JP4465468B2 - Factors controlling alkaloid productivity - Google Patents

Description

  The present invention relates to a gene comprising a polynucleotide encoding a transcription factor that is one of plant secondary metabolites and controls biosynthesis of isoquinoline alkaloids that are highly used as pharmaceuticals, and a transcription factor encoded by the gene And an isoquinoline alkaloid production method using the gene.

  In the course of long evolution, plants have acquired specific and advanced secondary metabolic systems. Secondary metabolites are said to be tens of thousands to millions, and are generally classified into alkaloids, terpenoids, flavonoids, and phenylpropanoids. Although the functions of these secondary metabolites are thought to be mainly defenses from external enemies, there is still very little information available.

  Various secondary metabolites produced by plants are widely used as fragrances, pigments, pharmaceuticals, etc., but there are problems in their production efficiency and quality homogeneity, and conversion to chemical synthesis has been performed. However, with the various problems associated with chemical synthesis and the growing trend toward natural products, there is a need to develop a material production system based on the inherent productivity of plants.

  In particular, among the various secondary metabolites, alkaloid species having physiological activity are still in great demand as components of pharmaceuticals on the market today, and methods for supplying them in large quantities are being studied. In general, alkaloid species are natural polymers with nitrogen-containing heterocycles, and their chemical structure is difficult due to their complex chemical structure, and extraction from plants is the main production method. However, the amount that can be collected from plants is small, and there is a demand for establishment of a high production system using artificially improved plants. Therefore, a new field of metabolic engineering has been attempted for the purpose of increasing biosynthesis efficiency by introducing genetic engineering techniques and producing new products by artificial routes (Non-Patent Documents 1 and 2). reference).

  Many metabolic pathways in plants are subject to transcriptional control, and transcription of genes associated with metabolic pathways is controlled by development, environment, or hormonal processes. The conventional method for artificially manipulating plant metabolic pathways to accumulate useful substances is by controlling processes that are the rate-limiting step of metabolic pathways. However, such methods are not very successful because the identification of the rate limiting step is often difficult and the accumulation of the final product is often limited by multiple enzyme activities.

  Therefore, a method for manipulating a transcription factor capable of controlling a plurality of metabolic processes is proposed, but transcription control is a complicated mechanism, and it is difficult to obtain a desired metabolite. That is, in order to control transcription, a plurality of proteins that bind to a target sequence or activate transcription are often required. Furthermore, even if an attempt is made to activate a metabolic pathway by overexpressing a transcription factor, plant growth and development may be inhibited.

  Although attempts to obtain a desired metabolite by controlling the processes of multiple metabolic pathways are promising, transcription that can comprehensively control the alkaloid biosynthetic system so far is complicated because the secondary metabolic pathway of plants is complicated. The factor has not been identified.

  Among the alkaloids, many isoquinoline derivatives and isoquinoline-based alkaloids derived from the biosynthetic origin have strong physiological activities such as berberine, morphine, and papaverine, and are used in many pharmaceuticals. Since the first half of this isoquinoline alkaloid biosynthesis system is common to each compound, it is indispensable to isolate and identify isoquinoline alkaloid biosynthesis system genes and regulatory genes.

  The present inventor has proposed a method for comprehensively isolating alkaloid biosynthetic enzyme genes and their control genes from alkaloid-highly producing aurene cells, and has been able to expect many novel genes A control candidate gene has been isolated (Patent Document 1).

  Specifically, as a result of research on the berberine biosynthesis system of auren, known as a medicinal plant, we have clarified the entire biosynthetic pathway by isolating and identifying many genes related to berberine biosynthesis. is there.

  That is, berberine, which is a benzylisoquinoline alkaloid, is biosynthesized from two amino acid tyrosine molecules as shown in FIG. The present inventors have so far purified biosynthetic enzymes using cultured cells with high berberine productivity as materials, and isolated and identified genes corresponding to the respective enzymes.

So far, the transcription factor ORCA of the alkaloid biosynthesis gene has been reported in periwinkle that produces indole alkaloid, but the expression control by this gene is partial and is not a comprehensive biosynthesis control gene. Even in the isoquinoline alkaloid biosynthesis system, no transcription factor that comprehensively controls a plurality of steps has been known.
JP 2004-121233 A Current Opinion in Plant Biology 2004 7; 202-209 Current Opinion in Biotechnology 2002 13; 181-187

  An object of the present invention is to provide a transcription factor capable of comprehensively controlling transcription of a plurality of genes in an alkaloid biosynthesis system.

  In order to solve the above-mentioned problems, the present inventor has obtained a new gene function analysis method and a cDNA library isolated from cultured aurene cells having a very high alkaloid biosynthetic capacity, thereby obtaining the auren alkaloid biosynthesis gene. We have succeeded in isolating transcription factors that can all regulate expression. This is the first isolation of comprehensive biosynthetic regulators of metabolic pathways.

  Specifically, an EST library of berberine highly productive auren strain 156-1 was created, and genes of proteins involved in transcriptional control were selected from this library. And by the transient RNAi method suppression of the gene in our protoplasts and the monitoring of the expression level of 6OMT (norcoclaurin-6-O-methyltransferase), a berberine biosynthesis enzyme, in the transient transformant The present inventors screened a trans transcription factor that effectively controls the isoquinoline alkaloid biosynthesis system, and isolated and identified a clone encoding the transcription factor of the present invention.

  That is, this invention provides the gene containing the polynucleotide which consists of the 86th-772 bases of the base sequence represented by sequence number 1 (refer FIG.2, FIG.5 and a sequence table). Of the sequence represented by SEQ ID NO: 1, the region encoding the transcription factor according to the present invention, ie, the open reading frame (ORF), has base numbers 86-772. Therefore, this invention provides the gene which consists of nucleotide 86-772 among the sequences represented by sequence number 1. However, any gene is included in the scope of the present invention as long as it includes a region corresponding to nucleotide numbers 86 to 772 of SEQ ID NO: 1.

  Further, the present invention comprises a nucleotide sequence in which one or several bases or base pairs are deleted, substituted or added in the polynucleotide consisting of the 86th to 772th bases of the base sequence represented by SEQ ID NO: 1. Also included are genes comprising a polynucleotide encoding a transcription factor that induces isoquinoline alkaloid biosynthesis gene expression. Here, “one or several bases or base pairs are deleted, substituted or added” means substitution, deletion, insertion and / or addition by a known mutagenesis method such as site-directed mutagenesis. It means that as many bases as possible are substituted, deleted, inserted and / or added.

