JP5229214B2 - Biomolecules for diagnosis - Google Patents

Description

  The present invention relates to biological molecules or biomolecules, and specifically to biomarkers. More specifically, the present invention relates to biomolecules used for diagnosis or prognostic evaluation of disease or for monitoring the efficacy of disease treatment.

  Breast cancer is now the second most common cause of cancer death in women (after lung cancer) and is one of the most common cancers among women. The World Health Organization estimates that more than 1.2 million people worldwide are diagnosed with breast cancer each year.

  The American Cancer Society estimates that by 2005, approximately 210,000 women in the United States will be diagnosed with invasive breast cancer (Stage I-Stage IV). The likelihood of developing invasive breast cancer during the lifetime of a woman is approximately 1 in 7 (13.4%). An additional 60,000 women are diagnosed with localized intraepithelial breast cancer (a very early form of the disease). Men can also have breast cancer, albeit with a lower probability. An estimated 1,700 cases are diagnosed in men in 2005.

  Each year, it is estimated that 40,000 women and 460 men die from breast cancer in the United States. According to the American Cancer Society, the chance of breast cancer being related to a woman's death is about 1/33 (3%). Breast cancer incidence (number of new breast cancer patients per 100,000 women) increased by approximately 4% during the 1980s, which was 100.6 per 100,000 women in the 1990s. It is leveling off. Breast cancer mortality also declined significantly between 1992 and 1996, with the greatest decline among young women. Medical professionals consider this decline in breast cancer deaths as a result of earlier detection and more effective treatment.

  Breast cancer is usually a palpable lump in the breast and / or unusual presentation of the breast (e.g., skin folds, folds, bumps, repositioned nipples, or inverted nipples, redness, It is first detected by tingling, rash, swelling, or breast asymmetry.

After detection by physical examination, mammography with x-rays or ultrasound may be performed. However, mammography is accompanied by false positive results due to cysts, calcifications, and benign lumps (eg, fibroadenoma). As a result, further diagnosis based on cytology is usually required for tissue samples obtained from biopsies. The interpretation of cytological samples requires highly trained professionals.
As such, improved methods for detecting and treating breast cancer are welcomed.

Objects of the invention The present invention addresses the above problems and provides a method for detecting and / or treating cell proliferation abnormalities (eg, cancer, etc.). In general, the abnormality is cancer, specifically breast cancer.

In one aspect, the present invention provides:
[1] A method for detecting and / or quantifying the presence, predisposition, and / or severity of cell proliferation abnormalities in a subject,
(A) providing at least one sample from the subject;
(B) measuring the expression of the PA2G4 gene, its RNA and / or mutation, and / or PA2G4 protein, its derivatives, mutants and / or fragments; and (c) the PA2G4 gene, its RNA and / or mutation, And / or comparing the expression of the PA2G4 protein, derivative, variant and / or fragment thereof to that of at least one control, the difference in expression being indicative of the presence or predisposition of a cell proliferation disorder in said subject And / or a method wherein severity is indicated.

[2] A method of monitoring the efficacy of a treatment for abnormal cell proliferation in a subject comprising
(A) providing at least two samples from the subject, each sample being obtained at a different time;
(B) measuring the expression of the PA2G4 gene, its RNA and / or mutation, or PA2G4 protein, its derivatives, variants and / or fragments; and (c) the PA2G4 gene, its RNA and / or in at least two samples; Alternatively, a method comprising comparing the expression of a mutation and / or PA2G4 protein, derivative, variant and / or fragment thereof is also provided.

[3] A method for determining the prognosis of a result of abnormal cell proliferation in a subject,
(A) providing at least one sample from the subject;
(B) measuring the expression of the PA2G4 gene, its RNA and / or mutation, and / or PA2G4 protein, its derivatives, mutants and / or fragments; and (c) the PA2G4 gene, its RNA and / or mutation, And / or comparing the expression of the PA2G4 protein, derivative, variant and / or fragment thereof with that of at least one control, wherein differences in expression indicate a prognosis of abnormal cell proliferation in said subject A method is also provided.

  [4] In any one of the above methods [1] to [3], the control may be, for example, at least one subject not diagnosed with abnormal cell proliferation. Alternatively, the control may be at least one subject having a low level expression of the PA2G4 gene and / or PA2G4 protein. The control may also be an average value in expression obtained from the selected population.

  [5] In any of the above methods [1] to [3], the gene, its RNA and / or mutation may be a human PA2G4 gene, its RNA and / or mutation, and the PA2G4 protein, The derivative, variant and / or fragment may be a human PA2G4 protein, derivative, variant and / or fragment thereof.

  [6] In any one of the above methods [1] to [5], the detection is performed by labeling the PA2G4 protein, a derivative, a mutant and / or a fragment thereof with at least one sulfenyl halide reagent, and then two-dimensionally. It can be performed by gel electrophoresis and mass spectrometry.

  [7] In the above method [6], the sulfenyl halide reagent may be 2-nitrobenzenesulfenyl chloride (NBS).

  [8] Also provided are methods of treating cell proliferation abnormalities in a subject comprising altering the expression of the PA2G4 gene, its RNA and / or mutation.

  [9] In any of the above methods [1] to [8], the PA2G4 gene may have the sequence represented by SEQ ID NO: 1.

  [10] In the above method [8] or [9], the change can be obtained by administering a hybridizable nucleic acid to all or part of the PA2G4 gene, its RNA and / or mutation. it can.

  [11] In the above method [10], the hybridizable nucleic acid may be DNA or RNA.

  [12] In the above method [11], specifically, the hybridizable nucleic acid may be siRNA.

  [13] In the above method [8] or [9], the change can be obtained by administering a compound capable of hybridization to all or part of the PA2G4 gene, its RNA and / or mutation. it can.

  [14] Also provided is a method of treating a cell proliferation disorder in a subject comprising altering the expression of a PA2G4 protein, derivative, variant and / or fragment thereof.

  [15] In the above method [14], the method may comprise changing the expression of a PA2G4 protein having the amino acid sequence of SEQ ID NO: 2.

  [16] In the above method [14] or [15], the changing comprises administering a polypeptide that binds to all or part of the amino acid sequence of the PA2G4 protein, derivative, variant and / or fragment thereof Can be obtained.

  [17] In the above method [16], the binding polypeptide may be an antibody.

  [18] In the method [14], the change can be obtained by administering a compound capable of hybridization to all or a part of the amino acid sequence of the PA2G4 protein.

  [19] In any one of the above methods [8] to [18], changing the expression comprises the PA2G4 gene, its RNA and / or mutation, and / or PA2G4 protein, its derivative, mutant and / Or can reduce the expression of the fragment.

[20] A method of screening for at least one drug that causes a variation in the expression of at least one protein and / or fragment thereof,
(A) administering at least one drug to at least one subject;
(B) obtaining at least one protein from the subject;
(C) labeling at least one amino acid residue of the protein with at least one reagent; and (d) analyzing the protein by mass spectrometry, whereby the at least one protein and / or fragment thereof is Also provided is a method that includes identifying and determining whether an expression variation has occurred.

  [21] In the method [20], the analyzing step includes separating the protein based on a first feature, optionally separating the protein based on a second feature, and ionizing the protein. Detecting and identifying the separated protein.

  [22] In the above method [20] or [21], the protein and / or fragment thereof may be PA2G4 protein and / or fragment thereof.

  [23] In the above method [22], the PA2G4 protein has the sequence of SEQ ID NO: 2.

  [24] In any of the above methods [20] to [23], the reagent may be a sulfenyl halide.

  [25] In any of the above methods [20] to [24], specifically, the reagent may be 2-nitrobenzenesulfenyl chloride (NBS).

  [26] In any of the above methods [20] to [25], the amino acid residue may be tryptophan.

  [27] In any of the above methods [21] to [26], the separating step can be based on at least one feature selected from the group consisting of mass, charge, functional group, and isoelectric point. .

  [28] In any one of the above methods [21] to [27], the separating step includes SDS-polyacrylamide gel electrophoresis (SDS-PAGE), two-dimensional gel electrophoresis (2DE), and high performance liquid chromatography. (HPLC) and / or a process for free flow electrophoresis (FFE).

  [29] In any of the above methods [21] to [28], the ionization is performed by electrospray ionization (ESI), matrix-assisted laser desorption / ionization (MALDI), or surface-enhanced laser desorption / ionization (SELDI). , Nanospray ionization, atmospheric pressure chemical ionization (APCI), chemical ionization (CI), electron impact (EI), fast atom bombardment (FAB), field desorption / field ionization (FD / FI) and thermospray ionization ( TSP) can be selected.

  [30] In any of the above methods [20] to [29], the analyzing step can be performed by tandem mass spectrometry.

  [31] In the above method [30], in the tandem mass spectrometry, a quadrupole time-of-flight configuration can be used.

[32] A method of selecting at least one candidate for clinical trials, experiments and / or diagnostic tests,
(A) providing at least one sample from at least one subject;
(B) measuring the expression of the PA2G4 gene and / or mutation thereof, or PA2G4 protein, derivative, variant and / or fragment thereof; and (c) the PA2G4 gene, RNA and / or mutation thereof, and / or Comparing the expression of the PA2G4 protein, derivative, variant and / or fragment thereof with that of at least one control, wherein differences in expression indicate that said subject is suitable as a candidate A method is also provided.

  [33] In the above method [32], the control may be at least one subject not diagnosed with abnormal cell proliferation.

[34] In the above method [32] or [33], specifically, the control may be one subject that has not been diagnosed with abnormal cell proliferation.
The control may also be at least one subject having a low or reduced level of expression of the PA2G4 gene and / or PA2G4 protein. The control may also be an average value in expression obtained from the selected population.

  [35] In any of the above methods [1] to [34], the abnormal cell proliferation may be cancer.

  [36] In any of the above methods [1] to [34], specifically, the abnormal cell proliferation may be breast cancer.

  [37] In any of the above methods [1] to [36], the subject may be a mammal.

  [38] In any of the above method [1] to method [36], specifically, the subject may be a human.

[39] A diagnostic kit and / or prognostic kit for diagnosis and / or prognosis evaluation of cell proliferation abnormality in a subject, wherein the PA2G4 gene, its RNA and / or mutation can be hybridized, and / or Alternatively, diagnostic kits and / or prognostic kits comprising at least one molecule that binds to PA2G4 protein, derivatives, variants and / or fragments thereof are also provided.
The molecule may be a nucleic acid sequence capable of hybridizing to the PA2G4 gene, its RNA and / or mutation.

  [40] In the above method [39], the molecule may be an siRNA capable of hybridizing to the transcript of the PA2G4 gene.

  [41] In the above method [39], the molecule may be a protein that binds to the PA2G4 protein, derivative, variant and / or fragment thereof.

[42] In the above method [39] or [41], the molecule may be an antibody that binds to the PA2G4 protein, derivative, variant and / or fragment thereof.
The kit can further include packaging and information relating to the use of the compound for purposes such as diagnosis and / or prognostic evaluation of disease states or treatment conditions.
The abnormal cell proliferation may be cancer. Specifically, the abnormal cell proliferation may be breast cancer. The subject may be a mammal, specifically a human.

