WO2014141392A1 - Method for producing regular fibrous connective tissue - Google Patents

Abstract

The present invention provides a method for producing a regular fibrous connective tissue, which comprises culturing a mesenchymal stem cell while contacting the mesenchymal stem cell with PRELP and then isolating a regular fibrous connective tissue from the culture. In one embodiment, the culturing of the mesenchymal stem cell while contacting the mesenchymal stem cell with PRELP is achieved by culturing a mesenchymal stem cell having a PRELP expression vector introduced therein. In one embodiment, the culturing of the mesenchymal stem cell is achieved by means of three-dimensional culturing.

Description

Method for producing parallel fibrous connective tissue

The present invention relates to a method for producing parallel fibrous connective tissue, and more particularly, to a method for producing parallel fibrous connective tissue, including culturing mesenchymal stem cells in contact with PRELP. The present invention also relates to cells, combinations and kits useful for the production of parallel fibrous connective tissue. Furthermore, the present invention provides a therapeutic agent for ligament injury and the like.

Ligament damage is damage that occurs when an abnormal force is applied to a ligament supporting a joint due to a sports injury or a traffic accident, and the ligament is torn or cut. When treating severe ligament damage, it is necessary to transplant the ligament to the damaged part, but since a technique to artificially regenerate the ligament has not been developed yet, a part of other normal ligaments is removed. Therefore, it is necessary to use for transplantation, and as a result, a normal ligament is also damaged. Therefore, development of a technique for artificially regenerating a ligament in vitro is desired.

On the other hand, Proline / arginine-rich-end-leucine-rich-repeat-protein (PRELP) is a protein contained in the connective tissue extracellular matrix. PRELP is known to function as a molecule that anchors the basement membrane to the underlying connective tissue. PRELP has been shown to bind type I collagen to the basement membrane and type II collagen to cartilage. PRELP has also been reported to bind to perlecan, a basement membrane heparan sulfate proteoglycan. PRELP has been suggested to be involved in the pathology of Hutchinson-Gilford progeria (HGP), and it has been reported that patients with this disease lack collagen binding in the basement membrane and cartilage.

PRELP has been reported to be highly expressed in mesenchymal stem cells in the joint (Non-patent Document 1).

An object of the present invention is to provide a technique for producing a parallel fibrous connective tissue such as a ligament in vitro.

As a result of intensive studies to solve the above problems, the present inventors compared the two-dimensional electrophoresis pattern of human vertebral ligament ossification tissue with that of human bone tissue, and found PRELP as a protein specifically expressed in the ligament. . When this gene was introduced into a mouse mesenchymal stem cell and the obtained transfectant was cultured on a 3D gel, surprisingly, a parallel fibrous connective tissue like a ligament tissue containing type I collagen was formed. As a result, the present invention was completed.

That is, the present invention is as follows.
[1] A method for producing parallel fibrous connective tissue, comprising culturing mesenchymal stem cells in contact with PRELP, and isolating parallel fibrous connective tissue from the culture.
[2] The production method according to [1], wherein the mesenchymal stem cells are cultured in a state of being contacted with PRELP by culturing the mesenchymal stem cells into which the PRELP expression vector has been introduced.
[3] The production method according to [1] or [2], wherein the mesenchymal stem cells are cultured by three-dimensional culture.
[4] The production method according to any one of [1] to [3], wherein the mesenchymal stem cells are cultured in a medium containing TNF-α in contact with PRELP.
[5] The production method according to any one of [1] to [4], wherein the mesenchymal stem cells are cultured in a medium containing zinc ions in contact with PRELP.
[6] A parallel fibrous connective tissue produced by the production method according to any one of [1] to [5].
[7] Mesenchymal stem cells into which a PRELP expression vector has been introduced.
[8] A combination comprising a mesenchymal stem cell into which a PRELP expression vector has been introduced, and a three-dimensional culture carrier.
[9] A combination comprising (1) PRELP or an expression vector thereof; and (2) a mesenchymal stem cell.
[10] The combination according to [9], further comprising a three-dimensional culture carrier.
[11] A kit for producing parallel fibrous connective tissue, comprising a mesenchymal stem cell according to [7] or a combination according to any of [8] to [10].
[12] A therapeutic agent for ligament injury comprising the parallel fibrous connective tissue according to [6] or the mesenchymal stem cell according to [7].
[13] A parallel fibrous connective tissue formation promoter comprising PRELP or an expression vector thereof.
[14] The agent according to [13], wherein the parallel fibrous connective tissue is a ligament.
[15] A therapeutic agent for ligament injury comprising PRELP or an expression vector thereof.
[16] A method of treating ligament injury in a mammal, comprising transplanting the parallel fibrous connective tissue according to [6] or the mesenchymal stem cell according to [7] to a mammal.
[17] A method for promoting the formation of parallel fibrous connective tissue in a mammal, comprising administering PRELP or an expression vector thereof to the mammal.
[18] The method according to [17], wherein the parallel fibrous connective tissue is a ligament.
[19] A method for treating ligament injury in a mammal, comprising administering PRELP or an expression vector thereof to the mammal.
[20] The parallel fibrous connective tissue according to [6] or the mesenchymal stem cell according to [7] for use in the treatment of ligament injury.
[21] PRELP or an expression vector thereof for use in promoting the formation of parallel fibrous connective tissue.
[22] PRELP of [21], or an expression vector thereof, wherein the parallel fibrous connective tissue is a ligament.
[23] PRELP or an expression vector thereof for use in the treatment of ligament injury.

According to the present invention, a ligament-like parallel fibrous connective tissue can be produced in an in vitro system. This makes it possible to produce an artificial ligament, which is useful for treating movement disorders caused by ligament rupture in athletes and the like.

