JP5164034B2 - Screening method for mucosal vaccine adjuvant - Google Patents

Description

  The present invention relates to a method for screening a mucosal vaccine adjuvant using a non-human animal in which a gene function encoding a TLR5 protein that specifically recognizes bacterial flagellin is deficient on the chromosome.

  It is known that the Toll gene is necessary for the determination of the dorsoventral axis during Drosophila embryogenesis (see, for example, Non-Patent Document 1 and Non-Patent Document 2) and the antifungal immune response in adults. (For example, see Non-Patent Document 3). Such Toll is a type I transmembrane receptor having a leucine rich repeat (LRR) in the extracellular region, and this intracytoplasmic region is homologous to the intracytoplasmic region of mammalian interleukin-1 receptor (IL-1R). (See, for example, Non-Patent Document 4, Non-Patent Document 5, and Non-Patent Document 6).

  In recent years, a mammalian homologue of Toll called Toll-like receptor (TLR) has been identified, and 13 families such as TLR2 and TLR4 have been reported so far (for example, Non-patent document 7, Non-patent document 8, Non-patent document). Reference 9 and Non-Patent Document 10). This TLR family is known to recruit IL-1R binding kinase (IRAK), activate TRAF6, and activate downstream NF-κB via MyD88, which is an adapter protein, like IL-1R. (For example, see Non-Patent Document 11, Non-Patent Document 12, and Non-Patent Document 13.) In addition, the role of the TLR family in mammals is thought to be related to innate immune recognition as a pattern recognition receptor (PRR) that recognizes common bacterial structures (eg, non-patent literature). 14).

  One of the pathogen-associated molecular patterns (PAMPs) recognized by the PRR is lipopolysaccharide (LPS), which is the main component of the outer membrane of Gram-negative bacteria (for example, Non-Patent Document 15). And LPS stimulates the host cell to cause the host cell to produce various inflammatory cytokines such as TNFα, IL-1 and IL-6 (see, for example, Non-Patent Document 16 and Non-Patent Document 17). It is also known that LPS captured by LPS-binding protein (LBP) is delivered to CD14 on the cell surface (see, for example, Non-Patent Document 18 and Non-Patent Document 19). The present inventors have produced a TLR4 knockout mouse, and the TLR4 knockout mouse is unresponsive to LPS, which is the main component of the outer membrane of the Gram-negative bacterium (see, for example, Non-Patent Document 20). A TLR2 knockout mouse was prepared, and it has been reported that the macrophage of the TLR2 knockout mouse has a decreased reactivity with respect to Gram-positive bacterial cell walls and peptidoglycan that is a component thereof (see, for example, Non-Patent Document 21).

  On the other hand, bacterial flagellin is a structural protein that forms most of flagella and contributes to pathogenicity through chemotaxis, adhesion and invasion on the host surface (see, for example, Non-Patent Document 22). It has been clarified that the TLR5 stimulating component isolated from Kiyoshi is flagellin (see, for example, Non-Patent Document 23). Salmonella flagellin has also been shown to be a stimulating ligand for TLR5 (see, for example, Non-Patent Document 24). As described above, among the TLR family members, TLR5 is the first TLR that has been clarified to recognize a protein ligand (see, for example, Non-Patent Document 25). Thus, TLR5 recognizes both flagellin derived from Gram-positive bacteria and Gram-negative bacteria, and in in vitro studies, TLR5 recognizes the conserved region of flagellin monomer, and not only acquired immune response but also inflammatory immunity It has been revealed that a response is induced (see, for example, Non-Patent Document 26).

  Furthermore, TLR5 is expressed on the basement membrane side of intestinal epithelial cells, and is considered to play an important role in recognizing flagellar bacterial infiltration on the mucosal surface (see, for example, Non-Patent Document 27). In epithelial cell lines, chemokine production is induced in response to flagellin, which later leads to migration of immature dendritic cells (DC) (see, for example, Non-Patent Document 28), and TLR5 is the human lung. (See, for example, non-patent document 29), and it has been revealed that there is a correlation between polymorphism of human TLR5 and susceptibility to legionellosis (for example, non-patent document) 30). Such evidence suggests that TLR5 is an important sensor for flagellar pathogens, but the in vivo role of TLR5 has not yet been elucidated.

Cell 52, 269-279, 1988 Annu. Rev. Cell Dev. Biol. 12, 393-416, 1996 Cell 86,973-983, 1996 Nature 351, 355-356, 1991 Annu. Rev. Cell Dev. Biol. 12, 393-416, 1996 J. Leukoc. Biol. 63, 650-657, 1998 Nature 388, 394-397, 1997 Proc. Natl. Acad. Sci. USA 95, 588-593, 1998 Blood 91, 4020-4027, 1998 Gene 231, 59-65, 1999 J. Exp. Med. 187, 2097-2101, 1998 Mol. Cell 2, 253-258, 1998 Immunity 11, 115-122, 1999 Cell 91, 295-298, 1997 Cell 91, 295-298, 1997 Adv. Immunol. 28, 293-450, 1979 Annu. Rev. Immunol. 13, 437-457, 1995 Science 249, 1431-1433, 1990 Annu. Rev. Immunol. 13, 437-457, 1995 J. Immunol. 162, 3749-3752, 1999 Immunity, 11, 443-451, 1999 Annu Rev Genet 26, 131-58., 1992 Nature 410, 1099-103., 2001 J Immunol 167, 1882-5, 2001 Nature 410, 1099-103., 2001 Immunol Lett 101, 117-22., 2005 J Immunol 167, 1882-5., 2001 Proc Natl Acad Sci USA 98, 13722-7., 2001 Genomics 64, 230-40., 2000 J Exp Med 198, 1563-72., 2003

  TLR5 has been identified as a receptor for flagellin in vitro, but its in vivo function is unclear. Unlike other TLR family members, TLR5 is not expressed on mouse spleen cells, peritoneal macrophages and CM-DC, which makes it difficult to address the function of TLR5 in innate immunity. An object of the present invention is to provide a screening method for an adjuvant of a mucosal vaccine, which can acquire a double barrier function between the mucosal surface and the living body by activating mucosal immunity by being administered from the mucosa such as orally or nasally. It is in.

The present inventors isolated the already identified TLR5 cDNA from a mouse gene library, replaced the TLR5 gene site with a neomycin resistance gene, and introduced an HSV-tk gene at each C-terminal side. Screening of ES cell clones that are doubly resistant to G418 and ganciclovir, and injecting these ES cell clones into C57BL / 6 mouse blastocysts, Then, a TLR5 knockout mouse in which the TLR5 gene function born on the chromosome according to Mendel's law is produced is prepared, and flagellin is a natural ligand of TLR5 by comparing and analyzing the TLR5 knockout mouse and a wild type mouse. I confirmed that there was. Furthermore, established recently, using the method for isolating high survival rate LPC, TLR5 or that is specifically expressed in the intestinal tract of CD11c ⁺ LPC mice specifically expressing the CD11c ⁺ LPC is TLR5, flagellin CD11c ⁺ LPC senses pathogenic flagellate bacteria mainly through TLR5 and induces an inflammatory response, TLR5 initially protects the host against flagellar bacteria Although induced, TLR5 ^{− / −} mice were found to be resistant to oral infection with Salmonella typhimurium, and the transition from the intestinal tract to the mesenteric lymph node (MLN) was found to be reduced. The present invention has been completed.