  Furthermore, the present invention provides a transcription factor which hybridizes under stringent conditions with a polynucleotide comprising the 86th to 772th bases of the base sequence represented by SEQ ID NO: 1 and induces isoquinoline alkaloid biosynthesis system gene expression. Also included are genes comprising a polynucleotide encoding. In the present invention, stringent hybridization conditions refer to hybridization conditions of 6M urea, 0.4% SDS, 0.5x SSC or equivalent stringency.

  The present invention also shows homology of 60% or more at the nucleotide level with a polynucleotide comprising the 86th to 772th bases of the base sequence represented by SEQ ID NO: 1 and induces isoquinoline alkaloid biosynthesis system gene expression. Also included are genes comprising a polynucleotide encoding a transcription factor. The homology is preferably 60% or more, more preferably 70% or more, 80% or more, 90% or more, and further preferably 92.5% or more, 95% or more, 98% or more. Sequence identity can be determined by FASTA search (Pearson W.R. and D.J. Lipman (1988) Proc. Natl. Acad. Sci. USA. 85: 2444-2448) or BLAST search.

The present invention also provides a gene encoding the following protein (a) or (b):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 2,
(B) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and acting as a transcription factor for inducing the expression of an isoquinoline alkaloid biosynthesis system gene ,
I will provide a.

  In the present invention, “deletion, substitution or addition of one or several amino acids” can be replaced, deleted, inserted and / or added by a known mutant protein production method such as site-directed mutagenesis. It means that a certain number of amino acids are substituted, deleted, inserted and / or added. Further, the “mutation” here means a mutation artificially introduced mainly by a known method for producing a mutant protein, but may be a product obtained by isolating and purifying a similar naturally occurring mutant protein.

  The gene provided by the present invention is preferably derived from an isoquinoline alkaloid-producing plant, and more preferably derived from aurene.

  The present invention provides a protein comprising the amino acid sequence represented by SEQ ID NO: 2, which comprises an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2. An isoquinoline alkaloid biosynthetic biosynthesis system gene, a protein that acts as a transcription factor, and a protein comprising the amino acid sequence represented by SEQ ID NO: 2 that exhibits 60% or more homology at the amino acid level, and an isoquinoline alkaloid Proteins that act as transcription factors that induce biosynthetic gene expression are also included in the present invention. Alternatively, a protein encoded by the gene provided by the present invention is provided. Here, the term in which one or several amino acids are deleted, substituted or added has the same meaning as described above, and the homology is preferably 60% or more, more preferably 70% or more, 80% or more, 90% or more. More preferably, they are 92.5% or more, 95% or more, or 98% or more. Sequence identity can be determined by FASTA search (Pearson W.R. and D.J. Lipman (1988) Proc. Natl. Acad. Sci. USA. 85: 2444-2448) or BLAST search as described above.

  The present invention also provides a recombinant vector containing the gene provided by the present invention, a transformed plant cell containing the recombinant vector, and a transformed plant containing the transformed plant cell. The transformed plant cell and transformed plant are preferably isoquinoline alkaloid producing plants. Specific examples of the plant transformed according to the present invention include a plant belonging to the genus Oren, poppy, or Gypsophila, and more preferable is Auren.

  The present invention further comprises a step of culturing the transformed plant cell of the present invention, overexpressing a transcription factor that induces isoquinoline alkaloid biosynthesis gene expression in the cell, and a step of collecting isoquinoline alkaloid from the resulting culture. A method for producing isoquinoline alkaloids is provided. Preferably the isoquinoline alkaloid is berberine. Other specific examples of isoquinoline alkaloids produced by the method of the present invention include morphine, codeine, thebaine, papaverine, coptisine, palmatin, columbamine, sinomenine, berbamine, allomolin, emetine, reticuline, coclaurine, norcoclaurine, scourelin, Examples include tuboclavlin and corridalin.

The present invention also provides a method for producing an isoquinoline alkaloid-producing plant comprising a step of culturing or cultivating the transformed plant, a step of transforming a plant cell with a polynucleotide comprising the gene, and the transformed plant There is also provided a method for producing an isoquinoline alkaloid-producing plant comprising the step of obtaining a plant body by redifferentiation.
Here, the transformed plant may be any of a plant body, a plant organ, a plant tissue, or a plant cultured cell.

  The present invention also provides a method for inhibiting isoquinoline alkaloid biosynthesis in a plant, comprising the step of inhibiting the expression of the gene. Here, inhibition of the expression of the gene of the present invention may be performed by any conventionally known means, and examples thereof include an antisense method and an RNAi method. Preferably, inhibition of expression is performed by RNAi method.

  According to the present invention, by controlling the biosynthesis system of isoquinoline alkaloid, mass production of berberine useful as a pharmaceutical that is an isoquinoline alkaloid becomes possible. Isoquinoline alkaloids also include other useful alkaloids such as morphine, thus providing a means to enable mass production of such useful secondary metabolites.

The present invention is described in further detail below.
About the gene according to the present invention The present invention provides a gene encoding a transcription factor that promotes the expression of an isoquinoline alkaloid biosynthetic enzyme.
The nucleotide sequence shown in SEQ ID NO: 1 is sequenced by the present inventor as an EST (expression sequence tag: expressed gene fragment) contained in a cDNA library obtained from a cultured cell of Coptis japonica belonging to the family Ranunculaceae. It has been decided. The EST having such a base sequence was suggested to be a gene encoding a transcription factor that regulates the biosynthesis of isoquinoline alkaloids from the analysis of homology based on the sequence information on the database.

  The gene according to the present invention is preferably a polynucleotide comprising nucleotides 86 to 772 of the nucleotide sequence shown in SEQ ID NO: 1, but any gene may be used as long as a portion corresponding to this portion is included. . The polynucleotide consisting of the base sequence shown in SEQ ID NO: 1 can be obtained from a cDNA library prepared by a conventionally known method from cultured aurene cells that highly produce berberine, an isoquinoline alkaloid.

  The polynucleotide consisting of bases 86 to 772 of the base sequence shown in SEQ ID NO: 1 was confirmed to be an ORF encoding a transcription factor that positively controls isoquinoline alkaloid biosynthesis gene expression. The transcription factor is a protein having homology with the Arabidopsis bHLH domain. Transcription factors that comprehensively control the alkaloid biosynthesis system have not been known so far, and comprehensive induction of genes of the alkaloid biosynthesis system can be expected by using the transcription factor of the present invention.

  The present invention also includes a gene encoding a protein that is functionally equivalent to the protein that acts as the transcription factor described in SEQ ID NO: 2. As used herein, “functionally equivalent to a protein acting as a transcription factor” regulates the biological function equivalent to the protein of SEQ ID NO: 2, that is, the expression of an isoquinoline alkaloid biosynthesis gene. It means having a function. Isoquinoline alkaloid biosynthesis genes include TYDC (tyrosine decarboxylase), NCS (norcoclaurine synthase), 6-OMT (norcoclaurine-6-O-methyltransferase), CNMT (coclaurin-N-methyltransferase) , CYP80B2 (cytochrome P450 80B2), 4'OMT ((S) -3'-hydroxy-N-methylcoclaurine-4'-O-methyltransferase, BBE (berberine bridge enzyme), SMT (scoulerin-9-O- Methyltransferase), a gene encoding CYP719A (cytochrome P450 719A: canadine synthase), and the like.