Detection of PRELP in the culture supernatant of mesenchymal stem cells introduced with a PRELP expression vector by Western blotting. C3H / 10T1 / 2-clone8 mouse mesenchymal stem cells (× 4) transfected with pCAGGS-PRELP before the start of PuraMatrix culture. C3H / 10T1 / 2-clone8 mouse mesenchymal stem cells (× 4) transfected with pCAGGS-PRELP on day 1 after PuraMatrix culture. C3H / 10T1 / 2-clone8 mouse mesenchymal stem cells (× 4) transfected with pCAGGS-PRELP on the second day after PuraMatrix culture. Electron micrograph of parallel fibrous connective tissue formed by C3H / 10T1 / 2-clone8 mouse mesenchymal stem cells transfected with pCAGGS-PRELP. Immunohistochemically stained images of C3H / 10T1 / 2 mouse mesenchymal stem cells transfected with pCAGGS-PRELP vector. Type I collagen: Alexa Fluor 488, phalloidin: Alexa Fluor 568, and DAPI. An immunohistochemically stained image of a fibrous ligament-like tissue derived from a C3H / 10T1 / 2 mouse mesenchymal stem cell transfected with the pCAGGS-PRELP vector. PRELP: Alexa Fluor 488, and DAPI. Transmission electron micrograph of ligament-like tissue derived from C3H / 10T1 / 2 mouse mesenchymal stem cells transfected with pCAGGS-PRELP vector. PRELP expression in human anterior cruciate ligament (ACL), human posterior cruciate ligament (PCL), human OPLL tissue and human tendon. * P <0.05, ** P <0.05, *** P <0.05. Expression of type I collagen (ELISA) in mesenchymal stem cells and human and mouse ligament-like tissues derived therefrom. Expression of type I collagen in mesenchymal stem cells and human and mouse ligament-like tissues derived therefrom (real-time PCR). Inhibition of expression of PDGF-AA, MMP-13 and type I collagen (ELISA) by introduction of shRNA targeting PRELP (shRNA-PRELP). Bars indicate PDGF, type I collagen and PDGF from the left. * P <0.001, ** P <0.001. Suppression of MMP-13 and type I collagen expression by introduction of shRNA targeting PRELP (shRNA-PRELP). Expression of type I collagen in human ligament-like tissue, human PCL tissue, human OPLL tissue and human ACL tissue (Western blotting). Expression of type I collagen in mouse mesenchymal stem cells and ligament-like tissues derived from the stem cells (flow cytometry). Skeletal specimens (A and B) and femur images (C and D) of wild-type mice (WT) and PRELP transgenic mice (Tg). BMD (left), BMC (right) and TV (middle) of the femurs of wild-type mice (WT) and PRELP transgenic mice (Tg). * P = 0.063, ** P = 0.058, *** P = 0.071. Immunohistochemical staining images of spinal ligament, knee ligament, periodontal ligament, and skin tissue of wild type mouse (WT) and PRELP transgenic mouse (Tg) with anti-PRELP antibody. Stretching analysis of ligaments of wild type mice (WT) and PRELP transgenic mice (Tg). * P <0.05. Type I collagen and MMP-13 concentrations in blood and urine of wild type mice (WT) and PRELP transgenic mice (Tg). Bars indicate type I collagen, MMP-13 from the left. * P <0.05. Fusion of ligament-like tissue and human osteoblasts prepared from mouse mesenchymal stem cells introduced with PRELP. The stationary phase (A) and metaphase (B) of the cell cycle are shown. Expression of PRELP (Alexa Fluor 488) and type II collagen (Alexa Fluor 555) in the adhesion region between chicken ligament and bone tissue. Anterior ten-thousand ligament from a chicken that has been cultured and repaired in a culture medium containing pPyCAG-cHA-IpacflexEGFP-PRELP. GFP fluorescence (left), hematoxylin-eosin staining (right). Gene expression analysis by array-GCH for mouse mesenchymal stem cells, ligament tissue of wild-type mice, ligament tissue of PRELP transgenic mice, and ligament tissue of mouse mesenchymal stem cells. Gene expression analysis by array-GCH for mouse mesenchymal stem cells, ligament tissue of wild-type mice, ligament tissue of PRELP transgenic mice, and ligament tissue of mouse mesenchymal stem cells. IPA for PRELP. Analysis of PRELP expression route. (A) NF-κB-p65 expression in mouse mesenchymal stem cells treated with ZnCl ₂ . (B) A ligament-like tissue formed by treating mouse mesenchymal stem cells introduced with the PRELP gene with TNF-α. NFκB (Alexa Fluor 555) and PRELP (Alexa) at 3 hours (C), 6 hours (D) and 12 hours (E) after treatment of mouse mesenchymal stem cells introduced with the PRELP gene with TNF-α Intracellular distribution of Fluor 350). Analysis of PRELP expression route. NFκB p65 (Alexa Fluor 488) and DAPI fluorescence images of mouse mesenchymal stem cells transfected with PRELP gene treated with 10 μM (F), 30 μM (G), and 50 μM (H) ZnCl ₂ . NFκB p65 (Alexa Fluor 488) and DAPI fluorescence image of mouse mesenchymal stem cells introduced with PRELP gene treated with TNF-α (I) or ZnCl ₂ (J). NF-kBIA, MEKK3, TAK-1 and TRAF6 gene expression in ligament-like tissues derived from human mesenchymal stem cells introduced with pCAGGS-PRELP after various treatments. Bars indicate NF-kBIA, MEKK3, TAK-1 and TRAF6 from the left. Expression of NF-κB-p65, -p52, -p50, and c-Rel in ligament-like tissue derived from human mesenchymal stem cells introduced with pCAGGS-PRELP after various treatments. Bars indicate NF-κB-p65, -p52, -p50, and c-Rel from the left. Expression of TAK1, TRAF6, MEKK3, and NFκB p65 in human mesenchymal stem cells expressing PRELP by TNF-α. Periodontal pocket reconstruction with ligament-like tissue prepared from mouse mesenchymal stem cells introduced with PRELP.

Hereinafter, the present invention will be described in detail.

(Method for producing parallel fibrous connective tissue)
The present invention provides a method for producing parallel fibrous connective tissue, comprising culturing mesenchymal stem cells in contact with PRELP and isolating fibrous tissue from the culture.

Proline / arginine-rich-end-leucine-rich-repeat protein (PRELP) is a known polypeptide contained in the connective tissue extracellular matrix in vivo.

In the present specification, PRELP usually means a mammal-derived one. Examples of mammals include, for example, laboratory animals such as rodents and rabbits such as mice, rats, hamsters, and guinea pigs, domestic animals such as pigs, cows, goats, horses, sheep and minks, pets such as dogs and cats, humans, Examples include, but are not limited to, primates such as monkeys, cynomolgus monkeys, rhesus monkeys, marmosets, orangutans and chimpanzees. PRELP is preferably derived from primates (such as humans) or rodents (such as mice).

In the present specification, with respect to factors such as polypeptides and polynucleotides, “derived from organism X” means that the polypeptide or polynucleotide is the same or substantially the same as the polypeptide or polynucleotide naturally expressed in organism X. It is meant to contain the same amino acid sequence or polynucleotide sequence. “Substantially the same” means that the focused amino acid sequence or nucleic acid sequence is 70% or more (preferably 80% or more, more preferably 90%) of the amino acid sequence or nucleic acid sequence of the factor naturally expressed in the organism X Or more, more preferably 95% or more, most preferably 99% or more), and the activity of the protein is maintained.

The nucleotide sequence and amino acid sequence of PRELP are known. Representative amino acid sequences of human PRELP and mouse PRELP and polynucleotide sequences (cDNA sequences) encoding the same are as follows. The parentheses indicate GENBANK accession numbers provided by NCBI.
[Human PRELP amino acid sequence]
SEQ ID NO: 2 (NP_002716): encoded by the polynucleotide of SEQ ID NO: 1 (NM_002725 REGION: 201..1349) SEQ ID NO: 4 (NP_958505): encoded by the polynucleotide of SEQ ID NO: 3 (NM_201348 REGION: 191..1339) 6 (signal sequence (1-20) was deleted from SEQ ID NO: 2 (mature type)): encoded by SEQ. ID. Signal sequence (1-20) was deleted (mature type)): encoded by polynucleotide of SEQ ID NO: 7 (signal sequence coding region deleted from SEQ ID NO: 3) [Mouse PRELP amino acid sequence]
SEQ ID NO: 10 (NP_473418): Coding SEQ ID NO: 12 (signal sequence (1-21) was deleted from SEQ ID NO: 10 (mature)) with the polynucleotide of SEQ ID NO: 9 (NM_054077 REGION: 164..1300): SEQ ID NO: 11 (deleting the signal sequence coding region from SEQ ID NO: 9)

In this specification, the activity of PRELP means the activity of inducing the formation of parallel fibrous connective tissue by culturing the cells in contact with the mesenchymal stem cells.

In the present specification, the term “mesenchymal stem cell” broadly means a population of stem cells or progenitor cells that proliferate in an undifferentiated state and can differentiate into all or some of bone cells, chondrocytes and adipocytes. Means to.

In the present specification, a mesenchymal stem cell usually means a mammal-derived one. Examples of mammals include, for example, laboratory animals such as rodents and rabbits such as mice, rats, hamsters, and guinea pigs, domestic animals such as pigs, cows, goats, horses, sheep and minks, pets such as dogs and cats, humans, Examples include, but are not limited to, primates such as monkeys, cynomolgus monkeys, rhesus monkeys, marmosets, orangutans and chimpanzees. The mesenchymal stem cells are preferably derived from primates (human etc.) or rodents (mouse etc.).