(A) Modification of tryptophan residue with 2-nitrobenzenesulfenyl chloride (NBS). ^* Represents either ¹² C (light) or ¹³ C (heavy). (B) Schematic of protein identification / quantification method by NBS / 2DE / MS. In this study, the selection of spots for excision was based on prior art analysis using conventional 2DE gels (see results for details). However, if more comprehensive proteomic studies are required, it is also clearly feasible to cut out all of the spots that can be seen on the NBS gel for subsequent analysis. (A) MALDI-TOF spectrum of a tryptic peptide of chicken ovalbumin. Two pairs of NBS-labeled peptides (m / z 1734.7 / 1740.7 and m / z 2012.01 / 1218.0) are highlighted. (B) Mass spectrum of NBS-labeled peptide pair (m / z 1734.7 / 1740.7), which shows the consistency between the amount of labeled protein and the resulting MALDI-TOF MS spectrum . (A) NBS-labeled peptide pair (m / z 1135.5 / 1141.5) from protein keratin-18 (K1C18_HUMAN) was obtained by MALDI-TOF MS using CHCA / DHB matrix. (B) The same peptide pairs were analyzed using a combination of HNBA matrix and CHCA / DHB matrix. To facilitate comparison, the scale of the full spectrum (upper panel) was set to 100 mV, while the scale of the expanded spectrum (lower panel) was set to 10 mV. The figure on the right shows that HNBA in combination with CHCA / DHB greatly enhanced the ionization of NBS-labeled peptides. 2DE map of NBS-labeled protein spots cut out and identified by MS analysis. Forty-eight protein spots were reliably identified by peptide mass fingerprinting from 88 spots with differential fluorescence staining intensity as analyzed by 2DE analysis. Among them, 44 protein spots were detected along with NBS-labeled peptide pairs, which were quantified by calculating the peptide volume ratio of ¹³ C / ¹² C. Correlation of relative protein quantification by NBS / 2DE / MS and 2DE methods (ratio of TAM treated MCF-7 cells to vehicle treated MCF-7 cells). Among the 44 differentially expressed proteins, the correlation coefficient between the ratios estimated by these two methods was 0.51. This indicates that there is a statistically significant correlation between these two protein quantification methods. Spot 14 and spot 21 are highlighted for further matching studies (see FIGS. 6 and 7). Spot 14 (disulfide isomerase ER-60) has a good agreement between NBS / 2DE / MS quantification and 2DE quantification. PDQuest 3D image analysis for this spot reveals only one distinct image peak. In contrast, spot 21 (CK19) is not a good match between NBS / 2DE / MS quantification and 2DE quantification. 3D image analysis shows that at least two image peaks are detected in this protein spot, indicating simultaneous movement of the protein. Mass spectrum of tryptic peptide of spot 21 (CK19). Peptide sequencing mass spectra of matching peptides (m / z 1222.75) and non-matching peptides (m / z 1419.85) are shown with their y-ions. The 122.75 matching peptide (TKFETEQALR) (SEQ ID NO: 56) was found to be derived from CK19, while the m / z 1419.85 mismatched peptide (LEGLTDEIINFLR) (SEQ ID NO: 57) was derived from CK8. there were. Two isoforms (spot 7 and spot 8) of heat shock 60 kDa protein (CH60_HUMAN) with different isoelectric points. (A) Based on quantification by NBS labeling, the protein was up-regulated for spot 8 but down-regulated for spot 7. (B) The fluorescence labeling ratio of the 2DE spot was consistent with the NBS labeling ratio. Technical reproducibility of NBS / 2DE / MS platform. The quantitative fold change of 40 protein spots from the same biological batch of double-labeled MCF-7 cells was compared. When considering 95% of these spots, the linear regression was y = 0.8884x + 0.1452, and R2 = 0.71. When considering 100% of these spots, the linear regression was y = 0.7751x + 0.201 and R2 = 0.64. Validation of NBS quantification by immunoblotting. Two representative proteins that were found to change upon TAM treatment (GRP78 and CK19) were confirmed for their effectiveness by immunoblotting with protein-specific antibodies. (A) GRP78 is upregulated in TAM treated MCF-7 cells. (B) (Upper) Immunoblot revealing down-regulation of PA2G4 protein at 24 and 48 hours after TMA treatment. A blot with β-actin antibody is shown because the total cell lysate is equally loaded. (Lower) RT-PCR amplification of PA2G4 transcript and β-actin transcript from cDNA using oligo dT as a primer shows relative down-regulation of PA2G4 mRNA during TAM treatment. 2DE images of MCF-7 cells treated with TMA (A) or vehicle (B) for 48 hours, and 2DE images (C) of NBS-labeled and mixed TAM-treated or vehicle-treated cells. All of the images show very similar protein patterns. The results of qualitative and quantitative image analysis are shown in FIG. PDQuest image analysis results comparing 2DE images of TCF treated or vehicle treated (untreated) MCF-7 cells. Triplicate gels were run for each treatment. (A) Concordance for the two sets of gels was about 85% to 95% in about 340 visible gel spots; (B) differentially presented at qualitative and quantitative levels. Number of protein spots. (A) Observation result of IHC staining for PA2G4 on normal tissue (inset is an enlarged view of normal tissue), and (B) Observation result of IHC staining for PA2G4 on tumor tissue (inset is tumor) An enlarged view of the organization). Fractionated protein extracts (ie, cytoplasmic protein extract (i), membrane / organelle protein extract (ii), and nuclear protein extract (iii)) to demonstrate the localization of PA2G4 Western blotting). Validation of PA2G4: (A) Western blotting for PA2G4 in cancer and normal samples, using anti-actin as a reference, (B) PA2G4 in cancer and normal samples found in (A) Each integrated value in the absorbance unit of the band. In both (A) and (B), ER + represents a cancer sample and TNT represents a normal sample. In (B), the vertical axis represents the integrated value in the absorbance unit of the band.

  References mentioned in this specification are, for convenience, listed in the form of a list of documents and added at the end of the examples. The entire contents of such references are incorporated herein by reference.

Definition Biological material-any material derived from a biological source. The material can include biomolecules, cells, tissues and / or body fluids. The material can be obtained from cell cultures, animal subjects, mammalian subjects or human subjects.

  Biomolecules—Biological molecules such as protein acids, nucleic acids (DNA and / or RNA), lipids, carbohydrates and their derivatives.

  Biomarkers—A biomarker is the presence and severity of a particular disease state or a biochemical or molecular molecule (protein, polypeptide, carbohydrate, lipid, etc. and their derivatives) that is associated with different treatment conditions. is there. Under the present invention, proteins or protein derivatives can be used as biomarkers. Biomarkers can be detected and measured by various methods. In order to identify a biomarker, it is usually necessary to detect differences or changes in the expression or abundance of a biological molecule and identify that particular molecule.

  Biomarker expression or abundance—Biomarker expression can be determined from the presence or abundance of the gene, gene transcript and gene product. The terms “gene” and “gene transcript” include RNA sequences complementary to a gene and cDNA sequences obtained by reverse transcription of a gene transcript. These terms also include wild-type genes, variations and variants of genes and gene transcripts, where such variations or variants share substantial identity with the gene or gene transcript. To do. Similarly, “gene product” includes a wild-type gene product, variations, fragments or derivatives thereof. “Substantial identity” means that the variations of the gene or gene product retain sufficient identity so that they can be detected by the methods and probes used for the wild-type gene or gene product, and Means retaining the same function as the wild-type gene or gene product. The determination can be qualitative, for example, whether the biomarker is expressed, etc., or the determination can be quantitative, or the determination can be any method known in the art For example, it can be semi-quantitative, such as by microarray technology or polymerase chain reaction. Deviation (increase or decrease) from normal levels in a non-disease state can indicate a disease state or a predisposition to a disease state. For example, protein overexpression or increased abundance may indicate a disease state, the severity of the disease state, and thus the prognosis for the subject whose biomarker was measured, and / or protein overexpression. Or increased abundance may be an indication of susceptibility to a disease state. Differences in expression and abundance can be determined between different biomarkers or between the same biomarkers under different conditions or time points. Biomarker expression can then be determined to correlate with the presence, severity of disease state, or to determine the efficacy of treatment, or to determine the prognosis of disease outcome for a subject. , Reference values, or other values obtained between different time points or between different biomarkers, and can be correlated with such values. The reference value can be determined from a statistically significant number of affected or unaffected subjects. Biomarker expression can also be used in conjunction with other suitable diagnostic or prognostic markers, biomarkers or indicators to obtain a higher level of confidence. When a biomarker is said to be “overexpressed” when compared to a control, at least one wild type or non-mutated control subject whose biomarker expression has not been diagnosed with a disease stage or disease state Means that the abundance or level is statistically significantly greater than the abundance or level expressed in nature. Similarly, when a biomarker is said to be “underexpressed”, the expression of the biomarker is in a natural state by at least one wild-type or non-mutated control subject not diagnosed with a disease stage or disease state. Statistically significantly less than the expression of biomarkers expressed in Under this definition, a subject who is genetically deficient in the biomarker cannot be said to be underexpressing the biomarker. Similarly, when the biomarker gene was transfected to express the biomarker, such a deficient subject was overexpressed because the biomarker was originally deficient. I can't say I'm doing it.

  Control—a reference subject, experiment or value to which the value obtained in a test can be compared. A control value or control range usually represents a “normal” state, so that a statistical difference or deviation in the control value or control range represents an abnormal state or disease stage. One skilled in the art knows how to select and / or obtain a control subject, experiment or value for use as a reference.

  Selecting a subject or candidate-determining that a subject or candidate is suitable for clinical trials, experiments, diagnostic tests and / or other tests by measuring at least one characteristic of the subject or candidate . Values representing such characteristics are then compared to reference or control values or ranges of values, and the results are suitable for the subject or candidate for clinical trials, experiments, diagnostic tests and / or other tests. Used to determine what is. One of skill in the art knows how to select a subject or candidate based on its compliance with a particular treatment or its susceptibility to a particular attack or disease.

  Abnormal cell proliferation-a condition in which there is abnormal growth of cells.

  Cancer—malignant and uncontrolled growth of cells in one part of the body that can spread to other parts of the body.

  Nucleic acid-"Nucleic acid" is a linear polymer of nucleotides linked by 3 ', 5' phosphodiester bonds. In DNA (deoxyribonucleic acid), the sugar group is deoxyribose, and the nucleotide bases are adenine, guanine, thymine, and cytosine. RNA or ribonucleic acid has ribose as a sugar, and thymine replaces uracil. An “isolated nucleic acid” is a nucleic acid whose structure is different from the structure of any naturally occurring nucleic acid or the structure of any fragment of a naturally occurring genomic nucleic acid. Thus, this term may include, for example, (a) a sequence of a coding sequence adjacent to a portion of a molecule in the genome of an organism in which the genomic DNA molecule has a naturally occurring genomic DNA molecule. DNA that is not adjacent to both; (b) the nucleic acid incorporated into the vector or prokaryotic or eukaryotic genomic DNA such that the resulting molecule is different from any naturally occurring vector or genomic DNA; A) an independent molecule such as a cDNA, genomic fragment, polymerase chain reaction (PCR) fragment, or restriction fragment; and (d) part of a hybrid gene (ie, a gene encoding a fusion protein) Includes certain recombinant nucleotide sequences. The present invention can also be used, for example, for detection of the human PA2G4 gene in a subject, or for screening of therapeutic compounds for treating cell proliferation related abnormalities, at least 50% relative to SEQ ID NO: 1. Characterized by an isolated nucleic acid having an identity (including any percentage between 50% and 100%, eg, 85%, 95% or 100%).

  Gene product—Under the present invention, a gene product refers to a gene product other than a protein. A gene product may be a length of RNA having a biological function that is different from the gene transcript encoded by a particular gene.

  Gene transcript—A messenger RNA sequence encoded by a gene.

  Protein—a biological molecule composed of one or more chains of amino acids in a particular order, encoded by a particular gene. As such, any mutation in the gene may be reflected in the expressed mutant protein. Under the present invention, a mutated protein having substantially the same biological function and activity as the non-mutated protein is considered the same as the non-mutated protein. Proteins may have derivatives such as isoforms. Protein isoforms are protein variants with some minor differences, and are usually the product of splice variants or some post-translational modification. Under the present invention, a protein also encompasses fragments that are sufficiently large that the protein can be detected, identified and / or quantified by the method used. A protein complex is a mixture of different proteins.

  Proteome—A collection of proteins expressed by a cell or organ under a specific time and under specific conditions. Proteome analysis is therefore a study of a complete set of proteins encoded by the genome.

  Percent identity—The “percent identity” of two nucleic acid sequences is determined using the algorithm of Karlin and Altschul (1990), modified as in Karlin and Altschul (1993). Such an algorithm is incorporated into the XBLAST program of Altschul et al. (1990). A BLAST nucleic acid search is performed by the XBLAST program. If a gap exists between the two sequences, Gapped BLAST is utilized as described in Altschul et al. (1997). When using BLAST programs and Gapped BLAST programs, the default parameters of the respective programs (eg, XBLAST) are used. See the World Wide Web address (http://ncbi.nih.gov). The percent identity of other sequences (eg, protein sequences, etc.) can be similarly determined.

  Antibody—An immunoglobulin protein produced by B lymphocytes of the immune system that binds to a specific antigen molecule. The term includes monoclonal antibodies, polyclonal antibodies, and fragments thereof (eg, Fab fragments, F (ab ') 2 fragments and Fv fragments).

  Drug—Any compound used for the treatment (amelioration, reduction or therapy) of any disease or pathological stage or pathological condition.

  Screen-to select compounds that have an effect in any disease or pathological condition. Screening may involve detecting, identifying, and / or quantifying any biomolecule (eg, protein, etc.) whose expression is affected by the compound.

  Treat-to treat, alleviate, reduce, repair, prevent or ameliorate an abnormality, a symptom of the abnormality, a secondary disease state of the abnormality, or a predisposition to the abnormality in a subject having a cell proliferation related abnormality To administer a compound or drug. An “effective amount” is an amount of a composition that can produce a medically desirable result (eg, a result as described above) in a treated subject. Such methods can be performed alone or in combination with other drugs or treatments. Treatment includes reducing the biomarker to a level found in a non-disease state.

  Hybridize, hybridizable-a biomolecule (eg, a sequence of nucleic acids, etc.) is hybridized to another sequence of nucleic acids if there is a sufficient stretch of complementary nucleotides between them Can do. For a peptide or protein, one protein (eg, an antibody or fragment thereof) can hybridize to another protein if a sufficiently complementary structure exists between these two biomolecules. it can.

  Diagnose, Diagnosis—Diagnosing a disease is determining the nature or identity of the disease. Diagnosis may be accompanied by a determination regarding the severity of the disease.

  Prognostic, prognostic-prognostic is to predict the outcome or prognosis of a disease, for example, to communicate the likelihood of survival based on observations and results of clinical tests.

  Predisposition—the possibility of being diagnosed with a particular disease or susceptibility to a particular disease.

  Blood derivatives—Blood is composed of cellular and liquid components. A blood derivative is any one or more of the blood components other than whole blood.

