JP5119437B2 - Method for producing functional non-natural protein, and method for site-specific modification / immobilization of the protein - Google Patents

Description

  The present invention relates to a method for industrially producing a functional non-natural protein composed of less than 20 amino acids, which enables site-specific modification and immobilization, or has new antioxidant ability. In particular, an in vitro virus evolution molecular engineering method including an alanine tRNA mutant or a serine tRNA mutant, and an industrial production method of a functional non-natural protein in which alanine or serine is site-specifically incorporated instead of a specific amino acid About.

  The activity of natural proteins has been improved by repeating the evolution cycle of selection, mutation, and amplification of the gene. Furthermore, in vivo, many of the proteins are modified to obtain functional group variations, resulting in an abundance of functional variations. Even in the industrialization, with the birth of evolutionary molecular engineering of proteins, proteins that form the basis of life reactions or gene DNAs that encode them are artificially created in laboratories. This technology makes it possible to produce enzymes and proteins with new activities that do not exist in nature, and proteins that have a structure that is significantly different from that of natural proteins, and is expected to have various applications in the medical and engineering fields. Has been. In evolutionary molecular engineering, an operation of selecting a molecule having a desired activity from a random polymer pool of block units of amino acids or nucleotides constituting a protein or a gene encoding the protein is performed.

  However, in order to bring about a further leap forward, an increase in protein functional group variation, protein immobilization for bioprocesses, and progress in protein stabilization technology are desired. For this purpose, protein modification technology is the key. For example, protein preparations and interferons, which are therapeutic agents for hepatitis, are modified with polyethylene glycol (PEG), so that even if the modification is non-specific, the stability in the human body is increased and the elimination half-life in the blood is increased. Could be extended. The modification technology is also closely related to protein immobilization technology, which is important in establishing bioprocesses and enhancing the functionality of cell culture dishes. This is because the difference between the two technologies is only that the substance added to the protein by modification is a molecule up to a certain size or a support.

  In recent years, site-specific modification methods for proteins include, for example, mutants in which all lysine residues have been replaced from proteins or all cysteine residues other than one cysteine residue so that the modified site is limited to one site. A method for designing a mutant in which a group is substituted is known (for example, see Non-Patent Document 1). However, there has been a problem in that protein activity decreases due to a large-scale amino acid substitution that deletes most of specific types of amino acids. Moreover, much more labor was required to search for mutants that compensate for the decreased activity.

  As a development system of the method, a method of selecting a protein having no lysine residue while maintaining activity using phage display from an initial population in which all six lysine codons are randomized has been reported. However, only a few clones were excluded from all lysines, and the efficiency of obtaining active clones from which lysines were excluded would be further reduced when targeting more general proteins. Furthermore, lysine codons should have appeared at sites that did not encode lysine in the original protein due to mutations in the process of creating the library. Indeed, the activity of the clones obtained in this report remains moderate.

  On the other hand, using a protein synthesis system to which an aaRS (aminoacyl tRNA synthetase) mutant is added, a method for introducing amino acids other than 20 (non-natural amino acids) during protein synthesis (for example, Patent Documents 1 and 2 and Patent Document 2) is known. In the former, after a highly reactive unnatural amino acid having a ketone group or the like is introduced to produce a protein, a modification reaction is performed on this functional group (see Non-Patent Document 2). In the latter case, an unnatural amino acid having a desired modification can be directly introduced into a protein on a ribosome (see Patent Documents 1 and 2). These methods have the merit that they can be site-specifically modified without causing a decrease in activity without applying an evolutionary molecular engineering technique.

However, it is rare that the desired properties can be obtained only by site-specific mutagenesis by the rational design of protein mutants, and the activity of many proteins is reduced. is required. Further, these methods require the use of a more specific protein synthesis system during mass production. Furthermore, the accuracy of these protein synthesis systems is low, and it is a big problem that proteins obtained as industrial products are not uniform. In particular, for the latter method, it is necessary to create a dedicated aaRS mutant for each type of unnatural amino acid. The production of such a mutant is not only extremely difficult at present, but also has a limit in physical size in order for the unnatural amino acid to be accepted by various factors for protein synthesis.
Japanese Patent Laid-Open No. 2004-261160 International Publication No. 03/014354 Pamphlet Nature Biotechnology, 2003, vol.21, pp.546-552 PNAS January 7, 2003, vol.100, No.1, pp.56-61

Thus, with conventional protein synthesis systems, it is difficult to produce proteins with new activities that do not exist in nature and proteins that are significantly different in structure from natural proteins at low cost, especially at the milligram level. In addition, even if evolutionary molecular engineering techniques are combined with conventional protein synthesis systems, the introduction of mutations necessary to create next-generation libraries reproduces amino acid species that should have been excluded from the initial library. However, the true effect of evolutionary molecular engineering could not be obtained.
Therefore, the present invention provides a specific amino acid species that retains the original function of the protein and enables site-specific modification / immobilization, or has a new function that does not exist in nature in addition to the original function of the protein. An object of the present invention is to provide an industrial production method of a non-natural protein in which is substituted with a natural amino acid other than the specific amino acid species.

The present inventor has intensively studied in view of the present situation, and creates an alanine tRNA mutant or a serine tRNA mutant corresponding to a specific amino acid species to be excluded from protein-constituting amino acids, the tRNA mutant and the specific amino acid. By applying a known in vitro virus method to a cell-free protein synthesis system that contains non-species natural amino acids, the amino acid species once excluded from the initial library will not reappear due to the evolution of the molecule. It has been found that a non-natural protein having can be produced.
In addition, based on the amino acid sequence information of the protein produced by the production method of the present invention, a polynucleotide comprising a base sequence encoding this amino acid sequence is synthesized (“gene resynthesis”), and this is synthesized with an existing protein synthesis. It was found that the functional unnatural protein can be produced in large quantities and at low cost by using it in a system.
Furthermore, among general-purpose protein modification and immobilization methods, a method that is specific to an amino acid species but is not site-specific is applied to the functional non-natural protein obtained by the production method of the present invention. Then, it discovered that site-specific modification and immobilization became possible.