  Examples of the gene of the present invention include mutants, derivatives, and the like that encode a protein comprising an amino acid sequence in which one or several amino acids are substituted, deleted, added and / or inserted in the amino acid sequence shown in SEQ ID NO: 2. Alleles, variants and homologs are included.

  Methods well known to those skilled in the art for preparing genes encoding proteins with altered amino acid sequences include, for example, site-directed mutagenesis (Kramer, W. & Fritz, H.-J. Methods in Enzymology, 154: 350-367 (1987)). In addition, the amino acid sequence of the encoded protein may be mutated in nature due to the mutation of the base sequence. In this way, even a gene encoding a protein having an amino acid sequence in which one or several amino acids are substituted, deleted or added in the amino acid sequence encoding the natural transcription factor of the present invention (SEQ ID NO: 2), So long as it encodes a protein having a function equivalent to that of a natural transcription factor (SEQ ID NO: 2), it is included in the gene of the present invention. Moreover, even if the base sequence is mutated, it may not be accompanied by a mutation of an amino acid in the protein (degenerate mutation), and such a degenerate mutant is also included in the gene of the present invention. The number of base mutations in the DNA constituting the gene of interest is typically within 100 amino acids, preferably within 50 amino acids, more preferably within 20 amino acids, and even more preferably within 10 amino acids (for example, Within 5 amino acids, within 3 amino acids).

  The method for obtaining the gene is not particularly limited, and a general method is employed. For example, the gene may be excised from a genomic DNA or cDNA library of an organism having the gene with an appropriate restriction enzyme and purified. That is, the gene encoding the transcription factor of the present invention includes genomic DNA, cDNA, and chemically synthesized DNA. Preparation of genomic DNA and cDNA can be performed by those skilled in the art using conventional means. For genomic DNA, for example, genomic DNA is extracted from plant cells or tissues, a genomic library (plasmids, phages, cosmids, BACs, PACs, etc. can be used as vectors) is developed and expanded. It can be prepared by carrying out colony hybridization or plaque hybridization using a probe prepared based on DNA encoding the protein of the invention (SEQ ID NO: 1).

  It is also possible to prepare a primer specific for the DNA (SEQ ID NO: 1) encoding the transcription factor of the present invention and perform PCR using this primer. In addition, for example, cDNA is synthesized based on mRNA extracted from plant cells or tissues, and inserted into a vector such as λZAP to create a cDNA library. It can be prepared by performing colony hybridization or plaque hybridization, or by performing PCR.

  Examples of the organism having the above gene include isoquinoline alkaloid-producing plants such as poppies, red-bellied shrimp, and oren (cultured cells). In particular, the target gene can be more reliably isolated by purification using cultured cells having high berberine productivity, among the above-mentioned cultured aurene cells.

  The DNA encoding the transcription factor of the present invention can be used for mass production of isoquinoline alkaloids by, for example, activating the expression of isoquinoline alkaloid biosynthesis genes. Overexpression of isoquinoline alkaloids has various industrial advantages. For example, berberine can be mass-produced by overexpressing it in cultured aurene cells, or morphine can be mass-produced by overexpressing it in poppy. In addition, for example, by suppressing the expression of the transcription factor, new horticultural varieties such as molecular breeding of poppies that do not produce morphine can be produced.

  Since the transcription factor of the present invention has a bHLH motif, it is considered to be a bHLH type transcription factor. In fact, when the expression of clone 48 having the base sequence shown in SEQ ID NO: 1 was inhibited, transcription of the isoquinoline alkaloid biosynthesis gene was markedly inhibited. Therefore, clone 48 is a transcription factor that activates gene expression of the isoquinoline alkaloid biosynthesis system.

Method for Isolating Full-Length cDNA of Gene Encoding Transcription Factor that Controls Isoquinoline Alkaloid Biosynthesis The gene according to the present invention is an EST of a gene encoding a transcription factor that controls an isoquinoline alkaloid biosynthesis system derived from cultured urethane cells. Therefore, it is possible to clone a full-length cDNA of a gene encoding the above isoquinoline alkaloid biosynthesis transcription factor from a plant belonging to the genus Oren (including cultured cells of aurium) or other plants. As a cloning method in this case, a conventionally known method can be used and is not particularly limited.

  Since the isoquinoline alkaloid biosynthetic pathway is widely conserved in the plant kingdom, many plants also have genes such as 6-OMT, which are genes involved in this, and transcription factors that control the expression of these genes. Have in common. Therefore, the gene of the present invention can be isolated from many plants according to a conventional method. The gene of the present invention can also be obtained by chemical synthesis by a general method such as the phosphite triester method (H. Hunkapiller et al., Nature, vol. 310, p. 105-111, 1984). it can.

  Specifically, in the case of a plant in which at least a part of the genome is databased, a homologous base sequence may be searched from the database based on the base sequence of the polynucleotide. For example, a base sequence homology search by BLAST, which is a widely used homology search algorithm, can be preferably used.

  In the case of a plant whose genome is not databased, for example, a conventionally known hybridization method using a DNA library can also be used. Specifically, a step of preparing a genomic library or cDNA library from a target plant using an appropriate cloning vector, hybridization is performed using at least a part of the polynucleotide as a probe, and the library And a step of detecting a positive fragment for the probe. Thus, the gene according to the present invention is also useful as a probe. The region used for the probe preferably contains a sequence specific to the target gene. The length of the polynucleotide used as the probe is preferably 100 bp or more.

  More specifically, in order to prepare a gene encoding a protein functionally equivalent to the transcription factor shown in SEQ ID NO: 2, a method well known to those skilled in the art includes a hybridization technique (Southern, EM Journal). of Molecular Biology, 98, 503 (1975)) and polymerase chain reaction (PCR) technology (Saiki, RK et al. Science, 230, 1350-1354 (1985), Saiki, RK et al. Science, 239,487-491 (1988) )). That is, for those skilled in the art, clone 48 (SEQ ID NO: 1), which is a gene provided by the present invention, or a part thereof is used as a probe, and an oligonucleotide that specifically hybridizes to the gene is used as a primer from plant cells. It is usually possible to isolate a gene having high homology with the gene. A gene encoding a protein having a function equivalent to that of the transcription factor of the present invention that can be isolated by a hybridization technique or a PCR technique is also included in the gene of the present invention.