  The present invention examines the above problems and provides a method for detecting and / or treating abnormal cell proliferation (eg, cancer). In general, the abnormality is cancer, specifically breast cancer.

In one aspect, the present invention is a method for detecting and / or quantifying the presence, predisposition, and / or severity of a cell proliferation disorder in a subject comprising:
(A) providing at least one sample from the subject;
(B) measuring the expression of the PA2G4 gene, its RNA and / or mutation, and / or PA2G4 protein, its derivatives, mutants and / or fragments; and (c) the PA2G4 gene, its RNA and / or mutation, And / or comparing the expression of the PA2G4 protein, derivative, variant and / or fragment thereof to that of at least one control, the difference in expression being indicative of the presence or predisposition of a cell proliferation disorder in said subject And / or a method wherein severity is indicated.

A method of monitoring the efficacy of a treatment for abnormal cell proliferation in a subject comprising:
(A) providing at least two samples from the subject, each sample being obtained at a different time;
(B) measuring the expression of the PA2G4 gene, its RNA and / or mutation, or PA2G4 protein, its derivatives, variants and / or fragments; and (c) the PA2G4 gene, its RNA and / or in at least two samples; Alternatively, a method comprising comparing the expression of a mutation and / or PA2G4 protein, derivative, variant and / or fragment thereof is also provided.

A method for prognosing a result of abnormal cell proliferation in a subject, comprising:
(A) providing at least one sample from the subject;
(B) measuring the expression of the PA2G4 gene, its RNA and / or mutation, and / or PA2G4 protein, its derivatives, mutants and / or fragments; and (c) the PA2G4 gene, its RNA and / or mutation, And / or comparing the expression of the PA2G4 protein, derivative, variant and / or fragment thereof with that of at least one control, wherein differences in expression indicate a prognosis of abnormal cell proliferation in said subject A method is also provided.

  The control is, for example, at least one subject not diagnosed with abnormal cell proliferation. The control may also be a subject with a low level expression of the PA2G4 gene and / or PA2G4 protein. The control may also be an average value in expression obtained from the selected population.

  The gene, its RNA and / or mutation may be a human PA2G4 gene, its RNA and / or mutation, and the PA2G4 protein, derivative, variant and / or fragment thereof is human PA2G4 protein, derivative, mutation It may be a body and / or a fragment.

  The detection can be performed by labeling the PA2G4 protein, derivative, variant and / or fragment thereof with at least one sulfenyl halide reagent, followed by two-dimensional gel electrophoresis and mass spectrometry.

  Also provided is a method of treating a cell proliferation disorder in a subject comprising altering the expression of the PA2G4 gene, its RNA and / or mutation.

  The PA2G4 gene may have the sequence shown in SEQ ID NO: 1. Alteration The alteration can be obtained by administering a hybridizable nucleic acid to all or part of the PA2G4 gene, its RNA and / or mutation. The nucleic acid capable of hybridization can be DNA or RNA. Specifically, the hybridizable nucleic acid can be siRNA. The alteration can be obtained by administering a compound capable of hybridization to all or part of the PA2G4 gene, its RNA and / or mutation.

Also provided is a method of treating a cell proliferation disorder in a subject comprising altering the expression of a PA2G4 protein, derivative, variant and / or fragment thereof.

  This method can include altering the expression of a PA2G4 protein having the amino acid sequence of SEQ ID NO: 2. Said alteration can be obtained by administering a polypeptide that binds to all or part of the amino acid sequence of said PA2G4 protein, derivative, variant and / or fragment thereof. The binding polypeptide can be an antibody. The change can be obtained by administering a compound capable of hybridization to all or a part of the amino acid sequence of the PA2G4 protein.

  Altering the expression can include decreasing the expression of the PA2G4 gene, RNA and / or mutation thereof, and / or PA2G4 protein, derivative, variant and / or fragment thereof.

  A method of screening for at least one drug that causes a variation in the expression of at least one protein and / or fragment thereof, wherein at least one drug is administered to at least one subject; at least one protein is obtained from said subject Labeling at least one amino acid residue of the protein with at least one reagent; and analyzing the protein by mass spectrometry, thereby identifying and expressing the at least one protein and / or fragment thereof A method is also provided that includes determining whether or not the fluctuations are occurring.

  The analyzing step separates the protein based on a first characteristic, optionally separates the protein based on a second characteristic, ionizes the protein, and detects and identifies the separated protein Can be included. The protein and / or fragment thereof may be a PA2G4 protein and / or fragment thereof. The PA2G4 protein has the sequence of SEQ ID NO: 2. The reagent can be a sulfenyl halide. Specifically, the reagent may be 2-nitrobenzenesulfenyl chloride (NBS). The amino acid residue can be tryptophan.

  The separating step can be based on at least one feature selected from the group consisting of mass, charge, functional group and isoelectric point. The separating step is a step for SDS-polyacrylamide gel electrophoresis (SDS-PAGE), two-dimensional gel electrophoresis (2DE), high performance liquid chromatography (HPLC) and / or free flow electrophoresis (FFE). possible. The ionization includes electrospray ionization (ESI), matrix-assisted laser desorption / ionization (MALDI), surface enhanced laser desorption / ionization (SELDI), nanospray ionization, atmospheric pressure chemical ionization (APCI), chemical ionization ( CI), electron impact (EI), fast atom bombardment (FAB), field desorption / field ionization (FD / FI) and thermospray ionization (TSP) can be selected. The analyzing step can be performed by tandem mass spectrometry. In the tandem mass spectrometry, a quadrupole time-of-flight configuration can be used.

A method of selecting at least one candidate for clinical trials, experiments and / or diagnostic tests comprising:
(A) providing at least one sample from at least one subject;
(B) measuring the expression of the PA2G4 gene and / or mutation thereof, or PA2G4 protein, derivative, variant and / or fragment thereof; and (c) the PA2G4 gene, RNA and / or mutation thereof, and / or Alternatively, comprising comparing the expression of the PA2G4 protein, derivative, variant and / or fragment thereof with that of at least one control, the difference in expression indicating that the subject is suitable as a candidate. Certain methods are also provided.

  Diagnostic kit and / or prognosis kit for diagnosis and / or prognosis evaluation of cell proliferation abnormality in a subject, at least one molecule capable of hybridizing to PA2G4 gene, its RNA and / or mutation, and / or PA2G4 Also provided are diagnostic and / or prognostic kits comprising at least one molecule that binds to a protein, derivative, variant and / or fragment thereof.

  The molecule may be a nucleic acid sequence capable of hybridizing to the PA2G4 gene, its RNA and / or mutation. The molecule may be a siRNA capable of hybridizing to the PA2G4 gene transcript. The molecule may be a protein that binds to the PA2G4 protein, derivatives, variants and / or fragments thereof. The molecule may be an antibody that binds to the PA2G4 protein, derivative, variant and / or fragment thereof.

  The abnormal cell proliferation may be cancer. Specifically, the abnormal cell proliferation may be breast cancer. The subject may be a mammal, specifically a human.

  This application determines the novel use, prognosis, of genes, their gene transcripts, RNA gene products and / or mutations thereof, and / or proteins, derivatives, variants and / or fragments thereof for diagnosing breast cancer Describes new uses to monitor and new uses to monitor the efficacy of treatment for breast cancer. Through the use of mass spectrometry (MS), Applicants have made the surprising discovery that the growth-related gene 2G4 (PA2G4) gene is suitable as a biomarker for these purposes.

  Mass spectrometry (MS) can be used to analyze molecules. In the MS system, the molecule of interest is ionized, separated in an analyzer based on its m / z ratio, and then detected by a detector. The results can be displayed in the form of a m / z spectrum. MS systems typically include a data analysis subsystem for analyzing data.

  Molecular ionization can be achieved by a number of methods including atmospheric pressure chemical ionization (APCI), thermospray ionization (TSP), chemical ionization (CI), electron impact (EI), electrospray ionization. (ESI), fast atom bombardment (FAB), field desorption / field ionization (FD / FI), surface enhanced laser desorption / ionization (SELDI) and matrix assisted laser desorption / ionization (MALDI).

  The analyzer can utilize various principles or arrangements for analyzing ions, including quadrupole, magnetic sector, and Fourier transform, quadrupole ion trap and time-of-flight (TOF) types. Both placements are included. More than one analyzer can be placed in tandem. Commonly used tandem arrangements include quadrupole-quadrupole, magnetic sector-quadrupole and quadrupole-time-of-flight arrangements.

  In MS, a person skilled in the art can select various ionization methods, analysis methods, and detection methods in order to best investigate a target biomolecule (eg, protein).

  Applicants used the 2-nitrobenzenesulfenyl chloride (NBS) labeling technique (Kuyama et al., 2003) in combination with 2DE and MS (NBS / 2DE / MS) for quantitative proteome analysis. In NBS labeling, a light NBS component and a heavy NBS component are coupled to tryptophan residues, thereby allowing a mass difference of 6 Da to be obtained between a light NBS labeled tryptophan peptide and a heavy NBS labeled tryptophan peptide. Is generated.

  NBS / 2DE / MS method for examining proteome changes in MCF-7 breast cancer cells induced by tamoxifen (TAM) treatment. TAM is the first-chosen hormone treatment for estrogen receptor positive (ER +) breast cancer, but previous reports have described mRNA gene expression patterns in breast cancer patients and cell lines associated with TAM treatment (Saji). Et al., 2005; Zhang et al., 1999). Using NBS / 2DE / MS, we selected 88 protein spots that were quantitatively altered between TAM treated MCF-7 cells and control MCF-7 cells, 44 of them could be successfully identified and quantified by NBS labeling. Three proteins (CK19, GRP78 and PA2G4) were also confirmed to be effective as authentic TAM-responsive proteins in MCF-7 cells by Western blotting, and in primary breast cancer, PA2G4 expression was reduced to two It was further shown to behave as a novel prognostic factor in an independent patient cohort.

  Among the proteins examined, growth-related 2G4 (PA2G4) has very good potential for use as a biomarker for breast cancer. This gene sequence is shown as SEQ ID NO: 1, and the sequence of the gene product (protein) is shown in SEQ ID NO: 2.

  PA2G4 (Ebp-1) belongs to a large family of cell cycle regulatory or replication proteins that maintain the cell cycle activity of proliferating cells. PA2G4 (Ebp-1) appears to be a growth-dependent gene that probably encodes a nuclear DNA binding protein involved in the control of cell replication. PA2G4 / Ebp-1 has been shown to be involved in the differentiation of human ErbB receptor-positive breast cancer cells and prostate cancer cells, and has anti-proliferative activity as a tumor suppressor protein of retinoblastoma (Rb) (Rao et al., 2002). This protein is found in both mammals and humans.

  The mitogenic effect of E2 is thought to be mainly due to its ability to increase the expression of important cell cycle regulatory genes. A comprehensive gene expression analysis of E2 action using a classic E2 responsive human model and identification of several genes targeted by E2 has been reported. PA2G4 was found to be overexpressed in MCF-7 even after 3 hours of E2 treatment. In this study, various breast cancer cell lines of ER + and ER− were used (Pompeia et al., 2004).

  Two other proteins (CK19 and GRP78) were confirmed to be effective as authentic TAM-responsive proteins in MCF-7 cells.

  The identification of drug responsive biomarkers in complex protein mixtures is one of the important goals of quantitative proteomics. In general, we have developed a novel method for identifying such drug-induced protein changes that combines the labeling of proteins with reagents and subsequent protein separation and analysis by mass spectrometry. Specifically, as an example, the inventors used tryptophan labeling with 2-nitrobenzenesulfenyl chloride (NBS) with two-dimensional gel electrophoresis (2DE) / mass spectrometry (MS). Lysates from drug-treated and control samples are labeled with light and heavy NBS residues and then separated on a common 2DE gel. Under the method of the invention, the protein of interest is separated and isolated by a 2DE process prior to analysis by MS. Protein changes are identified by MS from the differential intensity of NBS peptide peak pairs.

  Using NBS / 2DE / MS, we profiled proteomic changes induced by tamoxifen (TAM) in estrogen receptor (ER) positive MCF-7 breast cancer cell lines. Of the 88 protein spots that changed significantly upon TAM treatment, 44 spots representing 23 distinct protein species were successfully identified with NBS-pairing peptides. Of these 23 TAM altered proteins, 16 (70%) have never been associated with TAM or ER activity. We have found that the NBS labeling procedure is reproducible both technically and biochemically. The changes in NBS / 2DE / MS showed good agreement with traditional differential protein quantification with 2DE, but there was a discrepancy mainly due to the simultaneous migration of separate proteins in normal 2DE gels. . To confirm that the NBS / 2DE / MS results were valid, we used immunoblotting to identify GRP78, CK19 and PA2G4 as authentic TAM-regulated proteins. In addition, in two independent breast cancer patient cohorts, we demonstrate that PA2G4 expression can serve as a novel prognostic factor for disease-free survival.

  Since PA2G4 has been identified as a reliable biomarker for breast cancer, its gene, gene transcript, RNA gene product, gene derivative, gene mutation, protein, protein derivative, protein variant and protein fragment should be Can be used according to. Any method known in the art can be used to qualitatively detect the presence of PA2G4 or to quantitatively measure the presence of PA2G4.

