( 4), 573-590.
Reference 7; Starovasnik, MA, Skelton, NJ, O'Connell, MP, Kelley, RF, Reilly, D., Fairbrother, WJ (1996) Solution structure of the E-domain of staphylococcal protein A. Biochemistry 35, 15558- 15569.
Reference 8; Graille, M., Stura, EA, Corper, AL, Sutton, BJ, Taussig, MJ, Charbonnier, JB, Silverman, GJ (2000) Crystal structure of a Staphylococcus aureus protein A domain complexed with the Fab fragment of a human IgM antibody: structural basis for recognition of B-cell receptors and superantigen activity.Proc.Natl.Acad.Sci.USA, 97, 5399-5404.
Reference 9; D'souza VM, Holz RC. (1999) The methionyl aminopeptidase from Escherichia coli can function as an iron (II) enzyme. Biochemistry 38, 11079-11085.
Reference 10; JP 63-267281 Reference 11; JP 2005-112827 Reference 12; Horton RM, Hunt HD, Ho SN, Pullen JM and Pease LR (1989). Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61-68.
Reference 13; Masato Okada, Kaoru Miyazaki (2004) Protein Experiment Notes (above), Yodosha Reference 14; Supervision by Shigeo Ohno, Yoshifumi Nishimura (1997) Protein Experiment Protocol 1-Functional Analysis, Shujunsha Reference 15 Supervised by Shigeo Ohno and Yoshifumi Nishimura (1997) Protein Experiment Protocol 2-Structural Analysis, Shujunsha

Hereinafter, the present invention will be specifically described with reference to examples. However, the technical scope of the present invention is not limited to these examples.
In the present specification, various amino acid residues are described by the following abbreviations. Ala; L-alanine residue, Arg; L-arginine residue, Asp; L-aspartic acid residue, Asn; L-asparagine residue, Cys; L-cysteine residue, Gln; L-glutamine residue, Glu L-glutamic acid residue, Gly; L-glycine residue, His; L-histidine residue, Ile; L-isoleucine residue, Leu; L-leucine residue, Lys; L-lysine residue, Met; L -Methionine residue, Phe; L-phenylalanine residue, Pro; L-proline residue, Ser; L-serine residue, Thr; L-threonine residue, Trp; L-tryptophan residue, Tyr; L-tyrosine Residue, Val; L-valine residue. In the present specification, the amino acid sequence of a peptide is described according to a conventional method such that the amino terminus (hereinafter referred to as N-terminus) is located on the left side and the carboxyl terminus (hereinafter referred to as C-terminus) is located on the right side.

Example 1
1) Selection of mutation site of protein A extracellular domain and amino acid residue to be substituted First, the three-dimensional structure coordinate data of the complex of protein A B domain and human immunoglobulin G Fc region is used as an international protein three-dimensional structure database. It was downloaded from Protein Data Bank (PDB; http://www.rcsb.org/pdb/home/home.do) (PDB code: 1FC2). Next, the amino acid residues of the protein A / B domain existing within a distance of 6.5 angstroms from the Fc region and having an exposed surface area ratio of 35% or more in the case of the protein A / B domain alone. The group was calculated using the three-dimensional structure coordinate data and selected as a site to be mutated. The amino acid residues at the selected site are Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, His18, Glu24, Arg27, Asn28 among the wild-type amino acid sequences of the protein A / B domain represented by [SEQ ID NO: 4]. , Gln32, and Lys35. FIG. 5 shows the positions of these mutation target sites on the structure of the complex.
By the way, each extracellular domain of protein A has a high sequence homology (FIG. 2), and in addition, the D, E, and Z domains whose steric structure has been experimentally revealed are almost the same as the structure of the B domain alone. Because there is no difference (Non-patent literature: Gouda et al., (1992) Biochemistry. 31 (40), 9665-9672; Tashiro et al., (1997) Journal of Molecular Biology, 272 (4), 573-590 Starovasnik et al., (1996) Biochemistry 35, 15558-15569; Graille et al., (2000) Proc. Natl. Acad. Sci. USA, 97, 5399-5404.), B domain-Fc complex Structural knowledge can also be applied to E, D, A, C, and Z domain-Fc complexes. That is, the three-dimensional structure of the E domain-Fc complex, D domain-Fc complex, A domain-Fc complex, C domain-Fc complex, and Z domain-Fc complex has not yet been clarified. E, D, A, C, and Z domain-Fc complex is expressed as B domain, based on the sequence homology of extracellular domain and the similarity of three-dimensional structure of B, D, E, and Z domains alone. It can of course be analogized to form a homologous structure with the -Fc complex. Therefore, it is highly expected that the 12 selected sites to be mutated are located in the same spatial arrangement in the E, D, A, C, and Z domain-Fc complexes as in the B domain-Fc complex. 6th, 10th, 11th, 14th, 15th, 17th, 18th, 24th, 27th, 28th, 28th, 32nd, and 35th derived from the three-dimensional structure of the B domain-Fc complex These 12 sites to be mutated can be selected as sites to be mutated not only in the B domain but also in the E, D, A, C, and Z domains.