That is, the present invention provides (1) CD11c ⁺ intestinal mucosa lamina propria isolated from a non-human animal in which all or part of the endogenous gene encoding TLR5 has been inactivated by gene mutation and has lost the function of expressing TLR5 It relates to cells (LPC) .

The present invention also provides: (2) CD11c ⁺ intestinal mucosa lamina propria isolated from a non-human animal in which all or part of the endogenous gene encoding TLR5 is inactivated by gene mutation and the function of expressing TLR5 is lost. The present invention relates to a method of using cells (LPC) in vitro as a model cell showing immunological unresponsiveness to flagellin .

The present invention further relates to (3) Salmonella infection of the intestinal mucosa produced by inactivating all or part of the endogenous gene encoding TLR5 by genetic mutation and losing the function of expressing TLR5. It is related with the non-human model animal which shows tolerance .

The present invention also relates to (4) the non-human animal model described in (3) above, wherein the Salmonella is Salmonella typhimurium .

  According to the screening method of the present invention, a mucosal vaccine adjuvant excellent in treatment for bacterial infections such as systemic infections caused by flagellated bacteria such as Salmonella can be obtained.

As a screening method of the present invention, wild-type non-human animal-derived CD11c ⁺ intestinal mucosal lamina propria cells (LPC) and flagellin-derived flagellin or flagella-derived flagellum in the presence of a test substance or In the absence of incubation in contact in vitro, the concentration of IL-6 and / or IL-12p40 in the supernatant is measured, and the IL in the presence of the test substance compared to the absence of the test substance -6 and / or IL-12p40, a method of selecting an increase in measured concentration as an index (screening method I), or orally administering flagellated bacteria and a test substance to a wild-type non-human animal The number of flagellar bacteria in the membrane lymph node (MLN) is measured, and the mucosal vaccine adjuvant is selected using the decrease in the number of flagellar bacteria as an index, compared with the case where only flagellar bacteria are orally administered And non-human animal-derived CD11c ⁺ LPC, flagellin-derived flagellin or flagella-derived flagellum in vitro. A method of using the CD11c ⁺ LPC for screening for a mucosal vaccine adjuvant (Method I), which comprises stimulating with, or destroying, deleting or replacing all or part of an endogenous gene of a non-human animal encoding TLR5 A method of using the non-human animal for screening for a mucosal vaccine adjuvant, comprising orally administering flagellated bacteria to a non-human animal that has been inactivated by a genetic mutation such as the above and has lost the function of expressing TLR5 If it is II), it is not particularly limited. As the mucosal vaccine adjuvant, intestinal mucosal vaccine is activated. That TLR5 agonists like can be exemplified, and as an adjuvant a candidate substance (analyte) can include proteins, peptides, nucleotides, natural organic compounds, synthetic organic compounds.

  The flagellar bacterium (flagella of Gram-positive or Gram-negative bacteria) is not particularly limited as long as it has flagella. For example, Salmonella, Botulinum, Listeria, Helicobacter pylori, Legionella, Escherichia coli, enteritis Examples include Bacillus bacteria such as Vibrio and Bacillus subtilis, Campylobacter bacteria, Cholera bacteria, Pseudomonas bacteria, Rhinococcus bacteria, and bronchial septic bacteria, and Salmonella bacteria can be preferably exemplified. Salmonella bacteria include Salmonella typhimurium, S. enteritidis, Salmonella enterica, S. choleraesuis, Salmonella dublin (S. dublin), Salmonella Tiffy (S. typhi), Salmonella Paratyphi (S. paratyphi), Salmonella Delby (S. derby), Salmonella Hader (S. hadar), Salmonella Heidelberg (S. heidelberg), Salmonella Examples include Agona (S. agona) and Salmonella Arizona (S. arizonae).

  Examples of flagellin derived from flagellated bacteria include flagellin protein isolated and purified from the flagellar bacterium, and flagellin protein expressed by a gene recombination technique using a flagellin gene by a conventional method. The type of flagellar bacterium is not particularly limited due to its function in.

  In addition to the flagellum itself isolated from the flagellar bacterium, the flagellin derived from Salmonella such as Salmonella typhimurium, Salmonella enteritidis, etc., as well as the flagella itself isolated from the flagellar bacterium Examples include a host bacterium that transforms a gene with a flagellin expression vector integrated with a membrane surface anchoring plasmid vector and expresses flagellin on the surface of the cell.

Non-human animals in which all or part of the endogenous genes of the above-mentioned non-human animals encoding TLR5 are inactivated by gene mutations such as disruption, deletion, substitution, etc., and the function of expressing TLR5 is lost include mice, Preferred examples include rodents such as rats, and TLR5 homo-deficient (TLR5 ^{− / −} ) non-human animals such as rabbits. Among them, TLR5 ^{− / −} mice are preferably exemplified. it can. Hereinafter, a method for producing a non-human animal in which the function of expressing TLR5 has been lost will be described using a TLR5 knockout mouse (TLR5 ^{− / −} mouse) as an example.

  Using a gene fragment obtained from a mouse gene library by a method such as PCR from sequence information of the TLR5 gene, a gene encoding TLR5 is screened, and the screened TLR5 gene is subcloned using a virus vector or the like. And identified by DNA sequencing. All or part of the gene encoding TLR5 is replaced with a pMC1 neo gene cassette or the like, and the diphtheria toxin A fragment (DT-A) gene, the herpes simplex virus thymidine kinase (HSV-tk) gene, etc. on the 3 'end side A target vector is prepared by introducing the gene.

The prepared targeting vector is linearized, introduced into ES cells by electroporation (electroporation), etc., and homologous recombination is performed. Among the homologous recombinants, G418 and ganciclovia (GANC) ES cells that have undergone homologous recombination with antibiotics such as are selected. In addition, it is preferable to confirm whether the selected ES cell is the target recombinant by Southern blotting or the like. The confirmed ES cell clone is microinjected into a blastocyst of a mouse, and the blastocyst is returned to a temporary parent mouse to produce a chimeric mouse. When this chimeric mouse is intercrossed with a wild-type mouse, a heterozygous mouse (F1 mouse: +/−) can be obtained, and a TLR5 knockout mouse (TLR5) can be obtained by intercrossing this heterozygous mouse. ^{− / −} Mouse) can be prepared. In addition, as a method for confirming whether TLR5 occurs in a TLR5 knockout mouse, for example, RNA is isolated from the mouse obtained by the above method and examined by Northern blotting or the like. There is a method for examining expression by Western blotting or the like.

By the way, homozygous non-human animals born in accordance with Mendel's law include TLR5 homo-deficient non-human animals and their wild-type (TLR5 ^{+ / +} ) non-human animals. By using the non-human animal deficiency and its wild-type wild type at the same time, an accurate comparison experiment can be performed at the individual level. For example, it is preferably used together in the screening method II of the present invention.