  In order to isolate such a gene, the hybridization reaction is preferably carried out under stringent conditions. In the present invention, stringent hybridization conditions refer to hybridization conditions of 6M urea, 0.4% SDS, 0.5x SSC or equivalent stringency as described above. By using conditions with higher stringency, such as 6M urea, 0.4% SDS, and 0.1x SSC, efficient isolation of genes with higher homology can be expected. The isolated gene is considered to have high homology with the amino acid sequence of the protein of the present invention (SEQ ID NO: 2) at the amino acid level. High homology refers to sequence identity of at least 50% or more, more preferably 70% or more, more preferably 90% or more (for example, 95% or more) in the entire amino acid sequence. Sequence identity can be determined by FASTA search (Pearson W.R. and D.J. Lipman (1988) Proc. Natl. Acad. Sci. USA. 85: 2444-2448) or BLAST search.

  Whether or not a gene encodes a protein having a function as a transcription factor can be examined by, for example, a gel shift assay generally performed by those skilled in the art. Specifically, it can be performed by the following method. First, a test DNA is incorporated into a vector so as to generate a fusion protein with GST, although the gene product is not limited thereto, for example, and the fusion protein from the vector is expressed. The expression product is purified using GST as an indicator and mixed with a labeled DNA probe containing a bHLH binding motif. This mixed solution is analyzed by electrophoresis using non-denaturing acrylamide gel. The binding activity can be evaluated from the position of the detected band on the gel.

  Whether a gene encodes a protein having a function of activating the expression of an isoquinoline alkaloid biosynthesis gene can be examined by, for example, a reporter assay. Specifically, it can be performed by the following method. First, a vector is constructed in which a reporter gene is linked downstream of one promoter of an isoquinoline alkaloid biosynthesis system enzyme. The transcription activity of the test DNA gene product is evaluated by introducing the vector and a vector expressing the gene product of the test DNA into a reporter assay cell and measuring the activity of the reporter gene product. Examples of promoters that can be used in the reporter assay include promoters upstream of the above TYDC, NCS, 6-OMT, CNMT, CYP80B2, 4′OMT, BBE, SMT, and CYP719A. The reporter gene is not particularly limited as long as its expression can be detected, and reporter genes generally used by those skilled in the art for various assay systems can be used. Suitable reporter genes include, for example, β-glucuronidase (GUS) gene.

  In addition, whether or not a gene encodes a protein having a function as a transcription factor can be determined using a Southwestern method or a yeast one-hybrid method well known to those skilled in the art.

Method for producing transformed cell When producing a transformed plant that expresses the gene of the present invention, the gene encoding the protein of the present invention is inserted into an appropriate vector and introduced into a plant cell, thereby The resulting transformed plant cell is regenerated.

  The transformed cell according to the present invention is a transformed cell into which the above gene or recombinant vector has been introduced. More specifically, the transformed cell according to the present invention is a transformed cell into which a gene encoding the transcription factor according to the present invention has been introduced. Here, “a gene or a recombinant vector has been introduced” means that a gene incorporated into the vector as desired in a host is expressed by, for example, the action of a promoter, by a known genetic engineering technique (gene manipulation technique). It means to be introduced as possible.

  The transformed cell according to the present invention can be obtained by introducing the above gene directly or by introducing a vector incorporating the above gene into a host. Although the said host is not specifically limited, For example, microorganisms, such as yeast and E. coli, a plant, an animal, etc. can be mentioned. However, since the gene incorporated in the vector is derived from cultured plant auren, which is a kind of plant, the host is preferably a plant, and among the plants, the plant belonging to the genus Oren, isoquinoline such as poppy and genus Plants that produce alkaloids are particularly preferred. As described above, the category of the plant includes not only an individual plant but also an organ, tissue, cell, and the like of the plant. The transformation may be transient, but preferably the gene is stably integrated.

  The obtained gene is expressed under a promoter that can be expressed in plants, for example, cauliflower mosaic virus 35S promoter (CaMV35S promoter), nopaline synthetase promoter, ribulose diphosphate carboxylase / oxygenase small subunit promoter, etc. It is used by connecting to the basin in the sense direction or the antisense direction. In order to promote the expression of a target gene (in the present invention, a gene for which expression is to be promoted or suppressed), the gene of the present invention is linked to a promoter in the sense direction. In order to suppress the expression, for example, the gene of the present invention is linked to a promoter in the antisense direction. Alternatively, it is linked to a promoter so as to produce double-stranded RNA. In addition, when promoting the expression of the target gene, the gene of the present invention linked to the promoter in the sense direction and the target gene linked to the downstream region of another promoter are incorporated into one vector, or You may introduce | transduce into a plant cell as a separate vector.

  As a method for producing a transformed plant containing the transformed cells, specifically, for example, a polyethylene glycol method, an electroporation method (electroporation), an Agrobacterium-mediated method, a particle gun method, etc. Various known methods can be used. Plant regeneration from transformed plant cells can be performed by methods known to those skilled in the art depending on the type of plant cell (see Toki et al., Plant Physiol. 100: 1503-1507 (1995)). ). For example, as a method for producing a transformed plant, a method of regenerating a plant by introducing a gene into a protoplast with polyethylene glycol (Datta, SK (1995) In Gene Transfer To Plants (Potrykus I and Spangenberg Eds.) Pp66- 74), gene transfer to protoplasts by electric pulses to regenerate plants (Toki et al (1992) Plant Physiol. 100, 1503-1507), gene transfer directly to cells by particle gun method, A method of regeneration (Christou et al. (1991) Bio / technology, 9: 957-962.) And a method of introducing a gene through Agrobacterium to regenerate the plant (Hiei et al. (1994) Plant J 6: 271-282.), But is not particularly limited. In addition, the transformation method is preferably selected as appropriate depending on the type of plant or the like serving as a host (for example, monocotyledonous plants or dicotyledonous plants).

  Once a transformed plant into which the gene of the present invention has been introduced into the genome is obtained, offspring can be obtained from the plant by sexual reproduction or asexual reproduction. It is also possible to obtain a propagation material (for example, seeds, fruits, cuttings, tubers, tuberous roots, strains, callus, protoplasts, etc.) from the plant body, its descendants or clones, and mass-produce the plant body based on them. Is possible. The present invention includes plant cells into which the gene of the present invention has been introduced, plants containing the cells, progeny and clones of the plants, and propagation materials for the plants, their progeny, and clones.

  Examples of vectors that can be used in the present invention include vectors conventionally used for transformation of microorganisms, plants, plant cells, and the like. In addition to the gene or a fragment thereof, the vector includes a constitutive expression type or expression control type promoter for expressing a conventionally known gene, a drug resistance gene that facilitates selection of transformants, Agrobacterium A replication origin for using the binary-vector system for using the binary-vector system may be included.

