JP5146944B2 - Regulation of intracellular target molecules by IP3 receptor binding protein - Google Patents

Description

The present invention relates to compositions and methods for controlling biological functions in mammalian cells. More specifically, the present invention relates to compositions and methods for controlling the biological function of IP ₃ receptor binding protein (IRBIT) and its intracellular target molecule is involved.

  The present invention also provides a method for screening a substance utilizing the control of the biological function.

When phosphatidylinositol 4,5-bisphosphate is hydrolyzed with activation of a receptor on the cell membrane, the intracellular second messenger inositol 1,4,5-triphosphate ( inositol 1,4,5-trisphosphate (IP ₃ )). IP ₃ induces Ca ²⁺ release from intracellular calcium storage organelles (mainly endoplasmic reticulum) by binding to the IP ₃ receptor (IP ₃ R). In this IP ₃ / Ca ²⁺ signal pathway, the IP ₃ receptor plays a role in converting an IP ₃ signal into a Ca ²⁺ signal.

The IP ₃ receptor is a tetrameric intracellular IP ₃ -induced Ca ²⁺ release channel (IP ₃ -gate Ca ²⁺ release channel). In mammals, there are three different IP ₃ receptors. IP ₃ receptor type 1 (IP ₃ R1) is highly expressed in the central nervous system, particularly in the cerebellum. Mouse IP ₃ R1 consists of 2749 amino acids and is divided into three functionally different regions. That is, there is an IP ₃ binding domain near the N-terminus, a channel-forming domain having a 6-transmembrane region near the C-terminus, and a control region between these two regions. From deletion mutant analysis of IP ₃ binding domain it has been shown amino 226-578 residues of IP ₃ receptor is the minimum region required for ligand binding specificity and high affinity, IP ₃ binding core is called.

Increased cytoplasmic Ca ²⁺ concentration by activation of the IP ₃ receptor controls the activity of a wide variety of downstream target molecules. These downstream target molecules play an important role in a variety of cellular responses such as fertilization, development, proliferation, secretion, and synaptic plasticity.

The present inventors have previously found a novel IP ₃ receptor binding _{protein, IRBIT (I P 3 R -} b inding protein released with i nositol 1,4,5- t risphosphate) was named (Patent Document 1 ). IP ₃ receptor, present humans, mammals such as brain, such as a mouse, heart, liver, kidney, pancreas, since widely distributed in various tissues and cells such as the thymus, to such tissues and cells IRBIT It is estimated that. The amino acid and base sequences of human and mouse IRBIT were determined by the present inventors (Non-patent Document 1, Patent Document 1). These IRBITs consist of 530 amino acids and have 100% identity between humans and mice. Binding region of the IP ₃ receptor (in humans and mice, the amino acid 1 to 104) N-terminal region of IRBIT present in.

IRBIT is (1) a neutral protein (estimated pI value: 6.48), but the N-terminal region is relatively acidic (estimated pI value: 4.98), (2) multiple N-terminal regions phosphorylation sites are localized centrally, presumably phosphorylation is required for interaction with _IP 3 R1, (3) 508 th is essential for binding to IP ₃ of _IP 3 R1 lysine residue is also essential in the interaction with IRBIT, (4) dissociates from interaction with _IP 3 R1 by IP _3, and (5) by high salt concentrations, the interaction with _IP 3 R1 Since it is dissociated and extracted from the crude microsomal fraction, it has a feature that the interaction with IP ₃ R1 is presumed to be due to electrostatic binding (Patent Document 1).

IRBIT binds to IP ₃ binding region of IP ₃ receptor, has a property that dissociates from IP ₃ receptor by IP ₃ in in vitro. Therefore, IRBIT is, IP ₃ by inhibiting IP ₃ receptor binding, it is also revealed to have a function of suppressing the activity of IP ₃ receptor (Patent Document 1).

  The present inventors have now clarified a target molecule of IRBIT and further revealed that IRBIT has an important biological function as a third messenger as described below.

JP2004-129612A H. Ando et al. Biol. Chem. 2003, 278: 10602-10612

  It is an object of the present invention to provide compositions and methods that allow the control of biological functions in cells using the interaction between IRBIT and its molecular target.

  Another object of the present invention is to provide a method for screening a substance that enables control of the biological function by suppressing or enhancing the binding between IRBIT and its molecular target in a cell. .

  In order to solve the above-mentioned problems, the present inventors have conducted intensive research. IRBIT targets are molecules that control protein synthesis, molecules that control inositol phospholipids, and molecules that control intracellular pH. I found out. In addition, as one of the important molecules that control intracellular metabolism, IRBIT has a role as a third messenger that binds to the three types of target molecules found this time and controls the function of the target molecules. Prove that.

SUMMARY OF THE INVENTION Therefore, in summary, the present invention has the following features.
The present invention, in a first aspect, IP ₃ receptor binding protein (IRBIT), a composition comprising an antibody to a nucleic acid or, IRBIT controlling the expression / translation IRBIT,
(1) Protein synthesis,
(2) inositol phospholipid metabolism, and (3) intracellular pH,
The above composition for the control of at least one intracellular biological function selected from the group consisting of:

  In one embodiment, the protein synthesis involves cytoplasmic mRNA polyadenylation by cleavage / polyadenylation specificity factor (CPSF).

In another embodiment, the inositol phospholipid metabolism involves intracellular PIP ₂ synthase (PIPKII).

In another embodiment, the intracellular pH involves p-type Na / HCO ₃ cotransporter 1 (pNBC1) in the cell.

In another embodiment, the control is suppression or enhancement.
In another embodiment, the IRBIT is from a human or mouse.

  In another embodiment, the IRBIT comprises a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3, or an amino acid sequence having 90% or more identity with the amino acid sequence and is equivalent to IRBIT It is a protein that has an active activity.

In another embodiment, the composition is used either in vivo, in vitro, or ex vivo.
In another embodiment, the composition is for treatment of a disease.

  The present invention also provides, in a second aspect, a method of using IRBIT in controlling intracellular protein synthesis in vitro or ex vivo.

  In the embodiment, the IRBIT is coupled to the CPSF to control the function of the CPSF.

The present invention also provides, in a third aspect, a method of using IRBIT in controlling intracellular inositol phospholipid metabolism in vitro or ex vivo.
In that embodiment, the IRBIT suppresses PIPKII activity.

  The present invention also provides, in the fourth aspect, a method of using IRBIT in controlling intracellular pH in vitro or ex vivo.

In one embodiment thereof, the IRBIT activates pNBC1.
In another embodiment, activation of the pNBC1 requires phosphorylation of the IRBIT.

  In the fifth aspect, the present invention also provides a screening for a substance, comprising measuring the binding between IRBIT and CPSF, PIPKII, or pNBC1 in the presence of a candidate substance, and identifying a substance that suppresses or enhances the binding. Provide a method.

In that embodiment, the substance is therapeutic or diagnostic.
In another embodiment, the binding is performed in a mammalian cell.

  In still another embodiment, the substance controls at least one intracellular biological function selected from the group consisting of intracellular protein synthesis, inositol phospholipid metabolism, and intracellular pH.

Definition The term "IRBIT" as used herein are IP ₃ receptor binding protein derived from a mammal are bound to the IP ₃ binding site of the receptor, to the receptor of IP ₃ A protein released into the cytoplasm upon binding. In the present invention, IRBIT is, CPSF (cleavage / polyadenylation specificity factor ), PIPKII (phosphatidylinositol-5-phosphate 4-kinase), or _{pNBC1 (pancreas type Na / HCO 3} cotransporter 1) and binds these IRBIT target proteins Plays an important biological function involved in protein synthesis, inositol phospholipid metabolism, and maintenance of intracellular pH through binding to IRBIT. IRBIT is therefore responsible for the control of these biological functions.

As used herein, the term “protein synthesis” refers to a series of gene transcription and translation processes in a cell, and the present invention involves the regulation of mRNA polyadenylation in the cytoplasm. Moreover, inositol phospholipid metabolism refers to the metabolism of phospholipids containing IP _3.

  As used herein, the term “suppression” refers to a reduction, reduction or inhibition of the biological function.

  As used herein, the term “enhancement” refers to an increase, elevation or enhancement of the biological function.

  As used herein, the term “ex vivo” means that cells or tissues once taken out of a living body are treated with the composition of the present invention and then returned to the living body.

  As used herein, the term “patient” refers to a mammal, preferably a human, such as a human, mouse, rat, dog, cat, livestock animal (eg, cow, horse, pig, sheep, goat, etc.).

  The compositions and methods of the present invention are such that IRBIT is involved in protein synthesis, inositol phospholipid metabolism, or maintenance of intracellular pH via binding to CPSF, PIPKII, or pNBC1, respectively, in mammalian cells. Such IRBIT that controls biological functions, nucleic acids that control the expression / translation of IRBIT, or antibodies to IRBIT are useful for the treatment of diseases associated with abnormalities in the functions.