In the living body, mesenchymal stem cells are present at low frequency in tissues such as bone marrow, peripheral blood, umbilical cord blood, and adipose tissue. Mesenchymal stem cells can be isolated from these tissues by a known method. For example, mesenchymal stem cells can be isolated from bone marrow fluid by the Percoll gradient method (Hum. Cell, vol.10, p.45-50, 1997). Alternatively, mesenchymal stem cells can be isolated by culture and passage of hematopoietic stem cells after bone marrow puncture (Journalourof Autoimmunity, 30 (2008) 163e171). A method for isolating mesenchymal stem cells from human synovium, meniscus, intra-articular ligament, muscle, adipose tissue, and bone marrow using a cell sorter has been reported (Journal of Orthopaedic Research, 27: 435-441, 2009). Commercially available mesenchymal stem cells may also be used.

The mesenchymal stem cells used in the present invention are preferably isolated. “Isolated” means that the artificially placed in a state different from the naturally occurring state, for example, an operation to remove components other than the target component from the naturally occurring state. Means.

The purity of the isolated mesenchymal stem cells (percentage of mesenchymal stem cells in the total number of cells) is usually 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably substantially 100. %.

The individual that is the source from which the mesenchymal stem cells are collected is not particularly limited. However, when the obtained fibrous tissue is used for transplantation medicine, the patient itself or the MHC type is the same or not from the viewpoint that rejection does not occur. It is preferable to collect mesenchymal stem cells from substantially the same individual. Here, the type of MHC is “substantially the same” means that cells contained in the transplanted fibrous tissue when the fibrous tissue obtained from the mesenchymal stem cells is transplanted into a patient by using an immunosuppressant or the like. This means that the MHC types match to such an extent that can be engrafted.

In addition, from the viewpoint of enhancing the function of the parallel fibrous connective tissue to be produced, allogeneic mesenchymal stem cells having a genetic background that forms a strong parallel fibrous connective tissue (for example, black in the case of humans) It is also preferred to use mesenchymal stem cells).

Mesenchymal stem cells can be pre-cultured in a medium known per se suitable for the culture. Examples of such a medium include a minimum essential medium (MEM) containing about 5 to 20% fetal bovine serum, Dulbecco's modified Eagle medium (DMEM), Basal Medium Eagle, RPMI 1640 medium, 199 medium, F12 medium, and the like. However, it is not limited to them.

In the present invention, the method for culturing mesenchymal stem cells in contact with PRELP is not particularly limited, and any method may be used as long as it can induce the formation of fibrous tissue. For example, (A) a method for culturing a mesenchymal stem cell into which a PRELP expression vector has been introduced, (B) a sufficient amount of PRELP (preferably isolated PRELP) to induce the formation of fibrous tissue A method of culturing mesenchymal stem cells in a medium to be used can be employed. In (A), PRELP expressed from the introduced expression vector is released into the microenvironment of the mesenchymal stem cell or into the medium, and this contacts the mesenchymal stem cell. Preferably, mesenchymal stem cells into which a PRELP expression vector has been introduced are cultured.

The PRELP expression vector includes a promoter and a polynucleotide encoding PRELP, and the promoter is operably linked to the polynucleotide. The promoter is not particularly limited as long as it can initiate transcription in a mesenchymal stem cell as a host.

Although it does not specifically limit as an expression vector, For example, retrovirus (including lentivirus), adenovirus, adeno-associated virus, Sendai virus, herpes virus, vaccinia virus, pox virus, poliovirus, silbis virus, rhabdovirus, Virus vectors such as paramyxoviruses, orthomyxoviruses; artificial chromosome vector plasmids such as YAC (Yeast artificial chromosome) vector, BAC (Bacterial artificial chromosome) vector, PAC (P1-derived artificial chromosome) vector; Examples include an episomal vector capable of autonomous replication. When introducing the vector into mesenchymal stem cells, a lipofection method, a microinjection method, a DEAE dextran method, a gene gun method, an electroporation method, a calcium phosphate method, or the like can be used.

Further, when a viral vector is used as an expression vector, a packaging cell can also be used. A packaging cell refers to a cell into which a gene encoding a viral structural protein has been introduced, which produces the recombinant virus particle when a recombinant viral DNA incorporating the target gene is introduced into the cell. Therefore, any cell can be used as the packaging cell as long as it is a cell that replenishes the recombinant virus vector with a protein necessary for the construction of the virus particles. For example, HEK293 cells derived from human kidney or mouse fibroblasts can be used. Cell-derived NIH3T3 cell-based packaging cells; Platro-E cells designed to express Ecotropic virus-derived envelope glycoproteins, Plato-A cells designed to express Amphotropic virus-derived envelope glycoproteins And Plato-GP cells designed to express vesicular stomatitis virus-derived envelope glycoprotein can be used (Plat-E cells, Plat-A cells and Plat-GP cells are CEL It can be purchased from L BIOLABS). The method for introducing the viral vector into the packaging cell is not particularly limited, and a conventionally known method such as lipofection, electroporation, or calcium phosphate method can be used.

In addition, when a gene is introduced using an expression vector, a marker gene can be used simultaneously to confirm the introduction of the gene. The marker gene refers to all genes that enable selection and selection of cells by introducing the marker gene into cells, such as drug resistance genes, fluorescent protein genes, luminescent enzyme genes, chromogenic enzyme genes, etc. Is mentioned. Examples of drug resistance genes include neomycin resistance gene, tetracycline resistance gene, kanamycin resistance gene, zeocin resistance gene, hygromycin resistance gene and the like, and fluorescent protein genes include green fluorescent protein (GFP) gene, yellow fluorescent protein (YFP). ) Gene, red fluorescent protein (RFP) gene and the like. Further, examples of the luminescent enzyme gene include a luciferase gene, and examples of the chromogenic enzyme gene include a β-galactosidase gene, a β-glucuronidase gene, and an alkaline phosphatase gene. These marker genes can be used singly or in combination of two or more, and also include a fusion containing two or more marker genes such as a βgeo gene that is a fusion gene of a neomycin resistance gene and a β-galactosidase gene. Genes can also be used.

The expression vector may contain an enhancer, a splicing signal, a poly A addition signal, an SV40 replication origin (hereinafter sometimes abbreviated as SV40ori) and the like in a functional manner as desired.

The present invention also provides mesenchymal stem cells into which the PRELP expression vector thus obtained has been introduced. In the mesenchymal stem cell, the introduced expression vector may be integrated into the genome. Such mesenchymal stem cells can be clearly distinguished from the original mesenchymal stem cells and mesenchymal stem cells isolated from natural mammals in the genome structure. In addition, when an episomal vector capable of autonomous replication outside the chromosome is used, PRELP is genetically stably present in mesenchymal stem cells and can be expressed. Mesenchymal stem cells obtained using such vectors are also encompassed within the scope of the present invention.

A medium used for culturing mesenchymal stem cells can be prepared using a medium used for culturing animal cells as a basal medium. As the basal medium, for example, BME medium, BGJb medium, CMRL６1066 medium, Glasgow MEM medium, Improve MEM Zinc Option medium, IMDM medium, Medium 199 medium, Eagle MEM medium, αMEM medium, DMEM medium, Ham F12 medium, RPMI 1640 The medium is not particularly limited as long as it can be used for culturing animal cells, such as a medium, Fischer's medium, and mixed medium thereof.

The medium can be a serum-containing medium or a serum-free medium. A serum-free medium means a medium that does not contain unadjusted or unpurified serum, and is a medium or serum replacement reagent (for example, a purified blood-derived component or animal tissue-derived component (eg, growth factor)). , KSR (Invitrogen) etc.) is added to the serum-free medium.