Further, the CD11c ⁺ intestinal mucosal lamina propria cells (LPC) derived from wild-type and TLR5-deficient non-human animals (in which the function of expressing TLR5 is lost) in the screening method I of the present invention are present in the lamina propria. It means all cells and can be advantageously isolated by the method described in the literature (J Immunol 176, 803-810, 2006). That is, small intestine sections were prepared using PBS containing 10% FCS, 20 mM HEPES, 100 U / ml penicillin, 100 μg / ml streptomycin, 1 mM sodium pyruvate, 10 mM EDTA and 10 μg / ml polymyxin B. Treatment at 30 ° C. for 30 minutes to remove epithelial cells and thorough washing with PBS, followed by RPMI 1640/10% FCS with 400 M (1 U / ml) collagenase D and 10 μg / ml DNase I Digest with continuous agitation at 37 ° C. for 45-90 minutes, add EDTA (final 10 mM), and incubate the cell suspension for an additional 5 minutes at 37 ° C. in 15.5% Accudenz solution. And concentrating CD11c ⁺ LPC containing dendritic cells (DC) and eosinophils, followed by anti-CD11c CD11c ⁺ LPC can be obtained by performing positive selection using microbeads.

  The concentration of IL-6 and / or IL-12p40 in the screening method I of the present invention can be measured with a commercially available measurement kit or measurement system, specifically, measurement with a Bioplex system (Bio-Rad). Can be preferably exemplified. In addition, the number of flagellar bacteria in the mesenteric lymph node (MLN) in the screening method II of the present invention is measured by, for example, using a serial dilution of a lysate obtained by dissolving separated MLN in 0.01% Triton-X100. After plating on LB agar medium and incubating overnight at 37 ° C., the number of colonies can be counted.

In the screening method I of the present invention, as a method of contacting CD11c ⁺ LPC with flagellin-derived flagellin or flagella-derived flagellum (flagellin or the like) by in vitro incubation in the presence of a test substance. Add CD11c ⁺ LPC, flagellin, etc. and the test substance to the medium before and after incubation, or add CD11c ⁺ LPC and test substance to the medium and incubate, then add flagellin etc. to the medium Incubation method of adding CD11c ⁺ LPC to the medium after incubation with flagellin and the test substance and the test substance, incubation with CD11c ⁺ LPC, flagellin and the test substance in advance In a buffer solution such as physiological saline A method in which the cells are brought into contact and then incubated in a medium, a method in which flagellin and the like are brought into contact with a test substance in a buffer solution such as physiological saline, and then incubated together in a medium inoculated with CD11c ⁺ LPC, or CD11c ⁺ Examples include a method in which LPC and a test substance are previously contacted in a buffer solution such as physiological saline, and then incubated together in a medium supplemented with flagellin or the like. In addition, a test substance is administered to a non-human animal in advance. Then, a method of adding CD11c ⁺ LPC obtained from the non-human animal, flagellin and the like to the medium and incubating can be exemplified.

Further, in the screening method I of the present invention, the CD11c ⁺ LPC and flagellin like, in the absence of the test substance, as a method of contacting with incubation in vitro, before or after the medium CD11c ⁺ LPC and flagellin like And a method in which CD11c ⁺ LPC and flagellin are contacted in advance in a buffer solution such as physiological saline and then incubated in a medium.

In the screening method I of the present invention using CD11c ⁺ LPC derived from a wild-type non-human animal, the measured concentration of IL-6 and / or IL-12p40 in the presence of the test substance compared to the absence of the test substance Is significantly increased, the test substance can be expected as a mucosal vaccine adjuvant. Then, in the presence of a test substance that can be expected as a mucosal vaccine adjuvant, all or part of the endogenous gene of non-human animal encoding TLR5 is inactivated by gene mutation such as destruction, deletion, or substitution, and TLR5 is expressed. CD11c ⁺ LPC derived from the same type of non-human animal as that of the wild-type non-human animal that lost the function to be in contact with flagellin or the like by in vitro incubation and contact, and IL-6 and / or IL- When the concentration of 12p40 is measured and no significant increase in concentration is observed in the case of wild type animals, the test substance can be sufficiently expected as a mucosal vaccine adjuvant via TLR5.

As an aspect of the use of CD11c ⁺ LPC in the method of use I of the present invention, CD11c ⁺ LPC is brought into contact with flagellin or the like as described above, and CD11c ⁺ LPC is stimulated with flagellin or the like in the above screening method I of the present invention. The use mode of CD11c ⁺ LPC can be preferably exemplified.

  In the screening method II of the present invention, the flagellar bacterium and the test substance are orally administered as a method of orally administering the flagellar bacterium and the test substance simultaneously, Examples include a method of orally administering and then orally administering a test substance, and a method of orally administering a test substance and then orally administering flagellar bacteria. In addition, in the screening method II of the present invention, a wild-type non-human animal (eg, a wild-type mouse) of the same species as a non-human animal (eg, a TLR5 knockout mouse) that has lost the function of expressing TLR5, more preferably the same abdomen. It is preferable to compare and evaluate the number of flagellar bacteria in MLN of wild-type non-human animals (for example, wild-type mice of the same litter) because variations due to individual differences can be eliminated.

  In the screening method II of the present invention using a wild-type non-human animal, the presence in MLN when oral administration of flagellar bacteria and a test substance is higher than when oral administration of flagellar bacteria alone. When the measured value of the number of flagellar bacteria is significantly reduced, the test substance can be expected as a mucosal vaccine adjuvant. Then, the measured value of the number of flagellar bacteria that has been significantly reduced is the test substance that can be expected as the mucosal vaccine adjuvant, and all or part of the endogenous gene of the non-human animal encoding TLR5 is destroyed, deleted, replaced, etc. The test substance is mediated by TLR5 at the same level as when orally administered to a non-human animal of the same species as the wild-type non-human animal that has been inactivated by the mutation of It can be expected sufficiently as a mucosal vaccine adjuvant.

  As an embodiment of the use of a non-human animal that has lost the function of expressing TLR5 in the method of use II of the present invention, flagellin or the like is orally administered to the non-human animal that has lost the function of expressing TLR5 as described above. An example of the use of a non-human animal that has lost the function of expressing TLR5 as a positive control in the screening method II of the present invention can be preferably exemplified.

  EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, the technical scope of this invention is not limited to these illustrations. All animal experiments were performed based on an experimental protocol approved by the Experimental Animal Ethics Committee attached to the Research Institute for Microbial Diseases, Osaka University.

[Mouse, reagents, antibodies and bacteria]
C57BL / 6 mice were purchased from Nippon Clare (Osaka). TLR4 ^{− / −} mice were obtained from Hoshino, K., Takeuchi, O., Kawai, T., Sanjo, H., Ogawa, T., Takeda, Y., Takeda, K. & Akira, S., J Immunol. 162, 3749-52. (1999) was used. As lipopolysaccharide (LPS), LPS derived from Salmonella minnesota Re595 (Salmonella minnesota Re595) was prepared by a phenol-chloroform-petroleum ether extraction method. Purified flagellin was donated by A. Aderem (Institute for System Biology). Salmonella enterica serotype Typhimurium SR-11 3181 and 3181 FliA :: Tn10 were provided by Kitasato Institute of Life Science (Kutsukake, K., Ohya, Y., Yamaguchi, S. & Iino, T. Operon Structure of flagellar genes in Salmonella typhimurium. Mol Gen Genet 214, 11-5 (1988), Gulig, PA & Curtiss, R., Infect Immun 55, 2891-901 (1987)). Enterobacter cloaca was isolated from healthy human volunteers and identified by the National Institute for Microbial Diseases, Osaka University.