Hereinafter, the present invention will be described in more detail.
1. Composition According to the first aspect, the present invention provides a composition comprising IRBIT, a nucleic acid that controls the expression / translation of IRBIT, or an antibody against IRBIT. The composition of the present invention is used for control of at least one intracellular biological function selected from the group consisting of (1) protein synthesis, (2) inositol phospholipid metabolism, and (3) intracellular pH. Is done.
Hereinafter, control of the above three biological functions will be described.

Control of protein synthesis In the present invention, the control of protein synthesis is control of mRNA polyadenylation through binding of IRBIT and CPSF in cells.

  CPSF is a complex protein composed of four subunits, CPSF160, CPSF100, CPSF73 and CPSF30. The present inventors have now found that IRBIT binds to CPSF, in particular CPSF160, from co-precipitation tests by co-expression in COS cells and immunoprecipitation (FIG. 1).

  CPSF is an essential molecule for the polyadenylation reaction of mRNA in the nucleus, but has the function of regulating protein synthesis by extending the length of poly (A) in the cytoplasm, and CPSF160 mRNA It is known that the binding site is an essential region when CPSF recognizes mRNA adding poly (A) (C. Barnard Daron et al., Cell 2004, 119: 641-651, and E Klann et al., “Synthetic Plasticity and Translation Initiation”, Learning & Memory 2004, 11: 365-372, Cold Spring Harbor Laboratory Press). Specifically, E.I. In Klann et al. (Supra), “Cytoplasmic polyadenylation and CPEB” (pages 367-368), polyadenylation includes two sequences in the 3 ′ untranslated region of mRNA, namely cytoplasmic polyadenylation element (CPE). ) And AAUAAAA, CPE binding protein (CPEB), an important regulatory protein of polyadenylation, is phosphorylated by a specific protein kinase (Aurora), which induces CPEB It is described that CPSF and CPEB on the AAUAAAA sequence interact to rescue poly (A) polymerase (PAP) and extend the poly (A) tail of mRNA.

  Considering the above findings, it is considered that the function of CPSF is controlled by binding of IRBIT to the mRNA binding site of CPSF160 (FIG. 2).

Furthermore, the present inventors have now demonstrated that IRBIT has polyadenylation activity (I. Kaufmann et al., EMBO J. (2004) 23: 616-626) in the presence of PAP and Fip1 (subunit of CPSF). The knowledge that it has the function to suppress was obtained. From this finding, it is possible to enhance protein synthesis by suppressing IRBIT.

  Thus, IRBIT is involved in the regulation of mRNA polyadenylation, and hence protein synthesis, through binding to CPSF.

  Thus, IRBIT, or a substance that suppresses or enhances its production and function, allows for control of CPSF-related protein synthesis.

Regulation of inositol phospholipid metabolism IRBIT also binds to PIPKII and suppresses the activity of the enzyme (Example 2).
PIPKII is an enzyme that synthesizes phosphatidylinositol 4,5-diphosphate (PI (4,5) P ₂ ) from phosphatidylinositol pentaphosphate (PI (5) P), and further IP3 by hydrolysis of PIP ₂ Is produced. Considering the fact that IP ₃ is a ligand for the IP ₃ receptor and binding to the receptor releases both calcium ions (Ca ²⁺ ) and IRBIT into the cytoplasm, IRBIT is an inositol phospholipid. It can be said that it is involved in the control of metabolism (Katja A. Lamia et al., Mol. Cell Biol. 2004, 24: 5080-5087).

  Thus, IRBIT, or substances that suppress or enhance its production and function, allow for control of inositol phospholipid metabolism involving PIPKII (FIG. 3).

  For example, PIPKII contains three isoforms, PIPKII α, β and γ, in mammals, but IRBIT binds to any of these enzymes. In particular, for PIPKIIβ, since transgenic mice knocked out of the enzyme have high insulin sensitivity, inhibition of the enzyme has been shown to be useful for the treatment of type 2 diabetes (Katja A. Lamia et al., Supra). ). The findings by the inventors that IRBIT suppresses PIPKII activity indicates that IRBIT can be used to treat type 2 diabetes.

Control of intracellular pH IRBIT further binds to and activates pNBC1.
Specifically, by injecting IRBIT cRNA and NBC1 cRNA into Xenopus oocytes, the response of pNBC1 detected by intracellular pH change was about 6 to 7 times higher (FIG. 14). . This result indicated that IRBIT significantly enhanced pNBC1 activity.

  NBC1 is a 10-transmembrane protein existing on the cell membrane, and functions to carry sodium ions and bicarbonate ions in the same direction across the cell membrane at a certain ratio. Since the pH in the living body is skillfully adjusted by the concentration balance between bicarbonate ions and carbon dioxide, NBC1 is considered to be involved in the adjustment of the pH in the living body (E. Gross and I. Kurtz, Am J. Physiol.Rental Physiol.2002,283: F876-F887). In particular, NBC1 was identified as a causative gene of proximal tubular acidosis, a kind of acidemia in which the pH of blood tends to be acidic. The transport of bicarbonate ions by NBC1 is lacking in maintaining pH in vivo. It shows that it plays a role that cannot be done.

  Two splicing variants of kidney type (kidney type: kNBC1) and pancreas type (pNBC1) have been reported so far in NBC1, kNBC1 is mainly in the kidney, and pNBC1 is mainly in the pancreas. It is expressed in a relatively large number of tissues including the system. In order to clarify which part of NBC1 binds to IRBIT, the present inventors expressed the cytoplasmic region of NBC1 as a recombinant protein in E. coli and purified it, and then forcedly expressed it in cultured cells. Binding was examined in a pull-down assay. As a result, IRBIT was found to bind specifically and strongly to the N-terminal 85 amino acids specific to pNBC1 (FIG. 10). Furthermore, it was also found that the binding between IRBIT and pNBC1 was controlled by changing the concentration of a specific salt.

  These results strongly suggest that IRBIT may control pH adjustment by pNBC1 in various organs depending on intracellular conditions. In addition, patients with proximal tubular acidosis present various symptoms such as eye diseases such as glaucoma and cataract, short stature, mental retardation, pancreatitis, etc. Therefore, pH regulation by NBC1 plays an important role in organs other than kidney It is considered to have played. Therefore, IRBIT is also useful as a therapeutic method for diseases such as eye diseases such as glaucoma and cataract, short stature, mental retardation, pancreatitis and the like (Seth L. Alper, Annu. Rev. Physiol.) Via pNBC1. 2002, 64: 899-923).

  Therefore, IRBIT, or a substance that suppresses or enhances its production and function, enables control of the intracellular pH associated with pNBC1.

IP ₃ receptor binding protein (IRBIT)
IRBIT used in the present invention is derived from a mammal. IRBIT is known to be present in intracellular endoplasmic reticulum of tissues such as mammalian brain, heart, liver, kidney, pancreas and thymus (Japanese Patent Laid-Open No. 2004-129612). Examples of preferred IRBIT are human IRBIT and mouse IRBIT (Japanese Patent Application Laid-Open No. 2004-129612, H. Ando et al., J. Biol. Chem. 2003, 278: 10602-10612). Human IRBIT is particularly preferable. The amino acid and base sequences of human and mouse IRBIT are registered in GenBank as NM_006621 (see SEQ ID Nos. 1 and 2) and NM_145542 (see SEQ ID Nos. 3 and 4), respectively.

  Another preferred example of IRBIT is that it has 90% or more, preferably 95% or more, more preferably 98% or more, and most preferably 99% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3. A protein having an amino acid sequence having a biological activity equivalent to that of IRBIT. Here, biological activity includes binding to CPSF in protein synthesis in addition to S-adenosylhomocysteine hydrolase-like activity that catalyzes the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine. Refers to activities involved in the control of biological functions, including control of mRNA polyadenylation, control of inositol phospholipid metabolism through binding to PIPKII, and control of intracellular pH through binding to pNBC1.

  Similarly, examples of preferable DNA encoding IRBIT include 90% or more, preferably 95% or more, more preferably 98% or more, and most preferably 99% or more of the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4. DNA having identity, or DNA capable of hybridizing with the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4 under stringent conditions. Here, stringent conditions are not limited to the following, but hybridization at about 45-50 ° C. in 2-6 × SSC (sodium chloride / sodium citrate), followed by about 50- After washing with 0.2-2 × SSC / 0.1-1% SDS at 65 ° C. or after hybridization in 6 × SSC, Denhardt solution, 0.2% SDS at 60-65 ° C. , Consisting of washing with 0.2 × SSC, 0.1% SDS at 60-65 ° C. (e.g. FM Ausbel et al., Short Protocols in Molecular Biology (3rd edition) A Compendium of Methods from Current Protocols). Biolog , 1995, John Wiley & Sons, Inc.).