That is, the present invention provides (1) a method for producing a functional non-natural protein obtained by substituting a specific amino acid species with a natural amino acid other than the amino acid species,
a) associating a nucleic acid portion having a base sequence reflecting a genotype with a protein portion which is a translation product of the nucleic acid portion;
b) a step of selecting the mapping molecule obtained in the mapping step;
c) introducing the mutation into the nucleic acid portion of the mapping molecule obtained in the selection step; and d) amplifying the nucleic acid portion obtained in the mutation introduction step.
(2) The production method according to (1), further comprising the step of repeating the steps a) to d) by subjecting the nucleic acid part obtained in the step d) to the step a).
(3) A nucleoside or nucleoside analogue in which the nucleic acid part is mRNA, and in step a), a spacer is linked to the 3 ′ end side of the mRNA, and then the 3 ′ end side of the linked body can be covalently bonded to an amino acid. Are further linked to obtain an mRNA conjugate; then, the mRNA conjugate is added to a cell-free protein synthesis system containing a suppressor tRNA corresponding to the particular amino acid species and a natural amino acid other than the particular amino acid species. Provided is the production method according to (1) or (2), wherein protein synthesis is performed and the translation product of the mRNA conjugate and the mRNA conjugate are linked.
(4) The production method according to (3), wherein the suppressor tRNA is an alanine tRNA mutant or a serine tRNA mutant.
(5) The production method according to any one of (1) to (4), wherein the specific amino acid is threonine, lysine or cysteine.
(6) The production method according to any one of (3) to (5), wherein the nucleoside or nucleoside analog is puromycin.
(7) Provided is a method for site-specific modification of a functional non-natural protein, characterized by using a protein produced by the method according to any one of (1) to (6).
(8) Provided is a method for site-specific immobilization of a functional non-natural protein, characterized by using a protein produced by the method according to any one of (1) to (6).
(9) A polynucleotide comprising a base sequence encoding the amino acid sequence of the protein produced by the method according to any one of (1) to (6) is prepared and used. Provided is a method for producing a functional non-natural protein in which an amino acid sequence is maintained.
(10) Provided is a site-specific modification method for a functional non-natural protein, characterized by using a protein produced by the method according to (9).
(11) A site-specific immobilization method for a functional non-natural protein, characterized by using the protein produced by the method according to (9).

Since the re-appearance of the amino acid that should have been excluded from the primary library can be avoided by the generation method of the functional non-natural protein of the present invention, the evolutionary molecular engineering cycle in accordance with the policy of reducing the number of amino acids is advanced. This is possible for the first time, and the effect of limiting the types of amino acids is truly obtained.
Moreover, the functional non-natural protein of the present invention can be industrially produced by re-synthesis of the gene of the produced protein even by an existing protein synthesis system.

  The amino acid contained in the natural protein synthesis system has a dedicated aminoacyl tRNA synthetase (hereinafter referred to as “aaRS”) for each amino acid, and each enzyme binds the corresponding amino acid and tRNA. And the amino acid couple | bonded with tRNA is used for the protein synthesis | combination corresponding to the anticodon of the tRNA even if it is not the tRNA which should be couple | bonded originally. What is characteristic here is that aaRS strictly distinguishes only the corresponding tRNA from all tRNAs having an L-shaped similar three-dimensional structure, and corresponding amino acids from amino acid species having a similar chemical structure. It is a point that strictly identifies only the species. Therefore, if an error occurs in association by aaRS, accurate protein synthesis cannot be performed. The system with precisely optimized correspondence is the essence of the genetic code table.

By the way, in order for an amino acid to polymerize on a ribosome to become a protein, the amino acid needs to be bound to tRNA by aaRS. Therefore, a specific type of amino acid itself or aaRS or tRNA corresponding to the amino acid can be excluded from the protein synthesis system to exclude the specific type of amino acid from the protein.
The exclusion of amino acid species uses the cell-free protein synthesis reaction because most of the cell-derived small molecules are removed by dialysis after cell disruption and centrifugation. This can be done easily. Since the amino acid used for the synthesis is added separately, the amino acid can be excluded unless a specific type of amino acid is added in this step. As used herein, “exclusion” of a specific amino acid species means “substitution” of the specific amino acid species with other natural amino acids.
For removal of the factor relating to the amino acid, for example, a method of removing tRNA of a specific type of amino acid with an immobilized probe DNA or the like, or a method of removing aaRS of the amino acid with an immobilized antibody can be used. In addition, it is known that individual factors can be prepared separately and reconstituted in a cell-free protein synthesis system, but a reaction solution that does not mix specific factors is used when constructing this reconstituted cell-free protein synthesis system. A method can also be used. Furthermore, an aminoacyl-tRNA synthetase specific inhibitor can also be used.

  However, by simply excluding factors, protein synthesis is stopped at codons corresponding to the excluded amino acids, and a full-length protein cannot be obtained. Therefore, the feature of the production method of the present invention is to use “suppressor tRNA”. Naturally occurring nonsense suppressor tRNAs have an anticodon corresponding to a stop codon (indicating the termination of protein synthesis since the corresponding tRNA originally does not exist). Even if a mutation occurs in the anticodon, an amino acid is bound to this tRNA by aaRS, so that the amino acid is inserted into the peptide chain corresponding to the stop codon and nonsense suppression is possible. FIG. 1 shows an example of using a “suppressor tRNA” in which alanine is inserted instead of threonine corresponding to the removed threonine codon.

  Accordingly, the production method of the present invention uses a “suppressor tRNA” in a cell-free protein synthesis system to separate a nucleic acid part (genotype) and a protein part (phenotype) that is a translation product of the nucleic acid part. `` Associated molecule '' is constructed, and this associated molecule is selected by in vitro selection using specific activity as an index, and the gene part of the selected in vitro virus is amplified by PCR. It is characterized by repeating the operation of attaching a molecule, introducing a mutation, and amplifying.

The above-mentioned “corresponding molecule” includes a virus type that forms a complex of genotype and phenotype, a ribozyme type that puts the genotype and phenotype on the same molecule, and a genotype and phenotype in one bag Cell type to be put in is known (Protein Nucleic Acid Enzyme Vol.48 No.11 (2003)). In the production method of the present invention, the “in vitro virus method” in which mRNA and protein are covalently linked is preferable.
Other viral-type evolutionary molecular engineering techniques that integrate genotype and phenotype include phage display (Smith, GP, Science 228, 1315-1317 (1985); Scott, JK, Science 249, 386-390. (1990)), polysome display (Mattheakis, LC et al., Proc. Natl. Acad. Sci. USA 91, 9022-9026 (1994)), coded tag library (Brenner, S et al., Proc. Natl. Acad) Sci. USA 89, 5381-5383 (1992)), Selstat (Husimi, Y. et al., Rev. Sci. Instrum. 53, 517-522 (1982)) and the like.
Hereinafter, the production method of the present invention will be described using an in vitro virus method as an example. Details of the operation of construction, selection, mutagenesis, amplification, etc. of the mapping molecule are described in WO98 / 16636. ing.