[cell]
In order to prepare bone marrow dendric cells (BMDC) derived from bone marrow in vitro, bone marrow cells were prepared from the femur and tibia. Next, the cells were treated with 10% fetal calf serum (FCS: manufactured by Gibco), 100 μM 2-mercaptoethanol (2-mercaptoethanol: 2-ME: manufactured by Nacalai), and 10 ng / ml mouse granules. The cells were cultured in RPMI 1640 medium (Nacalai) supplemented with granulocyte-macrophage colony-stimulating factor (GM-CSF: manufactured by Pepro Tech). The medium was changed every 2 days. After 6-8 days, cells were harvested and used as GM-CSF-induced BMDC (GM-CSF-DC).

  In order to prepare spleen cells having macrophages and DC, the spleen was cut into small fragments, and RPMI1640 medium containing 400 U / ml collagenase (Wako) and 15 μg / ml DNA-degrading enzyme (Sigma) was used. Incubate for 20 minutes at ° C. 5 mM EDTA was added for the last 5 minutes. After RBC lysis, a single cell suspension was prepared, and positive selection of macrophages and DCs was performed using anti-CD11b and anti-CD11c microbeads (Miltenyi).

  To collect thioglycolate-induced peritoneal macrophages, 2 mL of 4% thioglycolate (Sigma) was injected intraperitoneally into mice. Three days later, peritoneal exudate cells (PEC) were collected.

In order to isolate intestinal lymphocytes and epithelial cells, the small intestine of mice cut into fine sections was prepared in preheated RPMI 1640 containing 1 mM EDTA, L-glutamine, penicillin, streptomycin and gentamicin and 10% FCS. The mixture was stirred at 0 ° C. for 10 minutes and then shaken vigorously for 15 seconds. This process was performed twice, and the resulting supernatant was passed through a small cotton-glass wool column to remove cell debris and separated by the Percoll density gradient method (Pharmacia Fine Chemicals, Pharmacia). A discontinuous density gradient (25, 40 and 75%) was used. Cells between 40% and 75% of the fractional layer were collected as small intestinal epithelial lymphocytes (IEL), and between 40% and 25% of the interface layer cells were collected as small intestinal epithelial cells (intestinal epithelial cells). cell: IEC). In order to prepare a CD11c ⁺ cell preparation derived from the lamina propria (LP) and Peyer's patches (PP) of the small intestine, small intestine sections and PP were prepared from 10% FCS, 20 mM HEPES (manufactured by Nacalai). ), 100 U / ml penicillin (SIGMA), 100 μg / ml streptomycin (SIGMA), 1 mM sodium pyruvate (Nacalai), 10 mM EDTA (Nacalai) and 10 μg / ml polymyxin B Using PBS containing (Calbiochem), the cells were treated at 37 ° C. for 30 minutes to remove epithelial cells, and washed thoroughly with PBS. Small intestine sections and PP were incubated at 37 ° C. in RPMI 1640/10% FCS containing 400 M (1 U / ml) collagenase D (Roche) and 10 μg / ml RNase I (Roche). Digested for ˜90 minutes with continuous stirring. EDTA was added (final 10 mM) and the cell suspension was incubated for an additional 5 minutes at 37 ° C. Cells were centrifuged in 15.5% Accudenz solution (Accurate Chemical & Scientific) to concentrate DC. The resulting cells were positively selected using anti-CD11c microbeads (Miltenyi).

[Measurement of inflammatory cytokine concentration]
GM-DC, PEC, CD11b ⁺ spleen cells, CD11c ⁺ spleen cells and CD11c ⁺ lamina propria cells (LPC) were transferred to LPS (100 ng / well) in a 96-well plate (5 × 10 ⁴ cells / well). ml) or flagellin (1 μg / ml). The concentrations of TNF-α, IL-6, IL-12p40 and IL-10 in the culture supernatant were measured with a Bioplex system (Bio-Rad) according to the manufacturer's instructions.

[RT-PCR and q-PCR]
RNA derived from tissues, organs, and primary cells was quantified, and 1 μg of RNA was reverse transcribed with primers of random hexamers according to the manufacturer's instructions using Superscript 2 (Invitrogen). PCR is for TLR4 [sense: GCCTCCCTGGCTCCTGGCTAGGAC (SEQ ID NO: 1), antisense: GGCCAATTTTGTCTCCACAGCCACC (SEQ ID NO: 2)], for TLR5 [sense: GGTGTGATCTTCATGGCCAGCCC (SEQ ID NO: 3), antisense: CGTCGCTTAAGGAATTCAGTTCCCGG (SEQ ID NO: 4) It was carried out using a primer pair for [beta] -actin [Sense: GACATGGAGAAGATCTGGCACCACA (SEQ ID NO: 5), Antisense: ATCTCCTGCTCGAAGTCTAGAGCAA (SEQ ID NO: 6)] and Taq polymerase (Takara Shuzo Co., Ltd.).

  PCR conditions were 97 ° C., 57 ° C. and 72 ° C. for 25 cycles for 30 seconds, and the products were analyzed on an agarose gel. Quantitative real-time PCR (q-PCR) analysis was performed using a 7700 sequence detector (Applied Biosystem). q-PCR was performed in a final volume of 25 μl containing cDNA amplified as described above, 2 × PCR master mix (Applied Biosystem) and the following primers: 18s rRNA (Applied Biosystem) as an internal control Manufactured), TLR4 and TLR5 (manufactured by Assay on Demand). The amplification conditions were 95 ° C. (10 minutes), 35 cycles at 95 ° C. (15 seconds), 60 ° C. (60 seconds), and 50 ° C. (120 seconds).

[Microarray analysis]
IEC and LPC collected from TLR5 ^{+ / +} and TLR5 ^{− / −} mice were treated for 4 hours in the presence or absence of flagellin (1 μg / ml). Total RNA was extracted with RN Easy Kit (Qiagen), and then mRNA was purified with Oligotex mRNA Kit (Pharmacia). Biotin-labeled and fragmented cDNA was synthesized from 100 ng of purified mRNA using an ovation biotin system (Nugen) according to the manufacturer's instructions. The cDNA product was hybridized to Affymetrix mouse genome 4302.0 microarray chip (Affymetrix) according to the manufacturer's instructions. The hybridized chip was stained, washed, and scanned with a gene array scanner (Affymetrix). Data analysis was performed using microarray suite software (version 5.0, Affymetrix) and Genespring software (Silicon Genetics).

[Double immunofluorescence staining of the small intestine]
When confirming the localization of TLR5 in the small intestine, biotinylated anti-CD11c and anti-TLR5 (Abgent) monoclonal antibody were reacted overnight at 4 ° C. on sections cut from frozen tissue. The sample was washed and then incubated with streptavidin-alexa 594 (Molecular Probes) and Alexa-448 chicken anti-rabbit IgG (Molecular Probes) for 2 hours at room temperature. Using a radiance 2100 / Bio-Rad confocal laser microscope (manufactured by Bio-Rad laboratories), analysis was performed by immunohistochemical staining.

