JP5098008B2 - Novel P450 gene and useful isoquinoline alkaloid production using the same - Google Patents

Description

  The present invention relates to P450 that catalyzes a carbon-carbon coupling reaction present in an isoquinoline alkaloid biosynthesis system, a gene encoding the P450, and production of useful isoquinoline alkaloids using the P450.

  Cytochrome P450 (referred to herein as P450 in the specification and claims) is a hemoprotein that exists widely from bacteria to higher organisms, and its reactions are diverse. Higher plants produce secondary metabolites with extremely diverse chemical structures and physiological activities. Secondary metabolites are used as pharmaceuticals, coloring agents, and fragrances. It has been shown that many P450s are involved in the biosynthesis of secondary metabolites in plants.

  For example, P450 catalyzes the enzymatic reaction of a diverse range of chemically different substrates, including oxidative, peroxidative, and reductive metabolism of endogenous and xenobiotic substrates. In plants, P450 is involved in biochemical pathways involving the synthesis of plant products such as phenylpropanoids, alkaloids, terpenoids, lipids, cyanogenic glycosides, glucosinolates (Non-Patent Document 1). . Specific reactions catalyzed by P450 include demethylation, hydroxylation, epoxidation, N-oxidation, sulfooxidation; N-, S-, and O-dealkylation, desulfation, deamination, and Reduction of the azo, nitro, and N-oxide groups is known.

  Ouren, a medicinal plant, mainly produces seven types of isoquinoline alkaloids such as berberine, an antibacterial alkaloid. These seven products are considered to be biosynthesized via reticuline, which is an important intermediate product in the isoquinoline alkaloid biosynthesis system.

  P450s specific for the isoquinoline alkaloid biosynthesis system include CYP80A1, which catalyzes carbon-oxygen coupling, isolated from barberry plant, CYP80B1, which catalyzes hydroxylation reaction, isolated from Poppyaceae, Buttercup CYP719A1 and the like that catalyze the formation of a methylenedioxy ring isolated from the family Auren are known (see FIG. 1). However, P450 that catalyzes the carbon-carbon coupling reaction is not yet known.

  Due to the diversity of P450 enzymes, ie their different structure and function, research on P450 enzymes has been very difficult. Furthermore, cloning of the P450 enzyme has been at least partially blocked because these membrane-localized proteins are usually present in low amounts and are often unstable to purification.

On the other hand, magnoflorin, one of the isoquinoline alkaloids, is an isoquinoline alkaloid contained in bonito and auren and is known to have medicinal properties, but its production depends on extraction from natural products, Use is limited to crude drugs and the like (Patent Document 1).
JP-A-6-183983 Chapple, Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998, 49: 311-343

  An object of the present invention is to provide a novel gene encoding P450 that catalyzes a carbon-carbon coupling reaction.

  In order to solve the above-mentioned problems, the present inventor has been involved in a system for biosynthesis of aurene alkaloids by using a novel gene function analysis method and an EST library isolated from cultured aurene cells having a very high alkaloid biosynthesis ability. The new P450 gene was successfully isolated. The P450 catalyzes a carbon-carbon coupling reaction, and P450 that catalyzes such a reaction is the first to be isolated.

  That is, this invention provides the gene containing the polynucleotide which consists of a base sequence represented by sequence number 1. The sequence represented by SEQ ID NO: 1 is a region encoding P450 according to the present invention, that is, an open reading frame (ORF).

  In addition, the present invention hybridizes under stringent conditions with a polynucleotide comprising a sequence complementary to the polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 1, and catalyzes a carbon-carbon coupling reaction. Also included are genes comprising a polynucleotide encoding a P450 enzyme. In the present invention, stringent hybridization conditions refer to conditions of 0.2% SDS, 0.2 × SSC, 65 ° C. or hybridization / washing conditions of stringency equivalent thereto.

  The present invention also includes a nucleotide sequence comprising one or several bases or base pairs deleted, substituted or added in a polynucleotide comprising the base sequence represented by SEQ ID NO: 1, and a carbon-carbon cup. Also included are genes comprising a polynucleotide encoding a P450 enzyme that catalyzes the ring reaction. Here, “one or several bases or base pairs are deleted, substituted or added” means substitution, deletion, insertion and / or addition by a known mutagenesis method such as site-directed mutagenesis. It means that as many bases as possible are substituted, deleted, inserted and / or added.

  The present invention also provides a polynucleotide encoding a P450 enzyme that exhibits 85% or more homology at the nucleotide level with a polynucleotide comprising the base sequence represented by SEQ ID NO: 1 and catalyzes a carbon-carbon coupling reaction. Genes containing are also included. The homology is preferably 90% or more, more preferably 95% or more and 97% or more. Sequence identity can be determined by FASTA search (Pearson W.R. and D.J. Lipman (1988) Proc. Natl. Acad. Sci. USA. 85: 2444-2448) or BLASTN search.

  The gene provided by the present invention is a plant having the ability to produce isoquinoline alkaloids, for example, Poppyaceae plants such as Hanabiso, poppy and Engosac, Barberry plants such as barberry, Citrus plants such as yellowfin, and magnoliaceae such as Kobushi It is preferably derived from a plant, an isoquinoline alkaloid-producing plant such as a cloveaceae plant such as a scallop, and a buttercup plant such as abalone, and more preferably derived from Coptis japonica.

  The present invention also provides a protein encoded by the above gene provided by the present invention.

The present invention provides the following protein (a) or (b):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 2,
(B) It consists of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and has the activity of a P450 enzyme that catalyzes a carbon-carbon coupling reaction. protein.

  In the present invention, “deletion, substitution or addition of one or several amino acids” can be replaced, deleted, inserted and / or added by a known mutant protein production method such as site-directed mutagenesis. It means that a certain number of amino acids are substituted, deleted, inserted and / or added. Further, the “mutation” here means a mutation artificially introduced mainly by a known method for producing a mutant protein, but may be a product obtained by isolating and purifying a similar naturally occurring mutant protein.

Furthermore, the present invention provides the following protein (a) or (c):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 2,
(C) a protein having 60% or more homology at the amino acid level with a protein comprising the amino acid sequence represented by SEQ ID NO: 2 and having a P450 enzyme activity that catalyzes a carbon-carbon coupling reaction.
Here, the homology is preferably 70% or more, more preferably 80% or more, 90% or more, or 95% or more. As described above, sequence identity can be determined by FASTA search (Pearson WR and DJ Lipman (1988) Proc. Natl. Acad. Sci. USA. 85: 2444-2448) or BLASTP search.

  The present invention also provides a gene encoding the protein.