  IRBITs from other mammals can also be used in the present invention. Such IRBIT includes, for example, IRBIT of laboratory animals such as rats, hamsters and rabbits, IRBIT of pet animals such as dogs and cats, IRBIT of domestic animals such as cows, horses, pigs, sheep and goats. Regarding the preparation of these IRBITs, probes and / or primers are prepared based on amino acid or base sequences described in literatures, data banks, etc., or based on known sequences of human or mouse IRBIT, DNA cloning method, IRBIT cDNA is cloned and / or amplified by conventional techniques such as polymerase chain reaction (PCR), for example using libraries from commercially available or prepared animal tissue, and the resulting IRBIT is encoded. The DNA is incorporated into a commercially available expression vector (for example, a plasmid) having an appropriate control sequence, transformed or transfected into an appropriate host cell, and the resulting cell is cultured in an appropriate medium to obtain IRBIT DNA. IRBIT protein produced and expressed Quality can be recovered. For a series of these methods, see, for example, J.A. Sambrook et al., Molecular Cloning A Laboratory Manual, 1989, Cold Spring Harbor Laboratory Press, F.M. M.M. Ausbel et al., Short Protocols in Molecular Biology (3rd Edition) A Compendium of Methods from Current Protocols in Molecular Biology, 1995, John Wisley. The 4th edition of Experimental Medicine, edited by Masamura Matsumura et al., “New Genetic Engineering Handbook” (2003) is described in Yodosha, Tokyo, Japan, and the like. It is possible to obtain IRBIT homologues.

  The mammalian tissue containing the IRBIT gene is homogenized using a homogenizer, centrifuged at about 10,000 rpm to obtain a supernatant, and then total RNA is collected, for example, by the guanidine / acidic phenol method, and cDNA is synthesized according to a conventional method. From this cDNA, DNA encoding IRBIT can be obtained. A kit for RNA extraction, for example, ISOGEN (trademark) manufactured by Nippon Gene Co., Ltd., is commercially available.

  The size of the probe for detecting the DNA encoding IRBIT is usually 30 bases or more, preferably 50 to 100 bases or more. Usually, a label such as a fluorescent label (for example, fluorescamine, rhodamine or a derivative thereof) or a radioisotope label (for example, 32P) is bound to the probe, thereby detecting the binding between the DNA encoding the target IRBIT and the probe. can do.

  The size of the primer for amplifying the DNA encoding IRBIT is usually 15 to 30 bases, preferably 20 to 25 bases. The primer should have a complementary sequence on the 3 ′ end side of the sense strand and antisense strand of DNA encoding IRBIT. However, when the sequence of the DNA encoding IRBIT to be amplified is unknown, a plurality of primers are prepared based on the known IRBIT sequence, the template DNA is amplified by PCR, and further, based on the amplified template DNA Thus, a formal primer can be prepared, and the target template DNA can be amplified by PCR.

  In general, PCR consists of about 20 to 40 cycles of DNA denaturation, primer annealing, and extension reaction as one cycle. Denaturation of DNA is a process for dissociating double-stranded DNA into single-stranded DNA, and is usually treated at 94 ° C. for about 15 seconds to 1 minute. Primer annealing is a process of pairing a primer with a complementary single-stranded template DNA. The optimum temperature and time for annealing depend on the base sequence and length of the primer, but the treatment is usually performed at about 55 to 60 ° C. for about 30 seconds to 1 minute. The extension reaction is a step of extending a template DNA in the presence of four types of dNTPs and a heat-resistant DNA polymerase, and is usually treated at 72 ° C. for about 30 seconds to 10 minutes. Before starting the cycle, the DNA can be completely denatured by heating at 94 ° C. for about 1-5 minutes. Further, after the completion of all the cycles, a heat treatment can be performed at 72 ° C. for about 1 to 5 minutes. The thermostable DNA polymerase is commercially available, and for example, Thermus aquatics (Taq) polymerase (sold from TaKaRa, PerkinElmer, Pharmacia, etc.) can be used. As for the PCR method, for example, protein nucleic acid enzyme “From the Forefront of PCR Method to Basic Application,” Volume 41, Volume 5, Issue, April 1996, Kyoritsu Publishing, Tokyo, Japan can be referred to.

  An expression vector is any vector that can be used in prokaryotic or eukaryotic cells. The vector can contain regulatory sequences such as a promoter, an origin of replication, a ribosome binding site, a multiple cloning site, a terminator, and the like. As expression vectors, vectors such as plasmids and viruses, particularly commercially available vectors such as pGEX-4T-1 (Amersham Pharmacia Biotech), pBluescript II SK, pHS19, pHS15, pG-1 and pXT1 (Stratagene) ), PMAL and pTYB series (first chemical), pQE series (Qiagen), pET series (Novagen), pSVK3 and pSVL SV40 (Pharmacia), pcDNA1 and pcDM8 (Funakoshi), pHB6, pVB6, pHM6, pVM6 And pXM (Roche Diagnostics) can be appropriately selected and used.

  Host cells include Escherichia genus such as E. coli, Bacillus genus such as Bacillus subtilis, Pseudomonas genus, Corynebacterium genus bacteria, Saccharomyces genus, Pichia genus, Schizosaccharomyces genus yeast, insect cells, plant cells And mammalian cells such as CHO, COS, HEK293, and the like.

  Methods for introducing DNA encoding IRBIT into host cells include methods such as calcium phosphate method, lipofection method, electroporation method, adenovirus, retrovirus and other viral infections (Masamura Matsumura et al. Ed. "New Genetic Engineering Handbook" (2003) Yodosha, Tokyo, Japan).

  More specifically, for mouse IRBIT, the purification, cDNA cloning and expression of IRBIT from mature mouse cerebellum are described in JP-A No. 2004-129612, and the disclosure thereof can be referred to.

  The biological activity of IRBIT is similar to that of IRBIT because it has homology to S-adenosylhomocysteine hydrolase, which catalyzes the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine. Can be measured based on. This assay is described, for example, in C.I. -S. The method of Yuan et al. (J. Biol. Chem. 1996, 271: 28809-28016) can be applied. Briefly, the above hydrolysis reaction was performed using IRBIT (about 3 μg) and rabbit S-adenosylhomocysteine hydrolase (Sigma) (about 2.5 μg), and the product (homocysteine) was converted to 5, This includes measuring the color developed by reacting with 5′-dithiobis (2-nitrobenzoic acid) (Sigma) at 412 nm using a spectrophotometer to determine the absorbance.

Nucleic acid that controls the expression / translation of IRBIT In the present invention, the nucleic acid that controls the expression / translation of IRBIT includes DNA encoding IRBIT, antisense RNA of mRNA encoding IRBIT, or a fragment thereof, and mRNA encoding IRBIT. A ribozyme that enables cleavage, a functional RNA such as siRNA (small interfering RNA), or a vector DNA containing such DNA or RNA (actually, DNA encoding RNA) is included.

DNA encoding IRBIT is human, a DNA encoding the IRBIT from a mammal such as a mouse, can be prepared in the manner described in the "IP ₃ receptor binding protein (IRBIT)" above it can. A preferred IRBIT-encoding DNA is a DNA comprising a base sequence encoding the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3, and a more preferred DNA consists of the base sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4. DNA encoding human or mouse IRBIT.

  The DNA encoding IRBIT can be inserted into an expression vector (eg, a plasmid or viral vector) and used for expression of IRBIT in cells.

  In addition to the DNA sequence encoding IRBIT and the promoter, the plasmid vector for expressing the DNA encoding IRBIT is a drug resistance gene (for example, neomycin resistance gene, ampicillin resistance gene, puromycin resistance gene, hygromycin resistance gene, etc. ), Terminators, multiple cloning sites, replication origins, ribosome binding sites, and other regulatory sequences.

  Moreover, as a viral vector for expressing DNA encoding IRBIT, for example, an adenovirus vector, an adeno-associated virus vector, a lentivirus vector, a retrovirus vector (such as a leukemia virus vector), a herpes virus vector, or the like can be used. . The viral vector is preferably of a type lacking, for example, self-replication ability so as not to cause disease when used in humans. For example, in the case of an adenovirus vector, a self-replication ability-deficient adenovirus vector lacking the E1 gene and E3 gene (for example, pAdeno-X manufactured by Invitrogen) can be used. Viral vectors can be constructed by methods described in the literature (US Pat. No. 5,252,479, International Publication WO94 / 13788, etc.).

  As the promoter, a promoter capable of expressing foreign DNA in mammalian cells can be used. Examples of promoters include cytomegalovirus (CMV) promoter, SV40 promoter, EF promoter and the like.

  The plasmid vector can be introduced into a patient in a state of being encapsulated in a form of a complex with a positively charged liposome such as lipofectamine, lipofectin, cellfectin, or positively charged cholesterol (for example, Mamoru Nakanishi, protein nucleic acid enzyme, 44, 11, 48-54, 1999, Kyoritsu Shuppan, Tokyo, Japan; Clinical Cancer research 59: 4325-4333, 1999; Wu et al., J. Biol. Chem. 1987, 262: 4429). In addition, a viral vector can be introduced into a cell by introducing it into an affected area and infecting the cell (L. Zender et al., Proc. Natl. Acad. Sci. USA (2003), 100: 77797-7802; Xia et al., Nature Biotech. (2002), 20: 1006-1010; XF Qin et al., Proc. Natl. Acad. Sci. USA (2003), 100: 183-188; Natl.Acad., Sci.USA (2002), 99: 14943-14945; JD Hommel et al., Nature Med. (2003), 9: 1539-1544). In particular, it has been confirmed that adenovirus vectors or adeno-associated virus vectors can be introduced into various cell types with very high efficiency. Since this vector is not integrated into the genome, the effect is transient and the safety is considered to be higher than that of other viral vectors.