Gene Expression The nucleic acids of the invention can be expressed in vitro by DNA transfer into suitable host cells by methods known in the art. For example, the nucleic acid can be inserted into a recombinant expression vector. A variety of host-expression vector systems may be utilized to express the nucleic acids of the invention. These include microorganisms (eg, bacteria transformed with recombinant bacteriophage DNA, recombinant plasmid DNA or recombinant cosmid DNA expression vectors; yeast transformed with recombinant yeast expression vectors, etc.), and sets Examples include, but are not limited to, human cell lines infected with recombinant virus expression vectors or recombinant plasmid expression vectors. Isolation and purification of the recombinant polypeptide or fragment thereof can be performed by conventional means, such methods include preparative chromatography and immunological separation with monoclonal or polyclonal antibodies. .

  The invention also features methods for prognosticating, diagnosing, treating, and identifying therapeutic compounds for treating cell proliferation related abnormalities for cell proliferation related abnormalities.

  The prognostication method of the present invention is based on the expression of a biomarker in a patient-derived sample from a reference value obtained from one or more patients whose disease outcome is known, or from a tissue or cell whose benign or malignant is known. Comparing with the reference value obtained. Thereafter, the prognosis of these patients can be determined.

  The diagnostic methods of the present invention can be used to treat one or more of the PA2G4, GRP78 and CK19 genomic DNA levels in a sample prepared from a subject (ie, an animal or human) with a normal subject (ie, a cell proliferation-related abnormality). Or in a sample prepared from a subject not at risk of developing cell proliferation related abnormalities).

  For both prognostic and diagnostic methods, higher genomic DNA levels of PA2G4 indicate that the subject is suffering from or at risk of developing a cell proliferation-related abnormality. These methods can be used alone or in combination with other techniques for diagnosing cell proliferation related abnormalities in appropriate subjects and providing a prognosis for the outcome of the disease Can be used in

  Locus amplification can be detected by various methods known in the art. For example, locus copy number can be determined and compared by PCR amplification of genomic DNA prepared from test and control samples. Locus amplification can also be identified by Southern blot analysis. Fluorescence in situ hybridization (FISH) of DNA sequences to metaphase chromosome deployments further provides the exact chromosomal location of the DNA sequence present on the chromosome and the amount of DNA sequence present on the chromosome. Can be used.

  The present invention also reduces the genomic DNA level of PA2G4, modulates the expression of PA2G4 or PA2G4 mRNA or protein, or reduces the level of PA2G4 or PA2G4 mRNA or protein, or PA2G4 Methods are provided for identifying compounds (eg, proteins, peptides, peptidomimetics, peptoids, antibodies or small molecules) that reduce the level of PA2G4 interaction with other molecules that recognize. The resulting identified compounds can then be used, for example, to prevent and treat cell proliferation related abnormalities.

  Candidate compounds of the present invention can be obtained using any of a number of methods in combinatorial library methods known in the art. Such libraries include peptide libraries, peptoid libraries (libraries of molecules with novel non-peptide backbones that have peptide functionality but are resistant to enzymatic degradation); spatially Included are accessible parallel solid phase libraries or liquid phase libraries; synthetic libraries obtained by deconvolution or affinity chromatography separation; and “one bead one compound” libraries. See, for example, Lam (1997).

  Various examples of methods for synthesizing molecular libraries can be found in the art, eg, Gallop et al. (1994).

  The library of compounds can be a solution (eg, Houghton, 1992), or beads (Lam, 1991), chips (Fodor, 1993), bacteria (US Pat. No. 5,223,409), spores (US Pat. 223,409), plasmids (Cull et al., 1992) or phage (US Pat. No. 5,223,409).

  In certain systems, reduce the genomic DNA level of PA2G4, or regulate the expression of marker nucleotide sequences under the control of a promoter associated with PA2G4, or reduce the level of PA2G4 mRNA or protein, or In order to reduce the level of PA2G4 or to identify a compound that reduces the level of PA2G4, the system is contacted with a candidate compound and the genomic DNA level of PA2G4, expression of the marker nucleotide sequence, mRNA of PA2G4 or The level of protein, the level of PA2G4 interaction is evaluated against the case in the absence of the candidate compound. In cell lines, cells can contain amplified genomic DNA of PA2G4 (eg, cancer cells), can express PA2G4 in its natural state, eg, PA2G4 fused to a heterologous promoter. It can be modified to express a recombinant nucleic acid having the gene. If the level of PA2G4 genomic DNA is altered by the candidate compound, i.e. lower in the presence of the candidate compound than in its absence, or expression of the marker nucleotide sequence in the presence of the candidate compound is Unlike expression in the absence of a candidate compound, the candidate compound is identified as being useful for preventing and treating cell proliferation related abnormalities.

  The genomic DNA levels of PA2G4, GRP78 and CK19 can be determined by the methods described above and by any other method widely known in the art.

Gene Product Expression The expression of marker nucleotide sequences (PA2G4, GRP78 and CK19) can be revealed at either the mRNA level or the protein level. Various methods for measuring mRNA levels in tissue samples or body fluid samples are known in the art. To measure mRNA levels, cells can be lysed and the level of mRNA in the lysate, or the level of mRNA in RNA purified or semi-purified from the lysate, determined by any of a variety of methods Such methods include, but are not limited to, hybridization assays using detectably labeled DNA or RNA probes, quantitative or semi-quantitative RT-PCR using appropriate oligonucleotide primers Includes methodology. Alternatively, use a quantitative or semi-quantitative in situ hybridization assay, eg, a tissue section or non-lysed cell suspension, and a detectable (eg, fluorescent or enzymatic) labeled DNA or RNA probe Can be done. Additional methods for quantifying mRNA include RNA protection assays (RPA) and continuous analysis of gene expression (SAGE).

  While NBS / 2DE / MS methods have been described, other methods for measuring protein levels in tissue or body fluid samples are also known in the art. Many such methods use antibodies (eg, monoclonal or polyclonal antibodies) that specifically bind to the target protein. In such assays, the antibody itself or a secondary antibody that binds to the antibody can be detectably labeled. Alternatively, conjugating an antibody with biotin and then binding to detectably labeled avidin (polypeptide) can be used to detect its presence. Combinations of these methods familiar to those skilled in the art (including “multilayer sandwich” assays) can be used to increase the sensitivity of the methodology. Some of these protein measurement assays (eg, ELISA or Western blot) can be applied to cell lysates, and other protein measurement assays can be applied to histological sections or non-lysed cell suspensions. (Eg, immunohistochemical methods or fluorescence flow cytometry).

The method of measuring the amount of label depends on the nature of the label, and various methods are widely known in the art. Suitable labels include, but are not limited to, radionuclides (eg, ¹²⁵ I, ¹³¹ I, ³⁵ S, ³ H or ³² P), enzymes (eg, alkaline phosphatase, horseradish peroxidase, luciferase or β-galactosidase), fluorescent Components or fluorescent proteins (eg, fluorescein, rhodamine, phycoerythrin, GFP or BFP) or luminescent components (eg, Qdot ™ nanoparticles (supplied by Quantum Dot Corporation (Palo Alto, Calif.))) . Other applicable assays include quantitative immunoprecipitation assays or complement fixation assays.

  The level of PA2G4 can be revealed by any method known in the art, for example, by an in vitro binding assay, or by using a yeast hybrid system. The binding domain of PA2G4 can be identified, for example, by mutagenesis and used in screening assays.

[treatment]
The present invention further provides methods for preventing and treating cell proliferation related abnormalities. The subject to be treated can be identified, for example, by revealing the level of PA2G4 genomic DNA, DNA transcript or DNA product in a sample prepared from the subject by the methods described above. If the PA2G4 genomic DNA level is higher in a subject-derived sample than the PA2G4 genomic DNA level in a sample from a normal subject (control), the subject is a PA2G4 genomic DNA, DNA transcript or DNA product. Candidates for treatment with an effective amount of a compound that reduces the level of.

  In an in vivo method, a therapeutic composition (eg, a composition containing a compound identified as described above) is administered to a subject. In general, the compounds are suspended in a pharmaceutically acceptable carrier (eg, physiological saline) and administered by oral administration or intravenous infusion, or subcutaneous, intramuscular, subarachnoid, abdominal cavity. It is injected or implanted in the interior, rectum, vagina, nasal cavity, stomach, trachea or lung. The compounds can be delivered directly to the cancer tissue for cancer prevention and treatment.

  The dosage required will depend on the choice of route of administration; the nature of the formulation; the nature of the subject's illness; the subject's size, weight, surface area, age and gender; other drugs being administered; and the judgment of the attending physician . A suitable dosage is in the range of 0.01 mg / kg to 100.0 mg / kg. A wide range of changes in required dosage should be expected in view of the diversity of available compounds and the different efficiencies of the various routes of administration. For example, oral administration is expected to require a larger dosage than administration by intravenous injection. Various changes in these dosage levels can be adjusted using standard empirical routines for optimization as is well understood in the art. Encapsulation of the compound in a suitable delivery vehicle (eg, polymer microparticles or implantable devices) can increase delivery efficiency, particularly for oral delivery.

  Another way to achieve nucleic acid uptake is to use liposomes prepared by standard methods. This vehicle can be formulated alone in these delivery vehicles or can be formulated at the same time as the tissue-specific antibody. Alternatively, molecular conjugates composed of plasmids or other vectors conjugated to poly-L-lysine by electrostatic or covalent forces can be prepared. Poly-L-lysine binds to a ligand that can bind to receptors on target cells (Cristiano et al., 1995). Alternatively, tissue specific targeting can be achieved through the use of tissue specific transcriptional regulatory elements (TREs) known in the art. Delivery of “naked DNA” (ie, without a delivery vehicle) to an intramuscular, intradermal, or subcutaneous site is another means to achieve in vivo expression.

  In related polynucleotides (eg, expression vectors), a nucleic acid sequence encoding an antisense PA2G4 RNA is operably linked to a promoter or enhancer-promoter combination. Enhancers provide the specificity of expression with respect to time, location and level. Unlike promoters, enhancers can function when present at various distances from the transcription start site, provided that the promoter is present. Enhancers can also be present downstream of the transcription start site.

  Inhibition of gene expression can be achieved by the use of small inhibitory RNA sequences (siRNA). The expression of the PA2G4 gene can also be inhibited using RNA interference (RNAi). This is a technique for post-transcriptional gene silencing (“PTGS”) in which the activity of the target gene is specifically abolished by cognate double-stranded RNA (“dsRNA”). In many embodiments, it is a dsRNA of about 18 to 26 nucleotides (specifically 20 to 24 nucleotides, more specifically 21 to 23 nucleotides). For example, a 21 nucleotide sequence homologous to the target gene is introduced into the cell and a sequence specific decrease in gene activity is observed. RNA interference provides a mechanism for gene silencing at the RNA level. RNA interference provides an efficient and wide range of applicable methods for gene knockout as well as therapeutic purposes.

  The sequence capable of inhibiting gene expression by RNA interference can be of any desired length. For example, such a sequence can have at least 15, 20, 25 or more consecutive nucleotides. Such a sequence can be a dsRNA or any other type of polynucleotide, provided that the sequence can form a functional silencing complex to degrade the target mRNA transcript.

  In one embodiment, such a sequence consists of a short interfering RNA (siRNA) or comprises a short interfering RNA (siRNA). The siRNA can be, for example, a dsRNA having 19 to 25 nucleotides. siRNA can be produced endogenously by degradation of longer dsRNA molecules by an RNase III-related nuclease called Dicer. siRNA can also be introduced into cells exogenously or by transcription of expression constructs. Once formed, the siRNA and protein components are assembled into an endoribonuclease-containing complex known as an RNA-induced silencing complex (RISC). The unwinding of the siRNA by ATP generation activates the RISC, so that the RISC targets the complementary mRNA transcript by Watson-Crick base pairing, thereby cleaving and destroying the mRNA. mRNA cleavage occurs near the center of the region where the siRNA strands are bound. This sequence-specific mRNA degradation results in gene silencing.

The polynucleotide can be administered in a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are biologically compatible vehicles (eg, physiological saline or liposomes) that are suitable for administration to animals or humans. A preferred dosage for administering a polynucleotide is approximately 10 ⁶ to 10 ¹² copies of the polynucleotide molecule. This dose can be administered repeatedly as necessary. The route of administration can be any of the routes of administration indicated above.

Antibodies to PA2G4 (monoclonal or polyclonal antibodies) can be used to reduce the level of PA2G4 protein or to reduce the level of PA2G4 in a subject. The term “antibody” includes intact molecules as well as fragments thereof (eg, Fab, F (ab ′) ₂ and Fv, etc.) that are capable of binding to epitalk determinants present in PA2G4 protein. Methods for making monoclonal and polyclonal antibodies and fragments thereof are known in the art. See, for example, Harlow and Lane (1988), Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, New York).

  Other compounds that can be used to inhibit the expression of PA2G4 include peptides or polypeptides having an amino acid sequence at the C-terminus of PA2G4 protein.