  More specifically, when introduced into microorganisms such as E. coli, pBluescript vectors, pET vectors, and the like can be used. The vector used for the transformation of plant cells is not particularly limited as long as the transgene can be expressed in the cells. For example, a vector having a promoter (for example, cauliflower mosaic virus 35S promoter) for constitutive gene expression in plant cells or a promoter (eg, ethylene responsiveness) that is inducibly activated by external stimulation. It is also possible to use a vector having a PR5d promoter, a water stress-inducible rd29A promoter, etc. In addition, promoters that guarantee tissue-specific expression (eg, root-specific PR5d promoter, tuber-specific patatin promoter, green leaf-specific rbcS promoter, etc.) can also be suitably used. When introducing into plant cells using electroporation, the vector is not particularly limited. Examples of the drug resistance gene include ampicillin resistance gene, kanamycin resistance gene, and hygromycin resistance gene. Examples of the promoter include a cauliflower mosaic virus-derived 35S promoter (constant expression type) and a heat shock inducing protein promoter (expression control type).

  Examples of the replication origin include replication origins derived from Ti or Ri plasmids. The DNA linked to the promoter can be directly introduced into plant cells as it is using the microinjection method, electroporation method, polyethylene glycol method, fusion method, high-speed ballistic penetration method, etc. It can also be incorporated into a plasmid for gene introduction and introduced into a plant cell indirectly via a virus or bacterium capable of infecting the plant as a vector. As such viruses, for example, cauliflower mosaic virus, gemini virus, tobacco mosaic virus, brom mosaic virus and the like can be used, and as bacteria, Agrobacterium tumefaciens (hereinafter referred to as A. tumefaciens), Agrobacterium rhizogenes etc. can be used. When introducing a gene into a plant by the Agrobacterium method using A. tumefaciens, for example, pBI101, pBI121 (both from Clontech) and the like can be used.

  Plant cells into which a vector is introduced in the present invention include various forms of plant cells, such as suspension culture cells, protoplasts, leaf sections, and callus.

Alkaloid production using a gene encoding an isolated transcription factor The present inventor can use alkaloid biosynthesis-related genes isolated and identified prior to the present invention to convert alkaloid biosynthesis activity of Scots almonds, or This shows that the biosynthesis activity of berberine by aurene can be improved (Sato F et al. Proc Natl Acad Sci (USA) 98: 367-372 (2001)).

  On the other hand, when producing a transformed plant in which expression of the gene of the present invention is suppressed, an RNAi method known to those skilled in the art may be used as described in the Examples. According to the RNAi method, suppression of endogenous gene expression can be achieved by transformation of DNA having a sequence identical or similar to the target gene sequence. For example, in order to obtain a plant body in which the expression of the transcription factor of the present invention is inhibited, a double-stranded RNA (dsRNA) is prepared in vitro based on the sequence shown in SEQ ID NO: 1, and this is directly applied to plant cells. What is necessary is just to introduce. Alternatively, it can also be achieved by transforming a vector DNA constructed to form inverted repeat, which is a construct for RNAi well known to those skilled in the art, into a target plant. The sequence used for RNAi need not be completely identical to the sequence of the target gene, but at least 70% or more, preferably 80% or more, more preferably 90% or more (for example, 95% or more). Have Sequence identity can be determined using the search described above. The dsRNA consists of at least 18 consecutive bases, preferably 20 bases, more preferably 22 bases or more (for example, 25 bases).

  Alternatively, a gene for suppressing the expression of the gene encoding the protein of the present invention may be inserted into an appropriate vector, which is introduced into a plant cell, and the resulting transformed plant cell may be regenerated. . “Suppression of the expression of the gene encoding the protein of the present invention” includes suppression of gene transcription and suppression of protein translation. Also included is a decrease in expression as well as complete cessation of gene expression.

  In addition to the RNAi method, as a method for suppressing the expression of a specific endogenous gene in plants, a method using an antisense technique is most commonly used by those skilled in the art. Suppression of endogenous gene expression can also be performed using DNA encoding a ribozyme. A ribozyme refers to an RNA molecule having catalytic activity. The ribozyme designed to cleave the target is linked to a promoter such as the cauliflower mosaic virus 35S promoter and a transcription termination sequence so that it is transcribed in plant cells. A ribozyme can be used to specifically cleave the transcription product of the target gene in the present invention, thereby suppressing the expression of the gene.

  From these results, if the transformed cells are prepared, the secondary metabolic function of the plant can be easily converted / improved, and substance conversion using a microbial cell system is also possible. Furthermore, if the above transformed cells are prepared by incorporating them into a vector containing a promoter overexpressing these genes (for example, 35S promoter derived from cauliflower mosaic virus), an enzyme for alkaloid biosynthesis is mass-produced. be able to.

  The transformed plant containing the transformed cell includes not only a complete plant but also a part thereof, a plant organ, a plant tissue, or a plant cultured cell. In addition, the above plants include plant tissues, protoplasts, cells, calli, organs, plant seeds, germs, pollen, egg cells, zygotes, etc. that originate from genetically modified plants and their progeny that have been transformed beforehand. Materials: Part of plants including flowers, stems, fruits, leaves, roots, etc. shall be included.

  The present invention also provides a method for producing an isoquinoline alkaloid-producing plant comprising a step of culturing or cultivating the transformed plant, a step of transforming a plant cell with a polynucleotide comprising the gene, and the transformed plant. A method for producing an isoquinoline alkaloid-producing plant comprising the step of redifferentiating a plant to obtain a plant body is also included. According to such a method, isoquinoline alkaloid can be produced efficiently and simply.

  By using the above-mentioned method, berberine and other various plants (for example, poppy plants such as poppies, blossoms, engosaku, ramid plants such as ramafuji, barberry plants such as barberry) The possibility of producing isoquinoline-based alkaloids such as magnoflorin, morphine, papaverine, sanguinarine, coridaline, cephalanthin and the like is opened up.

  In the present invention, a plant body in which the expression of the target gene is promoted / suppressed can be obtained by proliferating / redifferentiating a plant cell into which the gene of the present invention has been introduced by the method described above. The conditions for such plant cell growth / redifferentiation may be appropriately selected according to the type of plant.

  Overexpression of the gene of the present invention can promote the expression of TYDC, NCS, 6-OMT, CNMT, CYP80B2, 4'OMT, BBE, SMT, CYP719A genes, etc. Thus, the expression of the gene encoding such an enzyme is suppressed. Furthermore, not only these genes but also any gene in which the common sequence possessed by these genes is present in the transcriptional regulatory region can be controlled by the gene and vector of the present invention.