  Furthermore, the antisense RNA of mRNA encoding IRBIT or a fragment thereof can inhibit the translation of the IRBIT gene into the IRBIT protein.

  The fragment is a sequence consisting of about 30 bases or more, 50 bases or more, 70 bases or more, 100 bases or more, 150 bases or more, 20 bases or more, or 250 bases or more to the full length or less in the IRBIT gene or mRNA sequence. Can be included.

  The antisense RNA or fragment thereof can contain a modifying group such as halogen (fluorine, chlorine, bromine or iodine), methyl, carboxymethyl or thio group.

  The antisense nucleic acid can be synthesized using a well-known DNA / RNA synthesis technique or a DNA recombination technique. When synthesizing by DNA recombination technology, a target sequence is amplified by performing polymerase chain reaction (PCR) using a vector DNA containing the IRBIT base sequence as a template and a primer sandwiching the sequence to be amplified. Accordingly, it can be cloned into a vector to produce antisense DNA. Alternatively, the thus obtained DNA having an amplified target sequence can be inserted into a vector, the vector is introduced into a eukaryotic or prokaryotic cell, and an antisense RNA can be obtained using the transcription system.

  Similar inhibition is also possible with functional RNAs such as ribozymes, siRNAs that allow cleavage of mRNA encoding IRBIT.

  The siRNA is, for example, about 18 to 30, preferably about 19 to 25, more preferably about 20 to 20 consecutive from the mRNA sequence encoded by the nucleotide sequence of SEQ ID NO: 2 (human IRBIT) or SEQ ID NO: 4 (mouse IRBIT). It can comprise a 23 nucleotide sense strand sequence and its complementary sequence, an antisense strand sequence. Here, the sense strand sequence refers to the same base sequence as the target site of the mRNA, and the antisense strand sequence refers to a base sequence complementary to the sense strand sequence. The sense strand and the antisense strand can pair with each other to form a double-stranded siRNA. The siRNA can further comprise an overhang consisting of 1 to 5 bases, eg, UU, at each 3 'end of the sense and antisense strands.

In order to select the sense strand sequence of siRNA, for example, known knowledge for selection of target site of target IRBIT mRNA, for example, (a) GC content is about 30-70%, preferably about 50%. Criteria such as (b) all nucleotides are equal and G is not contiguous, (c) the 5 ′ terminal nucleotide of the antisense strand is A, U, etc. can be used (D. M. Dykxhoorn et al., Nature Rev. Mol. Cell Biol. (2003), 77: 7174-7181; A. Khvorova et al., Cell (2003), 115: 209-216). Moreover, the candidate gene site | part on IRBIT mRNA which is a target site of said siRNA can also be estimated using mfold which is a RNA secondary structure prediction program (JA Jaeger et al., Methods in Enzymology 1989, 183: 281). -306; DH Mathews et al., J. Mol. Biol. 1999, 288: 911-940). For example, the sequence that can be targeted by siRNA can be determined by estimating based on the above findings and actually confirming the effect. Non-limiting examples of siRNA that can be used in the present invention include the following sequences.
IRBIT siRNA-1: AAAUCCAGUUUGCUGAUGACA (SEQ ID NO: 5)
IRBIT siRNA-2: AACUCAGAAUGAAGUAGCUGC (SEQ ID NO: 6)

  siRNA can be synthesized using well-known chemical synthesis techniques. For example, chemically synthesized using a conventional DNA / RNA automatic synthesizer, or synthesized by a contract synthesis company related to siRNA (eg Funakoshi Co., Ltd. (Tokyo, Japan), Dharmacon, Ambion, etc.) It is available by entrusting.

  When introducing siRNA into a cell or tissue, it is preferable to inject siRNA directly into the cell or tissue, or to use a vector capable of expressing siRNA. Alternatively, siRNA or vectors can be complexed with liposomes, such as lipofectamine, lipofectin, cellfectin and other positively charged liposomes (eg, positively charged cholesterol), or microcapsules and used (eg, Nakanishi). Mamori et al., Protein Nucleic Acid Enzyme, Vol. 44, No. 11, pp. 48-54, 1999, Kyoritsu Shuppan, Tokyo, Japan; Clinical Cancer research 59: 4325-4333, 1999; Wu et al., J. Biol. 4429).

  A vector for expressing siRNA contains a DNA sequence encoding siRNA or a precursor thereof under the control of a promoter.

  One example of an expression vector is a hairpin vector. The vector includes DNA encoding a hairpin RNA in which the sense strand RNA sequence and the antisense strand RNA sequence are covalently bonded via a single-stranded loop sequence, wherein the DNA is intracellularly This is a vector which forms the hairpin RNA by transcription and is processed by Dicer to form the siRNA. A poly-T sequence consisting of 1 to 6, preferably 1 to 5, T is linked to the 3 ′ end of the hairpin DNA encoding siRNA as a transcription termination signal sequence or for overhang. Short hairpin RNA (shRNA) as a siRNA precursor transcribed from vector DNA preferably has an overhang consisting of 2 to 4 U at the 3 ′ end of its antisense strand, and due to the presence of the overhang, Sense strand RNA and antisense strand RNA can increase stability against degradation by nucleases. There is one endogenous dicer in humans, which has the role of converting long dsRNA and precursor microRNA (miRNA) into siRNA and mature miRNA, respectively. Examples of promoters are pol III promoters, such as U6 promoter or H1 promoter from human or mouse, pol II promoter, or cytomegalovirus promoter.

  Another example of an expression vector is a tandem vector. This vector includes a DNA sequence encoding a sense strand RNA sequence constituting the siRNA and a DNA sequence encoding an antisense strand RNA sequence, and a promoter at each 5 ′ end and each strand. A DNA in which a poly T sequence is linked to the 3 ′ end of each of the DNAs, wherein the sense strand RNA and the antisense strand RNA hybridize to form the siRNA after transcription in a cell. It is.

  An example of a promoter in a tandem type vector is a pol III promoter, for example, U6 promoter or H1 promoter derived from human or mouse, or cytomegalovirus promoter. The poly T sequence is a poly T sequence composed of 1 to 6, preferably 1 to 5 Ts. A tandem vector can be introduced into a cell, transcribed into RNA corresponding to a sense strand and an antisense strand, and hybridized with each other to generate a target siRNA.

  The hairpin type and tandem type vectors are plasmid vectors or viral vectors. Plasmid vectors may be prepared using the methods described in the examples below or the methods described in the literature, or commercially available vector systems such as piGENETMU6 and piGENETMH1 vectors (Takara Bio Inc., Kyoto, Japan). (TR Brummelkamp et al., Science (2002), 296: 550-553; NS Lee et al., Nature Biotech. (2002), 20: 500-505; M. Miyagishi et al.). , Nat.Biotechnol. (2002), 20: 497-500; PJ Paddison et al., Genes & Dev. (2002), 16: 948-958; T. Tusch, Nature Biotech (2002), 20: 446-44. 8; CP Paul et al., Nature Biotech. (2002), 20: 505-508; edited by Yoshikazu Tahira, RNAi experimental protocol, Yodosha (Tokyo, Japan), 2003).

  Another nucleic acid that is an active ingredient of the composition of the present invention is a ribozyme. Ribozyme is RNA having catalytic activity and has an activity of cleaving mRNA corresponding to the target IRBIT gene of the present invention. This cleavage inhibits or suppresses the expression of the gene.

  It is known that a ribozyme-cleavable target sequence is generally a sequence containing NUX (N = A, G, C, U; X = A, C, U), for example, a GUC triplet. Such ribozymes include hammerhead ribozymes. The hammerhead ribozyme has a nucleotide sequence that constitutes a sensor site, a nucleotide sequence that includes a region that can form a cavity that stably captures Mg2 + ions only when RNA is bound to the sensor site, and a sequence around the target RNA cleavage site. A nucleotide sequence comprising a region that is complementary to can be included.

  In order to deliver the ribozyme of the present invention into a cell or a patient, a ribozyme is encapsulated in a liposome (preferably a positively charged liposome) (Japanese Patent Laid-Open No. 9-216825 (1997)), and a virus such as an adeno-associated virus. A drug delivery system can be constructed by a method such as incorporation into a vector (Japanese Patent Publication No. 2002-542805).

  The ribozyme can be incorporated into a vector so that it can be expressed. Promoters for expressing ribozymes include pol II or pol III promoters. A preferred promoter is a pol III promoter, such as a tRNA promoter from a mammal, more preferably a tRNAVal promoter (S. Koseki et al., J. Virol., 73: 1868-1877, 1999).