  That is, the amino acid residue at the selected site is Asp6, Gln10, Asn11, Tyr14, Gln15, Leu17, Asn18, Ala24, Arg27 among the wild-type amino acid sequences of the protein A / E domains shown in [SEQ ID NO: 1]. , Asn28, Gln32, Lys35. In addition, 12 of Asn6, Gln10, Ser11, Tyr14, Glu15, Leu17, Asn18, Glu24, Arg27, Asn28, Gln32, Lys35 among the wild-type amino acid sequences of the protein A / D domain represented by [SEQ ID NO: 2] It is. In addition, 12 of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, Asn18, Glu24, Arg27, Asn28, Gln32, Lys35 among the wild-type amino acid sequences of the protein A / A domain represented by [SEQ ID NO: 3] It is. Of the wild-type amino acid sequences of the protein A / C domain represented by [SEQ ID NO: 5], 12 of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, His18, Glu24, Arg27, Asn28, Gln32, and Lys35 It is. In addition, 12 of Asn6, Gln10, Asn11, Tyr14, Glu15, Leu17, His18, Glu24, Arg27, Asn28, Gln32, and Lys35 among the wild-type amino acid sequences of the protein A / Z domain represented by [SEQ ID NO: 6] It is.

On the other hand, histidine is the best amino acid residue that replaces the original amino acid residue of the site to be mutated. This is because the chemical state of histidine changes greatly due to the dissociation of protons in the side chain between the neutral region and the weakly acidic region, so that the antibody binding property of each domain of protein A varies between the neutral region and the weakly acidic region. This is because it can be changed greatly.
Therefore, the mutation site of each improved protein A extracellular domain and the amino acid residue to be substituted were selected as follows.
Protein A / E domain mutant: one or more of Asp6His, Gln10His, Asn11His, Tyr14His, Gln15His, Leu17His, Asn18His, Ala24His, Arg27His, Asn28His, Gln32His, Lys35His.
Protein A / D domain mutant: one or more of Asn6His, Gln10His, Ser11His, Tyr14His, Glu15His, Leu17His, Asn18His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His.
Protein A / A domain mutant: one or more of Asn6His, Gln10His, Asn11His, Tyr14His, Glu15His, Leu17His, Asn18His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His.
Protein A / B domain mutant: one or more of Asn6His, Gln10His, Asn11His, Tyr14His, Glu15His, Leu17His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His.
Protein A / C domain mutant: one or more of Asn6His, Gln10His, Asn11His, Tyr14His, Glu15His, Leu17His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His.
Protein A / Z domain mutant: One or more of Asn6His, Gln10His, Asn11His, Tyr14His, Glu15His, Leu17His, Glu24His, Arg27His, Asn28His, Gln32His, Lys35His.

  In addition, the calculation of this example is performed by ccp4i 4.0 (Daresbury Laboratory, UK Science and Technology Facilities Council), Surface Racer 3.0 for Linux (Dr. Oleg Tsodikov, The University of Michigan), Red Hat Enterprise Linux WS release 3 (Red Hat) ) (Above software), Dell Precision Workstation 370 (Dell) (above hardware).

2) Improved protein A extracellular domain design.
As is apparent from the above, the site to be selected is not limited to one in the design of the improved protein of the present invention. A point mutant or a multiple mutant obtained by appropriately selecting from a plurality of mutation target sites and combining them can be used as an improved protein. The selection may be performed randomly or may take into account other known information such as structure-activity relationships. Further, it may be combined with a mutation already known to change the property of the extracellular domain of protein A to a favorable one.
That is, the 10th, 11th, 15th, and 17th positions are selected from the mutation sites selected in 1) above, and a double mutation combining two of these 4 mutation sites is selected as the wild type protein A. By carrying out with respect to the amino acid sequence, the amino acid sequence of each improved protein A extracellular domain was designed as follows.