[Bacterial infection of mice]
Salmonella typhimurium was grown in Luria-Bertani (LB) medium at 37 ° C. without shaking. The bacterial concentration was measured using absorbance at 600 nm (OD600). Bacteria were injected orally or intraperitoneally into 8 week old mice. Mice were sacrificed at various times to confirm bacterial load in the organ. Liver, spleen, LPC, Peyer's patches cell (PPC) and mesenteric lymph node (MLN) were dissolved in 0.01% Triton-X100. A serial dilution of the lysate was plated on LB agar and incubated overnight at 37 ° C., after which the number of colonies was counted.

[Statistical analysis]
To examine the difference in survival between control and mutant mice after bacterial infection, Kaplan-Meier plot and log rank tests were performed.

[Preparation of TLR5 knockout mouse]
To elucidate the physiological role of TLR5, TLR5 ^{− / −} mice were produced by targeted gene recombination. TLR5 genomic DNA was isolated from a 129 / Sv mouse genomic library and characterized by restriction enzyme mapping and sequence analysis. The mouse tlr5 gene consists of one exon. We used pMC-neo (Stratagene) having herpes simplex virus-thymidine kinase (HSV-tk) at the 5 ′ end as a vector, and constructed a targeting vector that can insert a neomycin resistance gene cassette into an exon of the Tlr5 gene. (FIG. 1a). The targeting vector was linearized with SalI and introduced into E14.1 ES cells by electroporation. Homologous recombination of clones resistant to G418 and gancyclovir was screened by PCR and confirmed by Southern blot analysis using the probe (SEQ ID NO: 7) shown in FIG. 1a.

  Two correctly targeted ES clones were microinjected into C57BL / 6 blastocysts to generate chimeric mice. Chimeric mice were mated with female C57BL / 6 mice and transmission of mutant alleles was observed by Southern blot analysis (FIG. 1b).

Next, male chimeric mice were mated with female C57BL / 6 to produce heterozygous mice. Such heterozygous mice were backcrossed 8 times with C57BL / 6 mice. Such heterozygous mice were backcrossed 8 times with C57BL / 6 mice. The heterozygote F8 precursor was intercrossed to obtain TLR5 ^{− / −} mice. TLR5 ^{− / −} mice were born as expected in the Mendelian ratio, and no developmental abnormalities were observed. In order to confirm the disruption of the tlr5 gene, Northern blot analysis of total RNA derived from TLR5 ^{+ / +} and TLR5 ^{− / −} intestinal tract was performed. In TLR5 ^{− / −} mice, no TLR5 transcript was seen (FIG. 1c).

Furthermore, systemic production of inflammatory cytokines was examined in order to examine the response of the mice to flagellin. Following injection of purified flagellin into the peritoneal cavity of TLR5 ^{+ / +} and TLR5 ^{− / −} mice, serum concentrations of interleukin (IL) -6 and IL-12p40 were measured every hour for up to 4 hours after injection. In TLR5 ^{+ / +} mice, IL-6 and IL-12p40 production increased within 2 hours after injection, while in TLR5 ^{− / −} mice it remained still low after 4 hours (FIG. 1d). These results confirmed that flagellin is a natural ligand of TLR5.

Next, the flagellin-mediated immune response in macrophages and conventional dendric cells (cDC) was analyzed. CD11b ⁺ or CD11c ⁺ spleen cells, peritoneal macrophages (PEC) and granulocyte macrophage colony stimulating factor (GM-CSF) induced bone marrow derived dendritic cells (GM-DC) were isolated from mice and then these cells were flagellin. Or it stimulated with TLR4 ligand and lipopolysaccharide (lipopolysaccharide: LPS), and IL-6 of the supernatant was measured (FIG. 2a).

  All of the cells produced IL-6 in response to LPS, but no IL-6 induction by flagellin stimulation was detected. Similarly, as the results of q-PCR showed, spleen cells, PEC and GM-DC expressed not tlr5 mRNA but tlr4 (FIG. 2b). In addition, in order to clarify the organs involved in inflammatory cytokine production in response to flagellin of TLR5, the expression level of TLR5 in the spleen, liver, kidney, heart, lung and intestinal tract from mice was q-PCR. (FIG. 2c). Compared with other organs, high expression of tlr5 mRNA was observed in the intestine.

First, the inflammatory response via TLR5 in IEC was examined. IECs were isolated from TLR5 ^{+ / +} and TLR5 ^{− / −} mice, they were stimulated with medium alone or with flagellin (1 μg / ml), and the characteristics of TLR5-inducible genes were examined using cDNA microarray (FIG. 3). . As a result, defensin β3 (Defb3), CD86 (CD86), killer cell lectin-like receptor subfamily A member 6 (klra6), complement component 8α (C8a), chemokine (CC motif) ligand 27 (Ccl27) Some genes involved in the immune response, such as, were induced by the stimulation of flagellin in TLR5 ^{+ / +} IEC, but the expression of these genes was reduced in TLR5 ^{− / −} IEC. However, even in TLR5 ^{+ / +} IEC, most chemokines were not induced as a response to flagellin. Furthermore, IEC did not induce any inflammatory cytokines. Although data are not shown this time, protein-level experiments confirmed that IEC did not induce any inflammatory cytokines upon flagellin stimulation.

  The expression of TLR5 in IEC was examined (Fig. 4a). The level of tlr5 mRNA in IEC was very low compared to the level found throughout the small intestine. Thus, we hypothesized that TLR5 should be specifically expressed in another subcompartment of the small intestine, and further from the mouse small intestine to Peyer's patch cells (PPC), intestinal epithelial lymphocytes (IEL) and lamina propria cells (LPC). ) Were isolated and examined for TLR5 expression (FIG. 4a). TLR5 was highly expressed in LPC, while expression in IEL and PPC was relatively low compared to levels measured throughout the small intestine.

Recent reports reveal that DCs are the major antigen presenting cells (APCs) in LPs in the small intestine of mice (Pavli, P., Woodhams, CE, et. Al., Immunology 70, from 40-7 (1990)) that separates the DC11c ⁺ from LPC and PPC, were examined the expression of tlr5mRNA, CD11c ^- the LPC without very high expression of TLR5 in CD11c ⁺ LPC detection It was done. In contrast to CD11c ⁺ LPC, CD11c ⁺ PPC had lower expression of TLR5 than was seen in the entire small intestine. Furthermore, the localization of TLR5 in the small intestine was examined by immunohistochemistry. TLR5 was highly expressed in intestinal CD11c ⁺ LPC (FIGS. 4b and c). Consistent with the q-PCR results, no TLR5 expression was detected in PP (FIG. 4d). CD11c ⁺ LPC specifically expressed TLR5 in the intestine.

To evaluate the effect of flagellin on CD11c ⁺ LPC, CD11c ⁺ LPC was isolated from the small intestine of TLR5 ^{+ / +} and TLR5 ^{− / −} mice and stimulated with LPS (100 ng / ml) or flagellin (1 μg / ml) The concentration of inflammatory cytokines in the supernatant was measured. Only the medium was used as a negative control (upper figure 5). TLR5 ^{+ / +} CD11c ⁺ LPC produced IL-6 and IL-12p40 in response to flagellin, whereas TLR5 ^{− / −} CD11c ⁺ LPC did not induce these cytokines. Neither CD11c ⁺ LPC showed any over-induction of TNF-α in response to flagellin. Interestingly, CD11c ⁺ LPC did not induce any cytokines in response to LPS.

