JP5004331B2 - HNF-4α activity inhibitor - Google Patents

Description

  The present invention relates to an inhibitor of HNF-4α (hepatocyte nuclear factor-4α) activity useful for the prevention or improvement of hypertriglyceridemia, fatty liver or diabetes.

  Low-molecular-weight lipophilic ligands such as steroids, thyroid hormones, and retinoids are diverse, such as morphogenesis in ontogeny, cell proliferation and differentiation, and maintenance of homeostasis through ligand-specific binding to nuclear receptors. Is involved in the regulation of physiological functions. The nuclear receptor binds to a ligand to change its steric structure and form a complex with a transcriptional coupling factor. This complex of a nuclear receptor and a transcription coupling factor binds to a specific sequence in the promoter region of the target gene, further recruits basic transcription factors, and controls the expression of the target gene at the transcription level.

  HNF-4α is a kind of nuclear receptor and has been identified as a transcription factor that is present in large amounts in the liver (Non-patent Document 1). Initially, HNF-4α was reported to activate transcription of target genes in the absence of exogenous ligands (Non-Patent Document 1), but in subsequent studies, a specific fatty acyl CoA was found to be HNF-4α. It was revealed that these are endogenous ligands of HNF-4α (Non-patent Document 2). HNF-4α is a gene involved in lipid transport such as MTP (microsomal triglyceride transfer protein), apoB (apolipoprotein B), and apoCIII (apolipoprotein CIII), and sugars such as PEPCK (phosphenolpyruvate carboxykinase) and G6Pase (glucose-6-phosphatase). It is known to positively control the expression of genes involved in metabolism. HNF-4α is expressed not only in the liver but also in the kidney and small intestine and is considered to be involved in the maintenance of energy metabolism and homeostasis in a wide range of organisms, including fatty acid synthesis, transport and secretion, and cell cycle regulation. Yes.

  Actually, in mice lacking HNF-4α specifically in the liver, decreased expression of MTP and apo protein in the liver, decreased serum cholesterol and serum triglycerides, and decreased body weight were observed (Non-patent Document 3). . Thus, the HNF-4α activity inhibitor has lipid metabolism regulating ability and sugar metabolism regulating ability, and is considered useful as an agent for preventing or improving hypertriglyceridemia, fatty liver and diabetes. However, there has been no report of an antagonist of HNF-4α so far.

  It has been found that the transcriptional activity of HNF-4α is suppressed by SHP (small heterodimer partner), which is one of the target genes of FXR (farnesoid X receptor) (Non-patent Document 4). In hepatoma-derived cell line HepG2 cells cultured with chenodeoxycholic acid (CDCA), an FXR ligand, gene expression of HTP-4α target genes MTP and apoB decreases and VLDL secretion decreases with increased SHP expression (Non-Patent Document 5). However, since CDCA is metabolized to toxic lithocholic acid, it is considered difficult to utilize it as a medicine or food. From the above, it is desired to identify a safe and excellent compound having the ability to suppress HNF-4α activity.

On the other hand, nitrogenistin is a flavonoid-like compound and is known to have a tyrosine kinase inhibitory action (Non-patent Document 6).
However, it is not known that nitrogenistin has the ability to regulate lipid metabolism or sugar metabolism.
Sladek, FM, et al., Genes Dev., 4, 2353-2365, 1990 Hertz, R., et al., Nature, 392, 512-516, 1998 Hayhurst, GP, et al., Mol. Cel. Biol., 21, 1393-1403, 2001 Lee, Y., et al., Mol. Cell Biol., 20, 187-195, 2000 Hirokene, H., et al ,. J. Biol. Chem., 279, 45685-45692, 2004 Cushman, M., et al., J. Med. Chem., 34, 798-806, 1991

  The present invention relates to providing a medicament or food useful for preventing or improving hypertriglyceridemia, fatty liver or diabetes.

  In view of the above problems, the present inventors have searched for various substances, and as a result, nitrogenistein has an inhibitory action on HNF-4α activity and is related to lipid metabolism targeted by FXR and LXRα (liver X receptor α). It was found to have a gene expression regulating action.