  Moreover, the plant which can promote / suppress gene expression according to the present invention is not particularly limited. Basically, any plant having an isoquinoline alkaloid biosynthetic pathway is considered to achieve the effects of the present invention. For example, the present invention can be applied to the Astragalus aurium, Aki larch, Aconite, Barberry, Barnacle, Oleander, Colombo, Poppy, Engosaku, Hanabishi, Citrus, etc.

The protein according to the present invention, the gene encoding the same and the use thereof The protein according to the present invention is a protein comprising the amino acid sequence represented by SEQ ID NO: 2 encoded by the above gene or the amino acid represented by SEQ ID NO: 2. A protein consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the sequence and acting as a transcription factor for inducing the expression of an isoquinoline alkaloid biosynthesis system, or the amino acid represented by SEQ ID NO: 2 It is a protein that exhibits a homology of 60% or more at the amino acid level with a protein comprising a sequence and acts as a transcription factor that induces the expression of an isoquinoline alkaloid biosynthesis system gene.

  In addition, the protein according to the present invention may contain a known additional sequence such as HA or Flag at the end or may be a fusion protein in order to easily purify and detect the protein. Further, it may be subjected to various modifications such as N-glycosylation.

  The recombinant vector according to the present invention has the above gene incorporated therein. The above vector can be expressed in a host such as a plant or a microorganism by a known transformation method so that the gene or gene fragment incorporated in the host can be expressed to obtain the protein according to the present invention. The protein according to the present invention may be obtained by recombinant production as described below, or may be isolated and purified from plant cells, and its origin is not particularly limited.

  When preparing a recombinant protein, generally, a gene encoding the protein of the present invention is inserted into an appropriate expression vector, the vector is introduced into an appropriate cell, and the transformed cell is cultured and expressed. Purify. The recombinant protein can be expressed as a fusion protein with another protein for the purpose of facilitating purification or the like. For example, a method for preparing a fusion protein with maltose binding protein using E. coli as a host (vector pMAL series released by New England BioLabs, USA), a method for preparing a fusion protein with glutathione-S-transferase (GST) (Amersham Pharmacia Biotech Vector pGEX series released by the company), a method of preparing by adding a histidine tag (pET series from Novagen), etc. can be used. The host cell is not particularly limited as long as it is a cell suitable for the expression of a recombinant protein. For example, yeast, various animal and plant cells, insect cells and the like can be used in addition to the above-mentioned E. coli. Various methods known to those skilled in the art can be used to introduce a vector into a host cell. For example, for introduction into E. coli, introduction methods using calcium ions (Mandel, M. & Higa, A. Journal of Molecular Biology, 53, 158-162 (1970), Hanahan, D. Journal of Molecular Biology, 166 557-580 (1983)). The recombinant protein expressed in the host cell can be purified and recovered from the host cell or its culture supernatant by methods known to those skilled in the art. When the recombinant protein is expressed as a fusion protein with the above-described maltose-binding protein, affinity purification can be easily performed.

  If the obtained recombinant protein is used, an antibody that binds to the protein can be prepared. For example, a polyclonal antibody can be prepared by immunizing an immunized animal such as a rabbit with the purified protein of the present invention or a partial peptide thereof, collecting blood after a certain period, and removing the blood clot. is there. In addition, the monoclonal antibody is obtained by fusing an antibody-producing cell of an animal immunized with the protein or peptide and a bone tumor cell, and isolating a single clone cell (hybridoma) that produces the target antibody. Can be prepared. The antibody thus obtained can be used for purification and detection of the protein of the present invention. The present invention includes antibodies that bind to the proteins of the present invention.

These proteins and genes act as transcription factors involved in the control of isoquinoline alkaloid biosynthesis and are very useful in themselves. Furthermore, these proteins and genes encoding these proteins can be used to modify the alkaloid biosynthesis system. Moreover, isoquinoline alkaloid can also be produced in vivo and in vitro by using the transformed cell according to the present invention or the above protein. It is also possible to isolate a novel biosynthetic gene by isolating a genomic protein that binds to the protein. That is, the production method of this isoquinoline alkaloid is only required to use at least the above protein or transformed cell, and other specific methods, conditions, materials (substrate, etc.), enzyme, buffer solution, pH, temperature, reaction time. These can be set as appropriate and are not limited. For example, conventionally known enzymes involved in biosynthesis of isoquinoline alkaloids other than the above proteins, such as coclaurin-N-methyltransferase, N-methyl-coclaurin-3′-hydroxylase, berberine bridge enzyme, skorelin-9-O-methyl It may be used together with transferase, norcoclaurine-6-O-methyltransferase, (S) -3′-hydroxy-N-methylcoclaurine 4′-O-methyltransferase, and the like.
EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not restrict | limited to these Examples.

Preparation of EST library The EST library was prepared as described in JP-A No. 2004-121233. This will be briefly described below.
(1) Isolation of ESTs and comprehensive nucleotide sequencing 156 High-berberine production strain of Coptis japonica cultured cells that have been established and maintained for many years in the omnipotent regulatory mechanism laboratory of the Graduate School of Life Sciences, Kyoto University MRNA was extracted from -1 strain (selected strain) by the method described in the conventional literature (Choi, et al., J. Biol. Chem, 277: 830-835, 2002).

  In addition, the berberine high production strain 156-1 of the aurene is disclosed in JP-A-11-178579, JP-A-11-178579, and F. Sato, and Y. Yamada, Phytochemistry, 23 (2): 281. -385 (1984) can also be used for the production and selection. Then, reverse transcription was performed from the mRNA using Rous associated virus 2 reverse transcriptase (Takara) and SuperScript II reverse transcriptase (Invitrogen) according to the method of Gubler and Hoffman. After subcloning the obtained cDNA into the pDR196 vector, the 5 ′ base sequences of about 5000 randomly selected clones were determined using the Megabase system (Amersham Pharmacia).

Selection of berberine biosynthesis-related genes based on EST macroarray
A clone used for EST analysis was subjected to PCR amplification, and then blotted onto a Biodyne ATM (Pall) membrane at 0.38 mm intervals using a Biomek 2000 robot was used as a macroarray. In contrast to macroarrays, mRNA extracted from cultured aurene cell lines with different alkaloid productivity (156-1SMT as high-producing strains, CjY and Cj8 as low-producing strains) was reverse-transcribed with Superscript II reverse transcriptase (Gibco BRL). The amount of gene expression in each cell was quantified using ³² P-labeled probe.