(A) Correspondence Correlation is performed by linking a spacer to the 3 ′ end side of mRNA, and then further linking a nucleoside or nucleoside analog capable of covalently binding to an amino acid to the 3 ′ end side of the ligated body. Then, the mRNA conjugate is added to a cell-free protein synthesis system containing natural amino acids other than the suppressor tRNA and the specific type of amino acid to be excluded, and protein synthesis is performed, and the translation product of the mRNA conjugate and the mRNA are obtained. It can be carried out by linking the linked body by covalent bond.

  According to this association method, when a codon of a specific amino acid type to be excluded comes in protein synthesis, a suppressor tRNA enters the ribosome A site correspondingly, and the suppressor tRNA 3 'is affected by the action of peptidyltransferase. The terminal nucleoside or nucleoside analog binds to the protein.

  The initial library of mRNA used in the present invention is an mRNA of a wild type nucleotide sequence itself, an mRNA mutation having a nucleotide sequence in which all codons of amino acid species to be excluded are replaced with codons of amino acid species having similar chemical properties And mRNA variants having a base sequence in which the codons of amino acid species to be excluded are random. In addition, the second generation mRNA library uses mRNA from the initial library in addition to mRNA from the initial library and mRNA variants obtained through the steps of mapping, selection, mutagenesis, and amplification. The body can be included.

  The “spacer” may be any polymer material as long as it is preferably a polymer material having a length of 100 mm or more, more preferably about 100 to 1000 mm. Specific examples include single strands of natural or synthetic DNA or RNA; double strands of DNA and DNA; polymers such as polysaccharides and polyethylene glycol. Polyethylene glycol preferably has a molecular weight of about 2,000 to 30,000.

  Examples of the “nucleoside or nucleoside analog” that can be covalently bonded to an amino acid include, for example, puromycin, 3′-N-aminoacylpuromycin aminonucleoside (PANS-amino acid) (for example, an amino acid) that forms an amide bond at the 3 ′ end of a nucleic acid. PANS-Gly of glycine, PANS-Val of valine, PANS-Ala of alanine, etc.). 3'-N-aminoacyl adenosine aminonucleoside (AANS-amino acid) (for example, AANS-Gly whose amino acid part is glycine) formed by dehydration condensation of the amino group of 3'-aminoadenosine and the carboxyl group of amino acid , AANS-Val of valine, AANS-Ala of alanine, etc.), and those in which a nucleoside and an amino acid are ester-bonded can also be used. Of these, puromycin is particularly preferred.

Examples of the mRNA conjugate of the present invention include mRNA (5 ′ untranslated region-start codon-protein coding sequence) -3 ′ untranslated region-DNA spacer-puromycin. In the ligated product, mRNA having 8 nucleotides AAAAAAAA as a 3 ′ untranslated region was converted into “phosphate group-d (CC)-(Spacer18) ₈ -dCC-puromycin” (“molecule α It is obtained by covalent bonding with Spacer18: — (CH ₂ ) ₂ —O — [(CH ₂ ) ₂ O] ₈ —PO ₃ —). This covalent bond may be formed by RNA ligase (Nucleic Acids Research vol. 31, e78, 2003) or by a general organic chemical reaction. Specifically, the binding between the molecule α and mRNA can be performed using T4 RNA ligase (Takara) and adding polyethylene glycol 2,000 to the attached buffer at a final concentration of 120 μM. The reaction time is about 15 ° C., and the reaction time is about 4 hours.
Next, after applying the conjugate of mRNA and molecule α to a cell-free protein synthesis system containing a suppressor tRNA and a natural amino acid other than the specific type of amino acid to be excluded, a final concentration of 50 mM MgCl ₂ and 500 By adding mM KCl and allowing to stand at about 10 ° C. for about 30 minutes, a complex, mRNA-DNA spacer-puromycin-protein, can be formed.

  The suppressor tRNA used in the present invention includes, for example, an “alanine tRNA mutant” having an anticodon corresponding to a specific type of amino acid to be excluded and alan being bound in place of the amino acid by aaRS for alanine. (Giege R. et al., Nucleic Acids Research 1998, vol.26, No.22, pp.5017-5035). In addition to the alanine tRNA mutant, a “serine tRNA mutant” having an anticodon corresponding to a specific type of amino acid to be excluded and serine bound in place of the amino acid by aaRS for serine is used in the same manner. (Takai K. et al., Biochemical and Biophysical Research Communications 257, 662-667 (1999)). This is because aaRS corresponding to these tRNA mutants do not recognize an anticodon and can bind alanine or serine to tRNA having a mutation introduced in the anticodon. The number of amino acid species to be excluded may be one or more, but is preferably 10 or less, particularly preferably 5 or less, from the viewpoints of expression of activity, formation of higher-order steric structure and the like.

  For example, when threonine is excluded from protein-constituting amino acids, the four codons encoding threonine are first paired with these four codons (ACU, ACC, ACA, ACG) to associate alanine instead of threonine. An alanine tRNA variant or a serine tRNA variant having a possible anticodon “UGU” or anticodon “GGU” is prepared by T7 in vitro transcription reaction, respectively.

  Specifically, an alanine tRNA mutant having an anticodon “UGU” can be prepared as follows. First, a DNA fragment containing TGT was subjected to a PCR reaction, and the resulting PCR product was cleaved with HindIII and BamHI, and then incorporated into the HindIII-BamHI site of vector pUC18 to prepare vector pALA (TGT). The vector is used for cloning, and then PCR reaction is performed to prepare a template DNA for transcription of the alanine tRNA mutant. The obtained PCR product has a T7 RNA polymerase promoter sequence and a downstream tRNA sequence, and serves as a template for in vitro transcription reaction. Next, a transcriptional reaction and purification are performed on the transcription template according to the method described in the literature (Nureki O. et al., J. Mol. Biol. 236, 710-724, 1994) to obtain an alanine tRNA mutant. be able to.

  Next, by adding the alanine tRNA mutant to the cell-free protein synthesis reaction solution that does not contain threonine, a “suppression” occurs in which alanine or serine is inserted into the polypeptide chain corresponding to the codon of threonine. A translation product is obtained.

  The exclusion of specific amino acid species can also eliminate protein instability due to chemical changes at the amino acid level. For example, cysteine, which is a sulfur-containing amino acid, forms a disulfide bond by oxidation, leading to protein deactivation. Methionine is added with an oxygen atom by oxidation, and the occurrence of steric hindrance causes a decrease in protein activity. Therefore, in order to impart antioxidant ability to a protein, it is necessary to exclude oxidizing amino such as cysteine and methionine from the protein. However, exclusion of cysteine, methionine, etc. has the following problems.