In one embodiment, the medium used for culturing mesenchymal stem cells contains TNF-α. It is expected that the formation of parallel fibrous connective tissue is promoted by culturing mesenchymal stem cells in the presence of TNF-α in contact with PRELP. For example, by culturing mesenchymal stem cells in contact with PRELP in the presence of TNF-α, the formation of parallel fibrous connective tissue is promoted, compared with the conditions in the absence of TNF-α. The parallel fibrous connective tissue is expected to be formed in a shorter time. In one embodiment, parallel fibrous connective tissue is formed by culturing mesenchymal stem cells in the presence of TNF-α in contact with PRELP for at least 24 hours.

In the present specification, TNF-α usually means a mammal-derived one. Examples of mammals include, for example, laboratory animals such as rodents and rabbits such as mice, rats, hamsters, and guinea pigs, domestic animals such as pigs, cows, goats, horses, sheep and minks, pets such as dogs and cats, humans, Examples include, but are not limited to, primates such as monkeys, cynomolgus monkeys, rhesus monkeys, marmosets, orangutans and chimpanzees. PRELP is preferably derived from primates (such as humans) or rodents (such as mice).

The nucleotide sequence and amino acid sequence of TNF-α are known. Representative amino acid sequences of human TNF-α and mouse TNF-α and polynucleotide sequences (cDNA sequences) encoding the same are as follows. The parentheses indicate GENBANK accession numbers provided by NCBI.
[Human TNF-α amino acid sequence]
SEQ ID NO: 14 (NP_000585.2): encoded by the polynucleotide of SEQ ID NO: 13 (NM_000594.3 REGION: 176..877) [mouse PRELP amino acid sequence]
SEQ ID NO: 16 (NP_038721.1): encoded by the polynucleotide of SEQ ID NO: 15 (NM_013693.2 REGION: 157..864)

The concentration of TNF-α in the medium can be appropriately set by those skilled in the art within the range of promoting the formation of parallel fibrous connective tissue, but is usually 0.5 to 500 ng / mL, preferably 1 to It is about 100 ng / mL.

TNF-α is preferably isolated. The purity of the isolated TNF-α (percentage of the weight of TNF-α in the total protein weight) is usually 70% or more, preferably 80% or more, more preferably 90% or more, most preferably 100%. .

In one embodiment, the medium used for culturing mesenchymal stem cells contains zinc ions (Zn ²⁺ ). It is expected that the formation of parallel fibrous connective tissue is promoted by culturing mesenchymal stem cells in the presence of Zn ²⁺ in contact with PRELP.

The concentration of Zn ²⁺ in the medium can be appropriately set by those skilled in the art within the range of promoting the formation of parallel fibrous connective tissue, but is usually about 1 to 100 μM, preferably about 10 to 50 μM.

In one embodiment, the medium used for culturing mesenchymal stem cells comprises culturing mesenchymal stem cells in contact with PRELP in the presence of TNF-α and zinc ions, including TNF-α and zinc ions. Thus, it is expected that the formation of parallel fibrous connective tissue is strongly promoted.

The concentration of each factor in the combined use of TNF-α and zinc ions can be appropriately set by those skilled in the art within the range of promoting the formation of parallel fibrous connective tissue. It can be illustrated.

The medium can contain additives known per se. The additive is not particularly limited, but for example, growth factors (such as insulin), iron sources (such as transferrin), minerals (such as sodium selenate), saccharides (such as glucose), organic acids (such as pyruvic acid, Lactic acid etc.), serum proteins (eg albumin etc.), amino acids (eg non-essential amino acids), reducing agents (eg 2-mercaptoethanol etc.), antioxidants, vitamins (eg ascorbic acid, d-biotin etc.), fatty acids Alternatively, lipids, antibiotics (for example, streptomycin, penicillin, gentamicin, etc.), buffers (for example, HEPES, etc.), inorganic salts and the like can be mentioned. Each of the additives is preferably contained within a concentration range known per se.

In one embodiment, the mesenchymal stem cells are adherently cultured in a culture container such as a petri dish, a plate, or a bottle.

In a preferred embodiment, the mesenchymal stem cells are cultured by three-dimensional culture. By performing the three-dimensional culture, the formation of parallel fibrous connective tissue is promoted as compared to the adhesion culture on a flat surface. In the present invention, “three-dimensional culture” means that a polymer compound having a sol-gel transition temperature and reversibly showing a sol state at a temperature lower than the transition temperature is used as a culture carrier. Accordingly, a physiologically active substance for cell culture is mixed with the culture support as a culture composition, and the polymer compound in the culture support or culture composition is gelled using the culture support. It means that the cells and / or tissues to be cultured in the gel material are embedded in the prepared medium.

Examples of the polymer compound used as a carrier for three-dimensional culture include polyalkylene oxide block copolymers represented by block copolymers of polypropylene oxide and polyethylene oxide; etherified celluloses such as methyl cellulose and hydroxypropyl cellulose Modified polysaccharides such as chitosan derivatives (K. R. Holme. Et al. Macromolecules, 24, 3828 (1991)); pullulan derivatives (Shigeru Deguchi, Polymer Preprints. Japan. 19, 936 (1990)); poly N- Conjugates of temperature-sensitive polymers such as substituted (meth) acrylamide derivatives, polyvinyl alcohol partial acetylated products, polyvinyl methyl ether and water-soluble polymer compounds (for example, Takehisa Matsuda et al., Polymer Preprints. Japan Japan 39 (8 ), 2559 (1990)), a hydrogel that self-polymerizes under physiological conditions and has a fine fiber structure. Such peptides formed and the like, but not limited thereto. Commercial products such as PuraMatrix can be used as appropriate.

In the present invention, the mesenchymal stem cells are cultured in a state of being contacted with PRELP for a sufficient period (usually 1 day or more, preferably 2 days or more) to form a fibrous tissue.

The culture conditions in the step (b) of the present invention can be appropriately set according to normal animal cell culture conditions. For example, the culture temperature is usually about 30 to 40 ° C., preferably about 37 ° C. The CO ₂ concentration is usually about 1-10%, preferably about 2-5%.

As a result of the culture, parallel fibrous connective tissue is formed in the culture. In the present specification, “parallel fibrous connective tissue” refers to a dense connective tissue in which collagen fibers are arranged in parallel in one direction. Close connective tissue refers to connective tissue formed by collagen fibers forming fiber bundles and densely arranged. Collagen fibers usually contain type I collagen. The parallel fibrous connective tissue can be ligament tissue.

The culture refers to a result obtained by culturing cells, and includes cells, culture media, cell secretory components, and the like.

After confirming the formation of parallel fibrous connective tissue by visual observation or microscopic observation, the parallel fibrous connective tissue can be obtained by isolating the parallel fibrous connective tissue from the culture.

The parallel fibrous connective tissue thus obtained is useful as an artificial ligament for the treatment of movement disorders due to ligament rupture in athletes and the like. The present invention also provides a parallel fibrous connective tissue produced by the method of the present invention. Since the parallel fibrous connective tissue produced by the method of the present invention has bone healing activity, it is preferably used for the treatment of ligament damage.

(Combination, kit)
The present invention also provides a combination (combination I) comprising mesenchymal stem cells into which a PRELP expression vector has been introduced, and a carrier for three-dimensional culture.

Furthermore, the present invention provides
Provided is a combination (Combination II) comprising (1) PRELP or an expression vector thereof; and (2) a mesenchymal stem cell.

The combination II can further contain a carrier for three-dimensional culture.

Using mesenchymal stem cells into which PRELP expression vectors have been introduced, combinations I and II, parallel fibrous connective tissue can be easily produced by the production method of the present invention. Therefore, each of the mesenchymal stem cells and the combinations I and II into which the PRELP expression vector has been introduced can be used as a kit for producing a parallel fibrous connective tissue.

Each component contained in the kit of the present invention is adjusted to an appropriate concentration in water or an appropriate buffer (eg, TE buffer, PBS, etc.) separately (or in a mixed state if possible). It can be dissolved or suspended and stored at about -20 ° C to 4 ° C.