Protein A / E domain variants;
Performed on the amino acid sequence of the protein A / E domain represented by [SEQ ID NO: 1], and the Gln10His / Asn11His protein A / E domain double substitution mutant represented by [SEQ ID NO: 7], [SEQ ID NO: 8] A double substitution mutant of Asn11His / Leu17His protein A / E domain shown, and a double substitution mutant of Gln15His / Leu17His protein A / E domain shown in [SEQ ID NO: 9] were designed.
Protein A / D domain variants;
The Gln10His / Ser11His protein A / D domain double substitution mutant represented by [SEQ ID NO: 10] is performed on the amino acid sequence of the protein A / D domain represented by [SEQ ID NO: 2]. A double substitution mutant of the Ser11His / Leu17His protein A / D domain shown, and a double substitution mutant of the Glu15His / Leu17His protein A / D domain shown in [SEQ ID NO: 12] were designed.
Protein A / A domain variants;
The Gln10His / Asn11His protein A / A domain double substitution mutant represented by [SEQ ID NO: 13] is performed on the amino acid sequence of the protein A / A domain represented by [SEQ ID NO: 3]. A double substitution mutant of Asn11His / Leu17His protein A · A domain shown, and a double substitution mutant of Glu15His / Leu17His protein A · A domain shown in [SEQ ID NO: 15] were designed.
Protein A and B domain mutants;
The Gln10His / Asn11His protein A / B domain double substitution mutant represented by [SEQ ID NO: 16] is performed on the amino acid sequence of the protein A / B domain represented by [SEQ ID NO: 4]. The double substitution mutant of Asn11His / Leu17His protein A / B domain shown, and the double substitution mutant of Glu15His / Leu17His protein A / B domain shown in [SEQ ID NO: 18] were designed.
Protein A and C domain mutants;
The Gln10His / Asn11His protein A / C domain double substitution mutant represented by [SEQ ID NO: 19] is performed on the amino acid sequence of the protein A / C domain represented by [SEQ ID NO: 5]. A double substitution mutant of Asn11His / Leu17His protein A / C domain shown, and a double substitution mutant of Glu15His / Leu17His protein A / C domain shown in [SEQ ID NO: 21] were designed.
Protein A / Z domain mutant;
The Gln10His / Asn11His protein A / Z domain double substitution mutant represented by [SEQ ID NO: 22] is performed on the amino acid sequence of the protein A / Z domain represented by [SEQ ID NO: 6], and [SEQ ID NO: 23] A double substitution mutant of Asn11His / Leu17His protein A · Z domain shown, and a double substitution mutant of Glu15His / Leu17His protein A · Z domain shown in [SEQ ID NO: 24] were designed.

  In the following 3) to 12), among the specific examples of the improved protein A designed as described above, the amino acid sequences represented by [SEQ ID NO: 22] to [SEQ ID NO: 24] were finally selected, and these An improved protein A extracellular domain showing the sequence was actually synthesized. In addition, the original protein A / Z domain represented by [SEQ ID NO: 6] was also actually synthesized and compared with this to evaluate the molecular properties of the improved protein A.

3) Design of base sequence of nucleic acid encoding amino acid sequence of improved protein A extracellular domain.
Based on the amino acid sequence of each of the improved protein A extracellular domains designed as described above, the base sequence of the gene encoding the improved protein A extracellular domain can be obtained from E. coli using Gene Designer (DNA2.0 Inc.). The PAZ genes (paz01, paz02, paz03, paz04) consisting of the nucleotide sequences of [SEQ ID NO: 25] to [SEQ ID NO: 28] were designed so that the expression efficiency of is optimal. Since the improved protein is produced by dividing into the following two systems from the practical viewpoint of protein synthesis, the base sequence of the gene was finely adjusted for each system in consideration of the base sequence of the vector. The OXADac-PAZ protein is produced as a fusion protein having an Oxaloacetate decarboxylase alpha-subunit c-terminal domain (OXADac) on the N-terminal side and an improved protein A extracellular domain sequence on the C-terminal side. That is, an amino acid sequence in which [SEQ ID NO: 30] is linked to the N-terminal side of [SEQ ID NO: 6], [SEQ ID NO: 21], [SEQ ID NO: 22] or [SEQ ID NO: 24] is synthesized. M-PAZ protein is produced using E. coli as a simple protein with no tag and no fusion. Therefore, a start codon sequence is added to the designed amino acid sequence. That is, M-PAZ protein is synthesized as an amino acid sequence in which Met is added to the N-terminus of [SEQ ID NO: 6], [SEQ ID NO: 21], [SEQ ID NO: 22], or [SEQ ID NO: 24].

