JP5175036B2 - Human chondrocyte trait maintenance factor - Google Patents

Description

  The present invention relates to a human chondrocyte character maintenance agent comprising an integrin inhibitor as an active ingredient. The present invention also relates to a method for screening a substance that inhibits integrin gene expression and exhibits a human chondrocyte phenotype maintenance effect in monolayer human chondrocytes.

  Cartilage is composed of chondrocytes and cartilage matrix. This cartilage matrix is mainly composed of aggrecan, which is a high molecular weight proteoglycan, and type II collagen, and constitutes the main component of the extracellular matrix. Proteoglycans consist of glycoproteins in which glycosaminoglycans such as chondroitin sulfate and ketalan sulfate are bound to a single core protein, and type II collagen is a fibrillar collagen that serves as a support. It is said to play an important role in determining the progression, proliferation and differentiation of chondrocytes. In addition to the type II collagen, collagen includes type I collagen contained in large amounts in bone, type III collagen that forms a scaffold for cells, type IV collagen contained in a large amount in the basement membrane, and the like.

  Increased expression of these aggrecan and type II collagen genes is recognized in the art as a mature chondrocyte marker.

  On the other hand, cartilage degenerative diseases include diseases associated with cartilage degeneration such as osteoarthritis, cartilage softening, amputated osteochondritis, rheumatoid arthritis, etc. Physical therapy (rehabilitation), osteotomy, artificial joint replacement, etc. are adopted. However, these treatment methods are all coping treatment methods, and are not fundamental treatment methods for which the primary purpose is to recover cartilage matrix that has been exhausted and reduced cartilage matrix.

  Recently, for cartilage degenerative diseases, mosaic surgery, Autologous Chondrocyte Transplantaton, an operation to transplant autologous cartilage, has been performed, but the results are still not good. The reason is that the transplanted cartilage is not hyaline cartilage, but forms fibrocartilage (hyaline cartilage is a joint cartilage, fibrocartilage is a spinal disc, and there are many fiber components. There is elastic cartilage of the auricle).

  In addition, regenerative medicine for cartilage has been gradually tried, but the problem is that the trait as a chondrocyte cannot be maintained and it is dedifferentiated. This problem can be attributed to the fact that isolated chondrocytes undergo dedifferentiation in a normal culture method, or that the dedifferentiation of transplanted chondrocytes occurs in the degenerated portion of articular cartilage. I know. Although chondrocyte dedifferentiation can be suppressed to some extent by pellet culture, high-density culture, scaffolding, etc., a method of suppressing this dedifferentiation and providing sufficient chondrocytes for transplantation, or joints Development of a drug capable of suppressing cartilage dedifferentiation and maintaining cartilage matrix production and leading to fundamental therapy is desired.

  So far, anti-inflammatory substances (IL-1 antagonists, TGF-β, IGF-1, FGF, BMP-2) have been known as substances that promote cartilage matrix synthesis (substances that promote the cartilage assimilation process). In addition, IL-1 receptor antagonists, TNF-α receptor antagonists, MAP kinase inhibitors, COX inhibitors, cell adhesion molecules, etc. are known as substances that inhibit cartilage matrix degradation (substances that inhibit the cartilage catabolism process). ing. In addition, as actions related to the formation or maintenance of cartilage matrix, type I collagenase release inhibition, proteoglycan release inhibition, proteoglycan synthesis promotion, type II collagenase synthesis promotion, etc. are known. It is known to be useful as a therapeutic and prophylactic agent for cartilage diseases for the purpose of suppression, promotion of cartilage formation, induction of chondrocyte differentiation (see Patent Documents 1 and 2).

  On the other hand, integrin is contained in the cell adhesion molecule exemplified as the substance that inhibits cartilage matrix degradation. Integrins are cell surface receptors with different chemical structures and are involved in cell adhesion, tissue inflammation, adhesion neuron differentiation, and cancer cell metastasis, many of which are found in extracellular proteins such as fibronectin, vitronectin, and fibrinogen It has an extracellular domain that binds to a tripeptide (RGD) having an amino acid sequence consisting of Arg-Gly-Asp. Integrins are heterodimers composed of non-covalently linked α and β polypeptide subunits, with at least 17 different α subunits (1-11, D, E, L, M, V, X) and at least 8 Two different β subunits (1-8) have been identified. Different α subunits and different β subunits combine to form heterogeneous integrins. VLA includes VLA1-6, and each α subunit constitutes integrin α1-6 and integrin β1 forms VLA, for example, forms VLA-5 together with integrin α5. Among them, integrin α5β1 and integrin α4β1 are fibronectin receptors and are required for the formation of fibronectin fibrils on the cell surface.

  Integrin α1β1 and integrin α2β2 are known as collagen receptors. The integrin αvβ3 is known as a vitronectin receptor, is considered to be an integrin that plays a role in tumor metastasis, solid tumor growth, osteoporosis, tumor angiogenesis, and arthritis, and is considered to be essential for cell migration at receptors such as osteopontin. The integrin αvβ5 is also called a vitronectin receptor, and is an integrin that plays a role in neovascularization.

  Conventionally, it has been reported that monoclonal antibodies against integrin αvβ5 inhibit angiogenesis, and these integrin αvβ3 and antagonist of integrin αvβ5 are angiogenesis, tumor metastasis, tumor growth, diabetic retinopathy, macular degeneration, atheromatous The possibility as a therapeutic or prophylactic agent for arteriosclerosis and osteoporosis has been reported (see Patent Document 3). Also, integrin expression inhibitors containing sulfonamide compounds as active ingredients are atherosclerosis, psoriasis, cancer, osteoporosis, retinal angiogenesis, diabetic retinopathy and other inflammatory diseases, cancer metastasis suppression, angiogenesis inhibition, etc. It is also known to be effective as a therapeutic agent (see Patent Document 4).

  On the other hand, (1) Adhesion of human articular chondrocytes with fibronectin and type II collagen is inhibited by integrin antibodies (see Non-Patent Document 1), and (2) human articular chondrocytes contain various cartilage substrates (ECM: type II) Collagen and aggrecan). Adhesion to fibronectin is inhibited by anti-integrin α5 antibody and anti-integrin β1 antibody (see Non-Patent Document 2), and (3) TGF-β is VAL- It has also been reported that the expression of 5 (α5β1) is increased to cause increased adhesion to fibronectin (see Non-Patent Document 3).

  It has also been reported that inhibition of integrin β1 prevents chondrocyte adhesion to type II collagen and negatively regulates TGF-β stimulation of chondrocyte proliferation and proteoglycan synthesis (Non-patent literature). 4).

  Furthermore, regarding integrin expression and type II collagen being involved in the maintenance of chondrocyte shape in monolayer culture, (1) in monolayer culture, chondrocytes produce type II collagen and fibronectin throughout the culture period. It has been clarified from the fact that a specific surface receptor (integrin β1 group) is expressed on the cell membrane, and (2) the treatment with integrin β1 antibody clearly reduces the adhesion on chondrocytes on type II collagen (non- Patent Document 5).

Thus, integrin production (expression) in chondrocytes has been reported from the prior art, and antibodies against integrins suppress the adhesion of type II collagen and fibronectin to chondrocytes. It has been suggested that integrin production is important for cartilage differentiation in relation to the cartilage matrix. Therefore, suppression of integrin gene expression was thought to have an opposite effect on chondrocyte character maintenance.
Loeser RF, Arthritis Rheum. 1993; 36: 1103-10. Yonezawa et al., Modern Medicine, 1996; 28 (9): 129-133. Lee, GM & Loeser, RF, Cells and Materials., 1998; 8; 135-149. Scully SP, et al. Clin Orthop Relat Res. 2001; (391 Suppl): S72-89. Shakibaei M, et al. Cell Biol Int. 1997; 21 (2): 115-25. International Publication No. 2002/42448 Pamphlet JP 2000-72678 A Special Table 2004-513953 WO 01/056607 pamphlet

  An object of the present invention is to provide a technique that is effective in suppressing the progression of cartilage degeneration and maintaining cartilage formation and is useful for the fundamental therapy of cartilage degenerative diseases. Specifically, the object of the present invention is a human chondrocyte trait maintenance agent, a method for proliferating human chondrocytes, a method for screening a substance having a human chondrocyte trait maintenance action or a cartilage matrix gene expression regulating action, and use for the screening Is to provide a kit.

  The inventors of the present invention have made extensive studies to solve the above-mentioned problems.Unlike conventional reports, the present inventors have inhibited 1) chondrocyte dedifferentiation by inhibiting integrin in a monolayer culture of chondrocytes. Found that 2) can regulate the expression of cartilage matrix genes, 3) can maintain the protein of cartilage traits, and obtained knowledge that integrin gene expression inhibitors are useful for maintaining human chondrocyte traits It was. Furthermore, transplantation of cells that inhibit integrin production, or cells that prevent integrin signals from being transmitted into the cells, can be used for cartilage regeneration by maintaining cartilage matrix. I found out. The present invention has been completed by further studies based on these findings.

That is, the present invention is an invention having the following contents:
Item 1. A human chondrocyte trait maintenance agent comprising an integrin gene expression inhibitor as an active ingredient.
Item 2. Item 2. The human chondrocyte trait maintenance agent according to Item 1, having the following action (a) and / or (b):
(A) suppress or maintain expression of type I collagen gene and / or type III collagen gene,
(B) Increase or maintain the expression of type II collagen gene and / or aggrecan gene.
Item 3. Item 3. The human chondrocyte trait maintenance agent according to Item 1 or 2, wherein the integrin gene expression inhibitor suppresses the production of at least one integrin selected from the group consisting of integrin α5β1, integrin αvβ5, and integrin αvβ3. .
Item 4. Item 4. The human according to Item 3, wherein the integrin gene expression inhibitor is an siRNA against at least one gene selected from the group consisting of an integrin α5 gene, an integrin αv gene, an integrin β1 gene, an integrin β3 gene, and an integrin β5 gene. Chondrocyte trait maintenance agent.
Item 5. Item 4. The human chondrocyte trait maintenance agent according to Item 3, wherein the integrin gene expression inhibitor suppresses the production of integrin α5β1.
Item 6. The integrin gene expression inhibitor is a polynucleotide consisting of a base sequence represented by SEQ ID NO: 1 or 2 that is a complementary sequence to the integrin α5 gene, and / or a sequence complementary to the integrin β1 gene, represented by SEQ ID NO: 3. Item 6. The human chondrocyte phenotype maintenance agent according to Item 5, which is a polynucleotide having a nucleotide sequence.
Item 7. Item 4. The human chondrocyte trait maintenance agent according to Item 3, wherein the integrin gene expression inhibitor suppresses the production of integrin αvβ5.
Item 8. The integrin gene expression inhibitor is a polynucleotide consisting of the nucleotide sequence shown in any one of SEQ ID NOs: 4 to 6, which is a complementary sequence to the integrin αv gene, and / or a sequence complementary to the integrin β5 gene. Item 8. The human chondrocyte trait maintenance agent according to Item 7, which is a polynucleotide comprising the base sequence represented by 7 or 8.
Item 9. Item 9. The human chondrocyte trait maintenance agent according to any one of Items 1 to 8, which has the following action (i) to (iv):
(i) suppressing the progression of cartilage degeneration (chondrocyte dedifferentiation) by suppressing integrin gene expression or suppressing integrin signaling;
(ii) maintaining the differentiation of chondrocytes,
(iii) repairing degenerated cartilage to normal cartilage tissue,
(iv) maintain the protein of cartilage traits,
(v) Maintaining cartilage trait gene expression (maintaining chondrocyte differentiation).
Item 10. Item 10. The human chondrocyte trait maintenance agent according to any one of Items 1 to 9, which is administered to a culture solution of human chondrocytes forming a monolayer.
Item 11. Item 11. The human chondrocyte trait maintenance agent according to any one of Items 1 to 10, which is a cartilage matrix gene expression regulator.
Item 12. Item 12. A method for proliferating chondrocytes, comprising proliferating chondrocytes by culturing a human chondrocyte trait maintenance agent according to any one of Items 1 to 11 and chondrocytes in the coexistence.
Item 13. Item 13. The method for proliferating chondrocytes according to Item 12, wherein chondrocytes having increased cartilage matrix molecules as chondrocytes proliferate are obtained.
Item 14. Item 14. The method for proliferating chondrocytes according to Item 12 or 13, wherein the proliferated chondrocytes are for use in chondrocyte transplantation.
Item 15. Item 15. The method for proliferating chondrocytes according to Item 14, wherein the chondrocyte transplantation is autologous chondrocyte transplantation.
Item 16. Item 12. A human chondrocyte trait maintenance method, which comprises adding the human chondrocyte trait maintenance agent according to any one of Items 1 to 11 to a culture solution of human chondrocytes in a monolayer.
Item 17. Item 17. The method for maintaining human chondrocyte trait according to Item 16, which is the method according to any one of (vi) to (x) below:
(vi) a method of suppressing the progression of cartilage degeneration (chondrocyte dedifferentiation) by suppressing integrin expression or integrin signaling;
(vii) a method of maintaining the differentiation of chondrocytes,
(viii) a method of repairing degenerated cartilage to normal cartilage tissue,
(ix) a method for maintaining a protein of cartilage trait,
(x) A method of maintaining cartilage trait gene expression (maintaining chondrocyte differentiation).
Item 18. A screening method for a substance having a human chondrocyte character maintaining action, comprising the following steps (1) to (5):
(1) a step of adding a candidate substance to a culture medium of human chondrocytes forming a monolayer,
(2) Measuring the level of expression of at least one gene selected from the group consisting of integrin α5 gene, integrin αv gene, integrin β1 gene, integrin β3 gene, and integrin β5 gene in the presence and absence of candidate substances The process of
(3) For the candidate substance that suppressed the gene expression in the step (2), the expression of type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene in the culture medium of step (1) Measuring the degree,
(4) In the step (3), a step of selecting a substance having the following action (a) and / or (b) as a substance having a human chondrocyte character maintaining action:
(a) suppress or maintain expression of type I collagen gene and / or type III collagen gene,
(b) Increase or maintain the expression of type II collagen gene and / or aggrecan gene.
Item 19. A screening method for a substance having a cartilage matrix gene expression regulating action, comprising the following steps (1) to (5):
(1) a step of adding a candidate substance to a culture medium of human chondrocytes forming a monolayer,
(2) Measuring the level of expression of at least one gene selected from the group consisting of integrin α5 gene, integrin αv gene, integrin β1 gene, integrin β3 gene, and integrin β5 gene in the presence and absence of candidate substances The process of
(3) For the candidate substance that suppressed the gene expression in the step (2), the expression of type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene in the culture medium of step (1) Measuring the degree,
(4) In the step (3), a step of selecting a substance having the following action (a) and / or (b) as a substance having a human cartilage matrix gene expression regulating action:
(a) suppress or maintain expression of type I collagen gene and / or type III collagen gene,
(b) Increase or maintain the expression of type II collagen gene and / or aggrecan gene.
Item 20. A kit for screening for a substance having a human chondrocyte character-maintaining action comprising at least the following components (a) to (e):
(a) a culture solution of human chondrocytes forming a monolayer,
(b) a primer pair or a probe for measuring expression of at least one gene selected from the group consisting of an integrin α5 gene, an integrin αv gene, an integrin β1 gene, an integrin β3 gene, and an integrin β5 gene;
(c) Primer pairs or probes for measuring expression of each type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene,
(d) PCR reaction reagent,
(e) Each of the above gene expression detection reagents.
Item 21. A kit for screening a substance having an action of regulating cartilage matrix gene expression, comprising at least the following components (a) to (e):
(a) a culture solution of human chondrocytes forming a monolayer,
(b) a primer pair or a probe for measuring expression of at least one gene selected from the group consisting of an integrin α5 gene, an integrin αv gene, an integrin β1 gene, an integrin β3 gene, and an integrin β5 gene;
(c) Primer pairs or probes for measuring expression of each type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene,
(d) PCR reaction reagent,
(e) Each of the above gene expression detection reagents.