  For detection in the macroarray, first, 0.5% SDS treatment was performed at room temperature for 5 minutes to remove weakly bound DNA and washed with milliQ water. Thereafter, prehybridization was performed with ExpressHyb (Clontech) solution containing 100 μg / ml ssDNA at 60 ° C. for 5-6 hours, and then a probe was added, and hybridization was performed at 60 ° C. for at least 16 hours. Then, 60 ° C, 30 minutes 2 x SSC, 1% SDS treatment 4 times, 60 ° C, 30 minutes 0.1 x SSC, 0.5% SDS once, 2x SSC treatment once at room temperature, Phosphor imaging Quantification was performed using plates (Fujix BAS2000). Data was analyzed with Array Vision ™ (Imaging Research Inc., Canada).

As a result of sequencing of clone 48 and presumed macroarray analysis of the function, it was judged that a gene having high expression in 156-1SMT and Cj8 and having low expression in CjY is highly likely to be a berberine biosynthesis-related gene.

  Clone 48 has been isolated as a clone showing homology with known transcription factors or signal transduction factors by determining the base sequence of clones randomly isolated from the above-mentioned EST library and conducting Blastx searches. is there. Whether or not the clone actually functions as a transcription factor was evaluated by screening with transient RNAi described later, and as a result of screening about 50 clones, a new function was found.

  Among them, the EST clone 48, which was considered to be a candidate gene that promotes alkaloid biosynthesis, was further sequenced. That is, full-length cDNA was isolated using Marathon cDNA Amplification Kit (Clontech), and its nucleotide sequence was determined. The determined base sequence is shown in SEQ ID NO: 1. This arrangement is shown in FIG. As a result of homology search using BLASTx based on the full-length sequence of clone 48 (ORF 684bp), homology with Arabidopsis thaliana putative bHLH transcription factor protein (E-value 1e-04) I found it.

Confirmation of expression level of berberine biosynthetic enzymes by gene function analysis and northern analysis of clone 48 Cultured cell lines with different berberine productivity (SMT: high berberine production strain, Cj8: SMT strain with high productivity but low biosynthesis enzymes Total RNA extracted from cells in the first week of passage of a strain with high gene expression (CjY: low berberine production strain) was electrophoresed on a gel containing formaldehyde and blotted onto a Biodyne ATM (Pall) membrane. In order to confirm the function of clone 48, which was estimated to be a transcription factor of the berberine biosynthesis system by homology search, it is one of the expression level of clone 48 and the berberine biosynthesis gene in these three kinds of auren strains The expression of 4'OMT ((S) -3'-hydroxy-N-methylcoclaurine-4'-O-methyltransferase) mRNA in cells was compared with that in previous literature (Hibi N., Higashiguchi S., Hashimoto T., Yamada Y., 1994, Plant Cell 6: 723-735). RNA extraction was performed according to the TIGR plant RNA extraction method (http://www.powow.com/akatlab/tigr.html) using TRIzol.

The results of Northern analysis are shown in FIGS.
The results of measuring the expression level of clone 48 are shown in FIG. The expression level of clone 48 mRNA clearly showed a good correlation with enzyme expression in the berberine biosynthesis system.
The results of measuring the expression level of 4′OMT are shown in FIG. From FIG. 3 and FIG. 4, the expression level of clone 48 and the expression level of 4′OMT, which is a berberine biosynthetic enzyme, showed a clear positive correlation. That is, the 4′OMT transcription level of clone SMT, medium strain Cj8, and low-producing strain CjY, in which the protein expression level of clone 48 is high, was high, medium and low, respectively.

Functional analysis of clone 48 by RNAi An experiment using the transient RNAi method was conducted to investigate how the expression of berberine biosynthetic system is affected by suppressing the expression of clone 48. .

Transient RNAi by introduction of dsRNA in clone 48
The RNAi protocol that creates a DNA construct (inverted repeat structure) that expresses dsRNA in the cell and introduces it into the cell to express dsRNA in the cell is very time-consuming and laborious. is there. Therefore, in this study, the transient RNAi method using dsRNA synthesized in vitro was used. Ourenberberine high production strain 156-1 was used as a target.

In vitro synthesis of dsRNA
In vitro preparation of dsRNA is described in R. Carthew and J. Kennerdell. (http://www.bioexchange.com/tools/protocol_detail. cfm? protocol_id = 31 # MMB101.
). Briefly, clone 48dsRNA was generated in vitro using the following PCR primers (see dashed line in FIG. 5):
5 'side: T7 promoter sequence + clone 48 gene specific region (lower case is T7 promoter sequence)
(5'-5'-taatacgactcactatagggagaccacGCACC AATAGATGCA CGAGA-3 ') (SEQ ID NO: 3),
3 'side: T7 promoter sequence + clone 48 gene specific region
(5'-taatacgactcactatagggagaccac GCAGAAGGTTCAGGAGCAAC-3 ') (SEQ ID NO: 4)
Ribomax Express kit (Promega) was used for in vitro synthesis of dsRNA. dsRNA was purified by phenol-chloroform-isopropanol extraction and dissolved in RNAse-free water.

Transformation of Ouren Protoplasts From SMT cells at the third week of passage, cell wall digestion solution (0.4% Onozuka cellulase R10 (Yakult Pharmaceutical Ind. Co.), 0.2% Macerozyme R10 (Yakult Pharmaceutical Ind. Co. ), 0.01% Pectolyase, 0.6 M sorbitol, 20 mM MES (pH 5.5) and 5 mM MgCl ₂ ). Approximately 1 g of cells was incubated overnight at 28 ° C. in 10 ml of the solution to obtain protoplasts.

dsRNA was introduced into protoplasts as described in Chiu et al. Curr. Biol., 6, 325-330 (1996). Briefly, after washing 3 times with W5 solution (154 mM NaCl, 125 mM CaCl ₂ .2H ₂ O, 5 mM KCl and 5 mM glucose), the protoplasts were added to MaCaM solution (0.4M mannitol, 20 mM CaCl ₂ Suspended in ₂ H ₂ O and 5 mM MES (pH 5.8) at 2 × 10 ⁶ protoplasts / ml.

The dsRNA and protoplasts were mixed gently at MaCaM solution, an equal volume of polyethylene glycol (PEG) solution (40% PEG, 0.4 M mannitol 0.1 M Ca (N0 ₃₎ dissolved in ₂ .4H ₂ 0, pH 10) slightly Added in increments. After gentle mixing, the protoplasts were incubated at 28 ° C. for 30 minutes, centrifuged and resuspended in 4 ml of W5 solution. After incubating at 28 ° C. and 40 rpm for 24 or 72 hours, protoplasts are recovered, and target clone 48, various alkaloid biosynthesis genes (specifically, TYDC (tyrosine decarboxylase, NCS (norcoclaurine synthase)) ), 6OMT (norcoclaurin-6-O-methyltransferase), CNMT (coclaurin-N-methyltransferase), CYP80B2 (cytochrome P450 80B2: N-methylcoclaurin-3'-hydroxylase), 4'OMT (( S) -3'-hydroxy-N-methylcoclaurine-4'-O-methyltransferase), BBE (berberine bridge enzyme), SMT (scourelin-9-O-methyltransferase), CYP719A (cytochrome P450 719A: canadine synthesis) Enzymes), see Figure 7 for the processes involved, and GA as a control not related to alkaloid biosynthesis PDH and actin transcription levels were measured.