The APC of PP has been examined in detail in mucosal tissues, and a unique DC subset possessed by PP plays an important role in the production of regulatory T cells and oral tolerance by producing IL-10, DCs have been shown to induce IL-10 in response to inflammatory stimuli such as LPS (Niedergang, F. et.al., Trends Microbiol 12, 79-88 (2004), Ruedl, C. et al. , et.al., Eur J Immunol 26, 1801-6 (1996), Wakkach, A., et.al., Immunity 18, 605-17 (2003)). Therefore, CD11c ⁺ PPC was isolated from TLR5 ^{+ / +} and TLR5 ^{− / −} mice, stimulated with flagellin or LPS, and the concentration of inflammatory cytokines in the supernatant was measured (bottom of FIG. 5). Both CD11c ⁺ PPC derived from TLR5 ^{+ / +} and TLR5 ^{− / −} mice did not induce any cytokines in response to flagellin, indicating that the expression of TLR5 shown in Example 4 was low (FIG. 4a). It was consistent. Also, both CD11c ⁺ PPC produced IL-6 and IL-10 in response to LPS. On the other hand, as described above, neither CD11c ⁺ LPC from TLR5 ^{+ / +} and TLR5 ^{− / −} mice produces IL-10 in response to flagellin, indicating that TLR5 signaling in these cells is This suggests a tendency to induce an inflammatory response rather than immune tolerance (FIG. 5).

In order to comprehensively examine the innate immune response mediated by TLR5 in the small intestine, TLR5 ^{+ / +} and TLR5 ^{− / −} LPCs were stimulated with flagellin (1 μg / ml) for 4 hours, RNA samples were prepared, and cDNA microarray analysis (Fig. 6). Several markedly up-regulated transcripts were identified in TLR5 ^{+ / +} LPCs 4 hours after flagellin stimulation, but expression of these genes was not induced in TLR5 ^{− / −} cells It was. The genes include cytokines (Il-6, Il-If5, Il-If9, Il-1b, Ebi3 and Iltifb), cytokine receptors (Tnfrsf5, Il1r1 and Il2ra), several chemokines (CKLF and CCL4), signaling Examples include proinflammatory genes such as molecules (Traf6 and gp130), prostanoids (Plaa and Pla2g2d), prostanoid synthase (Cox2) and secreted antibacterial peptides (Hamp, Lcn and Gzmb) (upper part of FIG. 6). Furthermore, genes related to cell adhesion, cytoskeletal tissue, intracellular translocation, vesicle fusion, and transcription were up-regulated by stimulation with flagellin (middle panel in FIG. 6). On the other hand, in both TLR5 ^{+ / +} and TLR5 ^{− / −} LPCs, interferon (IFN) and IFN-inducible genes were not induced in response to flagellin (FIG. 6, lower panel).

As shown in Example 6, CD11c ⁺ LPC produced IL-6 and IL-12p40 in response to flagellin but not LPS. Also, although not shown in the data, both TLR5 ^{+ / +} and TLR5 ^{− / −} CD11c ⁺ LPCs produced similar levels of IL-6 when stimulated with a TLR2 ligand. This suggests that LPS signaling is specifically suppressed in CD11c ⁺ LPC. Therefore, the expression levels of TLR4 and TLR5 were examined for CD11c ⁺ spleen cells (SPC) and CD11c ⁺ LPC (FIG. 7a). CD11c ⁺ SPC had high TLR4 expression, while TLR5 expression was low. In contrast to CD11c ⁺ SPC, TLR4 expression was very low in CD11c ⁺ LPC compared to TLR5 expression.

Since the expression characteristics of TLR4 and TLR5 are different between CD11c ⁺ LPC and CD11c ⁺ SPC, responses to symbiotic bacteria and pathogenic bacteria in these cells were examined. CD11c ⁺ LPC and CD11c ⁺ SPC were isolated from wild type, TLR4 ^{− / −} and TLR5 ^{− / −} mice, heat-killed symbiotic bacteria Enterobacter cloaca (10 m.o.i.), heat-killed pathogenicity Gram-negative bacteria Salmonella typhimurium (10 m.o.i.), heat-killed Salmonella typhimurium ΔfliA (10 m.o.i.), LPS (0.1 μg / ml) or flagellin (1 μg / ml) The cells were cultured in a medium supplemented with either of them, and IL-6 production was measured (FIG. 7b). Wild type CD11c ⁺ SPC produced large amounts of IL-6 in response to both Enterobacter cloaca and Salmonella typhimurium. TLR5 ^{− / −} CD11c ⁺ SPC also showed the same response as wild-type CD11c ⁺ SPC. However, the production of IL-6 in CD11c ⁺ SPC of TLR4 ^{− / −} is much lower than CD11c ⁺ SPC in wild type and TLR5 ^{− / −} , and CD11c ⁺ SPC is primarily through TLR4 through the innate immune response against gram-negative bacteria. It was suggested that

Wild type CD11c ⁺ LPC also induced large amounts of IL-6 in response to Salmonella typhimurium. In contrast to CD11c ⁺ SPC, the induction of IL-6 by Salmonella typhimurium in TLR5 ^{− / −} CD11c ⁺ LPC was significantly reduced, whereas TLR4 ^{− / −} CD11c ⁺ LPC was wild. IL-6 was produced to the same extent as type CD11c ⁺ LPC. Furthermore, the response of CD11c ⁺ LPC was examined using the mutant Salmonella typhimurium which was made to have no flagella by deleting the fliA gene (Kutsukake, K., et.al., Mol Gen Genet 214, 11-5). (1988)). As a result, not only TLR5 ^{− / −} CD11c ⁺ LPC but also wild-type CD11c ⁺ LPC were less responsive to the ΔfliA mutant compared to wild-type Salmonella typhimurium. This suggests that CD11c ⁺ LPC induces an immune response by recognizing Salmonella typhimurium flagellin. Also, unlike CD11c ⁺ SPC, wild type CD11c ⁺ LPC produced only a relatively small amount of IL-6 by Enterobacter cloaca. Taking these results together, it can be said that CD11c ⁺ LPC recognizes pathogenic flagella bacteria through TLR5 and induces an innate immune response.

To investigate whether TLR-5 plays a special role against bacterial infections in the gut, Salmonella typhimurium was orally infected to TLR5 ^{+ / +} and TLR5 ^{− / −} mice. Unlike expected, TLR5 ^{− / −} mice were more resistant to Salmonella typhimurium compared to TLR5 ^{+ / +} mice (FIG. 8a). Similar results were obtained in both the C57 / BL6 (FIG. 8a left) and C57 / BL6X129Sv mixed background (FIG. 8a right) mice. In addition, when mice were infected with Salmonella typhimurium by intraperitoneal injection, there was no significant difference in the survival rate between TLR5 ^{+ / +} and TLR5 ^{− / −} mice (FIG. 8b). Further 4 days after oral infection, TLR5 ^{- / -} in mouse, the number of bacteria recovered from the liver and spleen was significantly less than TLR5 ^{+ / +} mice (Figure 8c).