  The present invention also provides a recombinant vector comprising the gene provided by the present invention, as well as a host cell comprising the gene or the recombinant vector. Examples of host cells transformed with the gene or recombinant vector include Escherichia coli, yeast, plant cells, insect cells and the like, and preferably yeast and plant cells having an isoquinoline alkaloid biosynthesis pathway. Specific examples of the plant having an isoquinoline alkaloid biosynthetic pathway transformed according to the present invention include Poppyaceae plants such as Hanabiso, poppy and Engosac, Barberry plants such as barberry, Citrus plants such as yellowfin, Kobushi etc. , And isoquinoline alkaloid-producing plants such as the buttercup family such as Aurelia, and the like, preferably Aureen.

  The vector carrying the gene according to the present invention includes pUC, pBluescript and pET21 expression vectors when using E. coli as the host, pGYR and pFLD when using yeast, and pBIE when using plants. In the case of using an insect vector or an insect cell, a baculovirus expression vector pACκCH3 and the like can be mentioned.

  The P450 enzyme of the present invention catalyzes a carbon-carbon coupling reaction, and examples of such a reaction include a conversion reaction from reticuline to colituberin.

Furthermore, the present invention includes a step of culturing a host cell containing a recombinant vector containing the gene of the present invention, and
Expressing the protein of the present invention in the host cell,
A method for producing a P450 protein according to the present invention is provided.

  In the method, preferred host cells are the same as those described above. For the purpose of producing the protein of the present invention, Escherichia coli, yeast, and insect cells can be mentioned, and host cells themselves or fractions thereof (for example, microsomes). In order to use the fraction) for the enzymatic reaction as it is, yeasts into which NADPH-P450 reductase has been introduced, insect cells and plants having NADPH-P450 reductase endogenously can be mentioned.

  As a method for introducing a recombinant vector containing the gene of the present invention into a host cell, heat shock method, electroporation method, etc. when the host cell is Escherichia coli, LiCl method when yeast is used, and insect cell Includes viral transfection.

  The step of expressing the protein can be achieved, for example, by linking a constitutive promoter upstream of the P450 gene to be introduced, or by linking to an inducible promoter and inducing the promoter.

  The present invention also provides a method for producing colituberin, which comprises the step of converting Pt of the present invention as a catalyst to convert reticuline as a substrate into colituberin.

The present invention further comprises a step of converting Pt of the present invention as a catalyst to convert reticuline as a substrate into colituberin, and
A step of acting as a catalyst with coclaurine-N-methyltransferase and converting the substrate coritubberin into magnoflorin,
A method for producing magnoflorin is provided.

  In the present invention, “the step of converting Pt as a substrate by allowing P450 to act as a catalyst” expresses NADPH-P450 reductase necessary for the expression of P450 and P450 activity, for example, as described in the Examples. This can be done by adding reticuline from outside the cells to yeast. Moreover, it can also carry out by adding a reticuline to the microsome fraction prepared from this microbial cell. Furthermore, the P450 of the present invention expressed by a desired host such as Escherichia coli is purified to obtain an enzyme preparation, and reticuline as a substrate is added to the enzyme preparation in the presence of NADPH-P450 reductase. Can also be done.

  For example, as a method for recovering Kollituberin when yeast cells are used, a method of recovering a buffer in which the cells are suspended, adsorbing alkaloid through Sep-pak, and eluting with MeOH can be mentioned.

  Whether or not the reaction product generated from reticuline is colituberin can be confirmed by any means known to those skilled in the art. Specifically, it can be identified by subjecting the reaction product and the Koltsberine preparation to LC-MS and comparing the obtained spectra. Moreover, it can confirm also by the comparison by the NMR analysis of a reaction product and a Kollituberin sample.

  Magnoflorin can be obtained by subjecting the obtained reaction product to a further “step of converting coligberin, which is a substrate into magnoflorin, by using coclaurin-N-methyltransferase as a catalyst”. Such a step can be performed by adding the purified coclaurine-N-methyltransferase (CNMT) expressed in E. coli or the like to the above reaction product, or in a culture solution containing the above reaction product, It can also be carried out by culturing E. coli retaining CNMT. For example, when E. coli is used, magnoflorin can be recovered from the medium.

  Thus, whether or not the reaction product generated from colituberin is magnoflorin can be confirmed by any means known to those skilled in the art. Specifically, the reaction product and the magnoflorin sample can be identified by subjecting them to LC-MS and comparing the obtained spectra. Moreover, it can confirm also by the comparison by the NMR analysis of a reaction product and a magnoflorin sample.

  Whether or not the above-mentioned polynucleotide is a “polynucleotide encoding a P450 enzyme that catalyzes a carbon-carbon coupling reaction”, together with a polynucleotide encoding NADPH-P450 reductase necessary for the expression of the activity of P450 of the present invention. A polynucleotide whose activity of the expression product should be confirmed is co-introduced into a host cell that does not have the ability to produce isoquinoline alkaloids, that is, does not contain endogenous isoquinoline alkaloids, such as yeast, or the host cell itself or the host Reticuline is added as a reaction substrate to a microsomal preparation of cells or a preparation containing the desired expression product isolated and purified from the host cell and NADPH-P450 reductase, and the resulting reaction product contains colituberin. This can be determined by examining the above. Whether or not the obtained reaction product is colituberin can be determined by subjecting the Kollituberin preparation and the reaction product to a known analysis such as LC-MS and confirming that they are the same substance.

  Similarly, whether the above protein is “a protein having the activity of a P450 enzyme that catalyzes a carbon-carbon coupling reaction” is determined by adding reticuline as a reaction substrate to the protein preparation in the presence of NADPH-P450 reductase. In the same manner as described above, it can be determined by examining whether the reaction product is colituberin.

  In the present invention, by isolating and analyzing a novel P450 gene from genetic analysis of auren cells having high alkaloid biosynthesis activity, the P450 undergoes a reaction called carbon-carbon coupling in an isoquinoline alkaloid biosynthesis system. It was found to be a novel P450 to catalyze. The novel P450 of the present invention catalyzes the conversion of reticuline, an important intermediate in the isoquinoline alkaloid biosynthesis system, to colituberin. Recently, it has been revealed that colituberin has an inhibitory action on malonyl-CoA acyl carrier protein transacylase essential for the survival of H. pylori.

  In addition, colituberin produced by the P450 of the present invention is converted to magnoflorin, which is expected to have medicinal properties, by the catalytic action of coclaurine-N-methyltransferase (CNMT) that has already been isolated and identified by the present inventors. The Since isoquinoline alkaloids exhibit a very wide range of medicinal effects, the use of the gene of the present invention raises the possibility of new drug discovery.