Total RNA extraction and reverse transcription and RT-PCR
About 2-7 μg of total RNA was extracted from 3-4 × 10 ⁵ Ouren protoplasts using RNeasy kit (Qiagen) according to the manufacturer's instructions. After treatment with DNAse I, 10 μl aliquots were subjected to reverse transcription using Superscript III (Invitrogen). Reverse transcription was performed at 42 ° C.

PCR was performed in PE 9700 (Perkin-Elmer) using GoTaq DNA polymerase (Promega, USA). The primers used for each enzyme are exemplified below.
SMT; (GGATTTCTTTCAGTATGCTGG and TCTCTATCCGTCTCCCAATC), (SEQ ID NO: 5 and 6)
4'OMT; (ATGTTCTGGACATCAAAGCTC and ACCAACATCAACAAGTGAGTC), (SEQ ID NO: 7 and 8)
6OMT; (GCAGTGCAACTTGATCTAGCC and AGCTGGTTTTTCTCAGGGTGC), (SEQ ID NO: 9 and 10)
CNMT; (GCAACAGAGGTTGAGACCTTG and GCTGCTAGTCCTTTCTGGATG) (SEQ ID NOs: 11 and 12).
The amount of transcript was quantified by real-time PCR using the DyNAmoHS SybrGreen qPCR kit and MJ Research CFD-0200LCX. The results are shown in FIG. 6 and FIG.

  FIG. 6 shows the expression levels of clone 48, GAPDH and actin unrelated to the biosynthetic system in the clone-introduced dsRNA-introduced strain. By introducing the dsRNA of clone 48, it is confirmed that the RNAi phenomenon effectively inhibits the expression of clone 48. It was also confirmed that the expression of genes (actin, GAPDH) not related to the biosynthetic system was not affected by the suppression of the expression level of clone 48.

  FIG. 7 shows the expression levels of various berberine biosynthetic genes in strains into which clone 48 dsRNA was introduced. It was confirmed that by suppressing the expression of clone 48 with RNAi, the expression of all genes of the berberine biosynthesis system was suppressed. These experiments supported that clone 48 is a comprehensive transcription factor that positively regulates the berberine biosynthesis system.

  As described above, the present inventors have clarified that the novel protein according to the present invention is a transcriptional activator involved in isoquinoline alkaloid biosynthetic enzyme expression.

  According to the present invention, a gene encoding a transcription factor of an isoquinoline alkaloid biosynthesis system is provided. By isolating such a gene, a means for industrially mass-producing isoquinoline alkaloids useful as a raw material for pharmaceuticals will be secured, which has the potential to greatly contribute to the pharmaceutical industry.

It is a figure which shows an isoquinoline alkaloid biosynthesis pathway. FIG. 3 shows the full-length nucleotide sequence of clone 48 encoding a transcription factor according to the present invention. It is a figure which shows the expression level of the clone 48 in the strain | stump | stock from which berberine productivity differs. It is a figure which shows the expression level of 4'OMT of one of the biosynthetic enzymes in the strain from which berberine productivity differs. It is a figure which shows the primer used for the clone 48 which codes the transcription factor by this invention, and an Example. It is a figure which shows specific suppression of the expression of the clone 48 by transient RNAi. It is a figure which shows the expression suppression of the gene of the isoquinoline alkaloid biosynthesis pathway accompanying the expression reduction of the clone 48. FIG.

Claims (20)

  A gene comprising a polynucleotide comprising the 86th to 772th bases of the base sequence represented by SEQ ID NO: 1.   An isoquinoline alkaloid biosynthetic gene comprising a nucleotide sequence in which one or several bases or base pairs have been deleted, substituted or added in a polynucleotide comprising the 86th to 772th bases of the base sequence represented by SEQ ID NO: 1 A gene comprising a polynucleotide encoding a transcription factor that induces expression.   A polynucleotide encoding a transcription factor that hybridizes under stringent conditions with a polynucleotide consisting of nucleotides 86 to 772 of the nucleotide sequence represented by SEQ ID NO: 1 and induces expression of an isoquinoline alkaloid biosynthesis system gene. Including genes. A polynucleotide encoding a transcription factor that exhibits 90 % or more homology at the nucleotide level with a polynucleotide comprising the 86th to 772th bases of the base sequence represented by SEQ ID NO: 1 and induces isoquinoline alkaloid biosynthesis gene expression A gene containing nucleotides. Genes encoding the following proteins (a) or (b):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 2,
(B) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and acting as a transcription factor for inducing the expression of an isoquinoline alkaloid biosynthesis system gene .   The gene according to any one of claims 1 to 5, which is derived from an isoquinoline alkaloid-producing plant.   The gene of claim 6, which is derived from auren. The following protein (c) or (d):
(C) a protein comprising the amino acid sequence represented by SEQ ID NO: 2,
(D) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and acting as a transcription factor for inducing the expression of an isoquinoline alkaloid biosynthesis system gene . The following protein (e) or (f):
(E) a protein comprising the amino acid sequence represented by SEQ ID NO: 2,
(F) A protein that exhibits 90 % or more homology at the amino acid level with a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 and acts as a transcription factor that induces isoquinoline alkaloid biosynthesis gene expression.   A protein encoded by the gene of any one of claims 1 to 7.   A recombinant vector comprising the gene according to any one of claims 1 to 7.   A transformed plant cell comprising the recombinant vector of claim 11.   The transformed plant cell according to claim 12, which is an isoquinoline alkaloid-producing plant cell.   The transformed plant cell according to claim 13, which is an auren cell.   A step of culturing the transformed plant cell according to any one of claims 12 to 14, overexpressing a transcription factor that induces isoquinoline alkaloid biosynthesis system gene expression in the cell, and collecting the isoquinoline alkaloid from the obtained culture A method for producing an isoquinoline alkaloid, comprising a step.   16. The method of claim 15, wherein the isoquinoline alkaloid is berberine.   A transformed plant comprising the transformed plant cell according to claim 12.   The transformed plant according to claim 17, wherein the transformed plant is a plant, a plant organ, a plant tissue, or a plant cultured cell.   A method for inhibiting isoquinoline alkaloid biosynthesis in a plant, comprising the step of inhibiting the expression of a gene according to any one of claims 1 to 7. The method according to claim 19 , wherein the inhibition of expression is carried out by RNAi method.

Images