When the number of bacteria recovered from MLN, PP and LPC of TLR5 ^{+ / +} and TLR5 ^{− / −} mice 24 hours after oral infection was examined, the number of Salmonella typhimurium in PP and LPC was found to be TLR5 ^{+ /} There was little difference between ⁺ and TLR5 ^{− / −} mice. However, since the number of bacteria recovered from MLN was significantly less in TLR5 ^{− / −} mice than in TLR5 ^{+ / +} (FIG. 8d), in TLR5 ^{− / −} mice, Salmonella Impaired Typhimurium migration may delay infection from reaching the entire body.

<Discussion>
TLR5 has been identified as a receptor for flagellin in vitro, but its in vivo function is unclear. Unlike other TLR family members, TLR5 is not expressed on mouse spleen cells, peritoneal macrophages and CM-DC, which makes it difficult to address the function of TLR5 in innate immunity. Therefore, it was found that TLR5 was specifically expressed in CD11c ⁺ LPC in the intestinal tract of mice using a recently established method for isolating LPC with high survival rate (FIG. 4).

DCs are located in the lower part of the chorionic epithelium in LPs, and have long been known to absorb antigens from the intestine (Mayrhofer, G., et. Al., Eur J Immunol 13, 112-22 (1983) However, their role and properties in the intestine are not known. CD11c ⁺ LPC induced the secretion of various mediators including inflammatory cytokines, chemokines, antimicrobial peptides and tissue repair kinases in response to flagellin. Thus, for the first time, it is shown that an immune response was induced with CD11c ⁺ LPC through TLR5.

Analysis of the present invention revealed two interesting points regarding the function of CD11c ⁺ LPC through TLR5. One is the cytokine profile of CD11c ⁺ LPC when stimulated with flagellin. The intestines are constantly exposed to food antigens and numerous commensal bacteria. Tolerance to beneficial antigens appears to be controlled by mucosal DCs (Mowat, AM Nat Rev Immunol 3, 331-41 (2003)). These DCs stimulate the activity of regulatory T cells and are potent suppressors of T cell responses. Recently, it has been shown that DC subsets that express CD11c ^low CD45RB ^high and produce IL-10 promote inhibitory function in regulatory T cells (Wakkach, A., et al., Immunity 18, 605- 17 (2003)). PP has these DC subsets and produces IL-10 by inflammatory stimuli and develops oral tolerance (Niedergang, F. et al., Trends Microbiol 12, 79-88 (2004), Ruedl, C. , et al., Eur J Immunol 26, 1801-6 (1996)). CD11c ⁺ PPC induced IL-10 in response to LPS, whereas flagellin-stimulated CD11c ⁺ LPC produced IL-6 and IL-12 but not IL-10 (FIG. 5). CD11c ⁺ LPC tends to induce an inflammatory response rather than immune tolerance when stimulated with flagellin. However, recent reports reveal that LP DCs are involved in oral tolerance induction (Chirdo, FG, et al., Eur J Immunol 35, 1831-40 (2005)), Worbs, T. et al. , et al., J Exp Med 203, 519-27 (2006)). CD11c ⁺ LPC may play a role as an inflammatory mediator in bacterial infections. A more detailed study will help understand the regulation of immune function between immune tolerance and host defense by CD11c ⁺ LPC.

Another interesting point is that TLR4 expression is significantly lower in CD11c ⁺ LPC. Most symbiotic bacteria in the intestine are gram-negative anaerobic bacilli and have LPS in their cell walls. Recent reports have shown that CD11c ⁺ LPC extends dendrites and phagocytoses bacteria from the lumen (Niess, JH, et al., Science 307, 254-8 (2005)). Although the mechanism of bacterial phagocytosis by CD11c ⁺ LPC has been fully analyzed, it is still clear how the host intestinal mucosa gains immune tolerance against symbiotic bacteria and distinguishes symbiotic and pathogenic bacteria is not. Low expression of TLR4 may contribute to CD11c ⁺ LPC avoiding induction of excessive immune responses against commensal bacteria. CD11c ⁺ LPC induces an inflammatory response against pathogenic flagellate bacteria primarily through TLR5 but not TLR4. Although some commensal bacteria have flagella, CD11c ⁺ LPC did not show a strong response to Enterobacter cloaca. Recent studies have reported that some commensal bacteria such as α and ε proteobacteria change the flagellin recognition site of TLR5 without compromising flagellar motility (Andersen-Nissen, E., et al., Proc Natl Acad Sci USA 102, 9247-52 (2005)). In addition, some symbiotic bacteria suppress flagellin expression when the host environment is stable (Niedergang, F., et al., Trends Microbiol 12, 79-88 (2004)). Unlike pathogenic bacteria, commensal bacteria may have a mechanism that escapes the sensing of TLR5.

Other TLR family members such as TLR2 and TLR4 recognize bacterial components. The importance of TLR2 and TLR4 in host defense against various bacteria has been demonstrated using TLR2 ^{− / −} and TLR4 ^{− / −} mice. In particular, TLR4 mutant C3H / HeJ mice are very sensitive to intraperitoneal infection with Salmonella typhimurium (Akira, S., et al., Cell 124, 783-801 (2006)). However, since TLR5 is not highly expressed except in the intestinal tract, in the case of intraperitoneal infection, it was expected that no significant difference in survival rate was observed between TLR5 ^{+ / +} and TLR5 ^{− / −} mice. In addition, TLR5 ^{− / −} mice appeared to be more susceptible to oral infection with Salmonella typhimurium. This is because TLR5 on CD11c ⁺ LPC senses flagellar bacteria and induces host defense. Thus, it was not expected that TLR5 ^{− / −} mice would be resistant to oral infection with Salmonella typhimurium (FIG. 8a). In addition, TLR5 ^{− / −} mice survived longer than TLR5 ^{+ / +} because the transfer of Salmonella typhimurium from the intestinal tract to the liver or spleen was reduced (FIG. 8b). This unpredictable result is thought to be closely related to the specific pathogenicity of Salmonella.

In most reports, Salmonella typhimurium migrates through PP M cells (Hopkins, SA, et al., Cell Microbiol 2, 59-68 (2000)) and then into the subepithelial DC or small intestinal lumen. It has been shown to be taken up by protruding intraepithelial DCs (Rescigno, M., et al., Nat Immunol 2, 361-7 (2001). After being taken up, Salmonella typhimurium is active. The vesicle transport pathway of the host is adjusted to avoid the transport to the lysosome and establish a system suitable for replication (Patel, JC, et al., Trends Pharmacol Sci 26, 564-70 (2005)). DC matured and migrated to the T cell region or efflux MLN of PP (Niedergang, F., et al., Trends Microbiol 12, 79-88 (2004)). It is thought to be involved in the dissemination of Salmonella typhimurium to the liver and spleen (Niedergang, F., et al., Trends Microb iol 12, 79-88 (2004), Vazquez-Torres, et al., Nature 401, 804-8 (1999)). Incorporation of Salmonella typhimurium into PP and LPC is TLR5 ^{+ / +} and TLR5 ^{−. / -} mice did not differ (Fig. 8d) Moreover, in vitro, TLR5 ^{+ / +} and TLR5 ^{-. / -} between the CD11c ⁺ LPC of, there was no difference in the uptake (data not shown) .TLR5 ^- Bacterial counts in MLN of ^{− / −} are significantly lower than in TLR5 ^{+ / +} mice, suggesting reduced transport of Salmonella typhimurium from LP to MLN. Since CD11c ⁺ LPC of TLR5 ^{− / −} could not be matured, migration of CD11c ⁺ LPC carrying Salmonella typhimurium from the periphery to the circulatory system But, TLR5 ^{- / -} TLR5 on .CD11c ⁺ LPC which may be insufficient in mice initially induces defense host senses the flagellated pathogenic bacteria, facultative intracellular pathogens When Salmonella typhimurium is a systemic infection, CD11c ⁺ LPC may be used as a carrier. To elucidate the infection mechanism of systemic Salmonella typhimurium infection in the future, it is necessary to create a CD11c ⁺ LPC-specific marker or to conduct research to create a technique that depletes these cells is there. In addition, the development of a novel method targeting TLR5 on CD11c ⁺ LPC according to the present invention opens up the possibility of a new treatment for systemic Salmonella typhimurium infection and is useful for mucosal adjuvant immunotherapy It is.