The kit of the present invention can contain various reagents (medium, reagent for gene introduction, etc.) used in the production method of the present invention, culture vessels, instructions describing the test protocol, and the like.

The definition of each term relating to the combination and kit of the present invention is the same as the definition of each term in the above-mentioned “Method for producing parallel fibrous connective tissue”.

(Therapeutic agent I for ligament injury I)
When the parallel fibrous connective tissue produced by the production method of the present invention is transplanted into the living body of a recipient mammal suffering from ligament injury, the parallel fibrous connective tissue is engrafted at the recipient's ligament injury site. The ligament is regenerated at the site and the ligament injury is treated. In addition, when the mesenchymal stem cells into which the PRELP expression vector has been introduced are transplanted into the living body of a recipient mammal suffering from ligament injury, the mesenchymal stem cells engraft at the recipient's ligament injury site, To produce parallel fibrous connective tissue at which the ligament is regenerated and the ligament injury is treated. Accordingly, the present invention provides a therapeutic agent for ligament injury comprising a parallel fibrous connective tissue produced by the production method of the present invention or a mesenchymal stem cell into which a PRELP expression vector has been introduced (the present invention). A therapeutic agent for ligament injury of I).

Ligament damage means a state in which the ligament is damaged by external force or infection. Examples of ligament damage include joint ligament damage (eg, knee ligament damage (lateral collateral ligament damage, medial collateral ligament damage, anterior cruciate ligament damage, posterior cruciate ligament damage, etc.); ankle, instep, elbow, finger, etc. Ligament damage, etc.), periodontal ligament damage; damage of tough connective tissue (rubber band) that keeps internal organs such as the ligament supporting the eyeball in place, but is not limited thereto.

Examples of recipient mammals include laboratory animals such as rodents and rabbits such as mice, rats, hamsters, and guinea pigs, domestic animals such as pigs, cows, goats, horses, sheep and minks, and pets such as dogs and cats. , Primates such as humans, monkeys, cynomolgus monkeys, rhesus monkeys, marmosets, orangutans, chimpanzees, and the like, but are not limited thereto. PRELP is preferably derived from primates (such as humans) or rodents (such as mice).

From the viewpoint that rejection does not occur, parallel fibrous connective tissue produced by the method of the present invention using mesenchymal stem cells collected from the patient himself or another individual having the same or substantially the same type of MHC Alternatively, cells obtained by introducing a PRELP expression vector into the mesenchymal stem cells are preferably used for transplantation.

In addition, from the viewpoint of strengthening the function of the formed ligament, allogeneic mesenchymal stem cells having a genetic background to form a strong ligament (for example, black mesenchymal stem cells in the case of humans) It is also preferable to use parallel fibrous connective tissue produced by the method of the present invention or cells obtained by introducing a PRELP expression vector into the mesenchymal stem cells for transplantation.

As a method for transplanting the parallel fibrous connective tissue and the mesenchymal stem cells into which the PRELP expression vector has been introduced, the parallel fibrous connective tissue or mesenchymal stem cells are engrafted in the ligament injury site of the recipient, As long as the ligament is regenerated at the site and the ligament injury is treated, the parallel fibrous connective tissue and mesenchymal stem cells are preferably transplanted directly to the ligament injury site of the recipient. The transplantation of parallel fibrous connective tissue can be carried out, for example, by sticking a sheet of parallel fibrous connective tissue obtained by the production method of the present invention to a ligament injury site. Transplantation of the mesenchymal stem cells into which the PRELP expression vector has been introduced can be carried out, for example, by embedding the mesenchymal stem cells in a carrier such as a biocompatible gel and transplanting the mesenchymal stem cells to the site of ligament injury. I can do it.

For example, the ligament rupture site in a partially ruptured joint; the suture operation site for ligament rupture treatment; the above-mentioned parallel fibrous connective tissue in a periodontal pocket or the like damaged or retracted due to dental surgery, infection, aging, etc. Alternatively, mesenchymal stem cells into which a PRELP expression vector has been introduced are transplanted.

The dose of mesenchymal stem cells into which the parallel fibrous connective tissue or PRELP expression vector has been introduced can be appropriately set based on the degree of ligament injury, the site, and the like.

The definition of each term relating to the therapeutic agent I for ligament injury according to the present invention is the same as the definition of each term in the above-mentioned “Method for producing parallel fibrous connective tissue” and “Combination product, kit”.

(Therapeutic agent for ligament injury II)
As shown in Examples described later, by overexpressing PRELP in vivo, the formation of ligaments is promoted not only in vitro but also in vivo. Therefore, the present invention provides a therapeutic agent for ligament injury (the therapeutic agent II for ligament injury of the present invention II) comprising PRELP or an expression vector thereof. The therapeutic agent II for ligament injury of the present invention is also useful as an agent for promoting the formation of parallel fibrous connective tissue in vivo.

The therapeutic agent II for ligament injury of the present invention can contain any carrier, for example, a pharmaceutically acceptable carrier, in addition to PRELP or an expression vector thereof.

Examples of pharmaceutically acceptable carriers include sucrose, starch, mannitol, sorbit, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate, and other excipients, cellulose, methylcellulose, hydroxypropylcellulose, polypropylpyrrolidone. , Gelatin, gum arabic, polyethylene glycol, sucrose, starch and other binders, starch, carboxymethylcellulose, hydroxypropyl starch, sodium-glycol starch, sodium bicarbonate, calcium phosphate, calcium citrate and other disintegrants, magnesium stearate , Aerosil, Talc, Lubricant such as sodium lauryl sulfate, Citric acid, Menthol, Glycyrrhizin / Ammonium salt, Glycine, Orange powder and other fragrances, Benzoic acid Preservatives such as thorium, sodium bisulfite, methylparaben, propylparaben, stabilizers such as citric acid, sodium citrate, acetic acid, suspensions such as methylcellulose, polyvinylpyrrolidone, aluminum stearate, dispersants such as surfactants, Examples include, but are not limited to, water, physiological saline, diluents such as orange juice, base waxes such as cacao butter, polyethylene glycol, and white kerosene.

When a PRELP expression vector is used as an active ingredient, the ligament injury therapeutic agent II of the present invention can further contain a nucleic acid introduction reagent in order to promote introduction of nucleic acid into cells. Examples of the nucleic acid introduction reagent include lipofectin, lipofectamine, lipofectamine RNAiMAX (LipofectamineRNAiMAX), in vivofectamine, DOGS (transfectum), DOPE, DOTAP, DDAB, DHDAB, HDAB, polybrene, or polybrene Cationic lipids such as (ethyleneimine) (PEI) can be used. When a retrovirus is used as an expression vector, retronectin, fibronectin, polybrene, or the like can be used as an introduction reagent.

Examples of the dosage unit form of the therapeutic agent II for ligament injury according to the present invention include liquids, tablets, pills, drinking liquids, powders, suspensions, emulsions, granules, extracts, fine granules, syrups, dip, and decoction. , Eye drops, lozenges, poultices, liniments, lotions, eye ointments, plasters, capsules, suppositories, enemas, injections (solutions, suspensions, etc.), patches, ointments, jelly Examples include agents, pastes, inhalants, creams, sprays, nasal drops, aerosols and the like.

The content of PRELP or its expression vector in the therapeutic agent (pharmaceutical composition) is not particularly limited and is appropriately selected within a wide range, and is, for example, about 0.01 to 100% by weight of the entire pharmaceutical composition.

The therapeutic agent II for ligament injury of the present invention is administered by a method according to various forms when used. For example, in the case of injections, it is administered at the site of ligament damage, intraarticular cavity, intravenous, intramuscular, intradermal, subcutaneous or intraperitoneal, and in the case of external preparations, it is sprayed directly on the required site such as the skin or mucous membrane. In the case of tablets, pills, drinking liquids, suspensions, emulsions, granules and capsules, it is orally administered, and in the case of suppositories, it is administered rectum.