  According to the human chondrocyte trait maintenance agent of the present invention, an agent that maintains the differentiation traits of chondrocytes by direct administration to cartilage tissue in vivo (in vivo) or chondrocytes in ex vivo (ex vivo) By using as a substance (adjuvant) to be added to the medium when culturing, a drug that maintains the differentiation traits of chondrocytes can be provided.

  In addition, according to the present invention, a pharmaceutical preparation that is directly administered to chondrocytes in the body of a human knee joint or the like and maintains the differentiation traits of chondrocytes (suppresses dedifferentiation), or a cartilage matrix Pharmaceutical formulations that regulate gene expression can be provided.

  That is, according to the present invention, there is provided a human chondrocyte trait maintenance agent that can maintain the differentiation traits of mature chondrocytes and can also be used as an adjuvant for chondrocyte transplantation.

  The human chondrocyte phenotype maintenance agent of the present invention can suppress the degeneration of cartilage by suppressing the dedifferentiation of chondrocytes in the degenerated cartilage denatured part, so that the articular cartilage degeneration inhibitor prevents joint deformation. There is an advantage also in the point which can be used as. In addition, the human chondrocyte trait maintenance agent of the present invention is also useful as a cartilage repair agent capable of inducing cartilage differentiation of mesenchymal progenitor cells or promoting differentiation traits of mature chondrocytes. .

  Furthermore, according to the present invention, there are provided a screening method for a substance having a human chondrocyte phenotype maintaining action or a cartilage matrix gene expression regulating action, and a kit for its measurement, which have been found from a new unprecedented viewpoint.

  The abbreviations of amino acids, peptides, base sequences, nucleic acids and the like in this specification are defined by IUPAC-IUB (IUPAC-IUB Communication on Biological Nomenclature, IUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN). Eur J Biochem. 1984 138 (1): 9-37.], “Guidelines for the preparation of specifications including base sequences or amino acid sequences” (edited by the Patent Office) and conventional symbols in the field.

  In addition, DNA synthesis, production of vectors containing exogenous genes (expression vectors), host cells transformed with the vectors, production methods of expressed proteins secreted by the host cells, etc. are performed by general genetic engineering techniques. Can be easily manufactured and acquired (Molecular Cloning. 2nd ed. Cold Spring Harbor Lab Press; 1989; see Biochemistry Experiment Course "Gene Research Methods I, II, III", Japan Biochemical Society (1986), etc.) .

  In the practice of the invention in various embodiments, conventional methods of chemistry, molecular biology, microbiology, recombinant DNA, genetics, and immunology can be used unless otherwise specified. These include, for example, Maniatis (Maniatis T, et al. Molecular Cloning. A Laboratory manual. New York: Cold Spring Harbor Lab Press; 1982, Sambrook J, et al. Molecular A Laboratory manual. 2nd ed. New York. : Cold Spring Harbor Lab Press; 1981, Ausbel FM, et al. Current Protocols in Molecular Biology.New York: John Wiley and Sons; 1992, Glover (Glover D. DNA Cloning, I and II.Oxford Press; 1985, Anand (Anand. Techniques for the Analysis of Complex Genomes. Academic Press; 1992, Guthrie G, et al. Guide to Yeast Genetics and Molecular Biology. Academic Press; 1991 and Fink Fink DJ, et al. Hum Gene Ther. 1992 ; 3 (1): 11-9.).

  Integrins are heterodimers composed of non-covalently linked α and β polypeptide subunits. The α subunit includes eleven polypeptides including α5 and αv. Further, the β subunit includes six polypeptides including β1, β3, and β5. In the present invention, the integrin gene refers to a gene that encodes a polypeptide that constitutes the α or β subunit. Specifically, as the integrin gene, specifically, an integrin α5 gene (which encodes the α5 subunit of integrin). Integrin α5: GenBank Accession No. NM_002205), integrin αv gene (gene encoding integrin αv subunit; Integrin αv: GenBank Accession No. NM_002210), integrin β1 gene (gene encoding integrin β1 subunit) Integrin β1: GenBank Accession No. NM_002211), integrin β3 gene (gene encoding β3 subunit of integrin; Integrin β3: GenBank Accession No. NM_000212), integrin β5 gene (gene encoding β5 subunit of integrin; Integrin β5: GenBank Accession No. NM_002213) and other genes are included.

  In the present invention, integrin α5β1 is a heterodimer of α5 subunit and β1 subunit; integrin αvβ5 is a heterodimer of αv subunit and β5 subunit; and integrin αvβ3 is an αv subunit and β3 subunit. It is a heterodimer.

  In the present invention, the matrix gene refers to type I collagen gene (COL1A1: GenBank Accession No. NM_000088, COL1A2: GenBank Accession No. NM_000089), type II collagen gene (COL2A1: GenBank Accession No. NM_001844, NM_033150), III Type collagen gene (COL3A1: GenBank Accession No. NM_000090) and aggrecan gene (AGC1: GenBank Accession No. NM_001135, NM_013227).

  In the present invention, “maintenance of human chondrocyte trait” means that the differentiation trait of human chondrocytes is maintained. Regarding the maintenance of the traits of human chondrocytes, the expression or maintenance of the genes of type II collagen and aggrecan, which are the main proteins that form the cartilage matrix, or the production increase or maintenance of type II collagen and aggrecan, This can be confirmed by an increase in the staining intensity of chondrocytes due to metachromatism with toluidine blue or safranin O.

1. Human chondrocyte trait maintenance agent The human chondrocyte trait maintenance agent of the present invention comprises an integrin gene expression inhibitor as an active ingredient. The integrin gene expression inhibitor used in the present invention is not particularly limited as long as it can suppress integrin gene expression in human chondrocytes, and may inhibit integrin gene transcription. It may be one that inhibits. By suppressing the expression of the integrin gene in human chondrocytes, the following actions (a) and / or (b) are expressed, and the human chondrocytes can maintain their traits.
(A) Suppressing or maintaining the expression of type I collagen gene and / or type III collagen gene.
(B) Increase or maintain the expression of type II collagen gene and / or aggrecan gene.

Further, the integrin gene expression-suppressed product used in the human chondrocyte trait maintenance agent of the present invention has any of the following actions (i) to (iv):
(i) suppressing the progression of cartilage degeneration (chondrocyte dedifferentiation) by suppressing integrin gene expression or suppressing integrin signaling;
(ii) maintaining the differentiation of chondrocytes,
(iii) repairing degenerated cartilage to normal cartilage tissue,
(iv) maintain the protein of cartilage traits,
(v) Maintaining cartilage trait gene expression (maintaining chondrocyte differentiation).

  The integrin gene expression-suppressed product used in the present invention is not particularly limited as long as the action of (a) and / or (b) can be expressed. As a preferred example, in human chondrocytes, ingrin α5β1 , Those capable of inhibiting (suppressing) the production of integrin αvβ5 and / or integrin αvβ3.

  Specifically, examples of the integrin gene expression inhibitor that can suppress the expression of one or more integrin genes of integrin α5 gene, integrin αv gene, integrin β1 gene, integrin β3 gene, and integrin β5 gene Is done.

  Examples of the integrin gene expression inhibitor include antisense DNA, antisense RNA and siRNA (small interfering RNA) for the integrin gene, preferably siRNA.

  As an example of the siRNA for the integrin gene, a single-stranded polynucleotide comprising a polynucleotide sequence complementary to the mRNA of the integrin gene (hereinafter referred to as the integrin gene polynucleotide sequence) can be exemplified.

  In the present invention, the polynucleotide sequence for integrin gene only needs to contain a polynucleotide sequence complementary to a part or all of the mRNA of each integrin gene, and the complementary polynucleotide sequence is As long as it has an effect of suppressing the expression of each integrin gene in human chondrocytes, any region may be used.

  The region complementary to the target gene as the polynucleotide sequence for the integrin gene can be determined by NCBI BLAST search. Specifically, the integrin gene region selected as a target to which a part or all of the polynucleotide sequence for integrin gene complements is preferably an exon site that is 50 to 100 bases downstream from the start codon encoding the integrin gene. And 5 'and 3' UTRs should be avoided. Further, the polynucleotide sequence for integrin gene preferably has high specificity for the sequence of the complementary site of the target integrin gene. In addition, as an example of the polynucleotide sequence for integrin gene, a polynucleotide sequence complementary to part or all of the sequence region AA (N19) TT containing about 50% G or C in the integrin gene region The thing containing is suitably illustrated. In the case where the sequence is not found, the terminal site can be substituted as AA (N21) or CA (N21).

  The polynucleotide sequence for integrin gene may be RNA or DNA.

  The number of bases in the integrin gene polynucleotide sequence may be, for example, 15 to 30 bases, preferably 18 to 25 bases, more preferably 18 to 25 bases, and particularly preferably 19 to 21 bases.

  In the present invention, as the siRNA for the integrin gene, a double-stranded polynucleotide comprising the integrin gene polynucleotide sequence and a polynucleotide sequence complementary to the polynucleotide sequence can also be used.

  The polynucleotide sequence complementary to the integrin gene polynucleotide sequence may be one or several bases longer than the integrin gene polynucleotide sequence. For example, 2 bases of uracil (U) are added. May be. In addition, the polynucleotide sequence for the integrin gene (sense strand) and the polynucleotide sequence complementary to the polynucleotide sequence for the integrin gene (antisense strand for the sense strand) are expressed in each sequence. Any one of U, T, G, C or A having 1 to several bases may be at least at any terminal, or may be deleted, substituted or added internally.

  Furthermore, in the present invention, the siRNA for the integrin gene includes the polynucleotide sequence for the integrin gene and a polynucleotide sequence complementary to the polynucleotide sequence, and both the polynucleotide sequences are a nucleotide sequence and a non-nucleotide sequence. Or what was connected by the adjustment part (loop part) which consists of these combinations can also be used.