It is a figure regarding preparation of TLR5 ^{− / −} mouse. (A) Structure of tlr5 gene, targeting vector and predicted disrupted gene. The boxed area represents the exon to be encoded. Restriction enzyme: Southern blot analysis of progeny by NcoI (b) heterozygous outcross. Genomic DNA was extracted from the mouse tail, digested with NcoI, electrophoresed and hybridized with the radiolabeled probe shown in (a). As a result of Southern blotting, a 7.5 kb band was observed in wild type mice (+ / +), a 6.2 kb band was observed in homozygous mice (− / −), and heterozygous mice (+ In both cases, both bands were observed. (C) Northern blot analysis of liver. Total RNA (10 mg) extracted from the small intestine was subjected to electrophoresis, transferred onto a nylon membrane, and hybridized using TLR5 as a probe. The same membrane was rehybridized with a β-actin probe. (D) TLR5 ^{+ / +} (n = 5) and TLR5 ^{− / −} (n = 5) 30 μg of purified flagellin was injected intraperitoneally into mice. At the indicated time points, serum levels of IL-6 and IL-12p40 were measured by ELISA. It is a figure which shows the cytokine level and q-PCR after LPS or flagellin stimulation of various cells derived from C57BL / 6J mice. Data are mean ± SD of results obtained from three independent experiments. (A) C57BL / 6J mouse-derived splenic CD11b ⁺ cells, splenic CD11c ⁺ cells, GM-DC and PEC were cultured in LPS (100 nm / ml) or flagellin (1 μg / ml) or only in the medium, and the culture supernatant It is the result of having measured the cytokine level. (B, c) Total RNA (2 μg) was extracted from cells or organs derived from C57BL / 6J mice, and TLR5 mRNA levels were measured by q-PCR. It is a figure which shows the result of having stimulated the IEC of TLR5 ^{+ / +} and TLR5 ^{− / −} with the medium alone or with flagellin (1 μg / ml) and performing cDNA microarray. It is a figure regarding the expression in CD11c ⁺ LPC of TLR5. Data are mean ± SD of results obtained from three independent experiments. (A) Total RNA was extracted from various cells of C57BL / 6J mice, and TLR5 mRNA levels were measured by q-PCR. (B to d) Frozen sections of small intestine derived from C57BL / 6J mice were fixed, stained with anti-CD11c antibody (red) and anti-TLR5 antibody (green), and observed with a confocal microscope. (B) Intestine: 400 times magnification, (c) Intestine: 1600 times magnification, (d) Peyer's patch: 400 times magnification. It is a figure regarding the innate immune response via TLR5 in CD11c ⁺ LPC. CD11c ⁺ LPC and PPC derived from TLR5 ^{+ / +} and TLR5 ^{− / −} mice were cultured with medium alone, LPS (100 ng / ml) or flagellin (1 μg / ml), and cytokine levels in the culture supernatant were measured. . Data are mean ± SD of results obtained from three independent experiments. It is a figure regarding gene induction via flagellin in CD11c ⁺ LPC. CDNA microarrays were performed on samples in which CD11c ⁺ LPC from TLR5 ^{+ / +} and TLR5 ^{− / −} mice were stimulated with or without flagellin (1 μg / ml). FIG. 6 is a diagram of pathogenic bacteria in CD11c ⁺ LPC via TLR5. Data are mean ± SD of results obtained from three independent experiments. (A) Total RNA (2 μg) was extracted from CD11c ⁺ SPC and CD11c ⁺ LPC of C57BL / 6J mice, and the expression of TLR5 was analyzed by RT-PCR (left figure). The amount of TLR5 mRNA was measured by q-PCR (right figure). (B) CD11c ⁺ SPC and CD11c ⁺ LPC derived from wild type, TLR4 ^{− / −} and TLR5 ^{− / −} mice, heat-killed Enterobacter cloaca, heat-killed Salmonella typhimurium, heat-killed Salmonella typhimurium ΔfliA Then, the cells were cultured in either LPS or flagellin medium, and the cytokine level in the culture supernatant was measured. It is a figure regarding systemic infection through TLR5 of Salmonella typhimurium. (A) Survival rate of mice infected orally with 5 × 10 ⁸ Salmonella typhimurium in TLR5 ^{+ / +} (n = 5) and TLR5 ^{− / −} (n = 5) mice as C57 / BL6 background (Left figure) and C57 / BL6 × 129Sv mixed background TLR5 ^{+ / +} (n = 5) and TLR5 ^{− / −} (n = 5) mice orally infected with 1 × 10 ⁷ Salmonella typhimurium Survival rate (right). A generalized Wilcoxon test was performed for the difference between TLR5 ^{+ / +} and TLR5 ^{− / −} mice (P <0.001). (B) Survival of mice when TLR5 ^{+ / +} (n = 5) and TLR5 ^{− / −} (n = 5) mice with C57 / BL6 background were infected intraperitoneally with 1 × 10 ⁶ Salmonella typhimurium rate. A generalized Wilcoxon test is performed for the difference between TLR5 ^{+ / +} and TLR5 ^{− / −} mice (P = 0.267). (C) C57 / BL6 background TLR5 ^{+ / +} (n = 3) and TLR5 ^{− / −} (n = 3) mice were orally infected with 5 × 10 ⁸ Salmonella typhimurium and 96 hours later the liver and The number of bacteria in the spleen. (D) C57 / BL6 background TLR5 ^{+ / +} (n = 5) and TLR5 ^{− / −} (n = 5) mice were orally infected with 5 × 10 ⁸ Salmonella typhimurium, 48 hours later MLN, Bacterial count in PPC and LPC.

Claims (4)

CD11c ⁺ intestinal mucosal lamina propria (LPC) isolated from non-human animals that have inactivated all or part of the endogenous gene encoding TLR5 by genetic mutation and have lost the function of expressing TLR5. CD11c ⁺ intestinal mucosal lamina propria cells (LPC) isolated from non-human animals that have inactivated all or part of the endogenous gene encoding TLR5 by genetic mutation and have lost the function of expressing TLR5 are treated with flagellin. A method for use in vitro as a model cell exhibiting immune unresponsiveness. A non-human model animal resistant to Salmonella infection in the intestinal mucosa produced by inactivating all or part of the endogenous gene encoding TLR5 by genetic mutation and losing the function of expressing TLR5 . The non-human model animal according to claim 3 , wherein the Salmonella is Salmonella typhimurium.