The dosage of the agent of the present invention includes the activity and type of the active ingredient, the mode of administration (eg, oral and parenteral), the severity of the disease, the animal species to be administered, the drug acceptability of the administration target, body weight, age Usually, it is about 0.001 mg to about 2.0 g as an active ingredient amount per day for adults.

The therapeutic agent II for ligament injury of the present invention is usually a mammal (for example, such that PRELP or an expression vector thereof is delivered to a ligament injury site (preferably, a mesenchymal stem cell present in the ligament injury site). Rats, mice, guinea pigs, rabbits, sheep, horses, pigs, cows, monkeys, humans).

When the therapeutic agent II for ligament injury of the present invention is administered, PRELP acts on mesenchymal stem cells at the site of ligament injury, thereby promoting the formation of parallel fibrous connective tissue (eg, ligament) at the site of ligament injury, Ligament injury healing response and ligament reconstruction are promoted.

The definition of each term regarding the therapeutic agent II for ligament injury according to the present invention is as follows. Same as definition.

Hereinafter, the present invention will be described more specifically with reference to examples. However, these are merely examples and do not limit the scope of the present invention.

[Example 1]
Human PRELP cDNA was cloned. The cloned PRELP cDNA was treated with Xhol and inserted into the Xhol site of the pCAGGS expression vector. In order to confirm whether the expression vector was constructed as designed, the constructed vector was digested with restriction enzymes, and the electrophoresis pattern was confirmed. As a result, an electrophoretogram of the expected pattern was confirmed. Moreover, when the sequence analysis of the inserted cDNA area | region was conducted, it confirmed that it corresponded with the target arrangement | sequence (GENBANK accession number: EAW91481.1).

C3H / 10T1 / 2-clone8 mouse mesenchymal stem cells (JCRB0003) are cultured in Basal Medium Eagle (Wako) containing 10% FBS and then repeatedly detached with 0.25% Trypsin and 0.02% EDTA. By subcultivation culture was performed. After culturing C3H / 10T1 / 2-clone8 mouse mesenchymal stem cells in a 3.5 mm petri dish (BD) until 70% confluent, the culture solution was adjusted to 500 μL. To 100 μL of 20 mM Tris-HCL (pH 7.4) buffer (DAKO), add 2.0 μg of pCAGGS-PRELP vector, add 50.0 μL of Multi Fectam (Promega), mix, and let stand at room temperature for 30 minutes. MEM culture solution (invitrogen) 50 μL was added, mixed, and allowed to stand at room temperature for 5 minutes. 200 μL of Multi Fectam and pCAGGS-PRELP plasmid DNA complex was added to one 3.5 mm well, and the plate was shaken to be uniform and cultured at 37 ° C., 5% CO _{2 for} 4 hours. The medium was replaced with a new culture solution (Basal Medium Eagle containing 10% FBS), and after further culturing for 96 hours, it was confirmed by Western blot that the PRELP protein was expressed in the supernatant (FIG. 1). The culture medium was changed once every two days. FIG. 2 shows C3H / 10T1 / 2-clone8 mouse mesenchymal stem cells transfected with pCAGGS-PRELP before the start of PuraMatrix culture.

One week later, the C3H / 10T1 / 2-clone8 mouse mesenchymal stem cells attached to the petri dish were detached with 0.25% Trypsin and 0.02% EDTA, and centrifuged to collect the cell pellet at 5.0 × 10. ⁴ to adjust, washed with a 20% sucrose solution 1 mL, sonicated PuraMatrix (BD) 1 mL was added, rapidly mixed, and cultured in fresh wells.

1 day after the start of culture in PuraMatrix, it showed a fibrous morphology (FIG. 3). Two days after the start of culture in PuraMatrix, the whole well showed a fibrous morphology (FIG. 4).

As a result of microscopic observation, a structure in which collagen fibers were arranged in parallel in one direction was confirmed (FIGS. 3 and 4). The same structure was confirmed by observation under an electron microscope (FIG. 5). As a result of immunohistochemical staining of the formed fibrous tissue with an antibody against type I collagen, expression of type I collagen was confirmed. From the above results, it was suggested that the obtained fibrous tissue is a parallel fibrous connective tissue such as a ligament.

[Example 2]
In the same manner as in Example 1, C3H / 10T1 / 2 mouse mesenchymal stem cells were transfected with the pCAGGS-PRELP vector. The obtained transfectants were subjected to immunostaining using Alexa Fluor 488-labeled anti-type I collagen antibody, Alexa Fluor 568 phalloidin, and DAPI (FIG. 6).

Further, as a result of the culture, a fibrous form was observed in the cells floating from the culture dish (FIG. 7). The thickness of the ligament-like tissue was 15 μm, and the thickness of the cells was 30 μm. Stained with Alexa Fluor 488 labeled anti-PRELP antibody and DAPI.

Further, as a result of observation with a transmission electron microscope, the presence of a collagen fiber structure was confirmed (FIG. 8).

[Reference Example 1]
PRELP expression in human anterior cruciate ligament (ACL), human posterior cruciate ligament (PCL), human OPLL tissue and human tendon was examined by real-time PCR and Western blotting. CBB staining was used as a control. High expression of PRELP was not observed in ACL, PCL and OPLL, but expression of PRELP was low in tendons (FIG. 9).

[Example 3]
As in Example 1, a pCAGGS-PRELP vector was introduced into human mesenchymal stem cells and mouse mesenchymal stem cells and cultured to form a ligament-like tissue. The expression of type I collagen was examined by ELISA and real-time PCR.
The ELISA used EC1-E205, which can measure atelocollagen from degraded atelopeptide in type I collagen.
Real-time PCR was performed with TaqMan Gene Expression Assay kit using StepOnePlus real-time PCR system. The sequences used for TaqMan PCR are as follows (sequences from mouse collagen, type I, alpha 1Col1a1: Mm00801666_g1; human collagen, type I, alpha 2: Hs00164099_m1; mouse 18S ribosomal RNA, hypothetical LOC790964: Mm03928990_g1; human eukaryotic 18S rRNA: Hs99999901_s1). For each sample, mouse Col1a1 (n = 21) and human Col1a1 (n = 24) were quantified using Mouse 18S ribosomal RNA and human eukaryotic 18S rRNA mRNA as standards.
As a result, it was shown that expression of type I collagen was higher in the induced ligament-like tissue than in the mesenchymal stem cells in any of the methods (FIGS. 10 and 11).

[Example 4]
The effect of shRNA targeting PRELP on the expression of PDGF and MMP-13 in mouse mesenchymal stem cells introduced with the pCAGGS-PRELP vector was examined.
For shRNA targeting PRELP, four gene fragments were cloned into pRNAi / LV-RNAi vector (Biosettia, Inc), and suppression of PRELP expression was confirmed, followed by collagen and PDGF receptor expression in the supernatant. Suppressed
sh-NM_054077 5'- AAAAGGATTAGGCGTAAACCCAATTGGATCCAATTGGGTTTACGCCTAATCC-3 '(SEQ ID NO: 17)
Was used.
shRNA-lacZ, AAAAGCAGTTATCTGGAAGATCAGGTTGGATCCAACCTGATCTTCCAGATAACTGC (SEQ ID NO: 18), and
sh-scramble, AAAAGCTACACTATCGAGCAATTTTGGATCCAAAATTGCTCGATAGTGTAGC (SEQ ID NO: 19)
Was made as a control. For transfection, Lipofectamine 2000 (Life Technology) was used for overexpression according to the manufacturer's protocol and Gene Porter (Genlantis) was used for shRNA. The plate was shaken so that the vector was uniformly dispersed and cultured at 37 ° C., 5% CO _{2 for} 4 hours. The culture medium was replaced with fresh medium and the mixture was incubated for a further 96 hours. PRELP expression in the culture supernatant was confirmed by Western blotting, and secretion of the product in the culture medium was confirmed every 2 days. The culture solution was changed every two days. After 7 days, the cells had transformed into ligament fiber-like structures.
Transfected cells were cultured in PuraMatrix Peptide Hydrogel, and images obtained with BioStation ID (GE Healthcare) after 24 hours confirmed that the cells were converted to ligament fiber-like structures.
ELISA was performed for PDGF-AA (R & D systems), MMP-13 (GE Healthcare) and type I collagen (ACEL, Japan).
As a result, the introduction of shRNA targeting PRELP (shRNA-PRELP) suppressed the expression of PDGF-AA, MMP-13 and type I collagen (FIGS. 12 and 13).