Antibodies against the antibody IRBIT or fragments thereof can also be used for the control of the biological function.

Such antibodies include polyclonal antibodies, monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, chimeric antibodies, single chain antibodies, Fab fragments, F (ab ′) ₂ fragments, Fv, scFv, bispecific Antibodies, synthetic antibodies and the like are included.

  The antibody class and subclass may be of any type, and include, for example, IgG, IgM, IgE, IgD, IgA, IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2.

  An antibody may also be derivatized by pegylation, acetylation, glycosylation, amidation, and the like.

  Polyclonal antibodies are prepared in oil containing IRBIT as an immunogen (about 1 μg to 100 μg) and adjuvants such as Freund's complete or incomplete adjuvant, aluminum hydroxide (alum), muramyl dipeptide, and lipid A as necessary. The water emulsion is immunized intradermally or intravenously into non-human animals such as rabbits, guinea pigs, mice, rats, sheep, goats, etc., and after about 2 to 4 weeks, 1 to 2 IRBIT without adjuvant is added. Inject once and boost. After experimentally collecting blood and confirming that the antibody titer has sufficiently increased, blood is collected from the animal, and antiserum is collected by centrifugation. If necessary, IgG can be obtained by purification by ammonium sulfate fractionation, DEAE ion exchange chromatography or the like.

  Hybridomas that secrete monoclonal antibodies can be prepared according to the method of Keller and Milstein (Nature 1975, 256: 495-497). That is, a hybridoma is obtained by removing spleen or lymph node from an immunized animal, cell fusion of antibody-producing cells contained therein and myeloma cells derived from mammals such as mice, rats, guinea pigs, etc., and HAT selection. be able to. Cell fusion can be performed using, for example, polyethylene glycol (for example, molecular weight 1500 to 6000). Production of the antibody of interest can be determined by measuring the reactivity of the hybridoma culture supernatant to the immunizing antigen using conventional methods such as enzyme immunoassay, radioimmunoassay, and fluorescent antibody method.

  Alternatively, monoclonal antibodies can be produced from hybridomas by culturing the hybridomas in vitro and isolating them from the culture supernatant, or by culturing in vivo in ascites of mice, rats, guinea pigs, etc. It may be isolated.

  Alternatively, after cloning a gene encoding a monoclonal antibody from an antibody-producing cell such as a hybridoma, the gene can be incorporated into a vector and introduced into a mammalian cell (for example, CHO) to produce a recombinant antibody (P J. Delves et al., ANTIBODY PRODUCTION ESSENTIAL TECHNIQUES., 1997, John Wiley & Sons).

  As the human antibody, for example, a phage display library method (TC Thomas et al., Mol. Immunol. 33: 1389-1401, 1996) or a human antibody-producing animal (eg, mouse, cow, etc.) is used. It can be produced by the method (I. Ishida et al., Cloning Stem Cell 4: 91-102, 2002).

  For example, in a human antibody-producing mouse, a human chromosome fragment containing a human antibody-producing gene is introduced into a human artificial chromosome, and then the artificial chromosome is incorporated into, for example, the mouse embryonic stem cell genome by using the microcell method. Can be injected into blastocysts, transplanted into the uterus of foster mother mice, give birth to chimeric mice, and contain human antibody genes through crossbreeding of male and female chimeric mice or chimeric and wild-type mice, thus allowing human antibody production Can be produced by a method such as producing a homozygous offspring mouse (for example, RE 02/092812, International Publication WO 98/24893, WO 96/34096, etc.). The human antibody-producing transgenic mouse is immunized with the IRBIT protein of the present invention as an antigen, and then the spleen is removed, and the spleen cell and mouse myeloma cell are fused to form a hybridoma, and the target monoclonal antibody is selected. be able to.

In the phage display library method, DNA encoding an antibody of interest is screened from a library of immunoglobulin genes obtained directly from untreated human lymphocytes, and phage particles are placed between this DNA and the antibody chain. Is used to establish a physical association, thereby enriching the phage displaying antibodies with affinity for the target by affinity screening. By using this method, an antibody having a binding affinity for a target can be synthesized in a large amount by an ordinary technique (for example, JP-T-2003-527832).
The compositions of the invention can be used for the treatment of a disease or disorder.

Therapeutic Composition In the present invention, the disease or disorder is caused by protein synthesis, inositol phospholipid metabolism, and abnormal intracellular pH.

In the case of protein synthesis, control of protein synthesis accompanying the binding of IRBIT to CPSF can be mentioned. In this case, IRBIT suppresses protein synthesis, and a substance that suppresses the action of IRBIT (the above nucleic acid or antibody) can enhance protein synthesis. An example of protein synthesis abnormality involving CPSF is a tumor.

  In the case of inositol phospholipid metabolism, diseases associated with abnormal activation of PIPKII, for example, type 2 diabetes can be mentioned. Since IRBIT has an action of suppressing PIPKII activity, it can be used for the treatment of type 2 diabetes.

  In the case of intracellular pH, pNBC1 plays an important role in maintaining the intracellular pH, but it is particularly useful for diseases caused by the inclination of the pH to acid, eye diseases such as glaucoma and cataract, short stature, mental retardation, etc. And diseases such as pancreatitis. IRBIT binds to pNBC1 and allows the intracellular pH to be adjusted to a normal state.

  The content of the active ingredient in the composition of the present invention is not limited, but is about 1 μg to 100 mg. Its content can vary depending on the type of active ingredient.

  The dose of IRBIT in the composition of the present invention is about 1 μg to 1 mg, preferably about 50 μg to 500 μg per dosage unit, but is not limited to this range.

  The dose of the nucleic acid in the composition of the present invention is not limited to the following in terms of siRNA, antisense nucleic acid, or ribozyme, but is about 1 nM to 100 μM, preferably about 10 nM to 50 μM per dosage unit. .

  The dose of the antibody or fragment thereof in the composition of the present invention is not limited to the following, but is about 1-100 mg / ml, preferably about 5-70 mg / ml per dosage unit.

  However, the dose or dose described above can vary depending on the patient's condition, age, sex, severity, etc., and the dose or dose should be determined by the judgment of a specialist.

The compositions of the present invention are typically pharmaceutically acceptable carriers (ie, excipients or diluents) such as sterile water, saline, buffers, non-aqueous liquids (eg, almond oil, vegetable oil, Ethanol) and the like. The composition further includes pharmaceutically acceptable stabilizers (eg amino acids such as methionine), preservatives (methyl p-hydroxybenzoate, sorbic acid), isotonic agents (eg sodium chloride), emulsifiers (eg Lecithin, gum arabic), a suspending agent (for example, a cellulose derivative), and the like.
Preferred pharmaceutical preparations are solutions, suspensions, emulsions and the like.

  The administration method of the composition of the present invention includes oral administration and parenteral administration, for example, intravenous administration, topical administration and the like. Local administration includes methods such as direct injection into the affected area under surgery or endoscopy. In addition, the present invention is applied to a patient at a certain time interval, for example, one week, two weeks, three weeks, one month, two months, six months, one year, etc., based on a treatment plan determined by a specialist. The composition can be administered in 1 to several divided doses.

  The antibody or fragment thereof can be delivered to the patient either alone or, for example, in a form in which the antibody or fragment thereof is encapsulated in liposomes (preferably positively charged liposomes), microcapsules or nanoparticles. In combination with excipients or diluents), oral and parenteral routes (for example, intravenous administration or topical administration) can be used.

  The composition of the present invention can be used in vitro, in vivo, or ex vivo.

  In vitro, the composition of the present invention can be used for screening for therapeutic substances (see below).

  In ex vivo, cells and tissues once removed from a patient from a living body can be treated with the active ingredient of the present invention and then returned to the body. This makes it possible to restore cells and tissues in which protein synthesis, inositol phospholipid metabolism, or intracellular pH abnormality has occurred to normal.

2. Examples of use of IRBIT The present invention also provides the following methods of using IRBIT in vitro or ex vivo.

First, the present invention provides a method of using IRBIT in controlling intracellular protein synthesis in vitro or ex vivo.
This method is based on the effect that IRBIT binds to CPSF to control the function of CPSF.

Second, the present invention provides a method of using IRBIT in controlling intracellular inositol phospholipid metabolism in vitro or ex vivo.
This method is based on the effect that IRBIT suppresses PIPKII activity.

Third, the present invention provides a method for using IRBIT in controlling intracellular pH in vitro or ex vivo.
This method is based on the fact that IRBIT has the effect of activating pNBC1. In addition, activation of pNBC1 requires phosphorylation of IRBIT.

  As described above, IRBIT can be used in vitro to screen for substances that allow control of intracellular protein synthesis, inositol phospholipid metabolism or intracellular pH, and ex vivo, protein synthesis, It can be used to return cells or tissues in which inositol phospholipid metabolism or intracellular pH abnormality has occurred to a normal state.