  When the regulatory part is a nucleotide sequence, the nucleotide sequence is a nucleotide sequence of 1 to 10 bases, preferably a nucleotide sequence of 1 to several hundred bases, more preferably 1 to several tens of bases Examples thereof include a long nucleotide sequence, particularly preferably a nucleotide sequence having a length of 1 to 20 bases, or a nucleotide sequence comprising a sequence that generates a polynucleotide of the above length in the cytoplasm by a mechanism such as splicing. The nucleotide sequence constituting the regulatory portion may include a polynucleotide sequence complementary to the integrin gene polynucleotide sequence and the integrin gene polynucleotide sequence. Furthermore, nucleotide sequences constituting the regulatory portion include cytoplasmic transit sequences such as poly A, tRNA, Usn RNA, retrovirus-derived CTE sequences; NFκβ binding sequences, E2F binding sequences, SSRE, NF-AT and other decoys Sequence having activity; Interferon-induced suppression sequence such as VA1 or VA2 RNA of adenovirus; Sequence having RNase suppression activity, antisense activity, ribozyme activity, etc .; Marker sequence for identifying tRNA or expression site; Any one or a combination of two or more thereof, such as a selection marker sequence in E. coli, may be used. Functional sequences that require partial duplexes such as decoy activity may be made by including complementary nucleotides. Furthermore, a sequence necessary for splicing including an intron donor sequence and an acceptor sequence is provided inside the regulatory sequence, whereby a part of the regulatory sequence is cut out and religated in a cell having a splicing mechanism. You may design so that. The structure of these regulatory portion sequences can provide the effect of increasing the desired RNA function suppressing effect and the stability of the polynucleotide sequence for integrin genes.

  Further, when the regulatory moiety is a non-nucleotide sequence, a specific example thereof is a PNA (peptide nucleic acid) of a nucleic acid-like chemically synthesized analog having a polyamide skeleton.

  Furthermore, in the present invention, as an integrin gene expression inhibitor, a decoy nucleic acid for the integrin gene for suppressing transcription of the integrin gene can be used in addition to siRNA for the integrin gene.

  Specific examples of the integrin gene expression-suppressed product used in the present invention include “integrin α5-1”, “integrin α5-4”, “integrin αv-1”, “integrin αv-” shown in Examples described later. 2 ”,“ integrin αv-5 ”,“ integrin β1-1 ”,“ integrin β1-5 ”,“ integrin β5-1 ”, and“ integrin β5-2 ”targeted polynucleotides for integrin genes Mention can be made of what is deduced from the sequence. Specifically, “integrin α5-1” or “integrin α5-4” has a base sequence represented by SEQ ID NO: 1 or 2, respectively, and can function as an siRNA for the integrin α5 gene. “Integrin αv-1”, “integrin αv-2” or “integrin αv-5” has a base sequence represented by SEQ ID NO: 4, 5 or 6, respectively, and can function as an siRNA for the integrin αv gene. “Integrin β1-1” consists of the base sequence represented by SEQ ID NO: 3, and can function as an siRNA for the integrin β1 gene. “Integrin β5-1” or “integrin β5-2” has a base sequence represented by SEQ ID NO: 7 or 8, respectively, and can function as an siRNA for the integrin β5 gene.

  As a method for obtaining the polynucleotide sequence for the integrin gene, genetic engineering techniques [Methods in Enzymology, 2005; 392: 24-35, 73-96, 173-185, 405-419 .; Nucleic Acids Res. 1984; 12: 9441; Biochemistry Experiment Course 1 "Gene Research Method II", edited by Japanese Biochemical Society, page 105 (1986)], chemical synthesis means such as phosphate triester method and phosphate amidite method [J Am Chem Soc. 1967; 89 ( 2): 450-3 .; J Am Chem Soc. 1967; 89 (26): 7146-7147.] And combinations thereof. These techniques are generally used in the art, and those skilled in the art can easily obtain a target polynucleotide sequence for integrin gene from a gene sequence provider such as GenBank, and isolate or purify it. Single-stranded polynucleotide sequences can be obtained. In addition, RNA synthesis has a hydroxyl group at 2 ', making synthesis difficult compared to DNA synthesis. The synthesis requires a protecting group at 2', and the yield is greatly reduced by desalting and deprotection after production. It is also possible to lose the stability of the strand, but by using orthoester (2′-ACE) for 2 ′ protection, it is also possible to perform stable RNA synthesis, which is a method of Dharmacon 2 After protecting 2 'as a' -ACE synthetic RNA oligonucleotide, it can be easily desalted and deprotected by using a volatile buffer at the time of use (http://dharmacon.com/siRNA. html). RNA can also be synthesized by the phosphoramidide method using a reagent for RNA synthesis together with a commercially available ABI3900 high-throughput DNA synthesizer manufactured by Applied Biosystems.

  Furthermore, the polynucleotide sequence for integrin gene can also be obtained by entrusting synthesis to a company or department that entrusts synthesis of the polynucleotide. For example, Dharmacon Research (Lafayette, CO, USA), Sigma (SIGMA: http://www.gensetoligos.com/), Peribio Science (http://www.perbio.com), ChemGenes (http : /www.chemgenes.com), QIAGEN (https://www1.qiagen.com/), etc. it can.

  The synthesized RNA or DNA can be purified by PAGE or anion exchange HPLC.

  Moreover, the polynucleotide sequence for integrin genes can also be produced using gene recombination techniques. For example, after chemically synthesizing a single-stranded polynucleotide sequence comprising a target polynucleotide sequence, PCR is performed based on any sequence (including a promoter sequence and terminator sequence) that can be added to both ends of the sequence or to the outside thereof. The primer can be prepared, and the sequence can be converted into double-stranded DNA by PCR and then amplified. In addition, the promoter can be appropriately placed with respect to the transcription start point in vitro transcription, T7 promoter in E. coli, CMV promoter in eukaryotic cells, U6 promoter, H1 promoter, etc. in eukaryotic PolIII system. In addition to the transcription termination sequence, the post-transcription product can be cleaved at the same site by a self-cleaving ribozyme or the like. Alternatively, the amplified double-stranded DNA is linked to an expression vector in a restriction enzyme manner using a restriction enzyme recognition site that can be added to the end thereof, and amplified to produce a target polynucleotide sequence for integrin gene, Can be acquired. There is no technical difficulty in integrating into various plasmid vectors in the field today. For example, a vector containing the polynucleotide sequence for integrin gene can be produced with reference to International Patent Publications WO2003 / 070732, WO2003 / 046186, and WO2003 / 006477.

  The human chondrocyte trait maintenance agent of the present invention can express the trait maintenance effect of chondrocytes by being introduced into a chromosome or extrachromosome in a chondrocyte in need of trait maintenance. For introduction of the human chondrocyte trait maintenance agent of the present invention into chondrocytes, the aforementioned polynucleotide sequence that functions as an integrin gene expression inhibitor may be amplified directly by PCR and introduced directly into cells, A vector in which the polynucleotide sequence is incorporated may be used.

  Vectors for introducing a polynucleotide sequence that functions as an integrin gene expression inhibitor are already known in the art, and any of these known vectors can be used in the present invention. For example, a viral vector or a plasmid vector containing a copy of a “polynucleotide sequence functioning as an integrin gene expression inhibitor” linked to an expression control element and capable of expressing the polynucleotide sequence in a target cell can be mentioned. As such a vector, for example, a vector disclosed in US Pat. No. 5,252,479 and PCT International Publication WO 93/7282 (pWP-7A, pwP-19, pWU-1, pWP− 8A, pwP-21 and / or pRSVL etc.) or pRC / CMV (Invitrogen) etc. can be used. More preferably, for example, a virus vector such as a retrovirus vector, an adenovirus vector, an adeno-associated virus vector, a vaccinia virus vector, a lentivirus vector, a herpes virus vector, an alpha virus vector, an EB virus vector, a papilloma virus vector, a foamy virus vector, etc. Non-viral vectors such as cationic liposomes, ligand DNA complexes, and gene guns (Y. Niitsu et al., Molecular Medicine, 1988; 35: 1385-1395.), But are not limited thereto. Not a viral vector, but a dumbbell-shaped DNA (Zanta MA, et al. Gene delivery: a single nuclear localization signal peptide is sufficient to carry DNA to the cell nucleus.Proc Natl Acad Sci US A. 1999; 96 (1): 91-6.), Modified DNA with nuclease resistance, or naked plasmid can also be used suitably Liu F, Huang L. Improving plasmid DNA-mediated liver gene transfer by prolonging its retention in the hepatic vasculature. Gene Med. 2001; 3 (6): 569-76.).

  As the promoter used in the above vector, specifically, when the polynucleotide functioning as an integrin gene expression inhibitor is a tandem type consisting of a linear single-stranded oligonucleotide, antisense coding DNA and sense A sequence capable of promoting transcription from the promoter at each 5 ′ end of the coding DNA; and in the case of a stem type having a regulatory partial sequence between the antisense coding DNA and the sense coding DNA, By providing a sequence that can promote transcription from the promoter at the end, the expression suppression or function suppression effect of the integrin gene may be made more efficient. A transcript from such a sequence may be used in a state where it is added to the polynucleotide sequence that functions as an integrin gene expression inhibitor if there is no hindrance to the integrin gene expression in human chondrocytes. When the expression is affected, it is preferable to perform trimming using a trimming means.

  In any of the tandem type and stem type systems described above, the promoter may be either pol II or pol III as long as it can produce RNA corresponding to each of the above polynucleotide sequences. A polIII system suitable for the expression of such short RNAs can be used. Examples of the polIII promoter include U6 promoter, tRNA promoter, retroviral LTR promoter, adenovirus VA1 promoter, 5SrRNA promoter, 7SK RNA promoter, 7SL RNA promoter, H1 RNA promoter, and the like. The U6 promoter adds 4 uridine bases to the 3 ′ end of RNA. The overhang at the 3 ′ end is A, 0, 1, 2, 3 as the leading sequence of antisense code DNA and sense code DNA. Alternatively, by providing 4 bases, the 3 ′ terminal protrusion of the finally produced “polynucleotide that functions as an integrin gene expression inhibitor” can be freely extended to 4, 3, 2, 1, 0 bases. it can. Even when other promoters are used, it is possible to freely change the number of protruding bases at the end as well. When a polIII promoter is used, it is preferable to provide a terminator at the 3 ′ end of the sense code DNA and the antisense code DNA in order to express only short RNA and appropriately terminate transcription. The terminator is not particularly limited as long as it can terminate the transcription of the promoter. For example, a sequence in which four or more A (adenine) bases are continuous, and a sequence that can form a palindromic structure can be used.

  On the other hand, examples of the pol II promoter include cytomegalovirus promoter, T7 promoter, T3 promoter, SP6 promoter, RSV promoter, EF-1α promoter, β-actin promoter, γ-globulin promoter, SRα promoter and the like. However, when the polII system is used, it is synthesized as RNA of a certain length rather than as short as the polIII system. For this reason, when a pol II promoter is used, antisense RNA or sense RNA is generated from RNA synthesized as a certain length using means that can cleave RNA such as ribozyme by self-processing. It can also be made. A stem loop RNA can also be generated as a regulatory partial sequence by inserting a stem loop sequence immediately after the PolII promoter and inserting a polyA addition signal behind it.

  Introduction of an integrin gene expression inhibitor that is an active ingredient of the present invention into a chondrocyte is performed in the art using a vector containing a polynucleotide that functions as an integrin gene expression inhibitor as it is or as an integrin gene expression inhibitor. It can be carried out according to various known methods. Specifically, as a method for introducing into chondrocytes, the calcium phosphate method (Virology. 1973; 52 (2): 456-67.), The electroporation method (Nucleic Acids Res. 1987; 15 (3): 1311 -26 .; Nature. 1986; 319 (6056): 791-3.), Lipofection method (Proc Natl Acad Sci US A. 1987; 84 (21): 7413-7.), Infection introduction method by virus (Sci Am 1994; 271 (6): 34-6.), Polyethylene glycol method (EMBO J. 1984; 3 (12): 2717-22.), Particle gun method (Proc Natl Acad Sci US A. 1988; 85 (22 ): 8502-05.), Agrobacterium-mediated method (Nucleic Acids Res. 1984; 12 (22): 8711-21.), HVJ envelope method, aggregation method, microinjection method, DEAE-dextran method, or You can choose from gene guns.

  In addition, as a method for selecting a cell into which an integrin gene expression inhibitor that is an active ingredient of the present invention has been introduced, an integrin gene expression inhibitor or a recombinant vector into which a polynucleotide that functions as an integrin gene expression inhibitor is inserted The DNA sequence specific to can be selected by a known technique such as hybridization or PCR using a probe or primer as a probe or primer. In addition, when using the above recombinant vector, the vector can be provided with a selection marker, and a cell into which an integrin gene expression inhibitor has been introduced can be selected using the phenotype of the selection marker as an index. .

  The human chondrocyte phenotype maintenance agent of the present invention can be formulated by a conventional formulation technique using the aforementioned integrin gene expression-suppressed substance, and capsules, granules, creams, powders, It can be used as various solid and liquid pharmaceutical preparations such as syrups, tablets, injections, and ointments. Examples of the carrier and excipient for the preparation include solid or liquid substances. Examples of these include lactose, magnesium stearate, starch, talc, gelatin, agar, pectin, gum arabic, olive oil, sesame oil, ethylene glycol, polylactic acid (PLA), polyglycolic acid (PGA), polylactic acid poly Examples include glycolic acid copolymer (PLGA), hyaluronic acid, collagen sponge, and other common ones.