  For the exclusion of amino acid species having less than 4 codons such as cysteine, lysine, asparagine, there is a failure to interpret the codons. That is, in the recognition of the codon / anticodon pair, the recognition can be established in the third character of the codon and the first character of the anticodon other than the Watson-Crick type of adenine and uracil, guanine and cytosine. Therefore, in order to avoid cross-reaction with the tRNA of another amino acid sharing the first and second characters of the codon, the anticodon first character that matches the third character of the codon is modified in the wild type tRNA. There may be. Since the anticodon “GCA” of tRNA corresponding to the codon “UGU” or “UGC” of cysteine is not modified with the endogenous tRNA of E. coli, in the tRNA mutant in which alanine or serine is inserted instead of cysteine in the present invention. However, no modification is considered necessary. Similarly, no modification is considered necessary for a tRNA mutant having an anticodon “CUU” corresponding to the codon “AAG” of lysine.

  On the other hand, if the tRNA variant having the anticodon “UUU” corresponding to the codon “AAA” does not have the “U” modification of the first letter of the anticodon, this tRNA is against the codon “AAU” or “AAC” of asparagine. Although it is less efficient, there is a possibility of pairing. As a result, a slight amount of serine or alanine may be mistakenly inserted into the polypeptide site corresponding to this codon instead of the original asparagine.

  Such a failure to predict possible codon reading by a tRNA variant having an anticodon “UUU” (1) minimizes the amount of tRNA variant added; (2) amount of asparagine tRNA. (As a result of competition between this asparagine tRNA and the tRNA variant, there is no translation error due to the low-use tRNA variant); (3) The tRNA variant prepared by T7 in vitro transcription, Introduce modifications that maintain the accuracy of codon / anticodon recognition (because genes mnmA and iscS with anticodon-modifying enzyme activity have been identified and in vitro modification systems using these gene products have already been reported. (4) Assign asparagine to codons “AAG” or “AAA”; and (5) Exclude not only lysine but also asparagine from the protein synthesis system. Adding alanine mutant tRNA or serine tRNA variants as accommodate all down, it can be solved by a method such as. When asparagine is also assigned to codons “AAG” or “AAA”, the alanine tRNA mutant is not used, but tRNA in which the anticodon of asparagine tRNA is substituted is used. The anticodon substitution of asparagine tRNA may reduce the recognition ability of the enzyme that binds asparagine and tRNA, but this enzyme can be modified by recognizing both tRNA mutants. In this way, only asparagine can be correctly inserted corresponding to the codon of asparagine.

  By adopting the same method for other amino acid species, problems caused by ambiguity in codon / anticodon pairing can be prevented.

  Similarly, any amino acid can be removed from the protein translation system by substituting a specific amino acid species with alanine or serine. However, since the polypeptide obtained here is simply a specific amino acid species excluded from the wild-type sequence in a site-specific manner, in most cases, the activity of the obtained polypeptide is compared with that of the natural type. It is falling. Therefore, the following selection, mutation introduction, and amplification steps are required. By repeating these steps, a protein having a specific function retained or improved can be obtained.

(B) Selection As used herein, “selection” means a step of evaluating the function (biological activity) of a protein part constituting an in vitro virus and selecting the in vitro virus based on the desired biological activity. . Such methods are known, for example, in Nemoto N. et al., FEBS letters 1997, vol.414, pp.405-408; Roberts RW. Et al., PNAS, 1997, vol.94, pp.12297-12302, etc. Are listed.

  The function serving as an index of selection in the present invention includes, for example, the activity inherent to a protein in which a specific amino acid is site-specifically substituted, the antioxidant activity newly acquired by the protein, the binding activity of the protein, stability, enzyme activity, etc. It is. For example, when selecting an interferon having specific binding ability, an interferon receptor, antibody, etc. are immobilized in advance on a known support such as a bead, and the interferon polypeptide variant and its mRNA are used here. Interferon with high binding activity can be selected by reacting the corresponding molecule.

  Next, in the (c) mutation introduction and (d) amplification steps, mutations are introduced into the mRNA of the selected in vitro virus and amplified by PCR or the like. Specifically, mutation may be introduced after cDNA is synthesized by reverse transcriptase, and mRNA amplification may be performed while introducing mutation. Mutation was introduced by the already established Error-prone PCR (Leung, DW et al., J. Methods Cell Mol. Biol., 1, 11-15, 1989), Sexual PCR (Stemmer, WPC, Proc. Natl. Acad Sci. USA 91, 10747-10751, 1994) and the like.

  Using the in vitro viral mRNA with the mutation introduced and amplified, the next generation, construction of the translation product correspondence between the mRNA conjugate and the mRNA conjugate, selection of the correspondence molecule having the desired biological activity, Mutagenesis and amplification can be performed. By further repeating these steps as necessary, functional non-natural proteins can be modified and created. More importantly, the use of alanine or serine tRNA variants can prevent the reoccurrence of amino acid species that should have been excluded from the initial library in the resulting protein.

However, the above-mentioned method for producing a functional non-natural protein is based on a cell-free system using a special translation system, and thus the protein synthesis efficiency is not high. Therefore, when a large amount of the non-natural protein is obtained, it is desirable that a normal protein synthesis system using any of the 20 amino acids (either a cell system or a cell-free system) can be used.
Here, since the protein synthesis system of the present invention defines amino acids other than the amino acid using the codon of the removed amino acid, the gene encoding the protein obtained in the above evolution cycle includes the removed amino acid. Of codons may be included. Therefore, even if the gene is applied to a normal protein synthesis system, the removed amino acid will reappear. Therefore, an artificial gene capable of producing “the amino acid sequence of the obtained functional non-natural protein” according to a normal genetic code table is re-synthesized using a synthetic polynucleotide. Gene total synthesis is a routine experimental technique today, and it can keep costs low. For example, when the evolution cycle is performed using a special genetic code table that maps a lysine codon to alanine, the resulting gene may contain codons “AAA” and “AAG”, so these codons are alanine codons. “Resynthesize” the gene that has been replaced with (“GCU”, “GCC”, “GCA” or “GCG”).
By applying this re-synthesized artificial gene to a normal protein synthesis system that does not contain suppressor tRNA, a large amount of functional non-natural protein that maintains the amino acid sequence obtained in the evolution cycle (e.g., from milligram level to Gram level), and can be manufactured inexpensively and easily.