3. Screening The present invention further provides a method for screening a substance comprising measuring the binding between IRBIT and CPSF, PIPKII, or pNBC1 in the presence of a candidate substance, and identifying a substance that suppresses or enhances the binding.

  The above binding can be performed by measuring the binding between IRBIT and CPSF, PIPKII, or pNBC1 in the presence of a candidate substance in a test tube or in a cell (particularly a mammalian cell). Mammalian cells include, for example, CHO, COS, HEK293, HeLa, NIH3T3, and the like.

  The identified substance can be used for therapeutic or diagnostic purposes, for example. In particular, the substance controls at least one intracellular biological function selected from the group consisting of intracellular protein synthesis, inositol phospholipid metabolism, and intracellular pH.

  When the above binding is performed in a test tube, for example, IRBIT and CPSF, PIPKII or pNBC1 are present in a suitable buffer, a candidate substance is added thereto, and the level of binding between IRBIT and CPSF, PIPKII or pNBC1 is determined. , SDS-PAGE and immunoblotting. This system is effective in detecting a substance that suppresses or inhibits the binding. Preparation of a recombinant protein of IRBIT, CPSF, PIPKII or pNBC1 can be performed by the same method as described in the above IRBIT section.

  When the above binding is carried out intracellularly, DNAs encoding the respective proteins are incorporated into the same or different vectors so that IRBIT and CPSF, PIPKII or pNBC1 can be expressed simultaneously or separately, Cells are transformed or transfected. Preferably, the vector DNA does not contain a secretory signal sequence so that the translated protein is present in the cell, particularly in the cytoplasm.

  The amino acid and base sequence of CPSF, PIPKII, or pNBC1 can be obtained from GenBank and literatures, and are assigned, for example, (AB092504), (AF030558, AF033355), and (NM_003759, NM_018760), respectively. The amino acid and base sequence of IRBIT is as described above.

  The expression vector is preferably any vector that can be used in mammalian cells. The vector can contain regulatory sequences such as a promoter, enhancer, origin of replication, ribosome binding site, multiple cloning site, terminator, poly A signal and the like. As an expression vector, commercially available vectors such as pSG5, pXT1 (Stratagene), pSVK3, pBPV, pMSG and pSVL SV40 (Pharmacia), pHM6, pVM6 and pXM (Roche Diagnostics) are appropriately selected and used. can do.

  Examples of the promoter include CMV promoter, SV40 promoter, EF promoter and the like.

  Methods for introducing DNA encoding IRBIT, CPSF, PIPKII or pNBC1 into host cells include calcium phosphate methods, lipofection methods, electroporation methods, methods using viral infections such as adenoviruses and retroviruses (experimental medicine). 4th edition, Masaaki Matsumura et al., “New Genetic Engineering Handbook” (2003) Yodosha, Tokyo, Japan).

  Alternatively, a transgenic non-human animal (for example, a mouse) in which the IRBIT gene is exogenously integrated into the genome using a non-human animal oocyte or embryonic stem cell according to a known technique to enable forced expression, and A transgenic non-human animal (for example, a mouse) in which CPSF, PIPKII or pNBC1 gene is exogenously integrated into the genome and allowed to be expressed compulsorily is produced, and both animals are crossed to form IRBIT gene and CPSF, PIPKII or Chimeric non-human animals and their progeny capable of expressing the pNBC1 gene can be produced.

  How the binding of IRBIT, which is forcibly expressed in cells or transgenic non-human animals, to CPSF, PIPKII or pNBC1 is affected in the presence of candidate substances incorporated into cells or animals Is determined by measuring the binding by a pull-down method, immunoprecipitation method or the like. At the same time, the effect on the intracellular synthesis of a specific protein, the effect on inositol phospholipid metabolism, and the effect on the intracellular pH are examined.

  The influence on the intracellular synthesis of a protein can be measured by, for example, Western blotting using an antibody against a specific protein.

Effects on phosphatidylinositol metabolism may, for example, ^[3 H] label or be measured, such as by PIP ₂ weight quantification using PIP ₂ binding protein.

  The effect on intracellular pH can be measured, for example, by measuring intracellular pH using a fluorescent pH indicator.

  Candidate substances include, but are not limited to, small organic molecules, peptides, polypeptides, proteins, nucleosides, oligonucleotides, polynucleotides, nucleic acids (DNA or RNA), and the like.

As explained above, IRBIT has all very important significance in regulating intracellular metabolism, pH change, ion balance, regulation of phospholipid metabolism, control of protein synthesis, control of Ca ²⁺ release, etc. Have cells. It has now been found that the various biological functions described above can be controlled by controlling the concentration and expression pattern of IRBIT. Substances identified by the screening methods of the present invention are useful for such control.

  The present invention will be described more specifically with reference to the following examples. However, the scope of the present invention is not limited by these examples.

<Example 1>
Participation of IRBIT in cytoplasmic poly (A) addition reaction CPSF is a complex protein group consisting of four subunits of CPSF160, CPSF100, CPSF73 and CPSF30. In order to elucidate whether or not it binds to COS cells, etc., in which various subunits of myc-tagged cDNA are expressed in various combinations with IRBIT, and IRBIT or CPSF is coprecipitated I investigated.

  CPSF is a mouse-derived CPSF and was cloned by RT-PCR based on the full length of GenBank accession number AB092504 and the base sequence of each of the four subunits (H. Ando et al., 2003, supra). IRBIT is a mouse-derived IRBIT, which was cloned by RT-PCR based on the base sequence of GenBank accession number NM — 145542 (H. Ando et al., 2003, supra).

  A DNA was prepared by fusing the DNA encoding the full length of CPSF or each subunit to the DNA encoding the myc tag, and inserted into a mammalian vector. On the other hand, the cDNA encoding IRBIT was also inserted into the same vector. The prepared vector was transformed into COS cells to co-express the DNA.

  The cells were separated by centrifugation, the cells were lysed, the cytoplasmic fraction was collected, and the binding between IRBIT and CPSF was detected using an anti-IRBIT antibody (Japanese Patent Laid-Open No. 2004-129612) and an anti-myc antibody.

  As a result, it was found that IRBIT binds to CPSF via the CPSF160 subunit (FIG. 1).

  Furthermore, a similar experiment using a deletion mutant of CPSF160 revealed that IRBIT binds to the mRNA binding site of CPSF160 (FIG. 2).

  Since the mRNA binding site of CPSF160 is an essential region when CPSF recognizes mRNA that adds poly (A), binding of IRBIT to this region may cause IRBIT to inhibit CPSF function. In order to confirm this, the in vitro reconstitution system using the purified protein was used to examine the binding between IRBIT and CPSF and the effect on the polyadenylation reaction.

  CPSF is an essential molecule for the polyadenylation reaction of mRNA, but the place where it works is mainly in the nucleus, and for RNA just transcribed from DNA, it becomes mRNA and goes out of the nucleus. It works as one of the maturity reactions before leaving. However, exceptionally, in the maturation process of oocytes, or in the aspect of new protein synthesis locally in nerve cells, it is involved in polyadenylation of mRNA in the cytoplasm and regulates the length of poly (A) To regulate protein synthesis of the molecule of interest (Daron C. Barnard et al., Cell 2004, 119: 641-651). This cytoplasmic polyadenylation reaction is an exceptional phenomenon, but it is an indispensable phenomenon for establishing oocyte maturation and neuroplasticity. When investigating the intracellular distribution of IRBIT, it hardly exists in the nucleus. Therefore, the present inventors focused on the involvement of IRBIT in the cytoplasmic polyadenylation reaction.

  Since the Xenopus oocyte system is superior in examining the cytoplasmic polyadenylation reaction, the present inventors first performed cloning and isolation of IRBIT cDNA from the Xenopus oocyte according to a conventional method. It was. In Xenopus oocytes, unlike mammalian cells, three types of IRBIT mRNA were expressed, and these three types were found to bind to CPSF160.

The 3 ′ end of the IP ₃ receptor mRNA has a sequence that may undergo an intracytoplasmic polyadenylation reaction. In fact, this mRNA is present in dendrites in the cerebellar Purkinje cells. This is, IRBIT released from IP ₃ receptor via binding to CPSF, shows the possibility of controlling the protein synthesis of the IP ₃ receptor itself.

Furthermore, we have IRBIT suppresses polyadenylation activity (I. Kaufmann et al., EMBO J. (2004) 23: 616-626) in the presence of PAP and Fip1 (subunit of CPSF). I found that there was work.

  From the above results, it was shown that IRBIT regulates protein synthesis through binding with CPSF in cells.

<Example 2>
Interaction between IRBIT and PIP Kinase Type II (PIPKII) We further searched for molecules that interact with IRBIT.
In the same procedure as in Example 1, FLAG-IRBIT was overexpressed in HEK293 cells, and the protein that was immunoprecipitated with anti-FLAG antibody and coprecipitated with IRBIT was analyzed with a mass spectrometer. As a result, phospholipid phosphorylase phosphatidylinositol-5-phosphate 4-kinaseγ (PIPKIIγ) was identified. PIPKII Family (PIPKIIα, PIPKIIβ, PIPKIIγ) is an enzyme that synthesizes a PIP _2, considering that IP ₃ is produced by the hydrolysis of PIP2, IP ₃ receptor, IRBIT, information transmission mechanism consisting PIPKIIganma present There is a possibility of this (FIG. 3).