  The content of the human chondrocyte trait maintenance agent of the present invention in such a preparation varies depending on the dosage form, the type of integrin gene expression inhibitor, etc., but the integrin gene expression inhibitor or integrin gene expression inhibitor is an active ingredient. It is preferable to contain a vector having a polynucleotide sequence functioning as a vector at a concentration of 0.0001 to 80% (w / w) based on the total amount of the pharmaceutical preparation.

  The human chondrocyte trait maintenance agent of the present invention is known to be a growth factor involved in chondrogenesis in vitro before administration (including in vivo and ex vivo use, the same applies hereinafter) bFGF ( basic fibroblast growth factor: Weisser J, et al. Osteoarthritis Cartilage. 2001; 9 Suppl A: S48-54.), TGF-β1 (transforming growth factor-β1: van Beuningen HM, et al. Lab Invest. 1994; 71 ( 2): 279-90.), BMP (bone morphogenetic protein: Glansbeek HL, et al. Arthritis Rheum. 1997; 40 (6): 1020-8.), IGF-1 (insulin-like growth factor-1: Mi Z, et al. Arthritis Rheum. 2000; 43 (11): 2563-70.), And GlcAT-I (glucuronosyltransferase-I: Venkatesan N, et al. Proc Natl Acad Sci US A. 2004; 101 (52): 18087-92.) Etc. may be used together or before and after application of the growth factor. Further, the human chondrocyte trait maintenance agent of the present invention may be mixed with another substance that enhances the human chondrocyte trait maintenance effect or the cartilage matrix regulating action, and may be administered. They may be administered simultaneously without making a combination.

  The agent for maintaining human chondrocyte phenotype of the present invention is introduced into human chondrocytes and has the effect of (1) suppressing or maintaining expression of type I collagen gene and / or type III collagen gene and / or (2 ) It can exert an effect of increasing or maintaining the expression of type II collagen gene and / or aggrecan gene. That is, the human chondrocyte trait maintenance agent of the present invention regulates the expression of type I collagen gene, type II collagen gene, type III collagen gene, and / or aggrecan gene, which are cartilage matrix genes, in human chondrocytes. Can be used as a cartilage matrix gene expression regulator.

  The human chondrocyte phenotype maintenance agent of the present invention suppresses expression of a target integrin gene or suppresses integrin signaling in a target human chondrocyte, human cartilage tissue, human articular cartilage, or the like. (1) Suppress the progression of cartilage degeneration (chondrocyte dedifferentiation), (2) maintain chondrocyte differentiation, (3) repair degenerated cartilage to normal cartilage tissue, (4) cartilage traits Human chondrocyte traits can be maintained, such as maintaining proteins and (5) maintaining chondrogenic gene expression (maintaining chondrocyte differentiation). The human chondrocyte phenotype maintenance agent of the present invention can be used without particular limitation for various applications as long as the above effects can be effectively used. For example, osteoarthritis, cartilage softening, transected bone Chondritis, rheumatoid arthritis, intervertebral disc degeneration, intervertebral disc herniation, cartilage degenerative diseases such as non-rotative necrosis of subchondral bone with cartilage degeneration, various bone diseases (eg, achondroplasia or Morquio disease); trauma and surgery After cartilage damage / resection or osteotomy; can be used as a therapeutic agent for cartilage-related diseases such as congenital cartilage hypoplasia or malformation. In addition, the human chondrocyte trait maintenance agent of the present invention is useful for cartilage induction from undifferentiated progenitor cells or chondrocyte trait maintenance in cartilage defect repair by cell transplantation.

  Further, the human chondrocyte phenotype maintenance agent of the present invention is used as a therapeutic agent for cartilage canlen disease, as well as a cartilage repair agent or a fracture repair promoter.

  Furthermore, since the human chondrocyte trait maintenance agent of the present invention can be maintained in human chondrocytes by being introduced into chondrocytes, the chondrocytes into which the agent has been introduced can be proliferated for transplantation. A sufficient amount and quality of chondrocytes can be provided. Therefore, the human chondrocyte trait maintenance agent of the present invention can also be used for a method of proliferating chondrocytes that can be practically used for transplantation of chondrocytes.

  Hereinafter, typical methods for using the human chondrocyte phenotype maintenance agent of the present invention will be specifically described.

2. Chondrocyte trait maintenance with human chondrocyte trait maintenance agent (chondrocyte trait maintenance method)
The human chondrocyte trait maintenance agent of the present invention is introduced into human chondrocytes to maintain the traits of the human chondrocytes, specifically, (1) progression of cartilage degeneration (chondrocyte dedifferentiation) It can suppress, (2) maintain chondrocyte differentiation, (3) repair degenerated cartilage to normal cartilage tissue, or (4) maintain protein of cartilage traits. Therefore, the present invention further provides a method for maintaining human chondrocyte traits, which comprises administering or adding the human chondrocyte trait maintenance agent to human chondrocytes. The human chondrocyte trait maintenance method is useful for the treatment of cartilage-related diseases.

  As a specific embodiment for treating cartilage-related diseases using a method for maintaining human chondrocyte traits, a method of administering directly to a treatment target site of a patient (for example, a cartilage degenerative lesion or its periphery) (in vivo method) Once the human chondrocytes are taken out of the patient's body and cultured together with the human chondrocyte trait maintenance agent of the present invention, the site to be treated again (for example, a cartilage degenerative lesion or its peripheral part) There are typically two types of methods (ex vivo method).

  Specifically, in the former in vivo method, the human chondrocyte trait maintenance agent of the present invention is directly administered (parenteral administration) to the cartilage tissue or cartilage site to be treated of the patient, or is orally administered to the patient. Makes it possible to maintain the traits of human chondrocytes. The method for parenteral administration of the human chondrocyte character maintenance agent of the present invention is not particularly limited. For example, when the agent is a polynucleotide, a polynucleotide sequence direct introduction method (in vivo method) can be used. In such a polynucleotide sequence direct introduction method (in vivo method), depending on the extent to which the cartilage degenerated tissue of the patient, or the degenerated cartilage tissue at the cartilage degeneration site is replaced with normal cartilage tissue or the distribution region of normal cartilage tissue is increased, The effect of the human chondrocyte trait maintenance agent of the present invention can also be determined.

  In the in vivo method, administration of the human chondrocyte trait maintenance agent of the present invention is not particularly limited as long as the integrin gene expression inhibitor, which is an active ingredient, is introduced into the target chondrocytes. Any viral introduction method may be used.

  Examples of viral introduction methods include a method using a retroviral vector as a vector. Other viral vectors include adenovirus vectors, HIV (human immunodeficiency virus) vectors, adeno-associated virus vectors (AAV), herpes virus vectors, herpes simplex virus (HSV) vectors and Epstein-Barr virus (EBV). : Epstein-Barr virus) vector.

  Non-viral introduction methods include, for example, calcium phosphate coprecipitation method; electroporation method; lipofection method; polyethylene glycol method; microinjection method; DEAE-dextran method; Membrane fusion liposome method in which inactivated Sendai virus is fused to produce a membrane fusion liposome, and the polynucleotide is introduced into the cell by directly fusing with the cell membrane [(Nakanishi M, et al. Exp Cell Res. 1985; 159 (2 ): 399-409.): Nakanishi, M., et al., Gene introduction into animal tissues.In Trends and Future Perspectives in Peptide and Protein Drug Delivery (Ed.by Lee, VH, et al.)., Harwood Academic Publishers Gmnh. Amsterdam, 1995; 337-349.]; A polynucleotide plasmid is coated with gold and the polynucleotide is physically introduced into the cell by high-pressure discharge. Naked polynucleotide method that directly injects oligonucleotide plasmids into organs and tumors in vivo; Cationics that introduce polynucleotide sequences to suppress integrin gene expression embedded in multi-layer positively charged liposomes Liposome method (Yagi, K., et al., Biochem. Biophys. Res. Commun., 196; 1042-1048.); The integrin gene expression-suppressing polynucleotide sequence is introduced into specific cells only, and then into other cells. In order to avoid this, a ligand-DNA complex method in which a ligand that binds to a receptor expressed in a target human chondrocyte is bound to the polynucleotide of the present invention and administered thereto; HVJ-liposome method; particle gun method Or a method using a gene gun can be used.

In the in vivo method, the dose of the human chondrocyte trait maintenance agent of the present invention can be appropriately set according to the type of integrin gene expression-suppressed substance, which is an active ingredient, the age and sex of the patient, the degree of disease, and the like. For example, when a vector containing an integrin gene expression inhibitor is used, the titer of the vector is preferably about 1 × 10 ³ pfu to 1 × 10 ¹⁵ pfu per day per kg body weight. In addition, the dose can be administered once or several times per 1 to 7 days, collectively or divided, and can be appropriately changed depending on the severity of symptoms and the judgment of a doctor.

  In carrying out the in vivo method, a PCR method is used to determine whether or not the target polynucleotide sequence is actually introduced by direct introduction of an integrin gene expression inhibitor, particularly in preliminary experiments outside the body. Confirmation by in situ PCR method or real-time RT-PCR method, or regulation effect of cartilage matrix gene expression, which is a desired therapeutic effect based on the introduction of integrin gene expression, especially increased expression of type II collagen and aggrecan It is desirable to confirm the increase in protein.

  When using viral vectors, human cartilage can be obtained by searching for proliferative retroviruses by PCR, measuring reverse transcriptase activity, or monitoring membrane protein (env) genes by PCR. Needless to say, it is important to confirm the safety of the integrin gene expression product when administering the cytoplasm maintenance agent.

  On the other hand, in the latter ex vivo method, after collecting chondrocytes from a patient having cartilage degeneration to be treated, collagen, gelatin, a monolayer culture condition in a dish-like container, or a portion having antigenicity removed, In scaffolds that serve as scaffolds such as fibrin, polyglycolic acid, polylactic acid, etc., after adding the chondrocytes and the human chondrocyte trait maintenance agent of the present invention to the culture solution, and co-culturing for several weeks In this method, the produced cartilage-like tissue is transplanted into a cartilage defect site or a cartilage degeneration site.

  Specifically, the ex vivo method includes a step of culturing human chondrocytes collected from a patient and the human chondrocyte phenotype of the present invention in coexistence, and the chondrocytes obtained by culturing the subject to be treated. It can be carried out by a step of returning to the site.

  The human chondrocyte used in the ex vivo method is preferably a patient's own lesion or a degenerated site chondrocyte, but if the cell is difficult to obtain, it has a high proliferative capacity and is expected to differentiate into cartilage. Bone marrow mesenchymal cells, synoviocytes, muscle-derived cells and fibroblasts can be substituted.

  In the ex vivo method, the step of culturing the chondrocytes and the human chondrocyte trait maintenance agent of the present invention in coexistence is performed by expressing integrin gene as an active ingredient of the human chondrocyte trait maintenance agent of the present invention in the chondrocytes. This is carried out by introducing a suppressor and culturing the chondrocytes into which the integrin gene expression inhibitor has been introduced.

  In order to introduce an integrin gene expression inhibitor into chondrocytes, for example, in the presence of a transfection reagent such as Lipofectamine 2000, the integrin gene expression inhibitor is present in a concentration range of 0.01 to 10 μmol / L. The chondrocytes may be incubated for a predetermined time. The concentration of the integrin gene expression inhibitor may be appropriately set based on the efficiency of introduction into the chondrocytes. The efficiency of introducing an integrin gene expression inhibitor into chondrocytes can be estimated, for example, by conducting a preliminary test using an integrin gene expression inhibitor labeled with a fluorescent dye: (1) For human osteoarthritis Human chondrocytes collected from articular cartilage obtained during surgery from affected knee joint replacement surgery were seeded on adherent cell culture plates, then 10% FBS, penicillin, streptomycin, and ascorbic acid ( (2) Pre-culture at 37 ° C. under 5% carbon dioxide gas condition using DMEM / F12 medium supplemented with 25 μg / mL). (2) Then, the cells are washed with PBS, and human chondrocytes are placed in a 12-well plate. Add 0.5 mL to each well, and incubate at 37 ° C for 24 hours under 5% carbon dioxide. (3) Add integrin gene expression inhibitor labeled with a fluorescent dye to each well along with the transfection reagent. After further 5% carbon dioxide conditions, for 24 hours at 37 ° C., and measuring the fluorescence intensity of the (4) chondrocytes.

  From the fluorescence intensity thus measured, the efficiency of introducing the integrin gene expression inhibitor into chondrocytes can be estimated. Furthermore, the degree of the integrin gene expression suppression effect of the integrin gene expression inhibitor is estimated by comparing the estimated value of the introduction efficiency thus estimated with the expression level of the integrin gene produced by the chondrocytes. You can also For such estimation, the case where no integrin gene expression inhibitor was added or the case where a non-specific oligonucleotide sequence was added was used as a control, and the expression level of the integrin gene was compared with the control. Values such as 50%, 60%, 70%, 80%, 90%, 95%, 99%, and 100% may be used as a reference.