Thus, the production method of the present invention can not only create a protein having a specific function, but also can be modified and immobilized in a site-specific manner using a general-purpose reagent as described below. .
As such a modification method, a known method (modification method using NHS, maleimide or the like) for modifying all specific amino acid species nonspecifically can be used. For NHS activation modifiers, see Flanders KC et al., Biochemistry, 1982, vol. 21, pp. 4244-4251; Zhang L. et al., Journal of Biological Chemistry, 1999, vol. 274, pp. 8966-8972, maleimide activity. Details of the chemical modification agents are described in Curtis SK and Cowden RR., Histochem., 1980, vol.68, pp.23-28; Analytical Biochemistry, 1985, vol.149, pp.529-536, respectively. . For example, if the N-terminus of a non-natural protein is a free amino group, an NHS (N-hydroxysuccinimide) activation modifier, which is an inexpensive amino group-modifying reagent, is formylated, acetylated, etc. In this case, only one lysine codon is introduced again, and this site can be used as a specific modification site. When the N-terminal is not protected, the N-terminal fragment can be cleaved by various techniques. Site-specific modification to any position other than the end of the non-natural protein can also be performed using cysteine instead of lysine.

  By the same operation, it can be immobilized on the immobilization carrier via a specific amino acid residue of the non-natural protein. The immobilization carrier may be provided with a reactive group bonded to the support in addition to the support made of a solid insoluble in water or an organic solvent. Examples of the support include latex particles, agarose beads, sepharose beads, magnetic beads, microtiter plates, nitrocellulose membranes, nylon membranes, and the like that are usually used for immobilization of proteins. The immobilization carrier on which the non-natural protein is immobilized can be used, for example, for affinity chromatography, protein chip, bioreactor and the like. In addition, cell adhesion molecules such as extracellular matrix such as collagen, proteoglycan, fibronectin, elastin, hyaluronic acid, cadhein family, immunoglobulin superfamily, integrin family, selectin family, link protein family, and sialomucin family are immobilized. It can also be used for implant materials and artificial materials for regenerative medicine.

  EXAMPLES Next, although an Example is given and this invention is demonstrated in detail, this invention is not limited to these Examples at all.

Example 1 Preparation of alanine tRNA mutant
(1) SEQ ID NO: 1 TGTplus
GCAGCAAGCTTAATACGACTCACTATAGGGGCTATAGCTCAGCTGGGAGAGCGCCTGCTTTGTACG
(2) SEQ ID NO: 2: TGT_minus
GTCGGGATCCTGGTGGAGCTATGCGGGATCGAACCGCAGACCTCCTGCGTACAAAGCAGGCGCTCTCCCAGC
(3) SEQ ID NO: 3: alaPCRplus
GCAGCAAGCTTAATACGACTCAC
(4) SEQ ID NO: 4: alaPCRminus
GTCGGGATCCTGGTGGAGCTATGCGGG
(5) SEQ ID NO: 5: ala_JUSTminus
TGGTGGAGCTATGCGGGATCGAACC
(6) SEQ ID NO: 6: GGTplus
GCAGCAAGCTTAATACGACTCACTATAGGGGCTATAGCTCAGCTGGGAGAGCGCCTGCTTGGTACG
(7) SEQ ID NO: 7: GGT_minus
GTCGGGATCCTGGTGGAGCTATGCGGGATCGAACCGCAGACCTCCTGCGTACCAAGCAGGCGCTCTCCCAGC

A template DNA for transcription of an alanine tRNA mutant in which the anticodon site was replaced with TGT was prepared as follows.
First, 50 μL of a PCR reaction solution containing 5 pmol each of DNA (1) and DNA (2) (other composition conforms to Takara Pyrobest DNA polymerase instruction manual) was prepared, and PCR was carried out for 5 cycles. Subsequently, 40 pmol of DNA (3) and DNA (4) were added, and PCR was further performed for 15 cycles. The obtained PCR product was cleaved with HindIII and BamHI, and then inserted into the HindIII-BamHI site of vector pUC18 (TOYOBO) to prepare vector pALA (TGT). After confirming the sequence of this vector cloned using E. coli, PCR using KOD DNA polymerase was performed using DNA (3) and DNA (5). The reaction conditions followed the enzyme package insert.

  The obtained PCR product has a T7 RNA polymerase promoter sequence and a downstream tRNA sequence, and serves as a template for in vitro transcription reaction. In addition, by using DNA (6) and DNA (7) instead of DNA (1) and DNA (2), a template DNA for transcription of an alanine tRNA mutant in which the anticodon site was substituted with GGT was prepared.

  These DNAs serving as transcription templates were subjected to transcription reaction and purification by methods according to the literature (J. Mol. Biol. 236, 710-724, 1994) to obtain alanine tRNA mutants. The sequence is shown below. The underlined portion indicates an anticodon.

Sequence number 8: tRNA Ala (UGU)
GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCUU UGU ACGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA
SEQ ID NO: 9: tRNA Ala (GGU)
GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCUU GGU ACGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA

  These two tRNAs can recognize four codons (ACU, ACC, ACA, ACG) of threonine.

Example 2 Cell-free translation reaction without threonine using an alanine tRNA mutant Cell-free protein synthesis reaction was performed according to Journal of Structural and Functional Genomics, 2004; 5 (1-2): 63-8. The composition of the reaction solution is as follows: 55 mM Hepes-KOH (pH 7.5), 1.7 mM DTT, 1.2 mMATP (pH 7.0), 0.8 mM CTP (pH 7.0), GTP (pH 7.0), and UTP ( pH 7.0), 80 mM CP, 250 μg / ml creatine kinase, 4.0% polyethylene glycol 8000, 0.64 mM 3 ', 5'-cyclic AMP, 68 μM L (-)-5-formyl-5,6,7,8-tetrahydro Folic acid, 175μg / ml, E. coli total tRNA, 210 mM potassium glutamate, 27.5 mM ammonium acetate, 10.7 mM magnesium acetate, 1.0 mM amino acid each, ¹⁴ C-leucine, 6.7 μg / ml translation template plasmid, 93 μg / ml T7 RNA polymerase, And 30% (w / v) S30 extract. However, as the cell extract S30, a commercially available kit was purchased, and a buffer solution (10 mM Tris Acetate pH 8.2, 14 mM Mg (OAc) ₂ , 60 mM KOAc, 1 mM DTT) was used after dialysis. Moreover, the case where all 20 types of amino acids were included was compared with the case where 19 types other than threonine were included. Two types of alanine tRNA mutants were added in concentration ranges of 0, 1, 2, and 4 μM, respectively.