That is, the present invention relates to the following 1) to 5).
1) An HNF-4α activity inhibitor containing nitrogenistain as an active ingredient.
2) FXR target gene expression regulator containing nitrogenistain as an active ingredient.
3) LXRα target gene expression regulator comprising nitrogenistain as an active ingredient.
4) A lipid metabolism regulator comprising nitrogenistain as an active ingredient.
5) A sugar metabolism regulator comprising nitrogenistain as an active ingredient.

  ADVANTAGE OF THE INVENTION According to this invention, the pharmaceutical or foodstuff which exhibits the lipid-metabolism regulation ability and glucose metabolism regulation ability which were excellent through suppression of HNF-4 (alpha) activity, and is useful for prevention or improvement of hypertriglyceridemia, fatty liver, or diabetes is provided. can do.

  In the present invention, nitrogenigenin is 4'-Nitro-6-hydroxyflavone, which is a compound represented by the following structural formula.

  Such nitrogenistein can be produced, for example, by the method described in Cushman, M., et al., J. Med. Chem., 34, 798-806, 1991. Moreover, you may use commercially available nitrogeni stains, such as the product made from ALEXIS.

  Nitrogenstein has a transcriptional activity suppression action (Example 1) of HNF-4α, as shown in Examples below, and is a target gene of HNF-4α, MTP (microsomal triglyceride transfer protein), apoB (apolipoprotein B) ApoCIII (apolipoprotein CIII), PEPCK (phosphenolpyruvate carboxykinase), and G6Pase (glucose-6-phosphatase) gene expression inhibitory effect (Example 2). Here, since MTP, apoB, and apoCIII are triglyceride secretion-related genes, and PEPCK and G6Pase are gluconeogenesis-related genes, nitrogenistin suppresses secretion of triglycerides from the liver and suppresses increase in blood triglycerides. At the same time, gluconeogenesis is suppressed, and it is considered effective for blood glucose control and diabetes prevention or improvement.

  Moreover, it is known that the transcriptional activity of HNF-4α is suppressed by SHP (small heterodimer partner) which is one of target genes of FXR (farnesoid X receptor) (Non-patent Document 4), It was revealed that genistein has an action (Example 3) that enhances the expression of SHP (small heterodimer partner) and PLTP (phospholipids transfer protein) which is a lipid secretion and transport related gene. That is, nitrogenisin is thought to suppress the transcriptional activity of the nuclear receptor for HNF-4α via SHP, which is an FXR target gene. Therefore, nitrogenistin can be an FXR target gene regulator that exerts lipid metabolism / sugar metabolism regulation effect.

  Furthermore, there is LXRα (liver X receptor α) as a nuclear receptor controlled by SHP as in HNF-4α. Nitrogenstein is a fatty acid synthesis-related gene, SREBP1c (sterol regulatory element) which is a target gene of LXRα. Binding protein), ACC1 (acetyl-CoA carboxylase), and FAS (fatty acid synthase) were also confirmed to have an action to suppress their expression (Example 4). Therefore, nitrogenistin can be an LXRα target gene regulator that suppresses liver fatty acid synthesis and exerts a preventive or therapeutic effect on liver fat.

  Thus, nitrogenistin is used as an HNF-4α activity inhibitor, lipid metabolism regulator, sugar metabolism regulator, FXR target gene regulator, and LXRα target gene regulator (hereinafter referred to as HNF-4α activity inhibitor, etc.). It can also be used to produce HNF-4α activity inhibitors and the like. The said HNF-4 (alpha) activity inhibitor etc. can be used as a pharmaceutical for humans or animals, a quasi-drug, or a foodstuff which exhibits the effect of preventing or improving hypertriglyceridemia, fatty liver, or diabetes. The HNF-4α activity inhibitor, etc. is based on the concept of prevention or improvement of hypertriglyceridemia, fatty liver or diabetes, etc., and if necessary, beauty food, food for the sick or for specified health use It can be used as a functional food such as food.