  The ex vivo method for culturing chondrocytes includes a high density culture method for culturing collected chondrocytes at a high density, a pellet culture method for culturing in a single layer form in a dish-like container such as a pellet, a microgravity environment, etc. A culture method for culturing chondrocytes under the microgravity environment and a culture method for culturing chondrocytes in a scaffold material under the microgravity environment can be exemplified.

In addition, the step of returning the chondrocytes obtained by culturing to the treatment target site of the patient can be performed by, for example, converting chondrocytes into which an integrin gene expression inhibitor, which is an active ingredient, has been introduced into 1 × 10 ⁴ cells / body It may be transplanted to a site to be treated in a patient within a range of about 10 ¹⁵ cells / body.

  Hereinafter, embodiments of the ex vivo method will be described with specific examples. That is, the cartilage cells are first isolated by taking a patient's knee unloading part cartilage under a microscope and then dividing the obtained cartilage pieces into fragments and treating them with trypsin and collagenase. Subsequently, the human chondrocyte trait maintenance agent of the present invention is added to the obtained chondrocytes, for example, patient serum and antibiotics (Gibco) adjusted to 10% with physiological saline in the presence of Lipofectamine 2000. Incubate in Dulbecco's modified Eagle medium (Gibco) for 1 hour at 32 ° C. Next, after centrifuging at 2500 rpm, the collected chondrocytes are cultured at 37 ° C. under 5% carbon dioxide for 24 hours, and then the soluble polymer polyglycolic acid-polylactic acid or the antigenic part is removed. The gel is embedded in the atelocollagen gel and then cultured for 3 to 4 weeks. If necessary, growth factors involved in cartilage formation such as bFGF and TGF-β are also added. The medium is changed every 2 to 3 days. Thus, it is confirmed that the chondrocytes embedded within the culture period proliferate in the collagen gel or produce an extracellular matrix around them to become a cartilage-like tissue. Three to four weeks later, the joint cartilage injury site is developed by a technique such as joint incision, the cartilage-like tissue prepared ex vivo is transplanted into the cartilage defect of the patient, and the surrounding area is patched with a separately collected periosteum. Sew on the cartilage. Thus, the intended human chondrocyte trait maintenance agent of the present invention can be obtained after co-culturing human chondrocytes with chondrocytes obtained from human chondrocytes collected from a patient having a cartilage degeneration site and introducing and culturing them into human chondrocytes. A human chondrocyte phenotype maintenance method (ex vivo method) in which human chondrocytes are reimplanted again into a cartilage degeneration site or a cartilage degeneration lesion tissue of a patient can be performed.

  In the ex vivo method described above, the efficiency of introducing the human chondrocyte character maintenance agent of the present invention into cells can be confirmed by using the Alcian blue positive staining method. That is, after completion of the culture, a part of the cell layer was taken out, fixed with a 4% paraformaldehyde solution (Wako Pure Chemical Industries, Ltd.) at room temperature for 2 hours, and washed with distilled water and 5% acetic acid at pH 1.0. The cartilage matrix is stained with Alcian blue solution pH 1.0 (manufactured by Wako Pure Chemical Industries, Ltd.) at room temperature for 2 hours. Next, after washing with 5% acetic acid and distilled water and drying, 6 mol / L guanidine hydrochloride (manufactured by Nacalai Tesque) solution is added to the cell layer to extract the dye, and the microplate reader (manufactured by Bio-Rad) is extracted. Measure the absorption at 630 nm and measure the intensity of Alcian blue staining. The effect of the human chondrocyte trait maintenance method of the present invention can also be determined by determining the presence or absence of an effect of promoting cartilage matrix production from the degree of increase in the intensity of Alcian blue positive staining measured in comparison with that immediately after the start of culture.

  In addition, when the morphology of the cells at the end of the culture is observed using a phase contrast microscope, whether or not a round and altered cell morphology indicating that the substrate production of the cultured chondrocytes is enhanced is observed, or the cartilage The human chondrocyte trait of the present invention depends on whether cell differentiation is enhanced, and whether a typical mature chondrocyte-like morphology with a wide interval between cells showing a strong enhancement of cartilage matrix production is observed. The effect of the maintenance agent can also be determined.

  Furthermore, as another method, after completion of the culture, a part of the cell layer is taken out, and using in situ PCR method or real-time RT-PCR method, (1) type I collagen gene and / or type III Suppress or maintain the expression of collagen genes; (2) increase or maintain the expression of type II collagen genes and / or aggrecan genes; The effect of the human chondrocyte trait maintenance agent of the present invention can also be determined by measuring by a usual method using a probe.

  As another method, after completion of the culture, a part of the cell layer is taken out, and the cells are used with the above-described antibodies against type I collagen, type II collagen, type III collagen aggrecan (monoclonal antibody or polyclonal antibody). (1) maintained or increased production of type II collagen and / or aggrecan protein, which is a major component of the cartilage matrix expressed above, and / or (2) type I collagen and / or Alternatively, the effect of the human chondrocyte trait maintenance agent of the present invention can also be determined by confirming by Western blot analysis whether the production of type III collagen protein is reduced or maintained. In this method, flow cytometry analysis using a PE-labeled anti-type I collagen monoclonal antibody, a PE-labeled anti-type II collagen monoclonal antibody, a PE-labeled anti-type III collagen monoclonal antibody, and a PE-labeled anti-aggrecan monoclonal antibody is performed on chondrocytes. Can also be performed.

  In addition, after returning the chondrocytes to the diseased tissue of the patient again by the ex vivo method described above, the human chondrocyte trait maintenance agent of the present invention may be administered again by the in vivo method described above.

3. Method of proliferating chondrocytes Further, chondrocytes introduced with an integrin gene expression inhibitor, which is an active ingredient of the human chondrocyte trait maintenance agent, by culturing human chondrocyte trait maintenance agent and human chondrocyte coexisting Can be grown. That is, the present invention further provides a method of proliferating chondrocytes, characterized by obtaining proliferated chondrocytes by co-culturing human chondrocyte trait maintenance agent and human chondrocytes. Since the chondrocytes proliferated by the proliferation method are excellent in phenotype maintenance action, they can be used for chondrocyte transplantation, preferably autologous chondrocyte transplantation.

  In this proliferation method, the amount of human chondrocyte phenotype maintenance agent, the chondrocyte culture method, and the like are the same as in the ex vivo method in the above section.

4). Chondrocytes into which an integrin gene expression inhibitor is introduced The present invention also provides a chondrocyte into which an integrin gene expression inhibitor that is an active ingredient of a human chondrocyte trait maintenance agent is introduced. A pharmaceutical composition or pharmaceutical preparation (gene therapy agent) in which a pharmaceutically effective amount of the chondrocytes is mixed with an appropriate non-toxic pharmaceutical carrier or diluent is useful as a therapeutic agent for the aforementioned cartilage-related diseases.

  As a pharmaceutical carrier that can be used for the pharmaceutical composition (pharmaceutical preparation) containing the above chondrocytes, a filler, a bulking agent, a binder, a moistening agent, a disintegrating agent, a surface, which are usually used according to the use form of the preparation. Examples include diluents or excipients such as active agents and lubricants, and these can be appropriately selected and used depending on the dosage unit form of the resulting preparation.

  The chondrocytes may be those that retain the integrin gene expression inhibitor, which is an active ingredient of the human chondrocyte phenotype, in the form of a polypeptide as it is, or a polypeptide that functions as an integrin gene expression inhibitor. The vector containing the encoding polynucleotide may be retained in the cell.

  The pharmaceutical composition (pharmaceutical preparation) containing the chondrocytes may be in a form in which the chondrocytes are mixed in a phosphate buffered saline (pH 7.4), Ringer's solution, or an injection solution for intracellular composition. .

  The administration method of the pharmaceutical composition (pharmaceutical preparation) is not particularly limited. For example, the pharmaceutical composition (pharmaceutical preparation) is administered to a degenerated cartilage site or its peripheral part such as in a knee joint cavity or knee joint tissue. It is determined according to gender and other conditions and the degree of disease.

The amount of active ingredient (chondrocytes) to be contained in the pharmaceutical composition (pharmaceutical preparation) and the dosage thereof are not particularly limited, and the desired therapeutic effect, administration method, treatment period, patient age, sex It is appropriately selected from a wide range according to other conditions. In general, the chondrocytes are suitably selected from the range of about 1 × 10 ⁴ cells / body to 1 × 10 ¹⁵ cells / body.

  The pharmaceutical composition (pharmaceutical preparation) can be administered once or several times a day, and can be intermittently administered at intervals of 1 to several weeks.

5. Method for screening drug candidate substance
5-1. Screening method for substances having human chondrocyte character maintenance action-1
The present invention also provides a method for screening a substance having a human chondrocyte character maintaining action. Specifically, the screening method is performed through the following steps (1) to (5):
(1) a step of adding a candidate substance to a culture medium of human chondrocytes forming a monolayer,
(2) Measuring the level of expression of at least one gene selected from the group consisting of integrin α5 gene, integrin αv gene, integrin β1 gene, integrin β3 gene, and integrin β5 gene in the presence and absence of candidate substances The process of
(3) For the candidate substance that suppressed the gene expression in the step (2), the expression of type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene in the culture medium of step (1) Measuring the degree,
(4) In the step (3), a step of selecting a substance having the following action (a) and / or (b) as a substance having a human chondrocyte character maintaining action:
(a) suppress or maintain expression of type I collagen gene and / or type III collagen gene,
(b) Increase or maintain the expression of type II collagen gene and / or aggrecan gene.

  Candidate substances subjected to screening by this screening method include, for example, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma, and the like. These compounds may be novel compounds or known compounds.

  In the step (2), the expression level of the integrin gene can be measured by a known method using a primer or probe for integrin gene expression measurement. In addition, a primer sequence pair or probe sequence for measuring each integrin gene expression can be appropriately set by those skilled in the art based on known gene sequence information. The expression level of the target gene can be measured using, for example, an in situ PCR reaction or RT-PCR reaction method, or a detection method using a DNA chip can be used.

  In the above step (2), for example, in the case of each test, the degree of suppression of integrin gene expression of the candidate compound is about 20% or more, preferably about 30% or more, compared to the absence of the control or candidate substance. More preferably, when it is suppressed by about 50% or more, the candidate substance is selected as a target for the next step (3).

  Furthermore, in the above step (3), the expression level of the type I collagen gene, type II collagen gene, type III collagen gene, and / or aggrecan gene is also measured using the primer or probe for gene expression measurement, This can be carried out by a known method, and the sequences of these primers or probes can be appropriately set by those skilled in the art based on known gene sequence information.

  In the above step (4), (a) the effect of suppressing or maintaining the expression of type I collagen gene and / or type III collagen gene is about 20% or more compared with the absence of control or candidate compound, preferably When it is about 30% or more, more preferably about 50% or more, the candidate substance can be a substance having a human chondrocyte character maintaining action. In addition, (b) the effect of increasing or maintaining the expression of type II collagen gene and / or aggrecan gene is about 20% or more, preferably about 30% or more, more preferably compared to the absence of a control or candidate compound. Is about 50% or more, the candidate substance can be a substance having a human chondrocyte character maintaining action.

  Substances having a human chondrocyte character maintaining action selected by the above screening methods include, for example, cartilage disease, osteoarthritis, cartilage softening, amputated osteochondritis, rheumatoid arthritis, intervertebral disc degeneration, disc herniation, Cartilage degenerative diseases such as non-corrosive necrosis of subchondral bone with cartilage degeneration, various bone diseases (eg, achondroplasia or Morquio disease); after cartilage injury or excision due to trauma or surgery, or after osteotomy; It can be used as a therapeutic agent for cartilage-related diseases such as congenital cartilage hypoplasia and malformation.

  When the “substance having human chondrocyte character maintenance activity” selected using the screening method of the present invention is used as a medicine, it can be carried out according to conventional means. For example, in the same manner as the human chondrocyte phenotype maintenance agent of the present invention described above, an injection, tablet, capsule, elixir, microcapsule, sterile solution, suspension and the like can be used.

  The dose of the “substance with human chondrocyte character maintenance action” selected by the screening method of the present invention varies depending on the target disease, administration subject, administration route, etc., but for example, the substance is a low molecular compound. In the case of parenteral administration for the purpose of human cartilage degenerative disease, generally in an adult (with a body weight of 60 kg), the compound is about 0.01 μg to 30 mg per day, preferably about 0.1 μg to It is convenient to administer about 10 mg, more preferably about 1.0 μg to 1 mg by intravenous injection. The preparation may be administered once to several times a day.

5-2. Screening method of substance having human chondrocyte character maintenance action-2
Furthermore, this invention provides the screening method of the substance which has a human chondrocyte character maintenance effect | action as another embodiment different from the above. Specifically, the screening method is performed through the following steps (1) to (5):
(1) a step of adding a candidate substance to a culture medium of human chondrocytes forming a monolayer,
(2) Measuring the level of expression of at least one gene selected from the group consisting of integrin α5 gene, integrin αv gene, integrin β1 gene, integrin β3 gene, and integrin β5 gene in the presence and absence of candidate substances The process of
(3) For the candidate substances that suppressed the gene expression in the step (2), further measure the values of type I collagen protein, type II collagen protein, type III collagen protein, and aggrecan protein in the culture medium of step (1) The process of
(4) In the step (3), a step of selecting a substance having the following action (a) and / or (b) as a substance having a human chondrocyte character maintaining action:
(a) suppress or maintain expression of type I collagen protein and / or type III collagen protein,
(b) Increase or maintain the expression of type II collagen protein and / or aggrecan protein.