  In addition, the present invention provides multiple subjects (eg, subjects with amplified PA2G4 genomic DNA expression or PA2G4 protein expression) suffering from cell proliferation related abnormalities; effective amounts of PA2G4 inhibitors Then administering an effective amount of a nucleotide or nucleoside analog (eg, gemcitabine) to each subject at each unique time point; and selecting the optimal time point at which cell growth related abnormalities are maximally inhibited Thus, a method for developing a technique for treating cell proliferation related abnormalities is provided. Once the optimal time point has been identified, this approach can be used to treat cell proliferation related abnormalities in appropriate subjects.

  The following specific examples are merely illustrative and should not be construed as limiting the remainder of the disclosure in any way. Without further details, it is contemplated that one skilled in the art can fully utilize the present invention based on the description herein. All publications cited herein are hereby incorporated by reference in their entirety.

  While the present invention has been described generally above, the present invention is more readily understood by reference to the following examples, which are provided by way of illustration of the invention and are not intended to be limiting of the invention. Is done.

[Materials and methods]
Example 1-Chemical Reagents and Materials MCF-7 breast cancer cells were obtained from American Type Culture Collection (Manassas, VA, USA). Tamoxifen (TAM), chicken ovalbumin, streptomycin, L-glutamine, penicillin, 4-hydroxycinnamic acid (CHCA), 3-hydroxy-4-nitrobenzoic acid (HNBA), 2,5-dihydroxybenzoic acid (DHB) Protease inhibitor cocktail, phenylmethylsulfonyl fluoride (PMSF), sodium deoxycholate and sodium orthovanadate were obtained from Sigma (St Louis, MO, USA). Sulphenyl halide drugs and 2-nitrobenzenesulfenyl chloride (NBS, heavy and light forms) were obtained from Shimazu Biotech (Kyoto, Japan). Tris (2-carboxyethyl) phosphine (TCEP) hydrochloride was obtained from Pierce (Rockford, IL, USA). Deep Purple fluorescent dye, dithiothreitol (DTT) and horseradish peroxidase conjugated secondary antibody were obtained from GE HealthCare (Uppsala, Sweden). Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) and polyvinylidene difluoride membrane (PVDF) were obtained from Bio-Rad (Hercules, CA, USA). C18 Zip Tip was obtained from Millipore (Bedford, MA, USA). Sequencing standard modified trypsin was obtained from Promega (Madison, Wis., USA). Dulbecco's Modified Eagle Medium 5 (DMEM) was obtained from Gibco (Grand Island, NY, USA). Dextran activated carbon treated fetal bovine serum (FBS) was obtained from HyClone Laboratories (Pittsburg, PA, USA). Anti-vinculin antibody and anti-PA2G4 antibody were obtained from Upstate Biotechnology (VA, USA). Anti-cytokeratin 19 antibody and anti-GRP78 antibody were obtained from Santa Cruz Biotechnology (Santa Cruz Inc, CA, USA). Trizol and reverse transcriptase were obtained from Invitrogen (CA, USA). Oligonucleotide primers used in cDNA synthesis and RT-PCR were synthesized from Sigma Proligo (Sigma, Singapore).

Example 2-Cell culture and TAM treatment of MCF-7 cells MCF-7 breast cancer cells were cultured in DMEM supplemented with 10% FBS, 100 U / mL penicillin, 100 U / mL streptomycin and 2 mM L-glutamine. did. Prior to TAM treatment, cells were washed with PBS and maintained in phenol red-free DMEM containing 5% dextran activated carbon treated FBS for 24 hours. Cells were then treated with 10 μM TAM at 40-50% confluence and collected at 24 and 48 hours. As a control, sister cultures were treated with an equal volume of vehicle (0.1% ethanol).

[NBS / 2DE / MS]
Example 3 Protein Extraction and NBS Labeling TAM treated MCF-7 cells and control MCF-7 cells were treated with 2DE lysis buffer (7M urea, 2M thiourea, 4% CHAPS, 1 mM PMSF, Lysed in 50 μg / mL Dnase I, 50 μg / mL Rnase I and protease inhibitor cocktail), the extracted protein was buffer exchanged to 8M urea / 5 mM EDTA using 2D sample cleanup kit (Bio-Rad). . Protein was quantified by the Bradford method (Bradford, 1976) and 100 μg of each protein lysate was shaken and a 20-fold molar excess of 12C (light)-or 13C (heavy) -2-nitrobenzenesulfenyl chloride in 25 μL acetic acid. Labeled in the dark with (NBS). In NBS labeling, 12C or 13C NBS components are selectively introduced into tryptophan residues, which results in a mass difference of 6 Da between light and heavy NBS-labeled tryptophan peptides. Mass spectrometry (MS) can then be used to determine the intensity ratio of the peptide peak pairs, resulting in the relative quantification of each light and heavy population (FIG. 1A) (Kuyama) Et al., 2003).

  After labeling, the two protein mixtures were combined and the unlabeled NBS component was removed by a Sephadex LH-20 column (GE HealthCare). Of note, we note that the use of Sephadex LH-20 columns to remove excess NBS labeling does not significantly interfere with protein recovery (see FIG. 2 in Matsuo et al. (2006)) and samples It has previously been shown that protein recovery does not change whether or not is denatured by either urea or GdnHcl. Samples were dried in a vacuum concentrator, resuspended in 50 μL of 50 mM Tris buffer (pH 8.5) containing 0.1% SDS, reduced with 4 mM TCEP for 30 minutes at 37 ° C., then 10 mM Alkylation with iodoacetamide was performed in the dark at room temperature for 45 minutes. The lysate was then buffer exchanged into 2DE lysis buffer (7M urea, 2M thiourea and 4% CHAPS).

Example 4-Two Dimensional Gel Electrophoresis Prior to the first dimension separation, each IPG strip (18 cm, pH 4-7, GE HealthCare) was transferred to 340 μL of rehydration buffer (7 M urea, 2 M thiourea, Rehydrated with 4% CHAPS, 0.5% IPG buffer (pH 4-7) and 20 mM DTT) for 8 hours. The first dimension separation was performed with the IPGphor IEF system (GE HealthCare). 100 μg protein lysate, 20 mM DTT and 0.5% IPG buffer (pH 4-7) in 80 μL lysis buffer were applied to the anode side by cup loading. The strips were then focused at 20 ° C. for 3 hours at 200 V, 1 hour at 500 V, 7 hours from 500 V to 8000 V, and then 8000 V until 67,000 Vh was reached. After focusing, the IPG strip was equilibrated in two steps: (1) 15 min in 50 mM Tris-HCl (pH 8.8), 6M urea, 30% glycerol, 2% SDS, 1% DTT and a trace amount of bromophenol blue; (2) 15 minutes in a similar solution containing 2.5% iodoacetamide instead of DTT.

  Once equilibrated, the strips were transferred to a 10% uniform concentration polyacrylamide gel (18 cm × 20 cm × 0.75 mm). The IPG gel was then sealed with 0.5% (w / v) agarose in running buffer (25 mM Tris-HCl (pH 8.3), 192 mM glycine and 0.1% SDS). Subsequently, the second dimension separation was performed using the Protean II XL system (Bio-Rad). SDS-PAGE was performed at 8 ° C./gel for 1 hour at 17 ° C., and then at a constant current of 24 mA / gel until the dye tip reached the bottom of the gel. The gel was then labeled with Deep Purple fluorescent dye according to the manufacturer's protocol (GE HealthCare). Gels were digitized using FX Molecular Imager (Bio-Rad) and image analysis was performed using PDQuest 7.3 image analysis software (Bio-Rad).

Example 5-Protein Identification by Mass Spectrometry Gel spots of fluorescently labeled proteins were excised and in-gel trypsin digestion was performed using an Xcise robotic system (Shimazu Biotech, Kyoto, Japan). In the automatic operation, before digestion, the gel piece was washed twice with water, contracted with 100% acetonitrile (ACN), and dried. 30 μL trypsin (3.33 ng / μL in 50 mM ammonium bicarbonate, pH 8.5) was added to each gel plug and shaken and performed overnight at 30 ° C. with shaking. The sample was then cleaned and concentrated with C18 Zip Tip.

  Finally, the peptide mixture was eluted on a MALDI sample plate with 1 μL of 50% ACN / 0.5% TFA prior to MS analysis and 10 mg / mL α-cyano-4-hydroxycinnamic acid (CHCA). ), 2,5-dihydroxybenzoic acid (DHB) and 3-hydroxy-4-nitrobenzoic acid (HNBA) were mixed with 1 μL of matrix containing 50% ACN / 0.5% TFA. This is a novel matrix formulation based on Matsuo et al. (2006) instead of the usual CHCA / DHB matrix (Laugesen and Roepstorff, 2003). MALDI-TOF MS analysis was performed using an AXIMA-CFRplus mass spectrometer (Shimazu Corporation (Kyoto, Japan) and Kratos Analytical (Manchester, UK)) with the following settings: nitrogen laser (337 nm); Reflectron mode; positive ion detection. The acceleration potential was set to 35 kV using a gridless electrode. MALDI-TOF MS spectra were acquired in manual mode from 800 (m / z) to 3000 (m / z) and calibrated by internal reference with two trypsin autolysis peaks (m / z, 842.51 and 2211.10) did. Peak lists from the peptide mass mapping spectra were automatically retrieved and sent to the in-house Mascot server (Matrix Science, London, UK) and searched against the UniProt and NCBInr databases.

  To help search for NBS-labeled peptides, two correction values, 12C NBS (+153 Da) and 13C NBS (+159 Da), were added to the Mascot server as variable corrections. NBS-labeled paired peaks are manually selected from the TOF MS spectrum and relative quantification is calculated using the Kompact software (Shimazu / Kratos) to calculate the volume ratio of each NBS-labeled peak-pair. Achieved by. Peptide sequencing with MS / MS using an AXIMA-QIT MALDI quadrupole ion trap time-of-flight mass spectrometer (Shimazu Corporation (Kyoto, Japan) and Kratos Analytical (Manchester, UK)) equipped with a 337 nm nitrogen laser I went. One microliter trypsin digested sample was placed on a MALDI plate and mixed with 1 μL DHB (10 mg / mL in 50% ACN / 0.5% TFA). The TOF spectrum was calibrated with an external standard using fullerite pre-placed on the MALDI sample stage. All spectra were acquired with standard instrument settings for optimal transmission at medium and high masses. Data acquisition and data processing were performed using Kompact software (Shimazu / Kratos).

Example 6 Statistical Analysis To examine biological and experimental variability associated with NBS / 2DE / MS and to compare the amount of protein between NBS / 2DE / MS analysis and conventional 2DE analysis To do so, we applied a series of Pearson correlation tests to assess the similarity of these two data sets under study. To determine the significance of any accepted correlation value, the bootstrap permutation test replaces the indices of these two data sets being compared and recalculates the correlation coefficient for the randomized data set Was done by. For correlation tests, in order to determine the significance of any observed correlation value, a bootstrap permutation test is used to reverse the order of the proteins in these two data sets being compared, and This was done by recalculating the correlation coefficient. This procedure was repeated 10,000 times, and the frequency with which the randomized coefficient exceeded the observed value was computed and reflected as an empirical p-value.

Example 7-Western Blotting Analysis Whole cell lysates were treated with TAM treated cells and control cells in RIPA buffer (0.15 M NaCl, 50 mM Tris- containing 1 mM PMSF and 1 mM sodium orthovanadate. Prepared by dissolving in HCl (pH 7.4), 1 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS). Lysates were quantified with Bradford reagent using BSA as a standard. An equal amount of cell lysate (50 μg) was run on a 12% SDS-polyacrylamide gel and electroblotted onto a PVDF membrane. Blots were probed with anti-vinculin antibody, anti-cytokeratin 19 antibody and anti-GRP78 antibody, respectively. After incubation of the membrane with a horseradish peroxidase conjugated secondary antibody, the reactivity was visualized on X-ray film (Kodak) using a chemiluminescence detection kit (Bio-Rad).

Example 8-Semi-quantitative PCR analysis For cDNA synthesis and RT-PCR, total RNA was extracted from TAM-treated MCF-7 cells using Trizol reagent. RNA was quantified and an equal amount of RNA sample was electrophoresed on a 2% agarose gel to confirm normalization. Equal volumes of vehicle-treated and TAM-treated RNA samples were reverse transcribed with Superscript II reverse transcriptase using oligo dT primers in the conditions suggested by the manufacturer. RT-PCR was performed from cDNA using PA2G4 specific primers and β-actin specific primers. The sequences of the oligos used in this study are: PA2G4-RTF: CACGTGCCCTTCTCCATGGAG (SEQ ID NO: 58); PA2G4-RTR: ACTCTGGAGGAGGGCCTTA (SEQ ID NO: 59); β-actin-RTF: CGGGAAATCGTGCGTGAGATT-SEQ RTR: TGATCTCCTCTCTGCATCCCTGT (SEQ ID NO: 61).