  Examples of the dosage form when the HNF-4α activity inhibitor of the present invention is used as a pharmaceutical agent include oral administration or injection by tablets, capsules, granules, powders, syrups, enteric solvents, troches, drinks, etc. Parenteral administration with suppositories, transdermal absorption agents, external preparations and the like. In order to prepare pharmaceutical preparations of such various dosage forms, the nitrogenistin of the present invention alone or other pharmaceutically acceptable excipients (sorbitol, glucose, lactose, dextrin, starch, etc.) Saccharides, inorganic substances such as calcium carbonate, crystalline cellulose, distilled water, sesame oil, corn oil, olive oil, rapeseed oil, etc.), binders, lubricants, extenders, disintegrants, surfactants, lubricants, dispersants, Suspending agents, emulsifiers, buffers, preservatives, flavoring agents, fragrances, coating agents, carriers, diluents, antioxidants, bacterial inhibitors, and the like can be used in appropriate combinations. Among these dosage forms, the preferred form is oral administration, and when used as a preparation for oral administration, the content of the nitrogenistin of the present invention in the preparation is usually 0.001 to 80% by mass in the preparation. Of these, it is preferable, and it is more preferable to set it as 0.5-80 mass% especially.

Examples of the case where the HNF-4α activity inhibitor of the present invention is used as a food include, for example, processed wheat foods such as bread and noodles, rice processed foods such as rice cakes and cooked rice, biscuits, cakes and jelly , Chocolate, rice crackers, ice cream and other sweets, tofu, processed processed foods such as processed foods, soft drinks, fruit juices, milk drinks, carbonated drinks, and other dairy products such as yogurt, cheese, butter and milk Seasonings such as soy sauce, sauce, miso, mayonnaise, dressing, meat storage such as ham, bacon, sausage, processed meat products, processed fish food such as hampen, chikuwa, canned fish, cooking oil and frying oil . In addition, it may be in the form of tablet foods such as capsules, concentrated liquid foods, natural liquid foods, semi-digested nutritional foods, component nutritional foods, drink nutritional foods, oral enteral nutrition foods, functional foods, etc. it can.
In order to prepare various forms of food and drink, the nitrogenistain of the present invention alone or other food materials, solvents, softeners, oils, emulsifiers, preservatives, fragrances, stabilizers, colorants, oxidation An inhibitor, a humectant, a thickener and the like can be used in appropriate combination. The content of nitrogenistin of the present invention in the food is generally preferably 0.001 to 1% by mass, more preferably 0.002 to 0.2% by mass, particularly 0.005 to 0.05% by mass. % Is preferable.

  When the HNF-4α activity inhibitor or the like of the present invention is used as a pharmaceutical or food, the daily administration or intake amount per adult is, for example, 5 to 2000 mg, more preferably 10 to 1000 mg, particularly as nitrogenisin of the present invention. It is preferable to set it as 20-500 mg. The preparation is preferably administered once to several times a day.

Example 1 Evaluation of ability of nitrogenistein to suppress HNF-4α activity

  The ability of nitrogenistin to inhibit HNF-4α activity was evaluated by luciferase assay. Human liver-derived cell line HepG2 is seeded in a 12-well plate and 10% fetal bovine serum (FBS, ICN Biomedicals) and 100 units / ml penicillin, 100 μg / ml streptomycin (Invitrogen) and Dulbecco's medimemedi'em medi In SIGMA), the cells were cultured for 1 day. The evaluation is based on the MTP reporter plasmid (MTPp-Luc) in which the human MTP promoter region (nt-204 to +33, Genbank NM_000253), which is one of the HNF-4α target genes, is linked upstream of the firefly luciferase gene of the pGV-B2 vector. ) And DR1 reporter plasmid (DR1-Luc) in which DR1 (AGTTTGGAGTCTGAGAGTTGGATCTG (SEQ ID NO: 1)), a consensus binding sequence of HNF-4α, was linked upstream of the firefly luciferase gene of the pGV-P vector. A control plasmid (phRL-TK, Promega) ligated with a thymidine kinase promoter gene upstream of the reporter plasmid and the Renilla luciferase gene was simultaneously added at 0.33 and 0.03 μg per well, respectively, as a gene introduction reagent (Lipofectamine2000, Promega). Was used to introduce genes into HepG2 cells. After the gene transfer, the medium was replaced with a serum-free DMEM medium containing 20 μM nitrogenstein and further cultured for 24 hours.