  The embodiment of the present screening method, the method of using the substance obtained by the screening method, and the like are the same as the above-described “Method 1 for screening substance having human chondrocyte phenotype maintaining action”.

5-3. Method for screening a substance having an effect of regulating human cartilage matrix gene expression-3
In addition, the present invention provides a method for screening a substance having a human chondrocyte phenotype maintaining activity as another embodiment different from the above. Specifically, the screening method is performed through the following steps (1) to (5):
(1) a step of adding a candidate substance to a culture medium of human chondrocytes forming a monolayer,
(2) Measuring the level of expression of at least one gene selected from the group consisting of integrin α5 gene, integrin αv gene, integrin β1 gene, integrin β3 gene, and integrin β5 gene in the presence and absence of candidate substances The process of
(3) For the candidate substance that suppressed the gene expression in the step (2), the chondrocytes obtained from the culture medium of the step (1) are further fixed and stained with an Alcian blue solution, and the absorbance of the Alcian blue staining Measuring process,
(4) A step of selecting a substance having a significant difference in Alcian blue staining intensity as a substance having a human chondrocyte character maintaining action in the step (3) as compared with a value in the absence of a candidate substance.

  The embodiment of the present screening method, the method of using the substance obtained by the screening method, and the like are the same as the above-described “Method 1 for screening substance having human chondrocyte phenotype maintaining action”.

5-4. Method for screening substance having human cartilage matrix gene expression regulating action Furthermore, the present invention provides a method for screening a substance having human cartilage matrix gene expression regulating action. Specifically, the screening method is performed through the following steps (1) to (5):
(1) a step of adding a candidate substance to a culture medium of human chondrocytes forming a monolayer,
(2) Measuring the level of expression of at least one gene selected from the group consisting of integrin α5 gene, integrin αv gene, integrin β1 gene, integrin β3 gene, and integrin β5 gene in the presence and absence of candidate substances The process of
(3) For the candidate substance that suppressed the gene expression in the step (2), the expression of type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene in the culture medium of step (1) Measuring the degree,
(4) In the step (3), a step of selecting a substance having the following action (a) and / or (b) as a substance having a human cartilage matrix gene expression regulating action:
(a) suppress or maintain expression of type I collagen gene and / or type III collagen gene,
(b) Increase or maintain the expression of type II collagen gene and / or aggrecan gene.

  The embodiment of the present screening method, the method of using the substance obtained by the screening method, and the like are the same as the above-described “Method 1 for screening substance having human chondrocyte phenotype maintaining action”.

6). Screening Kit The present invention further provides a kit for simply carrying out the screening method. That is, the present invention contains at least one primer or probe for detecting the expression of an integrin gene in human chondrocytes and at least one primer or probe for detecting the expression of a human cartilage matrix gene as constituents. A screening kit for screening a substance having a human chondrocyte phenotype maintaining action or a human cartilage matrix gene expression regulating action is provided.

Examples of a kit for screening for a substance having a human chondrocyte phenotype maintaining activity include those comprising the following components.
1. A kit for screening a substance having a human chondrocyte character-maintaining action, comprising at least the following components (a) to (e):
(a) a culture solution of human chondrocytes forming a monolayer,
(b) a primer pair or a probe for measuring expression of at least one gene selected from the group consisting of an integrin α5 gene, an integrin αv gene, an integrin β1 gene, an integrin β3 gene, and an integrin β5 gene;
(c) Primer pairs or probes for measuring expression of each type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene,
(d) PCR reaction reagents, and
(e) Each of the above gene expression detection reagents.

2. A kit for screening a substance having a human chondrocyte character-maintaining action, comprising at least the following components (a) to (f):
(a) a culture solution of human chondrocytes forming a monolayer,
(b) a primer pair or a probe for measuring expression of at least one gene selected from the group consisting of an integrin α5 gene, an integrin αv gene, an integrin β1 gene, an integrin β3 gene, and an integrin β5 gene;
(c) PCR reaction reagent,
(d) each of the above gene expression detection reagents,
(e) each labeled anti-type I collagen protein antibody, labeled anti-type II collagen protein antibody, labeled anti-type III collagen protein antibody, and / or labeled anti-aggrecan protein antibody reagent, and
(f) Reagent for detecting labeled antibody.

3. A kit for screening a substance having a human chondrocyte character-maintaining action, comprising at least the following components (a) to (g):
(a) a culture solution of human chondrocytes forming a monolayer,
(b) a primer pair or a probe for measuring expression of at least one gene selected from the group consisting of an integrin α5 gene, an integrin αv gene, an integrin β1 gene, an integrin β3 gene, and an integrin β5 gene;
(c) PCR reaction reagent,
(d) each of the above gene expression detection reagents,
(e) cell fixative (4% paraformaldehyde solution),
(f) Alcian blue liquid, and
(g) Guanidine hydrochloric acid solution.

4). A kit for screening a substance having an action of regulating human cartilage matrix gene expression, comprising at least the following components (a) to (e):
(a) a culture solution of human chondrocytes forming a monolayer,
(b) a primer pair or a probe for measuring expression of at least one gene selected from the group consisting of an integrin α5 gene, an integrin αv gene, an integrin β1 gene, an integrin β3 gene, and an integrin β5 gene;
(c) Primer pairs or probes for measuring expression of each type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene,
(d) PCR reaction reagent,
(e) Each of the above gene expression detection reagents.

  Each kit described above can contain various reagents such as a cell culture solution, a reaction diluent, a staining agent, a labeling agent, a buffer solution, a fixing solution, and a cleaning agent as optional components together with the above-described components.

Examples are given below to illustrate the present invention in more detail. These examples are illustrative only and do not limit the invention. Hereinafter, in the examples, unless otherwise specified, the unit “%” means “% (w / w)”.
Example 1
I. Chondrocyte collection and culture Using articular cartilage obtained at the time of surgery from 14 knee joints (patient age 59-72 years, average 65 years old) suffering from osteoarthritis and undergoing artificial joint replacement surgery, This was treated with 0.5% pronase (Pronase: manufactured by Calbiochem) and 0.025% collagenase (collagenase P: manufactured by Roche Diagnostics, Basel, Switzerland) to isolate chondrocytes.

The isolated chondrocytes are cleaved into siRNA [small interference RNA: long double-stranded RNA, which is a double-stranded RNA consisting of a small RNA of about 21 nucleotides in the cell] Interference method that has been found to function as a molecule with target gene inhibitory activity and can produce an RNA interference effect without activating the interferon system by introducing siRNA having homology with the target gene into mammalian cells (Elbashir SM, et al. Nature. 2001; 411 (6836): 494-8.). Integrin α5, integrin αv, integrin β1, integrin β5 gene-specific RNA targeted in the present invention using a gene function suppression system that more specifically suppresses only a specific gene complementary to a portion having a length of about 20 nucleotides Was introduced into a 12-well adherent cell culture plate (Iwaki, Tokyo), 10% FBS (fetal bovine serum), penicillin, streptomycin, and ascorbic acid ( The cells were cultured in a DMEM / F12 culture medium (Gibco) supplemented with 25 μg / mL). The cell density at the time of culture was approximately 4 to 5 × 10 ⁴ / cm ² .

II. Introduction of siRNA and siRNA All siRNAs for integrin were purchased from Qiagen (Qiagen, Tokyo). The base sequences and catalog numbers of siRNA and control siRNA for integrins α5, αv, β1, and β5 are as follows. In the case of RNAi, considering the off-target effect (siRNA shows the activity of cleaving mRNA other than the originally planned mRNA), it was confirmed that similar results were obtained using at least two siRNAs per molecule. .
Integrin α5-1: UUAGUGUUCUUUGUUGGCC (Cat. No. SI00034195); SEQ ID NO: 1
Integrin α5-4: UUCAAGUAUGUCUCUGGGC (Cat. No. SI00034216); SEQ ID NO: 2
Integrin αv-1: UAAAUCUAUAAUAAAGUUGdCdT (Cat. No. SI00034335); SEQ ID NO: 4
Integrin αv-2: UAUUCCUGUAACAUCAUGCdTdA (Cat. No. SI00034342); SEQ ID NO: 5
Integrin αv-5: UUAUUCAUCAAACUACUACdAdT (Cat. No. SI02628108); SEQ ID NO: 6
Integrin β1-1: UUCAUUUGUAUUAUCCCUCdTdT (Cat. No. SI02628115); SEQ ID NO: 3
Integrin β1-5: Sequence not provided (Cat.No.SI00300573)
Integrin β5-1: UUUGAAGCCAUUUCAUAGCdGdG (Cat. No. SI00034412); SEQ ID NO: 7
Integrin β5-2: UUCACGAUGGUGUCCACCCdAdT (Cat. No. SI00034419); SEQ ID NO: 8
Control: ACGUGACACGUUCGGAGAAdTdT (Cat. No. 1022076); SEQ ID NO: 9
(The branch number after the molecular name is the siRNA identification number; the control is siRNA against glyceraldehyde 3-phosphate dehydrogenase (GAPDH))
Introducing siRNA into chondrocytes using Nucleofector (registered trademark) and primary cultured human articular chondrocyte buffer (both from Amaxa, Germany) immediately after enzymatic digestion, and by electroporation according to the company's protocol went. That is, 1 × 10 ⁶ chondrocytes were used for one introduction of siRNA, suspended in a dedicated buffer solution, and then electroporated with 1.5 μg of each siRNA.

  The cell viability by this method was approximately 60 to 70%, and the introduction efficiency of siRNA was estimated to be approximately 60% from the results of preliminary experiments using siRNA labeled with a fluorescent dye.

III. Quantitative evaluation by PCR Extraction of total RNA from cultured cells was performed using RNeasy kit (Qiagen) according to the attached protocol.

  All samples were treated with DNaseI (Qiagen) to avoid genomic DNA contamination. From each sample, 1 μg of total RNA was used to synthesize cDNA using AMV reverse transcriptase (Avian myeloblastosis virus reverse transcriptase: AMV-RT, manufactured by Roche Diagnostics), and quantitative PCR was performed using the light cycler (LightCycler: Roche Diagnostics).

  For PCR, LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics) was used according to the attached protocol. The amount of PCR product produced during PCR was measured by quantifying the fluorescence emitted from SYBR Green dye bound to the PCR product.

The base sequences of primers used for quantitative PCR are as follows. Hereinafter, “GAPDH” refers to glyceraldehyde 3-phosphate dehydrogenase, “Col2” refers to type II procollagen, “Col3” refers to type III procollagen, and “Aggrecan” refers to aggrecan.
GAPDH: Forward 5'- CAGGGACTCCCCAGCAGT -3 '; SEQ ID NO: 10
Reverse 5'-GGCATTGCCCTCAACGACCA -3 '; SEQ ID NO: 11
Col2: Forward 5'- GACATAGGAGGGCCCGAGCA -3 '; SEQ ID NO: 12 [4405-4424]
Reverse 5'- CGGCACCTGAAGGGAGGTCT -3 '; SEQ ID NO: 13
Col3: Forward 5'- TCGAACACGCAAGGCTGTGA -3 '; SEQ ID NO: 14 [4410-4429]
Reverse 5'-TGTCGGTCACTTGCACTGGTTGA -3 '; SEQ ID NO: 15
Aggrecan: Forward 5'-GCACGAGAAGGGCGAGTGGA-3 '; SEQ ID NO: 16 [6864-6883]
Reverse 5'- GCTCCTGGGCTCAGCGTCCT -3 '; SEQ ID NO: 17
The PCR reaction protocol is the same for all primer sets. After activating DNA synthase in steps of 95 ° C for 10 minutes, a thermal cycle of 95 ° C for 10 seconds, 60 ° C for 15 seconds, and 72 ° C for 6 seconds is performed. I went twice. For each reaction, the melting curve of the PCR product was analyzed to confirm that a single PCR product was obtained.

IV. Measurement of type II collagen and sulfated proteoglycan production
In order to measure the production of type II collagen and proteoglycan in chondrocytes into which siRNA has been introduced, siRNA against integrin αv (Cat. No. SI00034335; SEQ ID NO: 4) or control siRNA for 3 × 10 ⁶ chondrocytes (Cat. No. 1022076; SEQ ID NO: 9) was each introduced by electroporation three times, and the chondrocytes after the introduction were maintained in monolayer culture. The sulfated glycosaminoglycan (sGAG) produced by chondrocytes on the 3rd, 5th, and 7th days after the start of culture was converted to sulfated glycosaminoglycan test kit (sGAG test). kit: Evaluated by measuring with Wieslab, Lund, Sweden).