About Gene According to the Present Invention The present invention provides a gene encoding a novel P450 that catalyzes a carbon-carbon coupling reaction.
The base sequence shown in SEQ ID NO: 1 is a coding region of cDNA that has been identified and sequenced based on sequencing and homology search of clones from an EST library derived from Coptis japonica.

  The gene encoding P450 according to the present invention is preferably an ORF consisting of a polynucleotide consisting of the base sequence shown in SEQ ID NO: 1. However, any gene may be used as long as a portion corresponding to this portion is included. . For example, the gene consisting of SEQ ID NO: 3 obtained by adding 5 ′ and 3 ′ UTR to the ORF is also included in the present invention. The polynucleotide consisting of the base sequence shown in SEQ ID NO: 1 can be obtained from a cDNA library prepared from ouren producing isoquinoline alkaloids.

  The polynucleotide consisting of the base sequence shown in SEQ ID NO: 1 was confirmed to be an ORF encoding a novel P450. The P450 catalyzes a carbon-carbon coupling reaction in the presence of NADPH-P450 reductase. Specifically, the P450 couples two carbons of reticuline, which is an important intermediate product of the isoquinoline alkaloid biosynthesis system, to produce colituberin (see FIG. 6). So far, no P450 gene has been known to catalyze the carbon-carbon coupling reaction in the isoquinoline alkaloid biosynthesis system, and by using P450 of the present invention, magnoflorin, an important product of the isoquinoline alkaloid biosynthesis system, has been known. Large-scale production can be expected.

  The present invention also includes a gene encoding a protein functionally equivalent to the protein acting as P450 described in SEQ ID NO: 2. Here, “functionally equivalent to the protein acting as P450” means that the target protein has the same biological function as the protein described in SEQ ID NO: 2, that is, a function of catalyzing a carbon-carbon coupling reaction, for example, It has a function of catalyzing the conversion reaction from reticuline to colituberin.

  Examples of the gene of the present invention include mutants, derivatives, and the like that encode a protein comprising an amino acid sequence in which one or several amino acids are substituted, deleted, added and / or inserted in the amino acid sequence shown in SEQ ID NO: 2. Alleles, variants and homologs are included.

  Methods well known to those skilled in the art for preparing genes encoding proteins with altered amino acid sequences include, for example, site-directed mutagenesis (Kramer, W. & Fritz, H.-J. Methods in Enzymology, 154: 350-367 (1987)). In addition, the amino acid sequence of the encoded protein may be mutated in nature due to the mutation of the base sequence. Thus, even a gene encoding a protein having an amino acid sequence in which one or several amino acids are substituted, deleted or added in the amino acid sequence encoding the natural P450 (SEQ ID NO: 2) of the present invention, So long as it encodes a protein having a function equivalent to P450 of the type (SEQ ID NO: 2), it is included in the gene of the present invention. Moreover, even if the base sequence is mutated, it may not be accompanied by a mutation of an amino acid in the protein (degenerate mutation), and such a degenerate mutant is also included in the gene of the present invention. The number of base mutations in the DNA constituting the gene of interest is typically within 100 amino acids, preferably within 50 amino acids, more preferably within 20 amino acids, and even more preferably within 10 amino acids (for example, Within 5 amino acids, within 3 amino acids).

  The method for obtaining the gene is not particularly limited, and a general method is employed. For example, the gene may be excised from a genomic DNA or cDNA library of an organism having the gene with an appropriate restriction enzyme and purified. That is, the gene encoding P450 of the present invention includes genomic DNA, cDNA, and chemically synthesized DNA. Preparation of genomic DNA and cDNA can be performed by those skilled in the art using conventional means. For genomic DNA, for example, genomic DNA is extracted from the target organism, a genomic library (plasmids, phages, cosmids, BACs, PACs, etc. can be used as vectors) is developed and expanded, It can be prepared by performing colony hybridization or plaque hybridization using a probe prepared based on DNA encoding the protein (SEQ ID NO: 1).

  It is also possible to prepare a primer specific for the DNA (SEQ ID NO: 1) encoding P450 of the present invention and perform PCR using this primer. In addition, for example, cDNA is synthesized based on mRNA extracted from a target organism, inserted into a vector such as λZAP to create a cDNA library, developed, and colony-high as described above. It can be prepared by performing hybridization or plaque hybridization, or by performing PCR.

  Examples of the organism having the above gene include plants having the ability to produce isoquinoline alkaloids, for example, poppy family plants such as red sand, poppy and engosac, buttercups such as auren, barberry plants such as barberry, and vines such as Japanese oak And isoquinoline alkaloid-producing plants such as citrus family plants, citrus family plants such as yellowfin, and magnoliaceae plants such as kobushi. Among these, the target gene can be more reliably isolated by using an aurene cultured cell having high isoquinoline alkaloid productivity.

  The DNA encoding P450 of the present invention can be used for mass production of colituberin, for example, by introducing it into a host cell such as yeast together with DNA encoding NADPH-P450 reductase. In addition, it is considered that coclavulin-N-methyltransferase (CNMT), which is an enzyme that uses the reaction product, colituberin as a substrate, can be used for mass production of magnoflorin by acting on colituberin. CNMT has been isolated and identified by the present inventors and has been found to be expressed in hosts such as E. coli.

Next, the method for acquiring P450 of the present invention will be described.
Specifically, when acquiring P450 of the present invention from a plant in which at least a part of EST or genome is stored in a database, a base sequence having homology based on the base sequence of the polynucleotide is extracted from the database. Just search. For example, a base sequence homology search using BLASTN, which is a widely used homology search algorithm, can be preferably used.

  Further, in the case of a plant whose EST or genome is not stored in a database, for example, a hybridization method using a conventionally known DNA library can be used. Specifically, a step of preparing a genomic library or cDNA library from a target plant using an appropriate cloning vector, hybridization is performed using at least a part of the polynucleotide as a probe, and the library And a step of detecting a positive fragment for the probe. Thus, the gene according to the present invention is also useful as a probe. The region used for the probe preferably contains a sequence specific to the target gene. The length of the polynucleotide used as the probe is preferably 100 bp or more.

  More specifically, a method well known to those skilled in the art for preparing a gene encoding a protein functionally equivalent to P450 described in SEQ ID NO: 2 includes a hybridization technique (Southern, EM Journal of Molecular Biology, 98, 503 (1975)) and polymerase chain reaction (PCR) technology (Saiki, RK et al. Science, 230, 1350-1354 (1985), Saiki, RK et al. Science, 239,487-491 (1988) ) Is used. Thus, a gene encoding a protein having a function equivalent to that of P450 of the present invention that can be isolated by a hybridization technique or a PCR technique is also included in the gene of the present invention.