4) Production and immobilization of an improved protein A extracellular domain-containing fusion protein As shown in (1) and (2) below, using Escherichia coli, Oxaloacetate decarboxylase alpha-subunit c-terminal domain (OXADac) and wild Type protein A / Z domain fusion protein (OXADac-PAZ01) and the same type of protein A / Z domain fusion protein (OXADac-PAZ02, OXADac-PAZ03, OXADac-PAZ04) were produced.

(1) Synthesis of OXADac-PAZ expression plasmid
An entry plasmid pDONR221-PAZ (DNA2.0) incorporating a PAZ gene (paz01, paz02, paz03, paz04) consisting of the base sequence of [SEQ ID NO: 25] to [SEQ ID NO: 28], and OXADac of [SEQ ID NO: 30] The expression plasmid Champion pET104.1-DEST (Invitrogen) incorporating a base sequence encoding an amino acid sequence was subjected to homologous recombination using Gateway LR Clonase Enzyme Mix (Invitrogen). The reaction solution was used to transform E. coli DH5a strain for storage (Toyobo, Competent high). The obtained transformants were selected by colony PCR method and DNA sequencing method (GE Healthcare Bioscience, BigDye Terminator v1.1), and an OXADac-PAZ expression plasmid was extracted using QIAprep Spin Miniprep Kit (Qiagen).

(2) Expression and immobilization of OXADac-PAZ fusion protein
The OXADac-PAZ expression plasmid was used to transform E. coli BL21 (DE3) strain (Novagen) for expression. The pre-cultured transformant was subcultured to LB medium at 2.5 ml / 500 ml and cultured with shaking until OD ₆₀₀ = 0.8 to 1.0. In order to express the OXADac-PAZ fusion protein, IPTG (final concentration 0.5 mM) was added, and further cultured with shaking at 37 ° C. for 2 hours. The collected bacterial cells were suspended in 10 ml of PBS, subjected to ultrasonic disruption, and then sterilized by filtration to obtain a total protein solution. A part of the total protein solution was purified using IgG Sepharose 6 Fast Flow (GE Healthcare Bioscience) microspin, and expression and purification were confirmed by SDS-PAGE. The rest is injected into a liquid chromatography device AKTApurifier (GE Healthcare Bioscience) equipped with a HiTrap streptavidin HP column (GE Healthcare Bioscience) and conditions of 0.3 ml / min (running buffer: 20 mM Na phosphate (pH 6.7), 150 mM NaCl) The OXADac-PAZ fusion protein was immobilized on the column. Since OXADac has one biotinylated lysine in the molecule, it binds selectively and irreversibly to streptavidin in the column. In order to maximize the amount of immobilization, a large excess (10 times or more) of OXADac-PAZ fusion protein was injected relative to the binding capacity of the HiTrap streptavidin HP column.

5) Production of improved protein A extracellular domain As shown in (1) and (2) below, plasmid vectors containing genes encoding wild type and improved protein A / Z domains were synthesized, and then E. coli was isolated. The wild-type (M-PAZ01) and modified protein A • Z domains (M-PAZ02, M-PAZ03, M-PAZ04) to which Met was added were produced.

(1) Synthesis of M-PAZ expression plasmid Using the OXADac-PAZ expression plasmid prepared in 4) above as a template and adding a primer containing a restriction enzyme recognition sequence (annealing 49 ° C, 15 seconds), the PAZ gene The region was amplified. As the primers used, CACCATGGTGGATAACAAAC (SEQ ID NO: 31) was used as a sense primer, and TA GGATCCTTATTTTGGTGCTTGTGCATC (SEQ ID NO: 32) was used as an antisense primer. The obtained amplified product was confirmed by agarose electrophoresis (3%, 100V) and then purified using a QIAquick PCR Purification kit (Qiagen). After that, the PAZ gene (paz01, paz02, paz03, or paz04) digested with the restriction enzymes Nco I and BamH I (Nippon Gene, 37 ° C, overnight) and the same restriction enzyme are digested and dephosphorylated (Takara Shuzo, CIAP, 50 Ligation (Toyobo, Ligation High, 16 ° C, 1 hour) with the resulting plasmid pET16b (Novagen) for 30 minutes at ℃, and transformation of E. coli strain DH5α for storage (Toyobo, Competent high) using the resulting plasmid vector And selected on LB plate medium containing 100 μg / mL ampicillin. Transformants with the correct insertion sequence were selected by colony PCR and DNA sequencing (GE Healthcare Bioscience, BigDye Terminator v1.1), and the M-PAZ expression plasmid was extracted using Qiaprep Spin Miniprep kit (Qiagen). . Using this, Escherichia coli BL21 (DE3) strain (Novagen) for expression was further transformed.