  As a template, the coding sequence of Ras protein (SEQ ID NO: 10) was used. After a translation reaction for 60 minutes (it is considered that a protein having a molecular weight of about 21,000 was produced as a result of translation), the reaction product was analyzed using 4-12% NuPAGE Bis-Tris gel (Invitrogen). The gel was dried and analyzed using an image analyzer (Fuji Film). The results are shown in FIG. Lanes 1 to 3 are all positive controls containing all 20 amino acids.

As is clear from FIG. 2, a band was detected at a position of an assumed molecular weight. The coexistence of alanine tRNA mutants revealed that full-length translation products could be obtained even if the reaction solution did not contain threonine (lanes 4-6). On the other hand, when neither the threonine nor the alanine tRNA mutant was present, a full-length translation product was not obtained (lane 7).
Therefore, in lanes 4 to 6, it is considered that alanine was introduced into the protein instead of the threonine codon.

As it follows Preparation of alanine tRNA mutant for alanine mutant tRNA and cysteine for Example 3 lysine was prepared template DNA for transferring the alanine tRNA mutant anticodon site was substituted GCA or TTT, respectively.
For pALA (TGT) prepared in Example 1, two oligo DNA GCA F (SEQ ID NO: 11) and Mut A vector pALA (GCA) was prepared by using QuikChange Site-Directed Mutagenesis Kit (STRATAGENE) using R (SEQ ID NO: 12). Similarly, TTT F (SEQ ID NO: 13) and Mut PALA (TTT) was prepared using R.

Sequence number 11: GCA_F
TCAGCTGGGAGAGCGCCTGCTT GCA ACGCAGGAGGTCTG
Sequence number 12: Mut_R
GCAGGCGCTCTCCCAGCTGAGCTATAGCCCC
Sequence number 13: TTT_F
TCAGCTGGGAGAGCGCCTGCCT TTT AAGCAGGAGGTCTG

  Subsequently, an alanine tRNA mutant was prepared in the same manner as in Example 1. The sequence is shown below. The underlined portion indicates an anticodon.

SEQ ID NO: 14: tRNA Ala (GCA)
GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCUU GCA ACGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA
SEQ ID NO: 15: tRNA Ala (UUU)
GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCCU UUU AAGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA

  Each tRNA can recognize two codons for cysteine (UGU, UGC) or two codons for lysine (AAA, AAG).

Example 4 Cell-free translation reaction in which lysine was removed using an alanine tRNA mutant Cell-free protein synthesis was carried out in the same manner as in Example 2. However, the case where all 20 types of amino acids were included was compared with the case where 19 types other than lysine were included, and the alanine tRNA mutant tRNA Ala (UUU) was added in a concentration range of 0 μM, 1 μM and 4 μM. 5 μM 5′- O 2-[N- (L-lysyl) sulfamoyl] -adenosine was also added. As a template for protein synthesis, mRNA having a monomeric streptavidin (SEQ ID NO: 16) as a coding sequence was used. The results are shown in FIG. Lane 1 is a positive control containing all 20 amino acids.

As is apparent from FIG. 3, a band was detected at a position of an assumed molecular weight. Even when lysine was not included as an amino acid, a small amount of protein was synthesized by a small amount of lysine that was not removed by dialysis (lane 2), but this production was lost by addition of a lysyl tRNA synthetase inhibitor (lane). 4). Furthermore, it was found that a full-length translation product can be obtained by adding alanine tRNA mutant tRNA Ala (UUU) (lanes 5 to 6).
Therefore, in lanes 5 to 6, it is considered that alanine was introduced instead of lysine with respect to the lysine codon of the protein.

(Purification)
It was confirmed by mass spectrometry that alanine was introduced instead of lysine with respect to the lysine codon of the protein. Monomeric streptavidin was used as a gene for translation. As a control experiment for lysine removal, a cell-free protein synthesis system without lysine removal was used, and a His-tagged monomeric streptavidin gene and a gene in which all lysine codons of this gene were replaced with alanine codons were also used. .
90 μL of the cell-free protein synthesis reaction solution that had been reacted in the same manner as above (but without using RI) was collected in a 1.6 mL tube. 900 μL of phosphate buffer (pH 7.8) (8.8 M urea, 300 mM NaCl) was added to the collected sample, and the mixture was stirred in a vortex mixer at 37 ° C. for 1 hour. The sample applied to the vortex mixer was collected so that the cell-free protein synthesis reaction solution was 40 μL to 45 μL / Beads (i) (450 μL of the sample applied to the vortex mixer).
Co Beads 40 μL (50% slurry) already conditioned in phosphate buffer (pH 7.8) (8 M urea, 300 mM NaCl) and cell-free protein synthesis reaction sample collected in (i) equivalent to 45 μL (sample applied to vortex mixer) Of which was mixed (ii). A further 500 μL of phosphate buffer (pH 7.8) (8 M urea, 300 mM NaCl) was added to (ii) and subjected to Rotator for 1 hour at room temperature to mix Co Beads and the protein produced by cell-free protein synthesis (iii) ). (iii) was centrifuged at 5000 rpm for 1 minute, the supernatant was discarded, and the beads were left in the tube. 500 μL phosphate buffer (pH 7.8) (8 M urea, 300 mM NaCl) was added to each tube, and after stirring, the mixture was centrifuged at 5000 rpm for 1 minute, and the supernatant was discarded (operation 1). Operation 1 was repeated two more times. 20 μL of phosphate buffer (pH 6.0) (8M urea, 300 mM NaCl) was added, left at room temperature for 5 minutes, centrifuged at 9000 rpm for 1 minute, and the supernatant was recovered (operation 2). Operation 2 was repeated once more. 20 μL of phosphate buffer (pH 5.3) (8M urea, 300 mM NaCl) was added, left at room temperature for 5 minutes, centrifuged at 9000 rpm for 1 minute, and the supernatant was recovered (operation 3). Operation 3 was repeated once more. 20 μL of phosphate buffer (pH 4.0) (8M urea, 300 mM NaCl) was added, the mixture was allowed to stand at room temperature for 5 minutes, centrifuged at 9000 rpm for 1 minute, and the supernatant was recovered (operation 4). Operation 4 was repeated once more. SDS-PAGE is performed on the sample collected in steps 2 to 4, the SDS-PAGE gel is stained with CBB, and a sample without contaminating protein is detected using a MALDI-TOF / MS (matrix-assisted ionization time-of-flight mass spectrometer). ) Was collected as a sample.