  In order to isolate such a gene, the hybridization reaction is preferably carried out under stringent conditions. In the present invention, stringent hybridization conditions refer to hybridization / washing conditions of 0.2% SDS, 0.2 × SSC, 65 ° C. or equivalent stringency as described above. By using conditions with higher stringency, for example, 0.2% SDS, 0.1 × SSC, 65 ° C., efficient isolation of genes with higher homology can be expected. The isolated gene is considered to have high homology with the amino acid sequence (SEQ ID NO: 2) of the protein of the present invention at the amino acid level encoded by the gene. High homology refers to sequence identity of at least 60% or more, more preferably 70% or more, more preferably 80% or more (eg, 90% or more) in the entire amino acid sequence. Sequence identity can be determined by FASTA search (Pearson W.R. and D.J. Lipman (1988) Proc. Natl. Acad. Sci. USA. 85: 2444-2448) or BLASTP search.

  Whether a gene encodes a protein having a function as P450 of the present invention is determined by, for example, preparing a microsomal fraction from yeast cells into which the gene of interest is introduced together with NADPH-P450 reductase as described in the Examples. This can be determined by adding reticuline, which is a substrate of P450 of the present invention, to the microsomal fraction and identifying whether the reaction product is colituberin. Alternatively, it may be determined by adding reticuline to a suspension containing yeast cells into which the gene of interest has been introduced together with NADPH-P450 reductase, and confirming whether or not colituberin is produced in the suspension. I can do it. Alternatively, by expressing the gene of interest in a suitable host cell and adding reticuline to the isolated and purified enzyme preparation in the presence of NADPH-P450 reductase, it is determined by identifying whether to produce corituberin You can also.

  The method for identifying whether a product is colituberin is identified by analyzing the colisberine preparation and the product by LC-MS, LC-NMR, etc., and determining whether the result is the same product. I can do it.

About the protein according to the present invention The protein according to the present invention comprises a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 encoded by the above gene or one or several amino acids in the amino acid sequence represented by SEQ ID NO: 2. A protein consisting of a deleted, substituted or added amino acid sequence and having the activity of a P450 enzyme that catalyzes a carbon-carbon coupling reaction, or a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 at the amino acid level It is a protein that exhibits a homology of 60% or more and has the activity of a P450 enzyme that catalyzes a carbon-carbon coupling reaction.

  In addition, the protein according to the present invention may contain a known additional sequence such as HA or Flag at the end or may be a fusion protein in order to easily purify and detect the protein. Further, it may be subjected to various modifications such as N-glycosylation.

  The recombinant vector according to the present invention has the above gene incorporated therein. The above-described vector can be expressed into a host by a known transformation method so that the gene or gene fragment incorporated in the host can be expressed to obtain the protein according to the present invention. The protein according to the present invention may be obtained by recombinant production as described below, or may be isolated and purified from a plant, and its origin is not particularly limited.

  When preparing a recombinant protein, the gene encoding the protein of the present invention is usually inserted into an appropriate expression vector, the vector is introduced into an appropriate host cell, and the transformed host cell is cultured and expressed. Purify the protein. The recombinant protein can be expressed as a fusion protein with another protein for the purpose of facilitating purification or the like. For example, a method for preparing a fusion protein with maltose binding protein using E. coli as a host (vector pMAL series released by New England BioLabs, USA), a method for preparing a fusion protein with glutathione-S-transferase (GST) (Amersham Pharmacia Biotech Vector pGEX series released by the company), a method of preparing by adding a histidine tag (pET series from Novagen), etc. can be used. The host cell is not particularly limited as long as it is a cell suitable for the expression of a recombinant protein. In addition to the above-mentioned E. coli, for example, fungal cells such as yeast, various animal and plant cells, insect cells and the like can be used. . In particular, a yeast expression system is preferable because a vector having a NADPH-P450 reductase gene can be used and handling is easy.

  Various methods known to those skilled in the art can be used to introduce a vector into a host cell. For example, for introduction into E. coli, introduction methods using calcium ions (Mandel, M. & Higa, A. Journal of Molecular Biology, 53, 158-162 (1970), Hanahan, D. Journal of Molecular Biology, 166 557-580 (1983)). Examples of introduction into yeast include the lithium chloride method (Ito H, Fukuda Y, Murata K & Kimura A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153, 163-168.). The recombinant protein expressed in the host cell can be purified and recovered from the host cell or its culture supernatant by methods known to those skilled in the art. When the recombinant protein is expressed as a fusion protein with the above-described maltose-binding protein, affinity purification can be easily performed.

  If the obtained recombinant protein is used, an antibody that binds to the protein can be prepared. For example, a polyclonal antibody can be prepared by immunizing an immunized animal such as a rabbit with the purified protein of the present invention or a partial peptide thereof, collecting blood after a certain period, and removing the blood clot. is there. Monoclonal antibodies can be obtained by fusing the antibody-producing cells of animal immunized with the above protein or peptide and bone tumor cells, isolating single clone cells (hybridomas) that produce the desired antibody, and proliferating the cells. And obtaining antibodies from the cells. The antibody thus obtained can be used for purification and detection of the protein of the present invention. The present invention includes antibodies that bind to the proteins of the present invention.

  The protein of the present invention acts as P450 involved in isoquinoline alkaloid biosynthesis and is very useful in itself. Furthermore, these proteins and genes encoding these proteins can be used to modify isoquinoline alkaloid biosynthesis systems.

Transformant When producing a transformant that expresses the gene of the present invention, the gene is inserted into an appropriate vector and introduced into a target host cell.

  The transformant according to the present invention is a transformant into which the above gene, which is contained in a recombinant vector, is introduced as desired. More specifically, the transformant according to the present invention is one into which a gene encoding P450 according to the present invention has been introduced. Here, “a gene or a recombinant vector has been introduced” means that a gene incorporated into the vector as desired in a host is expressed by, for example, the action of a promoter, by a known genetic engineering technique (gene manipulation technique). It means to be introduced as possible.

  The transformant according to the present invention can be obtained by introducing the gene directly or by introducing a vector incorporating the gene into a host. The host is not particularly limited, and examples thereof include prokaryotes such as Escherichia coli, fungi such as yeast, plants, and insect cells. As described in the Examples, yeast is preferred as the host cell. Further, since the gene incorporated into the vector is derived from a kind of plant, auren, a plant is also preferable as the host. Isoquinoline alkaloid-producing cells are particularly preferred, such as the buttercup family such as barberry, the barberry family such as barberry, the rosaceae family such as giant oak, the citrus family plant such as yellowfin, the magnolic family plant such as beetle. The transformation may be transient, but preferably the gene is stably integrated.