A dual luciferase assay system (Promega) was used for luciferase activity measurement. Cells were lysed, a substrate solution containing luciferin was added to the lysate, and firefly and Renilla luciferase luminescence was measured with a luminometer (MiniLumat, Bertoled). By measuring the luciferase activity (HNF-4α transcriptional activity) in this experimental system, the HNF-4α activity inhibitory substance was evaluated. Luciferase activity (transcription activity of HNF-4α) was calculated by the following formula. Luciferase activity (transcription activity of HNF-4α) = (measured value of firefly luciferase luminescence by MTPp-Luc or DR1-Luc) / (measured value of renilla luciferase luminescence by phRL-TK)
The luciferase activity was expressed as a relative value with the transcriptional activity of HNF-4α by DMSO as a solvent control being 1.

  As shown in FIG. 1, in any of the reporter vectors, 20 μM nitrogenistin inhibited the transcriptional activity of HNF-4α to 30% or less. Thus, nitrogenisin is found to suppress HNF-4α transcriptional activity.

Example 2 Inhibition of HNF-4α Target Gene Expression by Nitrogenstein The influence of nitrogenistain on HNF-4α target gene expression was analyzed. The human liver-derived cell line HepG2 was seeded in a 12-well plate and cultured in DMEM containing 10% charcoal-treated FBS and 100 units / ml penicillin, 100 μg / ml streptomycin (Invitrogen) for 1 day. On the first day from the start of the culture, the medium was replaced with serum-free DMEM, and on the second day, the medium was replaced with a medium containing 1, 5, 10 μM nitrogenistein or 10 μM genistein. Total RNA was extracted from the cells 24 hours after the addition using an RNA extraction reagent. Reverse transcription reaction was performed using 125 ng of the extracted total RNA. Using synthesized cDNA (total RNA: 6.25 ng), by real-time PCR method, triglyceride secretion-related genes (MTP, apoB, apoCIII), gluconeogenesis-related genes (PEPCK, G6Pase) which are target genes of HNF-4α ) MRNA expression level was quantified.

The primer sequences used for the analysis are shown below.
<MTP amplification primer>
5 'side: GCATGCCAGATGGACAAGGATGAAG (SEQ ID NO: 2)
3 ′ side: CCGTGGAAGTACCATCCGCC (SEQ ID NO: 3)
<Primer for apoB amplification>
5 'side: GCCATTGCGACGAAGAAAAATA (SEQ ID NO: 4)
3 ′ side: TGACTGTGGTTGATTGCAGCTT (SEQ ID NO: 5)
<Primer for apoCIII amplification>
5 'side: TCAGTTCCCTGAAAGATACCTGGGA (SEQ ID NO: 6)
3 ′ side: ATGGATAGGGCAGGTGGAACTTG (SEQ ID NO: 7)
<PEPCK amplification primer>
5 'side: GTGCTGGAGTGGATGTTCAAC (SEQ ID NO: 8)
3 'side: ACATCTGGCTTATTCTTTGCTTC (SEQ ID NO: 9)
<G6Pase amplification primer>
5 'side: GCCTCAGCTCTATTTGTAGCCTC (SEQ ID NO: 10)
3 ′ side: CCGCACTCTTGCAGAAGGACA (SEQ ID NO: 11)
<36B4 amplification primer>
5 'side: CTGATCATCCAGCAGGTGTT (SEQ ID NO: 12)
3 ′ side: CCAGGAAGGCCTTGACCTT (SEQ ID NO: 13)

  The analysis was performed using SYBR Green Master Mix and ABI PRISM 7000 Sequence Detection System (Applied Bio Japan), and the mRNA expression level of each gene was corrected by the mRNA expression level of 36B4 gene. Moreover, the gene expression level is shown as a relative value with the gene expression level in DMSO used as a control as 1.

  As shown in FIG. 2, gene expression levels of HTP-4α target genes MTP, apoB, apoCIII, PEPCK, and G6Pase were suppressed in a concentration-dependent manner in HepG2 cells cultured in the presence of nitrogenistin. Therefore, it can be seen that nitrogenistin having an inhibitory action on HNF-4α activity actually suppresses the expression of the target gene of HNF-4α. In other words, nitrogenistin is effective in suppressing the increase in blood triglyceride by suppressing the secretion of triglyceride from the liver, and it is considered effective in controlling blood glucose and diabetes by suppressing gluconeogenesis.