(2) Expression and purification of recombinant protein
The Escherichia coli BL21 (DE3) transformant precultured in LB medium was subcultured in LB medium containing 100 μg / mL ampicillin at 50 μl / 10 ml, and cultured with shaking until OD ₆₀₀ = 0.8 to 1.0. IPTG was added at a final concentration of 0.5 mM, and further cultured with shaking at 37 ° C. for 2 hours. The collected cells were suspended in 10 ml of PBS and subjected to ultrasonic crushing. The crushed liquid is sterilized by filtration, and the filtrate is added to IgG Sepharose 6 Fast Flow (GE Healthcare Bioscience) microspin equilibrated with TST (50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 0.05% Tween20), and M-PAZ protein is added. Were combined. After washing unadsorbed components with TST, TST was replaced with 50 mM Na ₃ citrate (pH 7.0), and further with 0.5 M acetate (pH 2.5) to elute M-PAZ protein. The eluate was dialyzed with 50 mM Na phosphate (pH 6.8) and stored at 4 ° C.

  Table 1 shows the constitution and mutation of the amino acid sequences of each OXADac-PAZ fusion protein and each M-PAZ protein obtained in 4) and 5) above.

6) Purity of the obtained improved protein A extracellular domain The purity of each OXADac-PAZ fusion protein and each M-PAZ protein obtained in 4) and 5) above was determined by polyacrylamide gel electrophoresis as follows. As confirmed.
Prepare the above fusion protein and methionine-added protein after purification in an aqueous solution with a concentration of about 75 μM, respectively, and perform Tricine-SDS-PAGE (16% T, 2.6% C, 100 V, 100 min) to perform CBB (G-250) staining. The band was detected by and the purity was confirmed. As a result, the purified fusion protein and methionine-added protein were all measured (OXADac-PAZ01, OXADac-PAZ02, OXADac-PAZ03, OXADac-PAZ04, M-PAZ01, M-PAZ02, M-PAZ03, M-PA PAZ04) was detected as a major band, and it was confirmed that the synthetic yield of the improved protein A extracellular domain or its fusion protein was high (> 10 mg / L-medium) and the degree of purification was sufficient.

7) Identification of the obtained improved protein A extracellular domain The produced protein was identified by measuring the molecular weight of the improved protein A extracellular domain with a MALDI-TOF mass spectrometer as follows.
Each isolated and purified M-PAZ protein was prepared in an aqueous solution having a concentration of 15 to 25 μM. Next, 1 μl of a matrix solution (a solution in which α-cyano-4-hydroxycinnamic acid is saturated in 50% (v / v) acetonitrile-0.1% TFA aqueous solution) is dropped onto a sample plate for mass spectrometry, and each sample solution is added thereto. 1 μl was added dropwise and mixed on the sample plate and dried. Thereafter, a mass spectrum was obtained by irradiating a laser with an intensity of 2500-3000 with a mass spectrometer Voyager (Applied Biosystems). As a result of comparing the molecular weight of the peak detected by the mass spectrum with the theoretical molecular weight calculated from the amino acid sequence of each of the produced M-PAZ proteins, they agree within the measurement error, and the target protein (M-PAZ01, M- It was confirmed that PAZ02, M-PAZ03, and M-PAZ04) were manufactured.