  The gene of the present invention is a promoter that can be expressed in a host cell, such as a Lac promoter in E. coli, a GAPDH promoter or alcohol oxidase promoter in yeast, a cauliflower mosaic virus 35S promoter in plant cells, a baculovirus promoter in insect cells, etc. Used in connection with the downstream area. When the host cell does not have the endogenous NADPH-P450 reductase gene, it is necessary to introduce the gene in order to exert the P450 activity of the present invention in the host cell. In insect cells, even if NADPH-P450 reductase is not introduced, the activity can be detected only with endogenous NADPH-P450 reductase. If the activity is low in yeast, only endogenous NADPH-P450 reductase can be detected. Activity can be detected.

  As a method for producing a transformant containing the transformed host cell, specifically, for example, a polyethylene glycol method, an electroporation method (electroporation), an Agrobacterium-mediated method, a particle gun method, etc. Various known methods can be used. For example, as a method for producing a transformed plant, a method of regenerating a plant by introducing a gene into a protoplast with polyethylene glycol (Datta, SK (1995) In Gene Transfer To Plants (Potrykus I and Spangenberg Eds.) Pp66-74 ), Gene transfer to protoplasts by electric pulse to regenerate plants (Toki et al (1992) Plant Physiol. 100, 1503-1507), gene directly introduced to cells by particle gun method to regenerate plants (Christou et al. (1991) Bio / technology, 9: 957-962.) And a method of introducing a gene through Agrobacterium to regenerate a plant (Hiei et al. (1994) Plant J. 6: 271-282.) And the like, but not particularly limited. Moreover, it is preferable that the transformation method is appropriately selected according to the type of organism serving as a host. That is, for example, when the host is yeast, the lithium chloride method is preferred.

As vectors that can be used in the present invention, vectors conventionally used for transformation of bacteria, fungi and the like, for example, pUC, pBluescript, pET system for bacteria, pGYR, pFLD for yeast PBI121 can be mentioned for plants such as pYES2. The vector is a constitutive promoter for expressing a conventionally known gene in addition to the gene or a fragment thereof, such as GAPDH promoter or cauliflower mosaic virus 35S promoter, or an expression inducible promoter such as Lac promoter, It preferably contains an alcohol oxidase promoter and a drug resistance gene that facilitates selection of transformants, such as ampicillin or kanamycin, hygromycin resistance gene.
In the case where the host cell does not have the endogenous NADPH-P450 reductase gene, it is preferable to use a vector containing the gene in order to exert the activity of P450 of the present invention in the host cell.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not restrict | limited to these Examples.

Creation of EST library The EST library was prepared as described in JP-A No. 2004-121233. This will be briefly described below.
(1) Isolation of ESTs and comprehensive nucleotide sequencing 156 High-berberine production strain of Coptis japonica cultured cells that have been established and maintained for many years in the omnipotent regulatory mechanism laboratory of the Graduate School of Life Sciences, Kyoto University MRNA was extracted from -1 strain (selected strain) by the method described in the conventional literature (Choi, et al., J. Biol. Chem, 277: 830-835, 2002).

  In addition, the berberine high production strain 156-1 of the aurene is disclosed in JP-A-11-178579, JP-A-11-178579, and F. Sato, and Y. Yamada, Phytochemistry, 23 (2): 281. -385 (1984) can also be used for the production and selection. Then, the cDNA reverse-transcribed from the mRNA using SuperScriptII Reverse transcriptase (Invitrogen) is subcloned into the pDR196 (D. Rentsch et al., FEBS Lett. 370: 264-268 (1995)) vector, and then randomly selected. The base sequence of about 5,000 clones was determined using the Megabase system (Amersham Pharmacia).

Selection of P450 gene from EST library As a result of subjecting the clones whose base sequence was determined to homology search using BlastX and GENETYX-MAC, 30 sequences including overlapping ones encoded P450. Among them, characteristic features included those having high homology with CYP80A1 of barberry plant, Berberis stolonifera (53% according to amino acid sequence homology). This was called CYP80A1like. The base sequence of CYP80A1like ORF is shown in SEQ ID NO: 1, the deduced amino acid sequence is shown in SEQ ID NO: 2, and the base sequence obtained by adding 5 'and 3' UTR to ORF is shown in SEQ ID NO: 3.

Construction of construct for yeast expression system
In order to produce a recombinant protein using a yeast expression system for CYP80A1like and measure its activity, a plasmid in which the target gene was introduced into a yeast expression system plasmid was constructed.

  First, the CYP80A1like gene was amplified by PCR using the aurethane cultured cell cDNA as a template, and once incorporated into pT7Blue T-vector for sequence confirmation, then pGYR (T. Sakaki et al., J. Biol. Chem., 267 : 16497-16502 (1992) was modified and introduced into the Spe I site of pGYR-SpeI (see FIG. 2), specifically, the following procedure was followed.

(a) cDNA synthesis of Aureen cultured cell 156-1 strain Total RNA from about 500 mg of Auren cultured cell 156-1 strain (5 days after transplanting) using RNeasy plant kit (QIAGEN) according to the manufacturer's instructions Was extracted. Of the obtained total RNA, 1.3 μg was used to perform cDNA synthesis by performing reverse transcription using SUPERSCRIPT ™ II RNase H ^- Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions.

(b) Amplification of CYP80A1like gene
The full-length CYP80A1like gene was amplified by PCR using the aurene cultured cell cDNA prepared in (a) as a template. KOD-plus- (TOYOBO) was used as the DNA polymerase. The reaction solution composition was subjected to PCR according to the manufacturer's instructions under the following primers and conditions.

Primer forward ACTAGTTTCAGAACCAAGGATAGAGATTTCAAATGG (SEQ ID NO: 4)
Reverse ACTAGTAAAACGTGAAATTTCTTATTGCCGCAAC (SEQ ID NO: 5)

PCR conditions Denaturation 94 ° C 2 minutes
25 cycles 94 ° C 15 seconds, 55 ° C 30 seconds, 68 ° C 1 minute 45 seconds Final extension 68 ° C 4 minutes

  As a result of electrophoresis of the PCR product on a 1% agarose gel, amplification specific to the target size (about 1.5 kb) was observed. (Hereinafter, electrophoresis on a 1% agarose gel is simply referred to as electrophoresis).