  Quantification of type II collagen produced up to 7 days after the start of culture was performed as follows. 200 μL of RIPA lysis buffer (50 mM Tris-HCL, pH 7.4, 150 mM NaCl, 1% (v / v) Triton X-100 containing protease inhibitor (Complete Mini, Roche Diagnostics) , 1% (w / v) sodium deoxycholate, 0.1% (w / v) SDS, pH 8.0), and the insoluble fraction contained therein was obtained by centrifugation, and then in the resulting pellet. The amount of type II collagen was measured using a kit (Native type II collagen detection kit: manufactured by Chondrex, Redmond, WA, USA). Next, in order to eliminate the effect of fluctuations in the number of cells associated with electroporation from these measured values, the amount of DNA in the recovered RIPA lysis buffer supernatant was determined using the Quant-iT DNA Assay Kit (Invitrogen). Measured values of sulfated glycosaminoglycan and type II collagen were corrected with the amount of DNA obtained.

  As a result, as shown in FIG. 1, the results of siRNA against integrin β1 (SEQ ID NO: 3 and the RNA sequence of Cat. No. SI00300573) show that the effect of the siRNA is the highest from 4 to 5 days after the start of monolayer culture. It appeared strongly.

  SiRNA against integrin β1 decreased the expression of type I and type III procollagen from 3 to 7 days after the start of monolayer culture (see FIG. 2). Suppression of type I and type III procollagen was observed most strongly on the fifth day after the start of monolayer culture, and the expression of type III procollagen decreased on average by 41%. On the other hand, type II procollagen or aggrecan expression was not significantly changed during the period (maintenance or suppression of cartilage matrix gene expression) (see FIG. 2).

  The effect of siRNA on integrin α5 (RNA sequence of SEQ ID NO: 1 or SEQ ID NO: 2) was basically similar to those on integrin β1. The result is shown in FIG. When expression of type II procollagen and aggrecan remained almost unaffected, expression of type I and type III procollagen was significantly suppressed (maintenance or suppression of cartilage matrix gene expression).

  In the case of siRNA against integrin β1, the expression of type I and type III procollagen decreased most strongly on the fifth day after the start of monolayer culture, but the decrease in type III procollagen expression averaged 27%. The effect of siRNA on integrin α5 in reducing type III procollagen expression was somewhat weaker than that of siRNA on integrin β1.

  From the above results, it can be seen that integrin α5β1 is responsible for abnormal collagen induction in chondrocytes in the process of dedifferentiation, and control of integrin α5β1 activity is an abnormal gene in cultured chondrocytes. It is thought to be useful for preventing expression.

  Similar experiments were performed using siRNA for integrin αv (RNA sequence of SEQ ID NO: 4-6) and siRNA for integrin β5 (RNA sequence of SEQ ID NO: 7 or 8).

  As a result, as shown in FIG. 4, the introduction of siRNA for integrin αv (RNA sequence of SEQ ID NO: 4-6) hardly affected the expression of type II procollagen and aggrecan, and the expression of type III procollagen was Maintained.

  On the other hand, as shown in FIG. 5, the effect of siRNA (integer No. 7 or 8 RNA sequence) on integrin β5 was most strongly observed on day 5 after the start of culture in monolayer cultured chondrocytes, and type II procollagen Expression or aggrecan expression was increased, and expression of type III procollagen was maintained (maintenance or elevation of cartilage matrix gene expression).

  From the above results, it can be seen that integrin αvβ5 is responsible for the loss of cartilage matrix gene expression observed during the dedifferentiation process, and the control of integrin αvβ5 activity is the cartilage matrix in cultured chondrocytes. It is considered useful for maintaining gene expression.

  In the surface layer of cartilage degeneration, phenotypic changes in chondrocytes, similar to those observed in monolayer cultured chondrocytes, decreased relative production of type II collagen and aggrecan, induction of expression of type III collagen Suppresses cartilage degeneration by maintaining chondrocyte dedifferentiation, maintaining chondrocyte trait maintenance (chondral matrix gene expression regulating action), and restoring reduced cartilage matrix production ability It becomes possible to do. Human chondrocyte phenotype maintenance agent or cartilage matrix gene expression regulator comprising as an active ingredient an integrin gene expression inhibitor having the above action is a chondrogenesis promoter, an articular cartilage degeneration inhibitor that prevents joint deformation, It can be used as a cartilage repair agent or a cartilage regenerative agent that can promote differentiation traits.

  Accompanied by osteoarthritis, cartilage softening, amputated osteochondritis, rheumatoid arthritis, intervertebral disc degeneration, intervertebral disc herniation, cartilage degeneration by providing each of the above-mentioned human chondrocyte trait maintenance agents or cartilage matrix gene expression regulators Cartilage degenerative diseases such as non-rotating necrosis of subchondral bone, various bone diseases (for example, achondroplasia or Morquio disease); after cartilage damage or excision due to trauma or surgery, or after osteotomy; congenital cartilage It can be used as a therapeutic agent for cartilage-related diseases such as hypoplasia and malformation.

Example 2 Effect of Integrin Expression Suppression on Cartilage Matrix Protein Production Chondrocytes isolated from human articular cartilage by enzymatic digestion are electroporated with integrin αv, integrin β5 siRNA, or control siRNA immediately after isolation. The cells were introduced and maintained in monolayer culture. At one week from the start of culture, the cell culture layer was collected with RIPA buffer, the type II collagen and DNA were quantified, the type II collagen production was corrected by the amount of DNA, and then the siRNA for integrin was introduced and the control siRNA The type II collagen production was compared between the introduced groups. Approximately 3 × 10 ⁶ cells were used for a single quantification.

  Quantification of type II collagen protein was measured using an ELISA kit for collagen measurement (Native Type II Collagen ELISA Kit: catalog No. 6009: manufactured by Chondrex). That is, in the section IV of Example 1, after removing the cell culture medium from the monolayer cultured chondrocytes obtained after each siRNA was introduced, the cell monolayer of 1 well of the 12-well cell culture plate used 0.5 mL of 0.05M acetic acid (prepared to pH 2.8-3.0 with formic acid) was added to the cells, and the cells were transferred to a centrifuge using a cell scraper.

Then add 1/10 of the starting volume of pepsin solution (1-10 mg / mL dissolved in 0.05 M acetic acid) and digest the collagen overnight at 4 ° C. with gentle agitation on the rotor. X 1/10 of the starting volume of TSB solution (1.0 M Tris-2.0 M NaCl-59 mM CaCl ₂ , pH 7.8-8.0) was added and adjusted to pH 8.0 with 1N NaOH. Then add 1/10 of the starting volume of pancreatic elastase solution (1 mg / mL dissolved in 1x TSB, pH 7.8-8.0) and incubate for 30 min at 35 ° C with gentle agitation on the rotor. (This digests the internal or internal cross-links in the collagen molecule of the polymer to make the remaining polymer collagen simple), and centrifuges the sample at 10,000 rpm for 5 minutes at room temperature to obtain a supernatant. It was.

  Next, dilute the supernatant with the sample / standard dilution buffer (B) and use the Native Type II Collagen Detection Kit to use the ELISA method using the type II collagen capture antibody and the type II collagen detection antibody. The amount of type II collagen in the chondrocytes was measured by measuring at a wavelength of 490 nm.

  The DNA amount was measured using a Quant-iT DNA Assay Kit (manufactured by Invitrogen) according to the instruction manual (http://www.invitrogen.co.jp/). That is, 100 μL of component A (Quant-iT DNA BR reagent solution) and 20 mL of component B (Quant-iT DNA BR buffer solution) were added to a 96-well plastic dish and mixed and diluted.

  In each microplate, 200 μL of the sample solution diluted 1: 200 times in DMSO was added. The amount of additive in each final reaction solution in the measurement was 10 mM sodium chloride, 2 mM magnesium chloride, 10 mM sodium acetate, 10 mM ammonium acetate, 5 mM potassium acetate, pH 7.4, 1% ethanol, 0.1% phenol, 0.2% chloroform. 0.01% SDS, 0.010% Triton X-100, 100 μM dNTPs (dATP, dCTP, dGTP, and dTTP), 20 μg / mL BSA, 10 μg / mL IgG. Then, 10 μL of component C (each λDNA standard, 8 steps, 0, 5, 10, 20, 40, 60, 80, 100 ng / μL) was added to different wells and mixed well. Then, to another well, 20 μL of each sample was added and mixed well. After reacting for 5 minutes at room temperature, DNA was quantified by measuring the amount of fluorescent dye bound to the nucleic acid at a wavelength of 527 nm. Finally, the amount of DNA was obtained by calculation based on the regression line obtained based on the analysis result of the standard.

  As a result, when two types of siRNA (SEQ ID NOs: 4 and 6) were used to suppress integrin αv expression, type II collagen production as measured by ELISA was the control siRNA (SEQ ID NO: 9). ) Increased by 1.72 ± 0.30 times with respect to the chondrocytes introduced, and the case of SEQ ID NO: 6 showed an increase of 1.42 ± 0.2 times with respect to the chondrocytes introduced with the control siRNA.

  Next, when two types of siRNA (SEQ ID NOs: 7 and 8) were used to suppress the expression of integrin β5, the production of type II collagen measured by ELISA was the case of SEQ ID NO: 7, and the cartilage into which control siRNA was introduced. The cell number increased 1.54 ± 0.13 times, and SEQ ID NO: 8 showed a 1.66 ± 0.25 times increase over chondrocytes transfected with control siRNA.

  As described above, administration of an integrin gene expression inhibitor increases the production of cartilage matrix protein, and the integrin gene expression inhibitor can be expected to have an effect as an active ingredient of a human chondrocyte trait maintenance agent.

Example 3 Examination of production of sulfated proteoglycan by uptake of [ ³⁵ S] sulfate Immediately after isolation of chondrocytes isolated from human articular cartilage by enzymatic digestion, two types of siRNA ( In order to suppress the expression of SEQ ID NOs: 4 and 6), two types of siRNA (SEQ ID NOs: 7 and 8) or control siRNA (SEQ ID NO: 9) were introduced by electroporation to suppress the expression of integrin β5. The cells were maintained in monolayer culture.

[ ³⁵ S] sulfuric acid was added to 20 μCi / mL of one group of culture broth divided at the time of 5 days from the start of culture, and the produced sulfated proteoglycan was labeled. ^[35 S] Cell culture layer was recovered with 2 groups in 8 hours after the addition of sulfuric acid, ^[35 S] labeled group Masuda et al method by sulfuric acid (Masuda, K., et al, Analytical Biochemistry, 1994:. 217 , 167-175) quantified proteoglycan production, and the other group measured the amount of DNA using the Quant-iT DNA Assay Kit (manufactured by Invitrogen) to detect uptake of [ ³⁵ S] sulfate per 1 μg of DNA. Comparison was made between the group introduced with siRNA for αv or integrin β5 and the group introduced with control siRNA.

That is, siRNA for integrin αv or integrin β5 or control siRNA (SEQ ID NO: 9) was introduced by electroporation, and the resulting cells were equally divided into two to prepare a 12-well cell culture dish (manufactured by Iwaki). Each well was seeded and cultured and maintained daily using DMEM / F12 (50:50) medium containing 10% FBS, 50 μg / mL gentamicin, 25 μg / mL ascorbic acid (pH 7.2). . At the 5th day after the start of the culture, 20 μCi / mL of [ ³⁵ S] sulfuric acid was added and incubated for 12 to 18 hours. Then, the medium was removed, and the proteoglycan contained in the cell layer was replaced with a proteinase inhibitor (0.1M 6-aminohexanic). 4M guanidine hydrochloride and 0.05M sodium acetate solution (pH 6.0) containing acid, 0.01M EDTA, 0.005M benzamidine hydrochloride, 0.01M N-ethylmaleimide, and 0.001M phenylmethylsulfonylsulfonyl fluoride) 500 μl was added per well of the dish and extracted by gently shaking at 4 ° C. for 4 hours.

  The quantification of sulfated proteoglycan extracted in guanidine solution was performed using Alcian Blue, which has the property of forming a complex with glucosaminoglycan contained in proteoglycan.

Alcian blue was prepared as a 0.2% (w / v) solution in 0.05 M sodium acetate, pH 5.8 containing 0.085 M MgCl _2, and a fresh one within 2 weeks after preparation was used. Unless otherwise indicated, Alcian Blue (Catalog No. 161-0401, Batch 12H-4375: electrophoresis purification reagent) from Bio-Rad was used. For separation of the Alcian blue and glucosaminoglycan complex, a 96-well plate having a Millapore Durapore membrane (0.45 μm hole diameter) at the bottom was used. After adding 75 μL of dilution buffer (0.05 M sodium acetate with 0.5% Triton X-100, pH 5.8) to each well of this 96-well plate, then adding 25 μL of sample and 150 μL of Alcian blue dye solution The plate was gently shaken for 1 hour at room temperature to form an Alcian blue complex. Thereafter, the 96-well plate was attached to a vacuum manifold, and negative pressure was applied through the Durapore membrane to remove the buffer solution containing unincorporated [ ³⁵ S] sulfuric acid. Next, the operation of adding 200 μL of a buffer (0.1 M sodium sulfate, 0.05 M sodium acetate containing 0.05 M MgCl ₂ , pH 5.8) to each well of the 96-well plate and aspirating was repeated three times, and the unincorporated [ ³⁵ S] Sulfuric acid was sufficiently removed. After removing the bottom waste solution by blotting, the Durapore membrane at the bottom of each well is dropped into a 4 mL scintillation vial using a disposable punch, and 500 μL of solubilization buffer (4 M guanidine hydrochloride, 33% isopropanol) is placed in the scintillation vial. In addition, [ ³⁵ S] sulfuric acid bound to Alcian blue was separated and solubilized by gently shaking for 1 hour. Finally, 2.5 mL of scintillation fluid was added to each vial and the radioactivity was counted with a scintillation counter.