Example 2
As shown below, pH gradient affinity chromatography is performed using a column on which each OXADac-PAZ fusion protein is immobilized, and the pH at which the monoclonal antibody is eluted is examined. The dissociation property was evaluated.
First, the OXADac-PAZ fusion protein immobilization column was set in the liquid chromatography device AKTApurifier (GE Healthcare Bioscience), and TST buffer (50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 0.05% Tween20) was added at 1 ml / min. After allowing to flow and equilibrate under conditions, an IgG1 type humanized monoclonal antibody prepared to 100 μg / 200 μl was injected. Next, the TST buffer was replaced with 50 mM Na ₃ citrate (pH 7.0), and further replaced with 0.5 M acetate (pH 2.5) over 10 min at a flow rate of 0.5 ml / min, so that a pH gradient (pH 7) was obtained. .0 → 2.5 / 10min). From the output of a UV meter (280 nm) attached to the liquid chromatography apparatus and the pH meter, the pH of the peak from which the monoclonal antibody was eluted was recorded.
As a result, a control protein (OXADac-) having a wild-type amino acid sequence was immobilized on a column on which all of the measured fusion proteins (OXADac-PAZ02, OXADac-PAZ03, OXADac-PAZ04) having improved protein A / Z domains were immobilized. It was revealed that the humanized monoclonal antibody elutes at a higher pH than the column on which PAZ01) was immobilized (FIG. 6). For example, the best fusion protein with the improved protein A / Z domain
(OXADac-PAZ02, OXADac-PAZ04) elutes at a pH 1.4 points higher than that of the wild type.
The results are shown in Table 2 below together with the results of Examples 9 and 10 below.

Example 3
As shown below, step-wise pH affinity chromatography was performed using a column on which each OXADac-PAZ fusion protein was immobilized, and the elution state of the monoclonal antibody was examined at each pH. The antibody dissociation property in the region was evaluated.
First, the OXADac-PAZ fusion protein immobilization column is set in the liquid chromatography device AKTA prime plus (GE Healthcare Bioscience), and 0.4 ml of phosphate buffer (50 μm Na ₂ HPO ₄ / NaH ₂ PO ₄ (pH 7.0)) is added. After flowing and equilibrating under the condition of / min, 100 μL of 1 mg / ml sample (IgG1 type humanized monoclonal antibody) was added. Washing was performed with 12 ml of phosphate buffer, and elution was performed with 10 ml of elution buffer (100 mM CH ₃ COOH / CH ₃ COONa, pH 4 to 4.7). The column was then washed with 500 mM CH ₃ COOH, pH 2.5, and finally the column was re-equilibrated with 12 ml phosphate buffer. From the output of the UV meter (280 nm) attached to the liquid chromatography apparatus, a stepwise pH elution pattern of the human polyclonal Fc region was obtained.
As a result, in a column on which a fusion protein (OXADac-PAZ02, OXADac-PAZ04) having an improved protein A / Z domain is immobilized, a control protein (OXADac-PAZ01) having a wild-type amino acid sequence is immobilized on the column. In comparison with this, it was revealed that the humanized monoclonal antibody elutes at a higher pH (FIG. 7). For example, it was confirmed that the elution rate of PAZ01 in the pH 4.5 region was 0%, whereas the elution rate of PAZ02 was greatly improved to 71% (Table 2).

Example 4
The binding dissociation property of each OXADac-PAZ fusion protein was evaluated by the surface plasmon resonance (SPR) method as follows.
Note that the SPR method is recognized as an excellent method that can measure specific interactions between biopolymers over time and quantitatively interpret the reaction from a kinetic viewpoint.
First, the OXADac-PAZ fusion protein was immobilized on the measurement cell of the sensor chip SA (Biacore) via biotin. Next, human immunoglobulin IgG was dissolved in HBS-P (10 mM HEPES pH 7.4, 150 mM NaCl, 0.05% v / v Surfactant P20) as a running buffer to prepare a 1 μM sample solution. SPR was measured using Biacore T100 (Biacore) at a reaction temperature of 25 ° C. After addition of the sample solution, the dissociation behavior of IgG with a dissociation solution (10 mM sodium acetate, 50-500 mM NaCl, pH 4.5) was measured. BIAevaluation version 4.1 was used for analysis of observation results. The residual ratio of IgG was calculated by dividing the RU change before and after dissociation by the bound RU value of IgG, and the dissociation rate constant k _off was determined by fitting the dissociation curve to a 1: 1 Langmuir model. .
Under the dissociation conditions used in the experiment, the improved protein (OXADac-PAZ04) showed a significant dissociation behavior compared to OXADac-PAZ01 having the wild-type amino acid sequence (Table 2). For example, OXADac-PAZ04 dissociates 100% of adsorbed IgG under the conditions of 10 mM sodium acetate and 150 mM NaCl (pH 4.5), and the dissociation rate constant is more than 50 times that of the wild type. Showed an increase.