(c) Preparation of insert fragment
DATP was added to the CYP80A1like amplification product amplified with KOD-plus- using Go Taq (trademark) DNA polymerase. Specifically, CYP80A1-like PCR products were ethanol precipitated and dissolved in 6 μl of sterile water. 2 μl of 5 × PCR buffer attached to Go Taq ™ DNA polymerase, 1 μl of dATP (2 mM), and 1 μl of Go Taq ™ DNA polymerase were added to each solution to make a total of 10 μl. Then, it was made to react at 72 degreeC for 30 minutes, and dATP was added to the PCR product.

(e) Ligation and transformation Mix the insert (CYP80A1like fragment) and vector (pT7Blue T-vector), add an equal volume of DNA Ligation Kit Ver. 2 (TaKaRa) solution I, and react at 16 ° C for 1 hour. It was. Thereafter, E. coli DH5α strain was transformed using the heat shock method and developed on an LB plate (containing 50 μg / ml ampicillin).

(f) Selection of insert-introduced clones by colony PCR Several E. coli colonies obtained were selected, and colony PCR was performed using them as templates. PCR was performed under the following conditions using Go Taq (trademark) DNA polymerase (Promega) as a DNA polymerase and using M13-M4 primer and M13-Rv primer.
PCR conditions Denaturation 98 ° C 5 min
30 cycles 94 ° C 30 seconds, 50 ° C 30 seconds, 72 ° C 2 minutes Final extension 72 ° C 4 minutes
After PCR, electrophoresis was performed to obtain several clones in which specific amplification was observed at the expected size (about 1.6 kb).

(g) Confirmation of the base sequence of the insert-introduced clone
Sequencing was performed to confirm that the insert sequence of the clone obtained in (f) did not contain any mutation due to PCR. First, the E. coli colony obtained in (f) was inoculated into 5 ml of LB medium (containing 100 μg / ml of ampicillin), and cultured with shaking at 37 ° C. and 200 rpm for 16 hours. Thereafter, the plasmid was extracted using Wizard (registered trademark) Plus SV Minipreps DNA Purification System (Promega), and the plasmid concentration was measured using absorbance at 260 nm to obtain template DNA. The cycle sequencing reaction was performed using Thermo Sequenase fluorescent labeled primer cycle sequencing kit (Amersham Biosciences). The template DNA was equivalent to 1.0 pmol, and the primers were FITC-labeled M13-M4 primer and M13-Rv primer. The operation was performed according to the manufacturer's instructions, and the annealing temperature was 50 ° C.

  As a result of sequencing, it was confirmed that the CYP80A1like insert had the correct sequence.

(h) Preparation of sequence confirmed CYP80A1like insert fragment
About 1 μg of the plasmid whose base sequence was confirmed in (g) was treated with SpeI at 37 ° C. for 1 hour, and after electrophoresis, the CYP80A1like gene fragment was excised from the gel. Insert fragments were prepared from the excised gel using Wizard (registered trademark) SV Gel and PCR Clean-Up System (Promega).

(i) Preparation of pGYR vector fragment
pGYR was treated with SpeI at 37 ° C. for 1 hour, and after electrophoresis, a band of the desired size (about 12 kb) was cut out. Thereafter, a vector fragment was prepared using Wizard (registered trademark) SV Gel and PCR Clean-Up System (Promega).

(j) Ligation and transformation
After confirming by electrophoresis the concentration of the CYP80A1like insert fragment obtained in (h) and the pGYR-SpeI vector fragment prepared in (i), mix so that the ratio is about 1: 3 to 1:10, etc. An amount of DNA Ligation Kit Ver. 2 (TaKaRa) solution I was added, and the reaction was performed at 16 ° C. for 1 hour. Thereafter, E. coli DH5α strain was transformed using the heat shock method and developed on an LB plate (containing 50 μg / ml ampicillin).

(k) Selection of insert-introduced clones by colony PCR Several E. coli colonies obtained were selected, and colony PCR was performed using them as templates. As the DNA polymerase, Go Taq ™ DNA polymerase was used. As the primers, M13-M4 primer and the above CYP80A1like forward primer (SEQ ID NO: 4) were used. PCR was performed under the following conditions.
PCR conditions Denaturation 98 ° C 5 min
30 cycles 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 2 minutes 30 seconds Final extension 72 ℃ 4 minutes
After PCR, electrophoresis was performed to obtain several clones in which specific amplification was observed at the expected size (about 2.4 kb).

(l) Extraction of plasmid from insert-introduced clone
The E. coli colony obtained in (k) was inoculated into 5 ml of LB medium (containing 100 μg / ml of ampicillin), followed by shaking culture at 37 ° C. and 200 rpm for 16 hours. Thereafter, the plasmid was extracted using the alkaline SDS method. Then, a part thereof was treated with SpeI at 37 ° C. for 1 hour and electrophoresed to confirm the introduction of the insert again.

Activity measurement of CYP80A1like using yeast expression system
A plasmid for expression of CYP80A1like yeast (FIG. 2) was transformed into yeast, and after cultivation, a microsomal fraction in which CYP80A1like was considered to be localized was prepared and its activity was confirmed. Each reaction product was identified by LC-MS analysis. Specifically, the following procedure was followed.

(a) Transformation of yeast expression plasmid into yeast For expression, yeast (Saccharomyces cerevisiae) AH22 strain was used. The AH22 strain can biosynthesize all essential amino acids except L-histidine and L-leucine. Since pGYR has an L-leucine synthesis gene (LEU2), when L-histidine is added to the medium, only yeasts with plasmids can grow.

  The CYP80A1like expression construct was transformed into the yeast AH22 strain by the lithium chloride method. The protocol is shown below.

(Transformation protocol to yeast)
·material
YPD medium: 1% yeast extract, 2% polypeptone, 2% glucose
SD plate: 2% glucose, 0.67% N-base w / o amino acid, 1.5% agar, 20 μg / ml L-histidine
0.2M LiCl: 10ml (filter sterilization)
1M LiCl: 10ml (filter sterilization)
70% (w / v) PEG 4000: 10ml (After dissolution, make up to 10ml)
·Method
1. S. cerevisiae AH22 strain 1.0 × 10 ⁷ cells were used.
2. Centrifugation was performed at 13,000 rpm for 4 minutes using a tabletop centrifuge, and the supernatant was discarded.
3. The pellet was washed with 0.2M LiCl (slightly vortexed).
4. Centrifugation was performed at 13,000 rpm for 4 minutes using a tabletop centrifuge, and the supernatant was completely removed.
5. The pellet was suspended in 20 μl of 1M LiCl by pipetting.
6. 10 μl of DNA (plasmid) solution (containing 1 μg of plasmid) was added.
7. 30 μl of 70% (w / v) PEG 4000 was added and mixed well by pipetting.
8. Incubated at 30 ° C for 1 hour.
9. 140 μl of sterilized water was added, developed on an SD plate, and incubated at 30 ° C.
10. The cells were cultured on an SD plate at 30 ° C. for 3 days to obtain several colonies having a size of about 3 to 5 mm.