  FIG. 4 shows the result of purification. Lanes 1 and 2 are control proteins produced using E. coli, Lane 1 is monomeric streptavidin (StAvM4), and Lane 2 is Mutant (StAvM4_KallA) in which all eight lysine residues of StAvM4 are substituted with alanine. ). The mRNA encoding StAvM4_KallA is shown in SEQ ID NO: 17. Lanes 3 to 5 are proteins produced by a cell-free protein synthesis reaction. Lanes 3 and 4 are control experiments. Using a cell-free protein synthesis system that does not remove lysine, the translation reaction from the monomeric streptavidin gene (lane 3) and the gene in which all the lysine codons of this gene were replaced with alanine codons (lane 4) went. Lane 5 shows a translation product in which alanine is introduced in place of lysine for a lysine codon by performing a translation reaction from a monomeric streptavidin gene by a translation reaction from which lysine has been removed.

(MALDI-TOF / MS sample preparation)
1 μL of 10 mg / mL sinapinic acid (water: acetonitrile = 1: 1) was dropped on the plate and left to dry. After drying, 2.5 pmol of apomyoglobin was layered on the dried sinapic acid and left to dry. 10 μL of the purified sample (equivalent to about 200 ng) was aspirated with ZipTip already conditioned to a 2% acetonitrile solution (0.1% TFA). Subsequently, the suction and discharge were repeated five times and then discharged. Subsequently, the suction and discharge of 2% acetonitrile solution (0.1% TFA) corresponding to 10 μL was repeated (operation 5). Operation 5 was repeated once more. Subsequently, 2 μL of 60% acetonitrile was aspirated, layered on a plate dried with sinapinic acid and apomyoglobin, and allowed to stand until dry. After drying, 1 μL of 10 mg / mL sinapinic acid was layered, and the sample was allowed to stand until it dried and crystallized, and measured with MALDI-TOF / MS of SHIMAZU. The results are shown in FIG. The upper part of FIG. 5 shows the spectrum of StAvM4, the middle part shows the spectrum of StAvM4_KallA, and the lower part shows the spectrum of the protein obtained by the method of the present invention. Compared with the results of protein synthesis using the normal genetic code table (upper) and controls (middle), in the protein synthesis system of the present invention, alanine was inserted instead of lysine in the lysine codon. It was shown that

Example 5 Cell-free translation reaction with cysteine removed using an alanine tRNA mutant Cell-free protein synthesis was carried out in the same manner as in Example 2. However, when all 20 types of amino acids are included and 19 types other than cysteine are compared, alanine tRNA variants (GCA) are in a concentration range of 0 μM, 0.03 μM, 0.1 μM, 0.3 μM and 1 μM. Added in. Further, 5 μM of 5′- O 2-[N- (L-cysteinyl) sulfamoyl] -adenosine, which is a cysteinyl tRNA synthetase inhibitor, was added. The results are shown in FIG. Lanes 1 and 2 are positive controls containing all 20 amino acids.

  As is clear from FIG. 6, a band was detected at the position of the assumed molecular weight. Even when cysteine was not included as an amino acid, a small amount of protein was synthesized by a small amount of cysteine that was not removed by dialysis (lane 3), but this production disappeared by addition of a cysteinyl tRNA synthetase inhibitor (lane). 4). Furthermore, it was found that full-length translation products can be obtained by adding alanine tRNA mutant tRNA Ala (GCA) (lanes 5 to 8). Therefore, in lanes 5 to 8, it is considered that alanine was introduced instead of cysteine with respect to the cysteine codon in the protein.

Example 6 Cell-free translation reaction in which cysteine was removed using a serine tRNA mutant In the same manner as in Example 1, a plasmid pSER (TGA) encoding serine tRNA was prepared. However, pSER_F (SEQ ID NO: 18) and pSER_R (SEQ ID NO: 19) were used for the first 5 cycles of PCR, and MT (SEQ ID NO: 20) and REV (SEQ ID NO: 21) were used for the subsequent 15 cycles of PCR. In addition, pUC118 (TOYOBO) was used as a vector for integration, and HindIII and EcoRI were used as a set of restriction enzymes.

Sequence number 18: pSER_F
TTGTAAAACGACGGCCAGTGCCAAGCTTAATACGACTCACTATAGGAAGTGTGGCCGAGCGGTTGAAGGCACCGGTCTTGAAAACCGGCGACCCGAAAG
Sequence number 19: pSER_R
AGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCCTTCCCGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA
Sequence number 20: MT
ACGACGTTGTAAAACGACGGCCAGT
SEQ ID NO: 21: REV
CAGGAAACAGCTATGACCATGATTA

  Use the QuikChange Site-Directed Mutagenesis Kit (STRATAGENE) using the two oligo DNAs GCA1_SF (SEQ ID NO: 22) and Mut_SR (SEQ ID NO: 23) for the pSER (TGA) prepared in the previous section. Thus, vector pSER (GCA 1) was prepared. Similarly, pSER (GCA 2) was prepared using GCA2_SF (SEQ ID NO: 24) and Mut_SR.

Sequence number 22: GCA1_SF
GTTGAAGGCACCGGTCTGCAAAACCGGCGACCCGAAAG
Sequence number 23: Mut_SR
ACCGGTGCCTTCAACCGCTCGGCCACACTTCC
Sequence number 24: GCA2_SF
GTTGAAGGCACCGGTTTGCAACACCGGCGACCCGAAAG

  Subsequently, a serine RNA mutant was prepared in the same manner as in Example 1. However, MT and SerJustMinus (SEQ ID NO: 25) were used as PCR primers.

SEQ ID NO: 25: SerJustMinus
TGGCGGAAGCGCAGAGATTCG

The sequence of the prepared serine RNA mutant is shown below. The underlined portion indicates an anticodon.
SEQ ID NO: 26: tRNA Ser (GCA1)
GGAAGUGUGGCCGAGCGGUUGAAGGCACCGGUCU GCA AAACCGGCGACCCGAAAGGGUUCCAGAGUUCGAAUCUCUGCGCUUCCGCCA
SEQ ID NO: 27: tRNA Ser (GCA2)
GGAAGUGUGGCCGAGCGGUUGAAGGCACCGGUUU GCA CCACCGGCGACCCGAAAGGGUUCCAGAGUUCGAAUCUCUGCGCUUCCGCCA

  Any of the above tRNAs can recognize two codons (UGU, UGC) of cysteine.