Example 5
The antibody binding property of each M-PAZ protein in the neutral region was evaluated by the surface plasmon resonance (SPR) method as follows.
First, the Fc region of human immunoglobulin was immobilized on the measurement cell of the sensor chip by the amine coupling method. As a measurement control, a control cell in which the carboxymethyl group was blocked with ethanolamine was used. CM5 (Biacore) was used as a sensor chip. Next, each isolated and purified M-PAZ protein was dissolved in HBS-P (10 mM HEPES pH 7.4, 150 mM NaCl, 0.05% v / v Surfactant P20), which is a neutral region running buffer, and 500, Sample solutions with five concentrations of 400, 300, 200 and 100 nM were prepared. SPR was measured using Biacore T100 (Biacore) at a reaction temperature of 25 ° C. The collected data were analyzed using Biacore T100 Evaluation Software, 1: is fitted to one of the Langmuir model was calculated dissociation equilibrium constant K _D.
As a result, it was clarified that the improved protein M-PAZ02 exhibits 10 times more affinity in the neutral region than the control protein M-PAZ01 having the wild-type amino acid sequence.
The results are shown in Table 3 together with the results of Example 12 below.

Example 6
The thermal stability of each M-PAZ protein was evaluated by circular dichroism (CD) spectrum as follows.
It is known that the circular dichroism (CD) spectrum is a spectroscopic analysis method that sharply reflects changes in the secondary structure of proteins. By observing the molar ellipticity corresponding to the intensity of the CD spectrum while changing the temperature of the sample, it is possible to clarify at what temperature each improved protein A is denatured.
First, an aqueous solution (50 mM sodium phosphate buffer, pH 6.8 to 7.0) containing each isolated and purified M-PAZ protein at a concentration of 5 to 20 μM was prepared. This sample solution was poured into a cylindrical cell (cell length: 0.1 cm), and the CD805 was moved from 260 nm to 195 nm at a temperature of 20 ° C. using a J805 circular dichroism spectrophotometer (JASCO). A spectrum was obtained. The same sample was heated to 98 ° C. and further cooled to 98 ° C. to 20 ° C. to obtain a circular dichroism spectrum from 260 nm to 195 nm. The molar ellipticity of the spectrum re-cooled after heating recovered 60% or more, and it was confirmed that the three-dimensional structure of the improved protein A was reversible to some extent against heat denaturation.
Next, the measurement wavelength was fixed at 222 nm, the temperature was increased from 20 ° C. to 100 ° C. at a rate of 1 ° C./min, and the change in molar ellipticity with time was measured. Analyzing the obtained thermal melting curve using the theoretical formula of the two-state phase transition model (Non-patent literature: Arisaka, Introduction to protein science for bioscience), denaturation temperature T _m , and enthalpy change of denaturation at T _m ΔH _m was determined. As a result, it was clarified that the thermal stability of M-PAZ02 in the improved protein A measured was improved compared to the control protein (M-PAZ01) having a wild-type amino acid sequence ( Table 3).

It is a figure which shows the structure of the protein A protein derived from Staphylococcus aureus subsp. Aureus NCTC 8325. It is a figure which shows the amino acid sequence of the antibody binding domain of protein A (the underline part is a different part from B domain). It is a figure which shows the base sequence of the gene of the protein A derived from Staphylococcus aureus subsp. Aureus NCTC 8325 (the underline part corresponds to an antibody binding domain). It is a figure which shows the N terminal sequence (sequence number 30) of oxaloacetate decarboxylase alpha-subunit c-terminal domain (OXADac) -protein G variant fusion protein (underlined part is an amino acid sequence corresponding to OXADac). It is a figure which shows the three-dimensional structure of the composite_body | complex of protein A * B domain and Fc region of human immunoglobulin G. It is a graph which shows the result of antibody dissociation evaluation (1) in the weakly acidic region of the improved type protein using an immobilization column. It is a graph which shows the result of antibody dissociation evaluation (2) in the weakly acidic region of the improved protein using the immobilization column.

Claims (16)