Furthermore, the following experiment was performed, and the results are also shown below.
(1) Mouse IRBIT and Myc-PIPKIIα, β, γ were overexpressed in COS-7 and immunoprecipitation was performed. Specifically, the cells were solubilized with Lysis buffer (10 mM Hepes, 100 mM NaCl, 2 mM EDTA, 1% P-40, pH 7.4), and centrifuged (20000 × g, 30 minutes) to recover the supernatant. Anti-Myc antibody or anti-IRBIT antibody was added and allowed to react for 1 hour. Further, protein G sepharose was added and reacted for 1 hour, and then the immune complex was washed with Lysis buffer and eluted with SDS-PAGE sample buffer. Thereafter, Western blotting was performed using an anti-Myc antibody or an anti-IRBIT antibody. As a result, IRBIT co-precipitated with all of Myc-PIPKIIα, β, and γ (FIG. 4).

  (2) When immunoprecipitation was performed from mouse cerebellum with anti-IRBIT antibody, PIPKIIα was co-precipitated (FIG. 5). The result confirmed the binding of IRBIT and PIPKII in vivo.

  (3) Mouse IRBIT and Myc-PIPKIIγ were overexpressed in COS-7 and immunostained. Specifically, after fixation with 4% paraformaldehyde, membrane permeation treatment with 0.1% Triton X-100, blocking treatment with 2% goat serum, mouse anti-Myc antibody and rabbit anti-IRBIT antibody were added. And allowed to react at room temperature for 1 hour. Alexa488-conjugated anti-mouse IgG antibody and Alexa594-conjugated anti-rabbit IgG antibody were added as secondary antibodies and allowed to react at 37 ° C. for 45 minutes. As a result, it was found that both IRBIT and Myc-PIPKIIγ were localized in the cytoplasm (FIG. 6).

  (4) Deletion mutants of mouse IRBIT (60-530, 78-530, 105-530, 1-277, 1-104, 1-90 and 1-77 in the amino acid sequence of SEQ ID NO: 3) correspond to the sequences Was amplified by PCR, cloned into the GFP fusion protein expression vector pEGFP-C1 (Clontech), and the binding of each of these mutants to PIPKIIα was examined to be rich in serine in the N-terminal region of IRBIT. It became clear that the region is important for the binding (FIG. 7).

  (5) Mouse IRBIT serine-rich region point mutant (T52A, T58A, S62A, S64A, S66A, S68A, S70A, S71A, T72A, S74A, S76G, S77A, S80A, D83A in the amino acid sequence of SEQ ID NO: 3) , S90A and T97A) were generated using a site-specific mutant preparation kit (Stratagene) and the binding of each of these mutants to PIPKIIα was examined. As a result, IRBIT Ser68 and Ser71 were important for the binding (FIG. 8).

  From the above results, it was confirmed that IRBIT binds to the PIPKII family. Furthermore, from the preliminary data, it was concluded that IRBIT regulates the activity of inositol phospholipid metabolism because it has found that IRBIT suppresses PIPKII activity.

<Example 3>
Activation of NBC1 (Na / HCO ₃ transporter 1) by IRBIT The present inventors further provide NBC1 (sodium bicarbonate co-transporter 1) protein that transports sodium ions and bicarbonate ions on the cell membrane as a protein that binds to IRBIT. Was identified.

  NBC1 is known to have two splicing variants, p-type and k-type (Seth L. Alper, Annu. Rev. Physiol. 2002, 64: 899-923), of which IRBIT It became clear that binding to p-type NBC1 (referred to as pNBC1) and phosphorylation of several serine residues in IRBIT were required for binding to pNBC1. Specific experiments and results are shown below.

(1) Identification of IRBIT binding region in pNBC1 The p-type specific N-terminal sequence (1-85 amino acids) of pNBC1 was essential for binding to IRBIT. Further deletion mutants were prepared within the 85 amino acids, and the binding between these mutants and IRBIT was examined using a pull down assay. Specifically, the following experiment was conducted.

  HA-IRBIT was overexpressed in COS-7 cells to prepare a cell extract. MBP-pNBC1 deletion mutant recombinant protein was added, and after the reaction, the bound protein was pulled down with an amylose resin. HA-IRBIT was detected by Western blotting using an anti-HA antibody.

  As a result, it was shown that the N-terminal 62 amino acids in the p-type specific sequence can bind to IRBIT (FIGS. 9 and 10). However, when the N-terminal side or C-terminal side was further cut from these 62 amino acids, binding to IRBIT was not observed, and it was considered difficult to narrow the IRBIT binding region further. From these results, it was suggested that the binding to IRBIT does not involve the sequence of a specific number of amino acids of pNBC1, but may require a three-dimensional structure consisting of several tens of amino acids.

(2) Identification of pNBC1 binding region in IRBIT Next, various deletion mutants of mouse IRBIT (full length 530 amino acids; SEQ ID NO: 3) are expressed in COS7 cells, and the pNBC1 binding ability of each mutant is examined by pull-down assay. It was. Specifically, the following experiment was conducted.

  A GFP-IRBIT deletion mutant was overexpressed in COS-7 cells to prepare a cell extract. A recombinant protein of MBP-pNBC1 (1-85) was added, and after the reaction, the bound protein was pulled down with an amylose resin. A deletion mutant of GFP-IRBIT was detected by Western blotting using an anti-GFP antibody.

The result is shown in FIG. FIG from the deletion mutant (1-104,1-277) even pNBC1 expressing N-terminal side of IRBIT binding have been identified with the IP ₃ receptor was found to not bind. The deletion mutant expressing C-terminal of IRBIT which can not bind to IP ₃ receptors have already been confirmed (105-530) also includes a pNBC1 failed to bind. Since all serine phosphorylation sites that have been shown to be necessary for binding to pNBC1 are included in 1-104, pNBC1 has some conformation in spite of the presence of a short pNBC1 binding sequence in 1-104. There was also a possibility that the binding to was inhibited. Thus, a deletion mutant in which 1-104 was further deleted was prepared and analyzed for the binding to pNBC1, but no binding to pNBC1 was observed.

From the above results, it is clear that the entire structure including the N-terminal side and the C-terminal side of IRBIT is necessary for the binding to pNBC1, and IRBIT and IP ₃ are considered to be sufficient only for the N-terminal side of IRBIT. The difference with the binding mode with the receptor became clear.

(3) Binding between endogenous IRBIT and NBC1 Next, an experiment was conducted to confirm the binding between endogenous IRBIT and NBC1 using immunoprecipitation.

Since NBC1 was originally identified as an IRBIT-binding protein in the cerebellar membrane fraction, immunoprecipitation was first performed using the cerebellar membrane fraction extract. In addition, since IRBIT is known to bind to the IP ₃ receptor in the cerebellar membrane fraction, it was examined whether or not a ternary complex composed of NBC1, IRBIT, and IP ₃ receptor could be formed. Specifically, the following experiment was conducted.

After solubilizing the cerebellum membrane fraction with a surfactant, anti-IRBIT antibody, anti-NBC antibody, or control antibody was added and reacted. Furthermore, protein G sepharose was added to extract the immune complex. Thereafter, Western blotting was performed using anti-IRBIT antibody, anti-NBC antibody or anti-IP ₃ R antibody.

As a result, it was found that endogenous IRBIT was contained in the anti-NBC1 antibody immunoprecipitate and endogenous NBC1 was contained in the anti-IRBIT antibody immunoprecipitate, and that endogenous IRBIT and NBC1 were contained in the cerebellar membrane fraction. To form a complex (FIG. 12). On the other hand, already Ando et al (2003, supra) as reported by, but during an anti IRBIT immunoprecipitates was detected IP ₃ receptor, during anti NBC1 precipitate IP ₃ receptors detected could not. This result, many endogenous NBC1 it was shown that does not form a ternary complex comprising IRBIT and IP ₃ receptor.

  Furthermore, in order to confirm that the binding between IRBIT and NBC1 is universal, the binding between endogenous IRBIT and NBC1 was examined by using the same immunoprecipitation method as described above using the extract of COS7 cells. . Specifically, the following experiment was conducted.

  Anti-IRBIT antibody, anti-NBC antibody, or control antibody was added to the cell extract of COS-7 cells for reaction. Furthermore, protein G sepharose was added to extract the immune complex. Thereafter, Western blotting was performed using an anti-IRBIT antibody or an anti-NBC antibody.