(b) Culture of recombinant yeast and preparation of microsomal fraction
The CYP80A1like colony obtained in (a) was inoculated into 5 ml of concentrated SD medium (8% glucose, 5.4% N-base w / o amino acid, 160 μg / ml L-histidine). The concentrated SD medium used for recombinant yeast culture is more concentrated than the SD medium normally used for yeast culture, in order to obtain as many cells as possible with a small amount of medium. The yeast inoculated in the concentrated SD medium was cultured at 30 ° C. and 220 rpm until the culture became completely cloudy, and further transferred to 5 ml × 4 concentrated SD medium. After the culture became completely cloudy, it was further transferred to a 500 ml Erlenmeyer flask containing 300 ml of concentrated SD medium and anaerobically cultured. The culture was continued until the bacterial cell concentration finally reached 1.0 to 1.2 × 10 ⁸ cells / ml, and the following microsomal fraction was prepared.

(Preparation of microsome fraction)
・ Reagents Zymolyase buffer: 10 mM Tris-HCl, 2 M sorbitol, 0.1 mM DTT, 0.1 mM EDTA, pH 7.5
Sonication buffer: 10 mM Tris-HCl, 0.65 M sorbitol, 0.1 mM DTT, 0.1 mM EDTA, pH 7.5
・ Method (300ml culture medium)
1. The yeast cells were centrifuged at 8,000 × g for 10 minutes at 4 ° C. (6,000 rpm using HITACHI high-speed cooling centrifuge, rotor RPR9-2).
2. The cells (precipitate) were washed with 100 ml of distilled water.
Centrifugation was performed at 3.4 ° C. and 8,000 × g for 10 minutes (6,000 rpm using HITACHI high-speed cooling centrifuge, rotor RPR9-2).
4. The cells (precipitate) were washed with 25 ml of zymolyase buffer.
5. Centrifugation was performed at 4 ° C. and 8,000 × g for 10 minutes (7800 rpm using HITACHI high-speed cooling centrifuge, rotor RPR20-2).
6. The cells (precipitate) were suspended in 25 ml of zymolyase buffer containing 300 μg / ml of zymolyase 100-T (Seikagaku Corporation), and gently shaken at 30 ° C. for 1 hour.
Centrifugation was performed at 7.4 ° C., 9,000 × g for 10 minutes (8400 rpm using a HITACHI high-speed cooling centrifuge, rotor RPR20-2).
8. The cells (precipitate) were washed with 25 ml of zymolyase buffer.
9. Centrifugation was performed at 4 ° C. and 9,000 × g for 10 minutes (8400 rpm using a HITACHI high-speed cooling centrifuge, rotor RPR20-2).
10. The cells (precipitate) were washed with 25 ml of zymolyase buffer.
11. Centrifugation was performed at 4 ° C. and 9,000 × g for 10 minutes (8400 rpm using HITACHI high-speed cooling centrifuge, rotor RPR20-2).
12. The cells (precipitate) were suspended in 25 ml of sonication buffer (containing 1 mM PMSF). For freezing and thawing, it was left overnight at -80 ° C.
13. On the next day, the bacterial cell solution was dissolved at room temperature and homogenized about 20 times with a Downs type homogenizer (Tight) (WHEATON).
Centrifugation was performed at 14.4 ° C., 12,000 × g for 20 minutes (HITACHI high-speed cooling centrifuge, 10,000 rpm using a rotor RPR20-2).
15. The supernatant was transferred to an ultracentrifuge tube.
Ultracentrifugation was performed at 16.4 ° C., 100,000 × g for 60 minutes (BECKMAN separation ultracentrifuge L8-60M, 25,000 rpm using rotor Sw28).
17. Discard the supernatant, scrape the precipitate (microsomal fraction) with a Teflon homogenizer (IWAKI), and completely suspend it in an appropriate amount (1 to 3 ml) of 50 mM HEPES / NaOH (pH 7.6) (containing 0.5 mM EDTA). Homogenized until possible.
18. 150 μl of the resulting suspension was dispensed into 1.5 ml Eppendorf tubes. Samples were stored at -80 ° C.
After preparing the microsomal fraction of CYP80A1like expression yeast as described above, an enzyme reaction was performed.

(c) Enzymatic reaction using CYP80A1like recombinant protein
Enzymatic reaction using CYP80A1like recombinant protein is 100 μl using 50 mM HEPES / NaOH (pH 7.6), 0.5 mM NADPH (Oriental Yeast Co., Ltd), 5 μM reticuline (substrate), and 30-60 μl of microsomal fraction. The reaction was performed at 30 ° C. for 30 minutes.

  The presence or absence of reaction products was confirmed using LC-MS. However, the sample used for LC-MS was subjected to TCA precipitation after the reaction to precipitate proteins, and the supernatant was used for analysis. did.

(d) LC-MS analysis of CYP80A1like reaction products
The reaction product of CYP80A1like recombinant protein was analyzed using LCMS-2010 (Shimadzu). An ESI probe was used as a mass spectrometer.

LC-MS condition analyzer: LCMS-2010 (Shimazu)
Detection: 280nm
Column: TSKgelODS-80T _M (4.6x250mm) (Tosoh)
Solvent: acetonitrile / water / acetic acid (35: 64: 1)
Flow rate: 0.5ml / min

  The results are shown in FIG. The left spectrum of FIG. 3 shows the result of LC-MS analysis of the product immediately after the reaction of CYP80A1like when (R, S) -reticuline is used as a substrate. In addition to reticuline (m / z = 330), a peak of the reaction product at m / z = 328 was detected. The right spectrum of FIG. 3 shows the result of LC-MS analysis of the product 30 minutes after the reaction of CYP80A1like when (R, S) -reticuline is used as a substrate. In addition to reticuline (m / z = 330), the peak of the reaction product at m / z = 328 was detected, the major reaction product was m / z = 328, and the retention time was about 11 minutes. The product had m / z = 328 and a retention time of about 12 minutes. That is, as a CYP80A1like reaction product when (R, S) -reticuline was used as a substrate, it was confirmed that two compounds having the same molecular weight and different retention times were produced. In the following experiments, attempts were made to identify major reaction products.