  The amount of DNA was measured using the Quant-iT DNA Assay Kit (manufactured by Invitrogen: http://www.invitrogen.co.jp/) in the same manner as in Example 2 according to the instructions for use. DNA was quantified by measuring the amount of fluorescent dye bound to at 527 nm wavelength. Finally, the amount of DNA was obtained by calculation based on the regression line obtained based on the analysis result of the standard.

As a result of the above measurement, two types of siRNA (SEQ ID NOs: 4 and 6) were used to suppress the expression of integrin αv, but the production of sulfated proteoglycan measured by the amount of [ ³⁵ S] sulfuric acid uptake was as shown in SEQ ID NO: 4. In the case of siRNA, there was a 1.88 ± 0.39-fold increase over the control siRNA, and in the case of the siRNA of SEQ ID NO: 6, a 1.75 ± 0.25-fold increase over the control siRNA.

  In addition, two types of siRNA (SEQ ID NOs: 7 and 8) were used to suppress the expression of integrin β5, but the type II collagen production measured by ELISA was 1.68 compared to the control siRNA in the case of the siRNA of SEQ ID NO: 7. An increase of ± 0.15 times was shown, and the siRNA of SEQ ID NO: 8 showed an increase of 1.75 ± 0.33 times compared to the control siRNA.

  From the above results, it became clear that administration of an integrin gene expression inhibitor can maintain the production of cartilage matrix, and the integrin gene expression inhibitor is effective as an active ingredient of a human chondrocyte trait maintenance agent. Can be expected.

Example 4 Changes in cell shape accompanying suppression of integrin expression When articular chondrocytes are isolated from the cartilage matrix and maintained by monolayer culture, the cell shape rapidly changes and loses its original spherical shape. It has a long and flat shape like a fibroblast. This shape change is known to occur in synchronization with a change in cell phenotype, and is considered to be closely related to not only a morphological change but also a functional change of the cell. It is a well-known fact that cell-matrix adhesion also affects cell shape changes through integrins. For this reason, it was examined how the change in the shape of chondrocytes after the start of monolayer culture changes due to the suppression of integrin expression, in particular, the suppression of integrin αv or integrin β5 expression.

  In this experiment, the result that the change in the shape of chondrocytes after the start of monolayer culture was remarkably suppressed by suppressing the expression of integrin αv or integrin β5. When integrin αv and integrin β5 were each introduced with two types of siRNA (SEQ ID NOs: 4, 6 and 7, 8) and the changes in cell shape were compared with cells into which control siRNA (SEQ ID NO: 9) had been introduced, integrin αv Alternatively, in the cells in which the expression of integrin β5 was suppressed, it was clearly observed that the flattening of the cells was suppressed and the original spherical shape was well maintained.

  From this finding, it has been clarified that integrin αv or integrin β5 is a major factor that causes changes in cell shape during the process of chondrocyte dedifferentiation. Therefore, it was confirmed that administration of an integrin gene expression inhibitor can suppress the dedifferentiation of chondrocytes (maintain cartilage traits), and that the integrin gene expression inhibitor can be used as an active ingredient of a human chondrocyte trait maintenance agent. .

In Example 1, when human chondrocytes introduced with siRNA for integrin β1 (SEQ ID NO: 3 and RNA sequence of Cat. No. SI00300573) were cultured, the expression level of integrin β1 (expressed as a relative value to GAPDH) was measured. It is the result. In the figure, int is an abbreviation for integrin. The same applies to FIGS. 2 to 5 below. In Example 1, after culturing human chondrocytes introduced with siRNA for integrin β1 (SEQ ID NO: 3 and RNA sequence of Cat. No. SI00300573), the expression level of type II procollagen in the cells (left figure), It is the result of measuring the expression level of aggrecan (middle figure) and the expression level of type III procollagen (right figure). In the figure, each expression level is displayed as a relative value to GAPDH. In Example 1, after culturing human chondrocytes introduced with siRNA for integrin α5 (RNA sequence of SEQ ID NO: 1 or SEQ ID NO: 2), the expression level of type III procollagen (relative to GAPDH) in the cells was determined. It is the result of measurement. In Example 1, after culturing human chondrocytes introduced with siRNA against integrin αv (RNA sequence of SEQ ID NO: 4-6), the expression level of type II procollagen in the cells (left figure), the expression level of aggrecan (Middle figure) and the results of measuring the expression level of type III procollagen (right figure). In the figure, each expression level is displayed as a relative value to GAPDH. In Example 1, after culturing human chondrocytes introduced with siRNA against integrin β5 (RNA sequence of SEQ ID NO: 7 or 8), the expression level of type II procollagen in the cells (left figure), the expression level of aggrecan (Middle figure) and the results of measuring the expression level of type III procollagen (right figure). In the figure, each expression level is displayed as a relative value to GAPDH.

Claims (20)

Gene bank accession numbers (GenBank Accession No.) NM_002205 integrin α5 gene sequence described in Gene Bank accession numbers (GenBankAccessionNo.) NM_002210 integrin αv gene sequence described in Gene Bank accession numbers (GenBank Accession No .) NM_002211 integrin β1 gene sequence described in, against at least one gene sequence selected from the group consisting of integrin β5 gene sequence described in our and gene bank accession numbers (GenBank Accession No.) NM_002213 s A human chondrocyte trait maintenance agent comprising, as an active ingredient , an siRNA that is an iRNA and has an action of suppressing the expression of at least one of the integrin genes . The human chondrocyte trait maintenance agent according to claim 1, which has the following action (a) and / or (b):
(A) suppress or maintain expression of type I collagen gene and / or type III collagen gene,
(B) Increase or maintain the expression of type II collagen gene and / or aggrecan gene. The human chondrocyte trait maintenance agent according to claim 1 or 2 , wherein the siRNA suppresses the production of at least one integrin selected from the group consisting of integrin α5β1, integrin αvβ5, and integrin αvβ3. The agent for maintaining human chondrocyte phenotype according to claim 3 , wherein the siRNA suppresses the production of integrin α5β1. siRNA
In a sequence complementary to the integrin α5 gene, (a) a polynucleotide consisting of the base sequence represented by SEQ ID NO: 1 or 2 , or (b) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1 or 2, 1 to several bases of U, G, C, or A having at least one of the ends, or a polynucleotide comprising a base sequence deleted, substituted or added therein, and having an inhibitory action on the expression of the integrin gene a s iRNA a, and / or integrin β1 gene sequence complementary that having a base represented by a polynucleotide or (d) said SEQ ID NO: 3, comprising the nucleotide sequence represented by (c) SEQ ID NO: 3 In a polynucleotide comprising a sequence, one to several bases U, G, C, or A have at least at either end, or internally , Deletions, a polynucleotide consisting of a substituted or added nucleotide sequence, a s iRNA A that and having a said integrin gene expression inhibitory effect,
The human chondrocyte trait maintenance agent according to claim 4 . The human chondrocyte trait maintenance agent of Claim 3 whose siRNA suppresses the production | generation of integrin (alpha) v (beta) 5 . siRNA
(E) a polynucleotide consisting of the base sequence shown in any one of SEQ ID NOs: 4 to 6 , or (f) a base sequence shown in any one of the above SEQ ID NOs: 4 to 6, which is a sequence complementary to the integrin αv gene A polynucleotide consisting of a base sequence having U, G, C, or A of 1 to several bases at least at any of the ends, or deleted, substituted or added inside, and is a sequence complementary to s iRNA a, and / or integrin β5 gene that have a corresponding integrin gene expression inhibitory effect, (g) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 7 or 8, or, (h) In the polynucleotide comprising the base sequence represented by SEQ ID NO: 7 or 8, one to several bases of U, G, C, or A are at least one of Or having, in the interior, deletions, a polynucleotide consisting of a substituted or added nucleotide sequence, a s iRNA A that and having a said integrin gene expression inhibitory effect,
The human chondrocyte phenotype maintenance agent of Claim 6 . The human chondrocyte trait maintenance agent according to any one of claims 1 to 7 , which has the following action (i) to (iv):
(i) suppressing the progression of cartilage degeneration (chondrocyte dedifferentiation) by suppressing integrin gene expression or suppressing integrin signaling;
(ii) maintaining the differentiation of chondrocytes,
(iii) repairing degenerated cartilage to normal cartilage tissue,
(iv) maintain the protein of cartilage traits,
(v) Maintaining cartilage trait gene expression (maintaining chondrocyte differentiation). The human chondrocyte phenotype maintenance agent according to any one of claims 1 to 8 , which is administered to a culture solution of human chondrocytes forming a monolayer. The human chondrocyte trait maintenance agent according to any one of claims 1 to 9 , which is a cartilage matrix gene expression regulator. A method for proliferating chondrocytes, comprising proliferating chondrocytes by culturing the human chondrocyte trait maintenance agent according to any one of claims 1 to 10 and chondrocytes in the coexistence. The method for proliferating chondrocytes according to claim 11 , wherein chondrocytes having increased cartilage matrix molecules as chondrocytes proliferate are obtained. The method for proliferating chondrocytes according to claim 11 or 12 , wherein the proliferated chondrocytes are for use in chondrocyte transplantation. The method for proliferating chondrocytes according to claim 13 , wherein the chondrocyte transplantation is autologous chondrocyte transplantation. A method for maintaining human chondrocyte traits, comprising adding the human chondrocyte trait maintenance agent according to any one of claims 1 to 10 to a culture solution of human chondrocytes having a monolayer. The method for maintaining human chondrocyte traits according to claim 15 , which is the method according to any one of the following (vi) to (x):
(vi) a method of suppressing the progression of cartilage degeneration (chondrocyte dedifferentiation) by suppressing integrin expression or integrin signaling;
(vii) a method of maintaining the differentiation of chondrocytes,
(viii) a method of repairing degenerated cartilage to normal cartilage tissue,
(ix) a method for maintaining a protein of cartilage trait,
(x) A method of maintaining cartilage trait gene expression (maintaining chondrocyte differentiation). A screening method for a substance having a human chondrocyte character maintaining action, comprising the following steps (1) to (5):
(1) a step of adding a candidate substance to a culture medium of human chondrocytes forming a monolayer,
(2) the candidate integrin α5 gene in substance the presence and absence, integrin αv gene, integrins β1 gene, measuring the degree of expression of at least one gene selected from the group consisting of contact and integrin β5 gene,
(3) For the candidate substance that suppressed the gene expression in the step (2), the expression of type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene in the culture medium of step (1) Measuring the degree,
(4) In the step (3), a step of selecting a substance having the following action (a) and / or (b) as a substance having a human chondrocyte character maintaining action:
(a) suppress or maintain expression of type I collagen gene and / or type III collagen gene,
(b) Increase or maintain the expression of type II collagen gene and / or aggrecan gene. A screening method for a substance having a cartilage matrix gene expression regulating action, comprising the following steps (1) to (5):
(1) a step of adding a candidate substance to a culture medium of human chondrocytes forming a monolayer,
(2) the candidate integrin α5 gene in substance the presence and absence, integrin αv gene, integrins β1 gene, measuring the degree of expression of at least one gene selected from the group consisting of contact and integrin β5 gene,
(3) For the candidate substance that suppressed the gene expression in the step (2), the expression of type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene in the culture medium of step (1) Measuring the degree,
(4) In the step (3), a step of selecting a substance having the following action (a) and / or (b) as a substance having a human cartilage matrix gene expression regulating action:
(a) suppress or maintain expression of type I collagen gene and / or type III collagen gene,
(b) Increase or maintain the expression of type II collagen gene and / or aggrecan gene. A kit for screening for a substance having a human chondrocyte character-maintaining action comprising at least the following components (a) to (e):
(a) a culture solution of human chondrocytes forming a monolayer,
(b) integrin α5 gene, integrins αv gene, integrins β1 gene, Contact and at least one gene expression measurements primer pairs or probes selected from the group consisting of integrin β5 gene,
(c) Primer pairs or probes for measuring expression of each type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene,
(d) PCR reaction reagent,
(e) Each of the above gene expression detection reagents. A kit for screening a substance having an action of regulating cartilage matrix gene expression, comprising at least the following components (a) to (e):
(a) a culture solution of human chondrocytes forming a monolayer,
(b) integrin α5 gene, integrins αv gene, integrins β1 gene, Contact and at least one gene expression measurements primer pairs or probes selected from the group consisting of integrin β5 gene,
(c) Primer pairs or probes for measuring expression of each type I collagen gene, type II collagen gene, type III collagen gene, and aggrecan gene,
(d) PCR reaction reagent,
(e) Each of the above gene expression detection reagents.

Images