Example 9-Quantitative NBS / 2DE / MS analysis of TAM-treated MCF-7 cells Subsequently, we performed the NBS / 2DE / MS method on MCF-7 breast cancer cells treated with either TAM or vehicle. Applied to complex biological samples by performing profiling. Initially, MCF-7 samples were analyzed using a conventional 2DE platform to provide a basis for comparison. In this conventional 2DE analysis, triplicate gels for TAM-treated MCF-7 cells and vehicle-treated MCF-7 cells were generated and visualized by Deep Purple fluorescence labeling, using PDQuest, and fluorescence label intensity. Identified the differences in The resulting 2DE gels showed very similar protein patterns for samples treated with either TAM or vehicle, with 85% -95% concordance across approximately 340 protein spots in each gel. . Qualitatively, one protein spot was characteristic in TAM-treated cells, while seven were characteristic in vehicle-treated cells. At the quantitative level, 27 protein spots and 47 protein spots showed more than a 2-fold increase and decrease in intensity, respectively, when treated with TAM (FIG. 11 and Table 3). The same protein lysate from TAM treated cells and control cells was then also subjected to NBS / 2DE / MS analysis.

  In Table 1 below, 44 identified NBS protein spots represent 23 different protein species. The ratio of 13C / 12C was calculated based on NBS versus peak intensity. Three proteins were identified with two or more pairs of NBS peptides. For them, the 13C / 12C ratio was the average of all ratios of the same protein to peptide. To examine the technical reproducibility, protein lysates from the exact same batch of TAM-treated MCF-7 cells and vehicle-treated MCF-7 cells were relabeled with NBS, separated on 2DE gels, 13C / 12C It was quantified again based on the ratio. When derived by conventional 2DE gel image analysis, 88 spots were excised from NBS-labeled 2DE gels, of which 58 protein spots were identified with confidence by peptide mass fingerprinting. Spots 1 to 44 were proteins detected by the NBS-labeled peptide peak. Among them, 44 protein spots were detected along with NBS-labeled peptide pairs and these were quantified by calculating the peptide volume ratio of 13C / 12C.

  In Table 1, some protein spots had more than one NBS peptide pair. This indicates that multiple tryptophan-containing peptides are present in these proteins. For these proteins, the final NBS ratio was calculated by averaging the ratio of all NBS to peptides related to the same protein spot. In total, 44 identified NBS-labeled protein spots represented 23 different protein species (Table 1). In this case, 10 species were represented by multiple isoforms / spots on the 2DE gel, including K1C18_HUMAN (CK18). When NBS ratio analysis was used, 20 protein spots showed more than a 2-fold intensity decrease when treated with TAM, 1 spot showed more than 2-fold increase, and the remaining 23 spots were There was less than a 2-fold change between TAM and vehicle.

  44 identified NBS protein spots representing 23 different protein species. The ratio of 13C / 12C was calculated based on NBS versus peak intensity (13C / 12C (1) column). Three proteins were identified with two or more pairs of NBS peptides. For these proteins, the 13C / 12C ratio was the average of all ratios of the same protein to peptide. To examine technical reproducibility, protein lysates from the exact same batch of TAM-treated MCF-7 cells and vehicle-treated MCF-7 cells were again labeled with NBS, separated on a 2DE gel, and 13C / Quantification was performed again based on the ratio of 12C (column of 13C / 12C (2)). The average and SD values are based on the integrated values from the 13C / 12C (1) and 13C / 12C (2) columns.

  Table 2 (below): 88 spots were excised from an NBS-labeled 2DE gel when derived by conventional 2DE gel image analysis. A total of 58 protein spots were identified with confidence by peptide mass fingerprinting (FIG. 4 shows an NBS / 2DE reference map with identified protein spots). 44 of them contained NBS peptide pairs (Table 2). Some protein spots had more than one NBS peptide pair. This indicates that multiple tryptophan-containing peptides are present in these proteins. For these proteins, the final NBS ratio was calculated by averaging the ratio of all NBS to forming peptides associated with the same protein spot. When NBS ratio analysis was used, 21 protein spots out of 44 showed more than a 2-fold intensity change when treated with TAM, and 23 spots out of the remaining 44 were between TAM and the vehicle. The change was less than twice. In comparison, for the conventional 2DE analysis, 17 out of 44 of these spots were more than doubled while 27 of the remaining 44 were less than doubled. The 44 identified NBS-labeled protein spots represented 23 different protein species (Table 2). In this case, 10 species were represented by multiple isoforms / spots on the 2DE gel, including K1C18_HUMAN (CK18).

Example 10-Validation of differentially expressed proteins by immunoblotting Finally, to confirm the validity of the quantitative information obtained from NBS / 2DE / MS, we performed immunoblotting experiments on two representative proteins. Went. Total cell lysates from independent batches of MCF-7 cells treated with TAM or vehicle for 24 or 48 hours were separated on a 1D gel and immunoblotted with protein specific antibodies (FIG. 10). The 78 kDa glucose regulatory protein (GRP78) (multidrug resistance protein) had four isoforms shown in the NBS / 2DE map (Spot 15 to Spot 18 in FIG. 4). Based on the NBS (13C / 12C) ratio and 2DE quantification results, expression of all four isoforms was expected to increase after 48 hours of TAM treatment (Table 1 and FIG. 5). ). Immunoblotting with anti-GRP78 confirmed the up-regulation of this protein even after 24 hours after TAM treatment, and this increased expression was stable up to 48 hours (FIG. 10). Similarly, 5 CK19 isoforms were identified by 2DE analysis (Spot 19 to Spot 23 in FIG. 4). Based on conventional 2DE image analysis, all but spot 19 showed a significant increase (> 2x) when 48 hours TAM treatment was performed. However, based on NBS / 2DE / MS quantification, all of the CK19 isoforms showed clear down-regulation when treated with TAM (Spot 19 to Spot 23 in FIG. 5). In immunoblotting with anti-CK-19 antibody, when TAM treatment was performed for 48 hours, down-regulation of this protein was confirmed without any doubt (FIG. 10). This data shows that NBS / 2DE based protein quantification methods are likely to provide more accurate quantitative information about individual proteins compared to 2DE-only quantification techniques.

[Comparison of 2DE analysis lines and use of PA2G4 as a diagnostic and prognostic indicator in breast cancer]
Example 11-Proteomics of PA2G4 in breast cancer cells. a) 2DE analysis of two breast cancer cell lines (MCF-7 and HCC-38) and CRL cell line showed that PA2G4 was overexpressed in the ER + cell line but not in the ER- cell line.

  When compared to the CRL cell line, PA2G4 expression showed no significant difference in HCC-38, but a significant difference in MCF-7 (Table 3). This is consistent with the findings of Charpentier et al. (2000).

Example 12-PA2G4 as a prognostic marker for breast cancer
b) Overexpression of PA2G4 in MCF-7 cells can be suppressed by tamoxifen treatment. When NBS analysis was used, a 5-fold decrease was found, and when using 2DE analysis, a 3-fold decrease was found.

  To elucidate the link between our study on breast cancer and clinical outcome, we focused on PA2G4, which was first identified as an ERBB3 receptor interacting protein. We performed 24 immunoblotting experiments to confirm the downregulation of PA2G4 protein in TAM treated MCF7 cells. As shown in FIG. 10b, exposure of MCF7 cells to TAM resulted in less PA2G4 protein but significant down-regulation was induced after 24 hours, which lasted up to 48 hours. In independent experiments, we also observed that PA2G4 protein expression was greater in MCF-7 (ER +) than in the HCC-38 (ER-) and CCD-1059sk (ER-) breast cell lines. It has been found to be more than twice as large.

  Subsequently, we performed a series of semi-quantitative RT-PCR experiments and found that PA2G4 mRNA was clearly down-regulated by TAM exposure at both 24 and 48 hours (FIG. 10b). When considering this transcriptional regulation, we then performed data mining on two independent microarray datasets of ER + primary tumors. The first set (GIS; Miller et al., 2005) consisted of data from 201 ER + breast cancer patients, in which 67 patients received only adjuvant hormone treatment after surgery. The second set (Oxford; Sotriou et al., 2006) consisted of data from 65 ER + patients, in which 33 patients received TAM only and the remaining patients did not receive treatment. By performing univariate statistical analysis, we found that PA2G4 transcript expression resulted in a very significant correlation with disease-free survival in both datasets (p-values of 1.75 × 10-5 (GIS) and We found that patients with tumors expressing high PA2G4 show worse clinical results (Table 4A).

Table 4. Univariate and multivariate analysis of PA2G4 as a survival-related gene in ER + breast cancer. Significant associations (p <0.05) are highlighted in bold.

  A significant association between PA2G4 expression and survival was also observed in both datasets when univariate analysis was limited to only such patients receiving adjuvant hormonal treatment (The p values are 0.002 (GIS) and 0.008 (Oxford), respectively; Table 4a). We then tested whether PA2G4 expression could behave as an independent prognostic factor in comparison with other clinical variables such as tumor grade, patient age and tumor size. In this multivariate analysis, PA2G4 expression still retains its prognostic significance in both patient cohorts (p-values are 0.001 (GIS) and 0.04 (Oxford, respectively)), as well as Also retained in the GIS cohort of patients receiving adjunct hormone treatment (p = 0.005) (Table 4b). Thus, in two independent microarray datasets of ER + breast cancer, high PA2G4 expression in primary tumors is associated with reduced disease-free survival compared to patients with tumors that express low PA2G4. These results indicate that PA2G4 is a novel survival-related breast cancer gene and is suitable for use as a prognostic biomarker.

Example 13-Antibodies to PA2G4 Suitable antibodies to PA2G4 protein are available from commercial sources, and PA2G4 is detected and / or quantified in any immunological binding / hybridization reaction known in the art. Can be used to For example, a polyclonal antibody of PA2G4 can be obtained from Abnova Corporation (Taiwan) (product number H0000005036-A01). This is a murine polyclonal antibody raised against a partially recombinant PA2G4 immunogen. Alternatively, another example is an anti-Ebp-1 polyclonal antibody raised from rabbits (Product No. 07-397) available from Upstate (USA).

Example 14-Suitable recombinant expression vector for PA2G4 One skilled in the art can select a suitable vector and insert the PA2G4 gene sequence into the vector for subsequent expression of the gene. Regarding PA2G4, a vector into which PA2G4 is inserted is commercially available. For example, Origen (USA) has the PA2G4 sequence in its pCMV6-XL6 vector as product number SC103017.

Example 12-Use of PA2G4 in Diagnosis The present invention discloses the differential expression of PA2G4 gene and PA2G4 protein in ER + breast cancer cells and ER + breast cancer patients, and the inhibitory effect of tamoxifen (TAM) on its expression. Based on this finding, the present invention provides a method for diagnosing or prognosing ER + breast cancer disease in a subject and a method for determining whether a subject is at increased risk of developing breast cancer disease. I will provide a. Furthermore, the present invention provides therapeutic and prophylactic methods for treating or preventing breast cancer disease using the PA2G4 gene and its corresponding gene product.

  For diagnostic applications, anti-human PA2G4 antibodies should be used to analyze (detect and measure) this protein in human samples (eg, serum, nipple aspirate, extracellular fluid and primary tumor tissue). Can do. A PA2G4 expression level higher than that derived from a reference value obtained from a control (eg, a patient not diagnosed with breast cancer or suffering from breast cancer) indicates the potential for breast cancer.

Example 15-Use of PA2G4 to monitor therapy Our observations on the relationship between PA2G4 gene / protein expression and the inhibitory effect of TAM on said molecular expression, and survival data in two cohorts of breast cancer patients Based on research, we believe that the PA2G4 gene / protein has potential applications for monitoring breast cancer treatment. For further study, we use siRNA for gene silencing to observe physiological changes in ER + cells (eg, MCF-7) following siRNA transfection. In that case we can assess the role of the PA2G4 gene in ER + cell survival and whether we can suppress ER + cancer cells by specifically inhibiting the PA2G4 gene Can be revealed. Such assays are capable of dose-dependent temporal response studies and have specific application to serum and other body fluid samples. The results can indicate the feasibility of using PA2G4 to monitor treatment in breast cancer patients.

Example 16-Therapeutic use of PA2G4 A molecule for treating cell proliferation abnormalities (eg breast cancer etc.) is prepared using the PA2G4 gene sequence (SEQ ID NO: 1) or PA2G4 protein sequence (SEQ ID NO: 2). Can do. One skilled in the art will generate nucleic acids complementary to the PA2G4 gene or mRNA (eg, siRNA, etc.) by any method known in the art to inhibit or reduce mRNA translation. can do. Similarly, antibodies that are based on PA2G4 protein (such as the antibody shown in Example 10) bind to PA2G4 protein and are therefore known in the art to generate antibodies that inactivate the action of PA2G4 protein. It can be triggered by any method that is used. Such therapeutic molecules can be mixed with suitable excipients, vehicles or carriers and administered to diseased tissues or cells to obtain the desired therapeutic effect. Specifically, the desired therapeutic effect is to reduce or reduce the expression of PA2G4 gene and / or protein.