  A cell-free protein synthesis reaction was carried out in the same manner as in Example 5. However, as a tRNA variant, serine tRNA variant tRNA Ser (GCA1) in a concentration range of 0 μM, 0.25 μM, 1.0 μM, 2.8 μM, or serine tRNA variant tRNA Ser (GCA2) in 0 μM, 0.3 μM, 1.0 They were added in a concentration range of μM and 3.4 μM. The results are shown in FIG.

As is clear from FIG. 7, a band was detected at a position of an assumed molecular weight. Even when cysteine was not included as an amino acid, a trace amount of protein was synthesized by a small amount of cysteine that was not removed by dialysis (lane 2), but this production disappeared by addition of a cysteinyl tRNA synthetase inhibitor (lane). 3). It was further found that full-length translation products can be obtained by adding serine tRNA mutant tRNA Ser (GCA1) or tRNA Ser (GCA2) (lanes 4-6 and 7-9).
Therefore, in lanes 4 to 9, it is considered that serine was introduced instead of cysteine with respect to the cysteine codon of the protein.

Example 7 Cell-free translation reaction using a serine tRNA mutant from which lysine was removed Plasmid pSER (TTT) encoding a serine tRNA mutant was prepared in the same manner as in Example 6. However, TTT_SF (SEQ ID NO: 28) and Mut_SR (SEQ ID NO: 23) were used as primers.

Sequence number 28: TTT_SF
GTTGAAGGCACCGGTCTTTTAAACCGGCGACCCGAAAG

  Subsequently, a serine RNA mutant was prepared. The sequence of the prepared serine RNA mutant is shown below. The underlined portion indicates an anticodon.

SEQ ID NO: 29: tRNA Ser (UUU)
GGAAGUGUGGCCGAGCGGUUGAAGGCACCGGUCU UUU AAACCGGCGACCCGAAAGGGUUCCAGAGUUCGAAUCUCUGCGCUUCCGCCA

  This tRNA can recognize two codons (AAG, AAA) of lysine.

  A cell-free protein synthesis reaction was carried out in the same manner as in Example 4. However, serine tRNA mutant tRNA Ser (UUU) was added as a tRNA mutant in a concentration range of 0 μM, 0.3 μM, 1.0 μM, and 3.0 μM. The Ras protein coding sequence (SEQ ID NO: 10) was used as a template for protein synthesis. The results are shown in FIG. Lane 1 is a positive control containing all 20 amino acids.

  As is clear from FIG. 8, a band was detected at the position of the assumed molecular weight. Even when lysine was not included as an amino acid, a small amount of protein was synthesized by a small amount of lysine that was not removed by dialysis (lane 2), but this production was lost by addition of a lysyl tRNA synthetase inhibitor (lane). 3). Furthermore, it was found that a full-length translation product can be obtained by adding serine tRNA mutant tRNA Ser (UUU) (lanes 4 to 6). Therefore, in lanes 4 to 6, it is considered that serine was introduced instead of lysine with respect to the lysine codon of the protein.

FIG. 1 shows, as an example of an artificial genetic code table used in the production method of the present invention, a “genetic code table from which threonine is removed” in which alanine is associated with a codon of threonine instead of threonine. FIG. 2 is an SDS-PAGE showing the results of a cell-free translation reaction with threonine removed. FIG. 3 is an SDS-PAGE showing the results of a cell-free translation reaction according to Example 4 in which alanine was introduced instead of lysine with respect to the lysine codon. FIG. 4 is an SDS-PAGE showing the purification results of StAvM4 prepared by cell-free translation reaction. FIG. 5 shows the results of MALDI-TOF / MS mass spectrometry of the protein produced by the cell-free translation reaction according to Example 4 in which alanine was introduced instead of lysine with respect to the lysine codon. FIG. 6 is an SDS-PAGE showing the results of a cell-free translation reaction according to Example 5 in which alanine was introduced instead of cysteine with respect to the cysteine codon. FIG. 7 is an SDS-PAGE showing the results of a cell-free translation reaction according to Example 6 in which serine is introduced instead of cysteine with respect to the cysteine codon. FIG. 8 is an SDS-PAGE showing the results of a cell-free translation reaction according to Example 7 in which serine was introduced instead of lysine with respect to the lysine codon.

Claims (11)

In a method for producing a functional non-natural protein obtained by substituting a specific amino acid species with a natural amino acid other than the amino acid species,
a) a step of associating a nucleic acid portion having a base sequence reflecting a genotype with a protein portion which is a translation product of the nucleic acid portion , wherein the correspondence is (i) the specific amino acid species to be substituted A cell-free protein synthesis system, comprising: a suppressor tRNA corresponding to a codon for: (ii) a natural amino acid other than the amino acid species; and (iii) an inhibitor specific to an aminoacyl-tRNA synthetase for the specific amino acid species. Said step performed in
b) a step of selecting the mapping molecule obtained in the mapping step;
c) introducing the mutation into the nucleic acid portion of the mapping molecule obtained in the selection step; and d) amplifying the nucleic acid portion obtained in the mutation introduction step.   The method according to claim 1, further comprising the step of repeating steps a) to d) by subjecting the nucleic acid moiety obtained in step d) to step a).   The nucleic acid moiety is mRNA, and the step a) further comprises a nucleoside or nucleoside analog capable of linking a spacer to the 3 ′ end side of the mRNA and then covalently bonding to an amino acid on the 3 ′ end side of the linked body. Then, an mRNA conjugate is obtained; then, the mRNA conjugate is added to a cell-free protein synthesis system containing a suppressor tRNA corresponding to the particular amino acid species and a natural amino acid other than the particular amino acid species, and protein synthesis is performed. The production method according to claim 1 or 2, wherein the translation product of the mRNA conjugate is linked to the mRNA conjugate.   The production method according to claim 3, wherein the suppressor tRNA is an alanine tRNA mutant or a serine tRNA mutant.   The production method according to any one of claims 1 to 4, wherein the specific amino acid is threonine, lysine or cysteine.   The production method according to any one of claims 3 to 5, wherein the nucleoside or nucleoside analog is puromycin.   A method for site-specific modification of a functional non-natural protein, wherein the protein produced by the method according to claim 1 is used.   A method for site-specific immobilization of a functional non-natural protein, wherein the protein produced by the method according to any one of claims 1 to 6 is used.   A polynucleotide comprising a base sequence encoding the amino acid sequence of the protein produced by the method according to any one of claims 1 to 6, is prepared and used, and the amino acid sequence is maintained. A method for producing a functional non-natural protein.   A method for site-specific modification of a functional non-natural protein, wherein the protein produced by the method according to claim 9 is used.   A method for site-specific immobilization of a functional non-natural protein, wherein the protein produced by the method according to claim 9 is used.