(e) Analysis of CYP80A1like reaction products using photodiode array
The UV absorption spectrum of the CYP80A1like reaction product separated by HPLC was analyzed by a photodiode array.
HPLC conditions Analyzer: Shimadzu LC-10A system
Column: TSKgelODS-80T _M (4.6x250mm) (Tosoh)
Solvent: acetonitrile / water / acetic acid (35: 64: 1)
Flow rate: 0.8ml / min

  The results are shown in FIG. The left side of the figure shows the absorption pattern of the CYP80A1-like reaction product when the magnoflorin sample is used, and the right side is when reticuline is used as a substrate. The absorption pattern of the reaction product was similar to that of the magnoflorin preparation. From these results and the molecular weight and fragment ion patterns, it was suggested that the reaction product of CYP80A1like when reticuline was used as a substrate might be a precursor of magnoflorin.

(f) Identification of CYP80A1like reaction products
LC-NMR analysis was performed to identify the CYP80A1like reaction product. First, CYP80A1like expression yeast grown until the late logarithmic growth phase was collected. The collected yeast was suspended in HEPES / NaOH buffer (pH 7.6), and (R, S) -reticuline was added to a final concentration of 100 μM. The cell reaction time was 30 hours and 48 hours.

As a result of analyzing the buffer in which the yeast was suspended after the reaction, the production of the reaction product was confirmed. On the other hand, the bacterial cells themselves were extracted with MeOH, but almost no reaction product was obtained. After confirming the production of the reaction product, the yeast cell reaction solution is finally concentrated with Sep-Pak and then eluted with MeOH, and then evaporated to dryness, dissolved in DMSO, and dissolved in LC-NMR. A sample was used.
LC-NMR Conditions Analyzer: Varian UNITY-INOVA-500 spectrometer (H-1: 500MHz) equipped with a PFG indirect-detection LC-NMR probe with a 60 μL flow-cell (active volume)
Column: TSKgelODS-80T _M (4.6x250mm) (Tosoh)
Solvent: 0.1M NH ₄ OAc (0.05% TFA) / acetonitrile (0.05% TFA)

  When the NMR results of the CYP80A1like reaction product were compared with the NMR results of the Kollituberin sample, the CYP80A1like reaction product was identified to be Kollituberin. In addition, as for the Koritsuberin sample, a commercially available (+)-isocollidine (Aldrich) 1,2,10-OMe body was acid-decomposed with HBr and fractionated from a phenolic alkaloid mixture.

  It has been found that CYP80A1like of the present invention produces colituberin using reticuline as a substrate. Colituberin is a precursor of magnoflorin, and it is speculated that coclavulin-N-methylating enzyme (CNMT) is allowed to act on colituberin to produce magnoflorin. Therefore, it was next confirmed whether or not magnoflorin was produced by the action of CYP80A1like and CNMT using reticuline as a substrate.

  Specifically, CNMT reaction was performed using the reaction product generated after the CYP80A1like reaction using reticuline as a substrate. That is, the reaction was carried out for 30 minutes in a CYP80A1-like reaction solution, and then further reacted by adding CNMT crude enzyme expressed in Escherichia coli, SAM as a methyl group donor, and further ascorbic acid as an antioxidant. Thereafter, the protein was removed by TCA precipitation, and the supernatant was subjected to LC-MS analysis.

  The results are shown in FIG. The figure on the left is obtained as a result of performing a CNMT reaction immediately after performing a CYP80A1like reaction using reticuline as a substrate, and the figure on the right is the result of performing a CNMT reaction using the reaction product generated after performing a CYP80A1like reaction using reticuline as a substrate. Product is shown. When CYP80A1like reaction was carried out using reticuline as a substrate, a peak of the reaction product, ie, Colliberin (m / z = 328), was observed in addition to reticuline (m / z = 330). On the other hand, when CNMT reaction was further carried out using the product of CYP80A1like reaction as a substrate, in addition to reticuline (m / z = 330) and colituberin (m / z = 328), the peak of magnoflorin (m / z = 342) Was observed.

  From the above experiments, it was found that CYP80A1like according to the present invention produces colituberin using reticuline as a substrate, and further, it was found that colituberin is converted to tunaflorin by CNMT. The reaction diagram according to the present invention is shown in FIG.

It is a figure which shows the reaction which P450 molecular species specific to an isoquinoline alkaloid biosynthesis system perform. FIG. 3 is a view showing insertion of a CYP80A1like yeast expression vector pGYR-SpeI. It is a figure which shows the result of LC-MS analysis of the reaction product obtained after preparing the microsome fraction of the yeast which expresses CYP80A1like, and making it react with reticuline. It is a figure which shows the comparison of the absorption pattern by the photodiode array of a CYP80A1like reaction product at the time of using a reticuline as a substrate, and a magnoflorin sample. It is a figure which shows the CYP80A1like reaction product when using reticuline as a substrate, and the CNMT reaction product when using the reaction product as a substrate. CYP80A1like is a schematic diagram showing that reticuline is converted into colituberin, and CNMT further converts cortsberine into magnoflorin.

Claims (10)

  A gene comprising a polynucleotide comprising the base sequence represented by SEQ ID NO: 1. A P450 enzyme that hybridizes under stringent conditions with a polynucleotide comprising a nucleotide sequence represented by SEQ ID NO: 1 and a complementary sequence, and catalyzes a conversion reaction from reticuline to colituberin. A gene containing a polynucleotide.   The gene according to claim 1 or 2, wherein the gene is derived from auren.   A recombinant vector comprising the gene according to any one of claims 1 to 3.   A host cell comprising the gene of any one of claims 1 to 3 or the recombinant vector of claim 4.   6. The host cell according to claim 5, wherein the host cell is selected from the group consisting of yeast and poppy plant, buttercup plant, barberry plant, rhododendron plant, citrus plant, magnoli plant. The following protein (a) or (b):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 2,
(B) 1 or several amino acids are deleted in the amino acid sequence represented by SEQ ID NO: 2, substituted or added in the amino acid sequence, and the conversion reaction activity of P450 enzyme that catalyzes the to Koritsuberin from reticulin Protein. Culturing the host cell of claim 5 or 6, and
Expressing the protein of claim 7 in said host cell;
A method for producing the protein of claim 7 , comprising: A method for producing colituberin, comprising a step of converting the reticuline as a substrate into colituberin by causing the protein of claim 7 to act as a catalyst. A step of allowing the protein of claim 7 to act as a catalyst to convert reticuline as a substrate into colituberin; and
A step of acting as a catalyst with coclaurine-N-methyltransferase and converting the substrate coritubberin into magnoflorin,
A method for producing magnoflorin, comprising:

Images