Kit Example 17-Kit The present invention also provides a kit comprising at least one biomarker that is complementary or hybridizable to the PA2G4 gene, gene transcripts, gene products, variations or fragments thereof. Such complementary or hybridizable biomarkers include a nucleic acid probe that recognizes and binds to the PA2G4 gene or gene product or fragment or variation thereof, and recognizes and binds to the PA2G4 gene product or fragment thereof. Antibodies that bind are included. As long as sufficient homology exists to allow recognition of the gene or protein by complementary biomarkers, the gene can be wild type or variant thereof and the protein can be wild type or variant thereof It is. Complementary or hybridizable biomolecules can be labeled and thus for prognostic evaluation of cell proliferative diseases (predicting susceptibility to cell proliferative diseases) or for diagnosis of cell proliferative diseases Can be used to indicate the severity of a disease state, or to monitor the efficacy of a series of treatments.

Example 18-Other Biomarkers for Breast Cancer In this study, we have demonstrated another TAM modulation that has been shown to be a useful serum marker of apoptotic epithelium in patients with sepsis (de Graauw et al., 2005). A protein (CK18 neoepitope M30) was found. During apoptosis, DNA fragmentation, nuclear condensation and CK18 cleavage are known events, and a neoepitope in CK18, called the M30 neoantigen, becomes available during the early caspase cleavage event. The observed TAM-mediated down-regulation of CK18 indicates that measurement of CK18 down-regulation is useful in TAM-treated patients as a measure of drug responsiveness. Of note, even if TAM is the first hormonal treatment for breast cancer, the major detrimental side effect of TAM treatment is unwanted endometrial proliferation. As such, downregulation of CK18 indicates a predisposition to breast cancer, and CK18 is useful as a biomarker for breast cancer.

  Interestingly, previous reports on TAM-mediated changes in the Ishikawa endometrial adenocarcinoma cell line using 2DE showed a significant increase in CK18 expression (Shah et al., 2004). This is the opposite of our observation in breast cancer cells. Current observations on selective estrogen receptor modulator (SERM) -mediated down-regulation of CK18 in the MCF-7 cell line and the exact opposite observation in the endometrial cancer cell line indicate that CK18 is important for SERMs. May be a unique tissue-specific target. Finally, GRP78 is another protein identified by NBS quantification as being TAM regulated.

  GRP78 is a known drug resistance effector and also a stress response chaperone. Lung cancer patients and neuroblastoma patients positive for GRP78 expression tended to show a better prognosis and improved survival (Uramoto et al., 2005). The observed upregulation of GRP78 in TAM-treated MCF-7 cells represents an immediate stress response to drug treatment, and this upregulation can also link cell stress to the cell death program ( Rao et al., 2002; Ding et al., 2004). This is supported by a concomitant up-regulation of another ER stress gene (HERP) at the mRNA level during TAM treatment.

  Two independently validated proteins, GRP78 and CK19, are also found to be genuine up-regulated and down-regulated proteins during TAM treatment. The results show that NBS / 2DE / MS is a more reliable method for cellular protein quantification than the conventional 2DE method.

  Various biomarkers of breast cancer were discovered from integrated proteome and genome studies, and their effectiveness was confirmed using breast tissue microarrays. A breast tissue microarray was provided and reviewed by only one pathologist to minimize bias (Manuel Salto-Tellez: associate professor, Department of Pathology; Senior Research Institute, Oncology Research Institute; (Consultant Pathology, Clinical Director, Molecular Diagnostic Oncology Center, NUH, Singapore).

Example 19-Tissue microarray analysis Methods Optimization of IHC (immunohistochemical) staining was performed on breast tissue microarrays with the aim of optimizing IHC staining conditions for PA2G4 antibody (Ab). Four different antigen retrieval methods were applied to positive control cell blocks using different concentrations of primary antibody. Dilutions of 1:50, 1: 100, 1: 200 and 1: 400 (ratio based on volume) were tested.

As a positive control, the present inventors used paraffin-embedded cell blocks, and determined the intracellular location of the antigen by Western blotting on the fractionated protein extract. To make the cell block, MCF7 breast cancer cells were cultured in 75 mL flasks. When confluent, the cells were trypsinized and centrifuged into a cell pellet with a thickness of 5 mm or less. Immediately, the cell pellet was incubated with formalin for 20 minutes, followed by paraffin embedding.
Stained positive control tissue slides were examined by a pathologist after optimization. Optimal conditions (including specific antigen retrieval methods and specific primary antibody dilutions) were determined after hearing the pathologist's advice and applied to the breast tissue microarray.

Protocol for IHC staining solution:
Citric acid (pH 6.0) buffer 10.5 g of citric acid Adjust to pH 6.0 with 2M NaOH (approximately 65 mL)
Bring to 5 L with deionized water (add citric acid if pH is high, add NaOH if pH is low)
Tris-EDTA (pH 9.0) buffer 12 g Tris base 1 g EDTA
Make up to 500 mL with deionized water Adjust to pH 9 with 0.2 M HCl DAKO (pH 6.0) buffer 60 ml Dako (10 ×) (Cat. S2369) Target recovery, make up to 600 mL with deionized water.
DAKO (pH 9.0) buffer 60 ml Dako (10x) (Cat. S2367) Target recovery, make up to 600 mL with deionized water.
TBS wash buffer (pH 7.6) 10x
0.5M Tris 60.6g
9 (wt / v)% NaCl 90g
Bring to 1 L with deionized water and adjust to pH 7.6 by adding HCl.

II. Deparaffinization Prior to deparaffinization, the slides in the array must be kept at room temperature for 60 minutes or heated in an oven at 60 ° C. in a horizontal position for 20 minutes. Align the slides in a metal tray.
1. Immerse slides in xylene for 5 minutes and repeat once with fresh xylene for 5 minutes (xylene is toxic).
2. Immerse the slides in 100% ethanol for 5 minutes.
3. The slide is immersed in 95 (v / v)% ethanol / H 2 O for 5 minutes.
4). The slide is immersed in 70 (v / v)% ethanol / H2O for 5 minutes.
5. Place slides in running water for cleaning.

III. Antigen recovery Method A. Citrate buffer (heated in high pressure pot)
1.2 L of citrate buffer is boiled in a stainless steel pressure cooker for 10-15 minutes.
2. When the buffer has boiled, place the slide vertically into the pot and close the lid tightly. After the two buttons on the lid have lifted, start timing 3 minutes (do not let the slide touch the bottom of the pan directly).
3.3 After 3 minutes, remove the pot and cool under running water in the sink. The pressure can be released by turning the knob. After releasing the pressure, open the lid and place the slide under running water to cool.

Method B. Tris-EDTA buffer (heated in microwave)
1. Pour 600 ml of buffer into a plastic jar.
2. Align slides in plastic trays and transfer to buffer.
3. Wrap the jar with plastic film and make several holes at the top.
4). Place the jar in the microwave. Set the output to 5 (10 levels of 5 outputs at medium level) and set the time to 25 minutes (buffer is milky, not clear).
5. Remove the jar and place it under running water in the sink. The solution can become clear again.
6). After cooling, remove the slide into a container with water.
Method C. DAKO (pH 6.0) buffer (method as in B.)
Method D. DAKO (pH 9.0) buffer (method as in B.)

IV. Immunostaining 1. The slide is gently shaken to dry and a pen (DAKO, S2002) is used to draw around the area of tissue. A circle drawn by a pen around the tissue provides a barrier to liquid (eg, antibody solution, wash buffer, etc.).
2. The slide is lightly shaken to dry, and a blocking solution (DAKO, S2023) is dropped into the tissue. Incubate for 10 minutes.
Make sure that the solution is free of bubbles during the incubation period.
3. Remove the liquid from the slide and rinse with deionized water. Place slide in rack and wash under running water for 5 minutes.
4). Place the slide horizontally in a plastic tray and pour TBS for 5 minutes.
5. The primary Ab is diluted with antibody diluent (DAKO, S0809).
6). Remove the liquid from the slide and dab the slide. Add 200 uL of diluted Ab on top of the tissue and incubate for 30 minutes (do not foam).
7). Pull the slide up and fill with TBS. Remove the liquid and shake gently.
8). Pour TBS onto the slide and wait 5 minutes. During this period, additional TBS is sometimes added to avoid the slides from drying out.
9. Remove the liquid from the slide and dab the slide with a hand towel. Remove the white bottle (Dako REAL ™ EnVision ™ HRP rabbit / mouse) from the Envision Kit (DAKO, S5007), drop a few drops and cover the tissue for 30 minutes.
10. Remove the liquid from the slide and wash the slide with TBS. Pour TBS onto the slide and wait 5 minutes.
11.1 ml of substrate buffer is mixed with 20 μL of DAB (3,3′-diaminobenzidine: toxicity). Mix them before use. Both substrate buffer and DAB are included in the Envision kit (DAKO, S5007).
12 Remove the solution from the slide with TBS, dab to dry, and drop the DAB mixture onto the slide and incubate for 10 minutes.
13. Wash slides with deionized water.
14 Align slides on H / E rack and place under running water for 5 minutes.
15. The slide is placed in hematoxylin for 2 minutes until the tissue is stained blue, and the slide is placed in PBS (phosphate buffered saline) for 10 seconds. Wash slides for 10 minutes under running water.
16. Slides are dehydrated in a series of solutions: 70% ethanol, 95% ethanol, 100% ethanol (4 times), xylene (2 times). 1 minute each.
17. Place slide on mounting device.

Results PA2G4 IHC staining on the tumor tissue microarray showed 96.5% (ie 83 out of 86 tumor tissues) positive staining (colored brown). Among such positively stained tumor tissues, 40.7% (ie 35/86) tumor tissues were grade 3 positive staining; 36% (ie 31/86) ) Tumor grade was positive grade 2 staining; 20% (ie 17 out of 86) tumor tissues were grade 1 positive staining. Specifically, the observation result of IHC staining for PA2G4 with respect to a normal tissue is shown in FIG. 13A, and the inset shows an enlarged portion of the normal tissue.

On the other hand, all that showed positive staining in normal tissue microarrays were grade 1 positive staining (very small amount faintly browned). Specifically, the observation result of IHC staining for PA2G4 on the tumor tissue is shown in FIG. 13 (B), and the inset shows the enlarged portion of the tumor tissue.
This protein can be considered a good biomarker.

  FIG. 14 is the result of Western blotting on the fractionated protein extract for PA2G4. From left to right lanes, the protein extracts are cytosolic protein extract (i), membrane / organelle protein extract (ii), and nuclear protein extract (iii). As the picture shows, protein expression for PA2G4 is in both the cytoplasm and nucleus, but higher expression is present in the cytoplasm.

Example 20-Western blotting analysis (tissue sample)
Method I. Western Blotting A. Protein preparation The target tissue is sliced with a scalpel to obtain an appropriately sized fragment.
2. To remove blood and other contaminants on the surface of the tissue, the sliced tissue is washed once or twice with PBS for 30 seconds (more washing, depending on the degree of contamination, will result in heavily soiled tissue Is required).
3. The tissue is ground into smaller fragments in liquid nitrogen using a pestle and mortar.
4). Tissue fragments are collected in an Eppendorf tube containing 250 mM sucrose and washed 2 to 3 times for 30 seconds (depending on the degree of blood contamination).
5. Centrifuge at 8000 rpm for 2 minutes after each washing step and discard the supernatant.
6). After washing with sucrose, the pellet is taken out and completely ground into a fine powder.
7). The powder is collected in an Eppendorf tube and the protein is extracted using a Calbiochem Subcellular Proteome Extraction Kit (Calbiochem).
8). Abundant plasma proteins are removed from the protein lysate by using an albumin / IgG removal kit (GE HealthCare), followed by Multiple Affinity Removal Column (Agilent Technology).
9. The protein lysate buffer after the removal treatment is replaced with SDS sample buffer (2 (wt / v)% SDS, 20 (wt / v)% glycerol, 120 mM Tris (pH 6.8), and 160 mM DTT), Measure protein concentration.

B. Determination of protein concentration According to Bradford's Coomassie Blue method. Bovine serum albumin (BSA, 2 mg / ml) is used as a standard.
1. Dilute the BSA stock solution to 1 mg / ml to prepare a BSA standard concentration series (0 μg, 1 μg, 5 μg, 10 μg, 15 μg, 20 μg, 25 μg) in 500 μl deionized water (d-H 2 O).
Add 2.1 μl stock lysis buffer to a series of standards.
3. Samples are prepared by adding 1 μl of cell lysate to 500 μl of d-H 2 O.
Add 4.500 μl Coomassie Blue reagent and mix.
Do not leave the solution mixed at room temperature for too long. Precipitation occurs.
5. Read absorbance at 595 nm.
Store cell lysate at -20 ° C. If the total volume is large, aliquot the cell lysate into 0.5 ml Eppendorf tubes.