[Example 5]
As in Example 1, the expression of type I collagen in ligament-like tissue prepared by introducing the pCAGGS-PRELP vector into human mesenchymal stem cells was analyzed by Western blotting to human PCL tissue, human OPLL tissue and human ACL tissue. Compared with.
Like PCL, OPLL, and ACL, the ligament-like tissue expressed type I collagen (FIG. 14).

[Example 6]
Expression of type I collagen and stem cell marker (CD34) in a ligament-like tissue derived from mouse mesenchymal stem cells prepared in the same manner as in Example 1 was compared with mouse mesenchymal stem cells. Mouse mesenchymal stem cells highly expressed CD34, but their expression decreased after the introduction of the pCAGGS-PRELP vector and conversion to ligament-like tissue. On the other hand, the expression of type I collagen was higher after conversion to ligament-like tissue (FIG. 15).

[Example 7]
Production and genotyping of PRELP transgenic mice The PRELP gene (3.4 kb) was ligated into the XhoI site of pCAGGS and injected into the pronuclei of C57BL / 6 fertilized eggs using a microcapillary and an inverted microscope. It was confirmed that a transgenic mouse was produced by PCR amplification of the DNA extracted from the tail tissue of the obtained newborn mouse and genotyping.

The PRELP gene was synthesized using the phosphoramidite method and ligated to the XhoI site of pCAGGS-XhoI. The expression vector was digested with Xho-I and the electrophoresis pattern was confirmed. It was confirmed that the sequence of the inserted cDNA region matched the intended sequence (GenBank accession number: EAW91481.1). A section of tail tissue was cut out from the 20 newborn mice obtained, and DNA was extracted with DNA Mini Kit (Qiagen). PCR was performed using the following primer set to determine whether the sample contained a foreign gene.
R5′-GTCGAGGGATCTCCATAAGAGAAGAGGGACA-3 ′ (SEQ ID NO: 20)
F5′-GTCGACATTGATTATTGACTAGTTATTAATAGTAATC-3 ′ (SEQ ID NO: 21)
The following PCR conditions were used: 94 ° C for 2 minutes, 98 ° C for 10 seconds, and 68 ° C for 4 minutes for 30 cycles.

Skeletal sample Transgenic mice and wild-type littermates were fixed with 70% ethanol, and the skin and internal tissues were separated. Mice were fixed with 70% ethanol for an additional 2 days. Dehydration was performed in 99.5% ethanol for 2 days. Mice were incubated for 55 hours at 37 ° C. in alcian blue 8GX (JANSSEN, 40% acetic acid and 60% ethanol volume ratio), a staining solution containing Alcian blue at a final concentration of 0.05%. Mice were immersed in 99.5% ethanol for 2 days at room temperature and then in 2% potassium hydroxide for 24 hours at room temperature until clear. Incubate 4 hours at room temperature in alizarin red S (Kodak, C1051) 1% KOH, a staining solution containing alizarin red at a final concentration of 0.005%, then decolorizing solution (1% KOH, 20% glycerol) ) And soaked overnight at room temperature. Mice were stored in stock solution (50% ethanol and 50% glycerol). Higher reagents for ethanol, acetic acid, glycerol, and potassium hydroxide were purchased from Kishida Chemical.

Fig. 16A (wild type) and B (PRELP Tg) show skeleton specimens of 4-week-old mice stained with Alcian Blue and Alizarin Red.

Three-dimensional computed tomography bone density analysis During inhalation anesthesia of transgenic mice, bone density and bone mineral density measurement is performed using 3D micro-computed tomography (Rigaku), using RATOC software (RATOC System Engineering). Analyzed. A phantom (S / N: 1101-52) was used as a control. Bone density analysis was performed by performing 3D-CT of the femur, but no differences in BMD, BMC and TV were observed between wild type mice and PRELP transgenic mice. No changes in bone tissue were observed for skeletal samples from transgenic mice (FIG. 17).

Analysis of ligament tissue The present inventors created PRELP gene transgenic mice (n = 4). Spinal ligament, knee ligament, periodontal ligament, and skin tissue images revealed that PRELP gene transgenic mice are more complete ligaments than tissues from corresponding wild-type mice (Fig. 18). Immunohistochemical staining was performed using a rabbit anti-PRELP antibody (Sigma Aldrich; SAB1100370) as a primary antibody and Alexa Fluor 488-labeled goat anti-rabbit IgG antibody as a secondary antibody. DAPI was used for nuclear staining. After staining, the tissue was observed under CSLM (Olympus FluoView FV 1000-D).

Ligament Stretching Analysis Spinal ligament tissue from transgenic and wild-type mice is stretched under fixed loading conditions using the STB-CH-10 stretching system (Strex Inc), one third, one half, and The time until complete ligament tearing was measured. The time to ligament rupture was longer in the transgenic and stronger in the ligament tissue of the transgenic mouse than the ligament fiber of the wild type mouse (FIG. 19).

Transgenic and wild type mouse blood and urine type I collagen and MMP-13
As a result of blood and urine analysis, it was found that the amount of type I collagen in the blood was equivalent between the transgenic mouse and the wild type mouse. However, atelocollagen concentration was high in urine of transgenic mice (FIG. 20). From these results, it was suggested that PRELP overexpression resulted in high expression of type I collagen and increased urinary excretion. In addition, the concentration of MMP-13 was higher in the transgenic mice in both blood and urine (FIG. 20).

[Example 8]
Bone adhesion and ligament reconstruction Since the ligament is connected to the bone tissue to form a bone-bone connection, the mouse mesenchymal stem cell-derived ligament-like tissue produced by the same method as in Example 1 was combined with human osteoblasts. By combining, bone fusion of PRELP-derived ligament-like tissue was examined. Chromosome fluorescence staining showed fusion of human chromosome (rhodamine) and mouse chromosome (FITC) (FIG. 21). Karyotype analysis confirmed that mouse mesenchymal stem cell-derived ligament tissue was fused with human osteoblasts. As the probe, human Cot-1 DNA (digoxigenin, rhodamine spectrum orange label) and mouse Cot-1 DNA (biotin, FITC spectrum green label) were used. The stationary phase (A) and metaphase (B) of the cell cycle are shown (FIG. 21).

The expression of PRELP and type II collagen in the adhesion region between chicken ligament and bone tissue was examined. PRELP (Alexa Fluor 488) and type II collagen (Alexa Fluor 555) fluorescent staining showed that PRELP expression occurred only in ligament tissue and that type II collagen was clearly expressed between ligament tissue and bone (FIG. 22).

The anterior cruciate ligament was removed from the chicken and cut into many pieces. After culturing in a culture medium containing pPyCAG-cHA-IpacflexEGFP-PRELP, the destroyed ligament tissue was restored. GFP expression in the repaired tissue was confirmed by fluorescence microscopy (FIG. 23). After one week, collagen fiber ligation was observed by Azan staining. The GFP fluorescence of the new ligament tissue after repair revealed that the stem cells retained pPyCAG-cHA-IpacflexEGFP-PRELP (FIG. 23 left).