The result is shown in FIG. From the figure, it was found that when COS7 cells were extracted with the same buffer used when preparing the extract of the cerebellar membrane fraction, the binding between endogenous IRBIT and NBC1 was not detected. However, when 2 mM CaCl ₂ was added to this buffer and the same experiment was conducted, binding between endogenous IRBIT and NBC1 was detected. Since this buffer already contains 2 mM EDTA, the calcium ion concentration when ₂ mM CaCl ₂ is added is considered to be several μM. These results suggested that the binding between endogenous NBC1 and IRBIT may be regulated in a different manner in the cerebellar membrane fraction and COS7 cells.

(4) Activation of NBC1 by IRBIT A mouse IRBIT cRNA and a human pNBC1 or kNBC1 cRNA were co-injected into cultured cells of Xenopus Ocyte to bring the membrane potential to -25 mV, and an ND96 solution (96 mM NaCl) , 2 mM KCl, 1 mM MgCl ₂ , 5 mM HEPES, pH 7.4) to ND96 + HCO ₃ ⁻ solution was measured. IRBIT, pNBC1, and kNBC1 were used as controls.

As a result, only pNBC1 activity was enhanced about 6-7 times by IRBIT co-injection (FIG. 14A). Similarly, when the membrane potential was changed in the range of −160 mV to +60 mV in the ND96 + HCO ₃ ⁻ solution, only pNBC1 activity was significantly enhanced by simultaneous injection of IRBIT (FIG. 14B).

Furthermore, an IRBIT mutant (S68A, S71A, S74A or S77A) in which the phosphorylation site of IRBIT is substituted with alanine (A) is prepared, and the cRNA of IRBIT mutant and human are introduced into Xenopus oocytes in the same manner as described above. pNBC1 cRNA was co-injected, the membrane potential was set to −25 mV, and the change in current when the ND96 solution was changed to the ND96 + HCO ₃ ⁻ solution was measured.

  As a result, in all IRBIT mutants in which the phosphorylation site was substituted with alanine, the enhancing action of IRBIT on pNBC1 activity disappeared (FIG. 15). This indicates that phosphorylation of IRBIT is necessary for the activation of pNBC1.

According to the present invention, IRBIT has a very important significance in all cells in regulating intracellular metabolism, pH change, ion balance, regulation of phospholipid metabolism, control of protein synthesis, control of Ca ²⁺ release, etc. It turned out to have. Various biological functions can be controlled by controlling the concentration and expression pattern of IRBIT. For example, IRBIT is strongly expressed in choroid plexus, nerve cells, and glial cells in the cerebral nervous system, and contributes to functional control of the cerebral nervous system. In addition, IRBIT activates the action of pNBC1, which is important for maintaining intracellular pH, and particularly diseases caused by acidic pH, for example, eye diseases such as glaucoma and cataract, short stature, mental retardation, pancreatitis It is useful for the treatment of diseases such as Furthermore, IRBIT can be used to treat type 2 diabetes because it has a function of suppressing or inhibiting the activity of PIPKII. Thus, by identifying three proteins targeted by IRBIT according to the present invention, IRBIT and its inhibitors and enhancers are useful for controlling biological functions performed by the target protein in vivo. .

FIG. 1 is a Western blot showing the binding of IRBIT and CPSF160. In FIG. B. Represents Western blotting. P. Represents immunoprecipitation, HA represents hemagglutinin as a tag, and load represents cell extract. FIG. 2 is a schematic diagram showing that IRBIT binds to the mRNA binding site of CPSF160 subunit of CPSF. FIG. 3 is a schematic diagram showing inositol phospholipid metabolism involving the IP ₃ receptor, IRBIT, PIPKII, and IP ₃ . In the figure, PLC represents phospholipase C. FIG. 4 shows the binding of mouse IRBIT to Myc-PIPKIIα, β, γ. (A) shows immunoprecipitation with anti-Myc antibody. (B) shows immunoprecipitation with anti-IRBIT antibody. In the figure, input represents a cell extract, IP represents immunoprecipitation, and control IgG (negative control) represents a sample subjected to immunoprecipitation using this. FIG. 5 shows that mouse cerebellum PIPKIIα co-precipitated with anti-mouse IRBIT antibody by immunoprecipitation. The input is the same as in FIG. FIG. 6 shows that both IRBIT and Myc-PIPKIIγ are localized in the cytoplasm. Merge shows the overlapping of the stained image of PIPKII and the stained image of IRBIT, and the overlapping portion is yellow. FIG. 7 shows the identification of IRBIT binding sites that bind to PIPKII using IRBIT deletion mutants. (A) shows a schematic diagram of a deletion mutant of IRBIT. (B) shows the binding between the deletion mutant from the N-terminal side of IRBIT and Myc-PIPKIIα. (C) shows the binding between the deletion mutant from the C-terminal side of IRBIT and Myc-PIPKIIα. FIG. 8 shows that IRBIT Ser68 and Ser71 bind to PIPKII. In the figure, input represents a cell extract, IP represents immunoprecipitation, and IB represents Western blotting. FIG. 9A is a Western blot diagram (upper diagram) showing the binding of IRBIT and NBC1. IRBIT (black triangles) binds only to recombinant proteins 2 and 5 containing a portion specific to pNBC1 (pancreatic type). Each recombinant protein (1, 2, 3, 4, 5, 6 or 7) is indicated by a black circle in the SDS polyacrylamide gel electrophoresis diagram (bottom of FIG. 9A), and in FIG. 9B, pNBC1 and kNBC1 Along with the structure of (kidney type), these structures are shown schematically. In the figure, MBP represents the maltose binding protein tag used for purification. CBB represents Coomassie Brilliant Blue. FIG. 10 shows the binding ability of NBC1 deletion mutants to IRBIT. FIG. 10A shows a pull-down assay of binding (or interaction) with HA-IRBIT (where HA represents hemagglutinin) that was expressed and purified in Escherichia coli and each of the deletion mutants of pNBC1 was expressed in COS7 cells. The result examined by pull down assay) is shown. The upper diagram in FIG. 10B shows the result of SDS-PAGE of the pulled-down sample and staining with CBB. The lower diagram of FIG. 10B shows the result of Western blotting of the pulled-down sample with an anti-HA antibody. The black triangle indicates the migration position of HA-IRBIT, and the black dot indicates the migration position of each deletion mutant protein. FIG. 11 shows the binding ability of IRBIT deletion mutants to pNBC1. Various deletion mutants of IRBIT were forcibly expressed in COS7 cells as fusion proteins with GFP (green fluorescent protein), and binding to pNBC1 was examined by pull-down assay. Both FIG. 11A and FIG. 11B show the results of SDS-PAGE of a cell extract (lysate) or pull-down sample (pull-down) expressing each deletion mutant and Western blotting with an anti-GFP antibody. The black triangle indicates the migration position of each deletion mutant. It can be seen that all IRBITs other than the full length (FL) are no longer bound to pNBC1. FIG. 12 shows the binding of endogenous IRBIT and NBC1 in the cerebellar membrane fraction. From the extract of the cerebellar membrane fraction, immunoprecipitation (IP) was performed with a pre-immune antibody (control), anti-NBC1 antibody, and anti-IRBIT antibody as controls, and the precipitate was subjected to SDS-PAGE to obtain anti-IRBIT antibody, anti NBC1 antibody, Western blotting with anti-IP ₃ receptor antibody (IB) was conducted. The black triangle indicates the migration position of each protein. FIG. 13 shows the binding of endogenous IRBIT and NBC1 in COS7 cell extract. From the COS7 cell extract, immunoprecipitation (IP) is performed with a pre-immune antibody (control), anti-IRBIT antibody, and anti-NBC1 antibody as controls, and the precipitate is subjected to SDS-PAGE to obtain anti-NBC1 antibody or anti-IRBIT antibody. Western blotting (IB) was performed. The black triangle indicates the migration position of each protein. Left three rows in CaCl ₂ absence right three rows are used sediment was respectively immunoprecipitated with CaCl ₂ presence. FIG. 14 shows the activation of pNBC1 by IRBIT, measured by the voltage clamp method. FIG. 14A shows the current value (μA) when the membrane potential is fixed at −25 mV. FIG. 14B shows the change in current when the membrane potential is changed between −160 mV to +60 mV as an IV curve. FIG. 15 shows that IRBIT phosphorylation is required for activation of pNBC1.

Claims (5)

IP ₃ receptor binding protein (IRBIT), or IRBIT containing a vector, which can contain expressing DNA encoding a composition for inhibiting protein synthesis in mammalian cells, the protein synthesis, A composition that involves cytoplasmic mRNA polyadenylation by a cleavage / polyadenylation specificity factor (CPSF). The composition according to claim 1 , wherein the IRBIT is derived from a human or a mouse. The IRBIT is a protein comprising the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3, or a protein comprising an amino acid sequence having 90% or more identity with the amino acid sequence and having a biological activity equivalent to IRBIT The composition according to claim 1 or 2 , wherein The composition according to any one of claims 1 to 3 , wherein the composition is used in vitro. The composition according to any one of claims 1 to 4 , wherein the IRBIT binds to CPSF and inhibits the function of CPSF, thereby suppressing the protein synthesis.

Images