C. SDS-PAGE Separation Gel 1. Prepare 15 ml of separation gel in flask with constant stirring for 15 minutes.
10% SDS separation gel:
30 (wt / v)% acrylamide / Bis 4.95 ml
1.5M Tris-HCl (pH 8.8) 3.75 ml
10 (wt / v)% SDS 0.15 ml
d-H2O 6ml
Before injection
TEMED (N, N, N, N-tetramethylethylenediamine) 7.5 μl
10 (wt / v)% APS (ammonium persulfate) 75 μl
2. Wear gloves and clean the plate with 95% ethanol. Dry with Kimwipes. Assemble the plate and place the plate on the plate holder. The shorter plate is facing out.
3. Add TEMED and 10% APS to the gel solution for separation and stir for a while. Using a pipette, add the solution to the gap between the plates to about 0.5 cm above the top of the shorter plate. Immediately add a small amount of H ₂ O saturated butanol to cover the top of the separation gel.
4). Leave on the bench for 1 hour. Make sure there are no leaks from the bottom of the plate.
5. Except butanol, cleaned by d-H 2 _O on the surface of the gel. Dry the plate with Kimwipe.
6). Make a 5 ml concentration gel:
Gel for 4% SDS concentration:
30 (wt / v)% acrylamide / Bis 0.66ml
1M Tris-HCl (pH 6.8) 1.28 ml
10 (wt / v)% SDS 50 μl
d-H ₂ O 3 ml
Before injection
TEMED 5μl
10 (wt / v)% APS 25 μl
7). Place the concentrating gel on the separating gel up to the top of the short plate. Immediately insert a 10-well comb into the plate gap.
8). Leave at least 5 hours for polymerization.
9. The comb carefully removed, cleaning the surface of the gel by d-H 2 _O. Dry the gel.
10. Prepare 500 ml of running buffer (25 mM Tris-HCl, 0.2 M glycine, 0.35 (wt / v)% SDS).
11. Fix the gel to the electrophoresis holder and place it in the tank. Pour running buffer between the two plates to the top of the longer plate. Make sure there is no buffer leak from the upper chamber to the lower chamber. The buffer level does not continue to drop.
12 Protein lysate in an equal volume of 2 × loading buffer (62.5 mM TrisHCL (pH 6.8), 25 (wt / v)% glycerol, 2 (wt / v)% SDS, 5 (wt / v)% mercaptoethanol and 0.01 (wt / v)% bromophenol blue).
13. Lysate (5 μg / well) is loaded in duplicate.
14 Electrophoresis is performed at 150 V for 1 hour until the dye reaches the bottom of the gel.

D. Semi-dry transfer Transfer buffer: 60 mM Tris, 40 mM glycine and 15 (v / v)% methanol (pH 9.2)
1. Immerse the gel in 200 ml of transfer buffer for 30 minutes.
2. The PDVF membrane is moistened with methanol for 15 seconds, rinsed with deionized water, and then immersed in transfer buffer for at least 15 minutes. Immerse two filter papers in transfer buffer for 15 minutes.
3. Assemble the transfer stack on the plate in the following order:
+ Filter paper, membrane, gel, filter paper-
Note: a. Cut the membrane and filter paper to the same size as the gel.
b. Avoid air bubbles between the membrane and the gel.
4). Power supply: 15-20V; Time: 30-45 minutes (Power and time are adjusted according to the size of the gel).

E. Immunoblotting Open the cassette.
2. Place the transfer membrane in blocking buffer (20 mM Tris base (pH 7.6), 150 mM NaCl, 0.1 (v / v)% Tween-20, 5 (v / v)% nonfat milk), and blot the blot at 4 ° C. Incubate overnight.
3. The blocking buffer was removed, and the membrane was washed with a wash buffer (20 mM Tris base (pH 7.6), 150 mM NaCl, 0.1 (v / v)% Tween-20) while changing the wash buffer every 10 minutes. Rinse with stirring for 30 minutes.
4). After blocking, the membrane is incubated with the primary antibody.
5. After rinsing, the primary antibody buffer is decanted from the membrane, and the membrane is rinsed for 30 minutes with agitation in the wash buffer, changing the wash buffer every 10 minutes.
6). The secondary antibody is diluted 1:50, usually with block buffer (horseradish peroxidase conjugated antibody). Incubate at room temperature for 1 to 2 hours.
7). The secondary antibody buffer is removed and the membrane is rinsed for 30 minutes with agitation in the wash buffer, with the wash buffer being changed every 10 minutes.

F. Band detection ECL (Enhanced Chemiluminescence) reagent (equal volume mixture of Solution A and Solution B (obtained from GE HealthCare, UK)) is prepared.
2. Add the reagent onto the membrane and react for 5 minutes.
3. The blot is exposed to VersaDoc 5000 and the band pattern is analyzed using Quantity One software.

II. Breast tissue sample and protein extraction The tissues used for this analysis were obtained from Singapore National Cancer Center Tissue Repository after two examinations by an independent histopathologist. Normal breast tissue was obtained from a cosmetic surgery patient.
Preparation of protein extracts is essentially as described in Ou, K. et al. Kesuma, D .; Ganesan, K .; Yu, K .; J. et al. Proteome Res. 2006, 5, 2194-2206. Briefly, sliced tissue was washed with PBS to remove blood and other contaminants. The ground tissue was treated with 7 M urea (Bio-Rad), 2 M thiourea (Fluka Chemie), 4% (w / v) CHAPS (GE HealthCare), 1 mM PMSF (Sigma), 50 μg / mL Dnase ( Boehringer Mannheim), 50 μg / mL Rnase (Boehringer Mannheim), and protein inhibitor cocktail (Sigma, 1 mL / 10 ⁸ cells). The resulting cell lysate was sonicated with a probe sonicator (Misonix Inc., NY, USA) and centrifuged at 40,000 rpm for 20 minutes to remove cell debris. The extracted protein was then buffer exchanged into 8M urea and 5 mM EDTA using a 2D sample cleanup kit (Bio-Rad).
During Western blotting we used a mixture of extracts from 3 breast cancer patients who were ER + (estrogen receptor) positive and 5 extracts from normal individuals, respectively.

Results Validation of PA2G4 is shown in FIG. FIG. 15 (A) shows the results of Western blotting for PA2G4 in cancer and normal samples using anti-actin as a reference. Each band in FIG. 15 (A) is measured as an integral value in the absorbance unit and calculated by PDQuest software. FIG. 15B shows the integrated values obtained in the absorbance unit of the PA2G4 band in the cancer sample and the normal sample, respectively. In both FIG. 15 (A) and FIG. 15 (B), ER + represents a cancer sample and TNT represents a normal sample. The vertical axis in FIG. 15B represents the integrated value of the absorbance unit of the band. From these figures, the breast cancer sample clearly shows overexpression in comparison to the normal sample. Similar up-regulation in breast cancer tissue is also observed in individual samples and cell lines (data not shown).

  It will be apparent to those skilled in the art that the present invention can also be used in veterinary medicine for animals. While specific embodiments have been provided for carrying out the invention, it is understood that various modifications and improvements can be made by those skilled in the art without departing from the spirit and scope of the invention.

US Pat. No. 5,223,409

Altschul et al., J Mol Biol 215, 403-410 (1990) Altschul et al., Nucleic Acids Res 25, 3389-3402 (1997) Bradford, M. M. (1976) Anal. Biochem. 72, 248 Carell et al. Angew Chem Int Ed Engl 33, 2061 (1994) Carrell et al. Angew Chem Int Ed Engl 33, 2059 (1994) Charpentier AH, Bednarek AK, Daniel RL, Hawkins KA, Laflin KJ, Gaddis S, MacLeod MC, Aldaz CM (2000) Effects of estrogen on global gene expression: identification of novel targets of estrogen action.Cancer Res 60: 5977-5983 Cristiano et al. J Mol Med 73, 479 (1995) Cull et al. PNAS USA 89, 1865-1869 (1992) Cwirla et al. PNAS USA 87, 6378-6382 (1990) de Graauw, M .; Tijdens, I .; Cramer, R .; Corless, S .; Timms, J. F .; van de, W. B. J. Biol. Chem., 280, 29885-29898 (2005) Ding, SJ; Li, Y .; Tan, YX; Jiang, MR; Tian, B .; Liu, YK; Shao, XX; Ye, SL; Wu, JR; Zeng, R .; Wang, HY; Tang, ZY ; Xia, QC Mol Cell Proteomics, 3, 73-81 (2004) Felici J Mol Biol 222, 301-310 (1991) Fodor Nature 364, 555-556) (1993) Gallop et al. J Med Chem 37,1233 (1994) Houghten Biotechniques 13, 412-421 (1992) Hsu, WM; Hsieh, FJ; Jeng, YM; Kuo, ML; Tsao, PN; Lee, H .; Lin, MT; Lai, HS; Chen, CN; Lai, DM; Chen, WJ Int. J. Cancer, 113, 920-927 (2005) Karlin and Altschul Proc Natl Acad Sci USA 87, 2264-2268) (1990) Karlin and Altschul, Proc Natl Acad Sci USA 90, 5873-5877) (1993) Kuyama, H .; Watanabe, M .; Toda, C .; Ando, E .; Tanaka, K .; Nishimura, O. Rapid Commun. Mass Spectrom. 17, 1642-1650 (2003) Lam Nature 354, 82-84, (1991) Lam Anticancer Drug Des 12, 145, (1997) Laugesen, S .; Roepstorff, P. J. Am. Soc. Mass Spectrom. 14, 992-1002, (2003) Matsuo, E .; Toda, C .; Watanabe, M .; Ojima, N .; Izumi, S .; Tanaka, K .; Tsunasawa, S .; Nishimura, O. Proteomics, 6, 2042-2049 (2006) Miller, LD; Smeds, J .; George, J .; Vega, VB; Vergara, L .; Ploner, A .; Pawitan, Y .; Hall, P .; Klaar, S .; Liu, ET; Bergh, J Proc.Natl.Acad.Sci.USA 2005, 102, 13550-13555 Sotiriou, C .; Wirapati, P .; Loi, S .; Harris, A .; Fox, S .; Smeds, J .; Nordgren, H .; Farmer, P .; Praz, V .; Haibe-Kains, B .; Desmedt, C .; Larsimont, D .; Cardoso, F .; Peterse, H .; Nuyten, D .; Buyse, M .; Van de Vijver, MJ; Bergh, J .; Piccart, M .; Delorenzi, M. J Natl. Cancer Inst. 2006, 98, 262-272 Pompeia C, Hodge DR, Plass C, Wu YZ, Marquez VE, Kelley JA, Farrar WL.Cancer Res 64: 3465-3473 (2004) Rao, RV; Castro-Obregon, S .; Frankowski, H .; Schuler, M .; Stoka, V .; del Rio, G .; Bredesen, DE; Ellerby, HMJBiol.Chem. 277, 21836-21842, ( 2002) Saji, S .; Kawakami, M .; Hayashi, S .; Yoshida, N .; Hirose, M .; Horiguchi, S .; Itoh, A .; Funata, N .; Schreiber, SL; Yoshida, M .; Toi , M. Oncogene, 24, 4531-4539 (2005) Scott and Smith Science 249, 386-390, (1990) Shah, Y. M .; Basrur, V .; Rowan, B. G. Mol Cell Endocrinol. 219, 127-139, (2004) Uramoto, H .; Sugio, K .; Oyama, T .; Nakata, S .; Ono, K .; Yoshimastu, T .; Morita, M .; Yasumoto, K. Lung Cancer 49, 55-62 (2005) Zhang, GJ; Kimijima, I .; Onda, M .; Kanno, M .; Sato, H .; Watanabe, T .; Tsuchiya, A .; Abe, R .; Takenoshita, S. Clin Cancer Res 5, 2971- 2977 (1999) Zuckernann et al. J Med Chem 37, 2678-85 (1994) Ou, K., Kesuma, D., Ganesan, K., Yu, K. et al., J Proteome Res. 2006, 5, 2194-2206.

SEQ ID NO: 58 is a PA2G4 reverse transcription forward primer.
SEQ ID NO: 59 is a reverse transcription reverse primer.
SEQ ID NO: 60 is a beta-actin reverse transcription forward primer.
SEQ ID NO: 61 is a beta-actin reverse transcription reverse primer.

Claims (6)

A method of assisting in detecting the presence of breast cancer in a subject,
(B) measuring the expression of PA2G4 protein in a sample from the subject; and (c) comparing the measured expression of PA2G4 protein with that of at least one control, the measured expression of PA2G4 protein A method wherein the presence of breast cancer in the subject is indicated by an increase in the control from that of the control. A method of monitoring the efficacy of a treatment for abnormal cell growth of breast cancer in a subject comprising:
(B) measuring at least one expression selected from the group consisting of RNA encoded by the PA2G4 gene and PA2G4 protein in samples from at least two subjects obtained at different time points; and (c) measured Comparing at least one expression selected from the group consisting of RNA encoded by the PA2G4 gene and PA2G4 protein in at least two samples. A method for determining the outcome of breast cancer in a subject,
(B) measuring at least one expression selected from the group consisting of an RNA encoded by the PA2G4 gene and a PA2G4 protein in a sample from the subject; and (c) an RNA encoded by the measured PA2G4 gene; Comparing at least one expression selected from the group consisting of PA2G4 protein with that of at least one control, the RNA encoded by the measured PA2G4 gene, and at least one selected from the group consisting of PA2G4 protein A method wherein the expression is shown to be poorer than that of a control, indicating that the prognosis of breast cancer in the subject is poor .   4. The method according to claim 1 or 3, wherein the control is at least one subject not diagnosed with breast cancer.   The method according to claim 1, wherein the subject is a mammal.   The method according to claim 1, wherein the subject is a human.