[Reference Example 2]
Array-CGH
RNA was extracted using AllPrep DNA / RNA mini kit (Qiagen), and RNA integrity was analyzed (Agilent 2100 Bioanalyzer). RNA with a value of 9.0 or greater was reverse transcribed using Superscript VILO cDNA synthesis kit (Life Technologies) and array-CGH was performed using Agilent Human Genome Microarray Kit 244 K (Agilent Technologies). The Array-CGH platform is a high-resolution 60-mer oligonucleotide-based microarray containing approximately 244400 probes spanning 7.4 kb and 16.5 kb of median length and non-coding genomic sequences, respectively. Labeling and hybridization were performed according to the protocol provided by Agilent (Protocol v4.0, June 2006). The array was analyzed using an Agilent DNA microarray scanner. Example 1 Analyzing gene expression of stem cell-derived ligament tissue prepared by introducing PRELP into mouse mesenchymal stem cells, ligament tissue of wild-type mice, ligament tissue of PRELP transgenic mice, and mouse mesenchymal stem cells did.

From the results of all gene analyses, changes in gene expression compared to stem cells from the extracellular matrix are consistent between the ligament tissue of wild-type mice, the ligament tissue of PRELP transgenic mice, and the stem cell-derived ligament tissue. It was shown (Figures 24 and 25).

[Reference Example 3]
PRELP protein and gene interaction Based on RNA gene expression and PRELP protein interaction, IPA software was used to analyze new pathways. These networks reveal functional and genetic associations. The IPA tool showed no connection with known biological pathways. This study revealed the possibility of a new network significantly associated with PRELP (FIG. 26).

[Example 9]
When the expression route mouse mesenchymal stem cells PRELP treated with ZnCl _2, it showed high NF-κB-p65 expression but, the influence of LY294002 was little. * P <0.001, n = 4 (FIG. 27A). When 10 ng / mL TNF-α was added to mouse mesenchymal stem cells into which the PRELP gene had been introduced, a ligament-like tissue appeared 24 hours later. Addition of 10 ng / mL TNF-α and LY294002 also resulted in conversion to ligament-like tissue (FIG. 27B). Immunofluorescence tissue staining was performed on NFκB (Alexa Fluor 555) and PRELP (Alexa Fluor 350). Three hours after addition of TNF-α, the boundary of the intracellular ER was demarcated (FIG. 27C), 6 hours later, PRELP protein expression was confirmed in the ER (FIG. 27D), and 12 hours later, fibrillation Conversion occurred and PRELP expression was confirmed (FIG. 27E). Presence of NfκB expression suggests that PRELP functions as a nuclear transcription factor affected by 30 μm / mL ZnCl ₂ . 27F, G, and H show NFκB p65 (Alexa Fluor 488) and DAPI fluorescence images when 10 μM, 30 μM, and 50 μM ZnCl ₂ were added to mouse mesenchymal stem cells into which the PRELP gene had been introduced. A ligament-like tissue appears 12 hours after adding 10 ng / mL TNF-α to mouse mesenchymal stem cells into which the PRELP gene has been introduced (I), and the same ligament-like tissue is also observed when 30 μM ZnCl ₂ is added Conversion to (J) occurred.

[Reference Example 4]
NF-kBIA, MEKK3, TAK-1 and TRAF6 gene expression in ligament-like tissues derived from human mesenchymal stem cells introduced with pCAGGS-PRELP was analyzed by real-time PCR. The expression of these genes was increased by 30 μM ZnCl ₂ and TNF-α (FIG. 28).

After introducing PRELP into human mesenchymal stem cells, ZnCl ₂ and LY294002 (PI3 kinase inhibitor) were added, and NF-κB-p65, -p52, -p50, and c-Rel were measured by ELISA. NfκB family Transcription factor assay kit (Active Motif, Inc., USA) was used for signal transduction study, and Western blotting with anti-PRELP antibody and anti-NF-κB-p65 antibody was used. CBB staining was used as a control. The expression of NF-κB-p65, -p52, -p50, and c-Rel increased by ZnCl ₂ was not canceled by LY294002 (FIG. 29).

TAK1, TRAF6, MEKK3, and NFκBp65 expression in human mesenchymal stem cells expressing PRELP by TNF-α were analyzed by Western blotting. Stem cells transfected with PRELP and treated with TNF-α expressed TRAF6, MEKK3 and NFκB p65. PRELP Western blotting confirmed that PRELP protein was present in cells treated with control sh-Lac Z and sh-scramble and that PRELP was rapidly knocked down by shRNA-PRELP (FIG. 30).

[Example 10]
Similar to Example 1, ligament-like tissue was produced from mouse mesenchymal stem cells into which PRELP had been introduced. When this was transplanted into the destroyed periodontal pocket, the periodontal pocket was reconstructed (FIG. 31).

According to the present invention, a ligament-like parallel fibrous connective tissue can be produced in an in vitro system. This makes it possible to produce an artificial ligament, which is useful for treating movement disorders caused by ligament rupture in athletes and the like.

Claims (23)

1. A method for producing parallel fibrous connective tissue, comprising culturing mesenchymal stem cells in contact with PRELP and isolating parallel fibrous connective tissue from the culture.
2. The production method according to claim 1, wherein the mesenchymal stem cells are cultured in contact with PRELP by culturing the mesenchymal stem cells into which the PRELP expression vector has been introduced.
3. The production method according to claim 1 or 2, wherein the mesenchymal stem cells are cultured by three-dimensional culture.
4. The production method according to any one of claims 1 to 3, wherein the mesenchymal stem cells are cultured in a medium containing TNF-α while being in contact with PRELP.
5. The production method according to any one of claims 1 to 4, wherein the mesenchymal stem cells are cultured in a medium containing zinc ions while being in contact with PRELP.
6. A parallel fibrous connective tissue produced by the production method according to any one of claims 1 to 5.
7. Mesenchymal stem cells into which a PRELP expression vector has been introduced.
8. A combination comprising a mesenchymal stem cell into which a PRELP expression vector has been introduced, and a three-dimensional culture carrier.
9. (1) PRELP, or an expression vector thereof; and (2) a combination comprising mesenchymal stem cells.
10. The combination according to claim 9, further comprising a three-dimensional culture carrier.
11. A kit for producing a parallel fibrous connective tissue, comprising the mesenchymal stem cell according to claim 7 or the combination according to any one of claims 8 to 10.
12. A therapeutic agent for ligament injury comprising the parallel fibrous connective tissue according to claim 6 or the mesenchymal stem cell according to claim 7.
13. A parallel fibrous connective tissue formation promoter comprising PRELP or an expression vector thereof.
14. The agent according to claim 13, wherein the parallel fibrous connective tissue is a ligament.
15. A therapeutic agent for ligament injury comprising PRELP or an expression vector thereof.
16. A method for treating ligament injury in a mammal, comprising transplanting the parallel fibrous connective tissue according to claim 6 or the mesenchymal stem cell according to claim 7 to a mammal.
17. A method of promoting the formation of parallel fibrous connective tissue in a mammal, comprising administering PRELP or an expression vector thereof to the mammal.
18. The method according to claim 17, wherein the parallel fibrous connective tissue is a ligament.
19. A method for treating ligament injury in a mammal, comprising administering PRELP or an expression vector thereof to the mammal.
20. The parallel fibrous connective tissue according to claim 6 or the mesenchymal stem cell according to claim 7 for use in the treatment of ligament injury.
21. PRELP or its expression vector for use in promoting the formation of parallel fibrous connective tissue.
22. 23. The PRELP of claim 21, or an expression vector thereof, wherein the parallel fibrous connective tissue is a ligament.
23. PRELP or its expression vector for use in the treatment of ligament injury.

Images