A variant protein of the E domain protein of protein A consisting of the amino acid sequence shown in SEQ ID NO: 1, comprising any one of the following amino acid sequences (a) to (c), and the Fc region of immunoglobulin G The mutant protein having a binding activity in a weakly acidic region with respect to the Fc region of immunoglobulin G compared to the wild-type E domain of protein A.
(A) An amino acid sequence obtained by substituting an amino acid residue consisting of any combination of Gln10 and Asn11, Asn11 and Leu17, and Gln15 and Leu17 with a histidine residue in the amino acid sequence represented by SEQ ID NO: 1.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b). A variant protein of the D domain protein of protein A consisting of the amino acid sequence represented by SEQ ID NO: 2, comprising the amino acid sequence of any of the following (a) to (c), and the Fc region of immunoglobulin G The mutant protein having a binding activity in a weakly acidic region with respect to the Fc region of immunoglobulin G compared to the wild-type D domain of protein A.
(A) An amino acid sequence obtained by substituting an amino acid residue consisting of any combination of Gln10 and Ser11, Ser11 and Leu17, and Glu15 and Leu17 with a histidine residue in the amino acid sequence represented by SEQ ID NO: 2.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b). A variant protein of the A domain protein of protein A consisting of the amino acid sequence shown in SEQ ID NO: 3, comprising the amino acid sequence of any of the following (a) to (c), and the Fc region of immunoglobulin G The mutant protein having a binding activity in a weakly acidic region with respect to the Fc region of immunoglobulin G as compared to the wild-type A domain of protein A.
(A) An amino acid sequence obtained by substituting an amino acid residue consisting of any combination of Gln10 and Asn11, Asn11 and Leu17, and Glu15 and Leu17 with a histidine residue in the amino acid sequence represented by SEQ ID NO: 3.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b). A variant protein of the B domain protein of protein A consisting of the amino acid sequence shown in SEQ ID NO: 4, comprising the amino acid sequence of any of the following (a) to (c), and the Fc region of immunoglobulin G The mutant protein having a binding activity in the weakly acidic region with respect to the Fc region of immunoglobulin G as compared with the wild-type B domain of protein A (a) the amino acid sequence represented by SEQ ID NO: 4 An amino acid sequence obtained by substituting an amino acid residue consisting of any combination of Gln10 and Asn11, Asn11 and Leu17, and Glu15 and Leu17 with a histidine residue.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b). A protein A C domain protein mutant protein comprising the amino acid sequence shown in SEQ ID NO: 5, comprising any one of the following amino acid sequences (a) to (c), and an Fc region of immunoglobulin G: The mutant protein having a binding activity in a weakly acidic region with respect to the Fc region of immunoglobulin G as compared to the wild-type C domain of protein A (a) the amino acid sequence represented by SEQ ID NO: 5 An amino acid sequence obtained by substituting an amino acid residue consisting of any combination of Gln10 and Asn11, Asn11 and Leu17, and Glu15 and Leu17 with a histidine residue.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b). A variant protein of the Z domain protein of protein A consisting of the amino acid sequence shown in SEQ ID NO: 6, comprising the amino acid sequence of any of the following (a) to (c), and the Fc region of immunoglobulin G The mutant protein having a binding activity in a weakly acidic region with respect to the Fc region of immunoglobulin G as compared with the wild-type Z domain of protein A (a) the amino acid sequence represented by SEQ ID NO: 6 An amino acid sequence obtained by substituting an amino acid residue consisting of any combination of Gln10 and Asn11, Asn11 and Leu17, and Glu15 and Leu17 with a histidine residue.
(B) A mutant protein comprising an amino acid sequence in which one or several amino acid residues are added or inserted in the histidine-substituted amino acid sequence of (a).
(C) A mutant protein comprising an amino acid sequence in which one or several amino acid residues other than the histidine residue substitution site are deleted or substituted in the histidine-substituted amino acid sequence of (a) or (b). A protein comprising an amino acid sequence in which the amino acid sequence of the protein according to any one of claims 1 to 6 and the amino acid sequence of a linker peptide or linker protein are alternately arranged. A fusion protein comprising an amino acid sequence obtained by linking the amino acid sequence of the protein according to any one of claims 1 to 6 and the amino acid sequence of another protein. A protein with a spacer comprising the amino acid sequence of the protein according to any one of claims 1 to 6 and the amino acid sequence of a spacer for immobilizing the protein on a water-insoluble solid phase support. A nucleic acid encoding the protein according to any one of claims 1 to 9 .   A nucleic acid comprising the base sequence represented by any of SEQ ID NOs: 26 to 28. A recombinant vector containing the nucleic acid according to claim 10 or 11 . A transformant into which the recombinant vector according to claim 12 has been introduced. An immobilized protein, wherein the protein according to any one of claims 1 to 9 is immobilized on a water-insoluble solid phase support. An antibody, an immunoglobulin G, or a protein capture agent having an Fc region of immunoglobulin G, comprising the protein according to any one of claims 1 to 9 . An antibody, an immunoglobulin G, or a protein capture agent having an Fc region of immunoglobulin G, comprising the immobilized protein according to claim 14 .