Example 3 Regulation of FXR target gene expression by nitrogenistin The influence of nitrogenistine on FXR target gene expression was analyzed. In the same manner as in Example 3, HepG2 cells were cultured with 1, 5, and 10 μM nitrogenistin, and were subjected to Real-time PCR to SFX as an FXR target gene and PLTP (phospholipids transfer protein) as a lipid secretion transport-related gene. The mRNA expression level was quantified.

The primer sequences used for the analysis are shown below.
<Primer for SHP amplification>
5 'side: AACTGCCCAGACAGACCCCAG (SEQ ID NO: 14)
3 'side: GCACCAGGGTTCCAGGACTT (SEQ ID NO: 15)
<Primer for PLTP amplification>
5 ′ side: ATTCCAACCATTCTGCACTGG (SEQ ID NO: 16)
3 ′ side: TGCACAAAGTTGATGCCCTC (SEQ ID NO: 17)

  As shown in FIG. 3, gene expression levels of SHP and PLTP were enhanced in HepG2 cells cultured in the presence of nitrogenistin. Therefore, in Example 3, it was revealed that nitrogenistin, which was shown to suppress the expression of the HNF-4α target gene, was also useful as an FXR target gene expression regulator. In other words, nitrogenistin is thought to be effective in regulating lipid metabolism and sugar metabolism by suppressing the transcriptional activity of nuclear receptors such as LXRα and HNF-4α via SHP.

Example 4 Regulation of LXRα Target Gene Expression by Nitrogenstein The influence of nitrogenistine on LXRα target gene expression was analyzed. In the same manner as in Examples 3 and 4, HepG2 cells were cultured with 1, 5, 10 μM nitrogenistin, and SREBP1c (sterol regulatory element binding protein, which is a gene related to fatty acid synthesis, which is a target gene of LXRα, was obtained by Real-time PCR. ), ACC1 (acetyl-CoA carboxylase), and FAS (fatty acid synthase) mRNA expression levels were quantified.

The primer sequences used for the analysis are shown below.
<SREBP1c amplification primer>
5 'side: AGGGGGTAGGCCAACGGCCCT (SEQ ID NO: 18)
3 'side: GAAGCATGTCTTCGAAAGTGCAATCC (SEQ ID NO: 19)
<Primer for FAS amplification>
5 'side: GTAGGTGTTAGGGCATGTCCCA (SEQ ID NO: 20)
3 'side: GGTCTCTACCAGCAATGCAAT (SEQ ID NO: 21)
<Primer for ACC1 amplification>
5 'side: GGAGATGTACCGCTGACCGAGAA (SEQ ID NO: 22)
3 ′ side: ACCGACGCGCATGGTTTTCA (SEQ ID NO: 23)

  As shown in FIG. 4, in HepG2 cells cultured in the presence of nitrogenistin, the gene expression levels of LRERa target genes SREBP1c, FAS, and ACC1 were suppressed in a concentration-dependent manner. Therefore, nitrogenistain is useful as an LXRα target gene expression regulator, as shown in Examples 2 and 3, in which nitrogenistein showed an HNF-4α target gene expression suppressing action and an FXR target gene expression regulating action. It became clear that there was. In other words, nitrogenisin is considered to be effective in suppressing liver fat by inhibiting liver fatty acid synthesis.

Example 5 Suppression of Apolipoprotein B Secretion by Nitrogenstein The influence of nitrogenistine on apolipoprotein B (apoB) secretion was analyzed. A human liver-derived cell line HepG2 was plated on a 6-well plate and cultured in DMEM containing 10% charcoal-treated FBS and 100 units / ml penicillin, 100 μg / ml streptomycin (Invitrogen). On the first day from the start of the culture, the medium was replaced with a medium containing 5 μM nitrogenistin and 5% lipoprotein-deficient serum (LPDS). On the second day after the addition, the medium was replaced with serum-free DMEM containing nitrogenistein, and cells and medium were collected 18 hours later. ApoB secreted into the medium was quantified using a Total human apolipoprotein B ELISA Assay kit (ALerCHEK). Each value was corrected by the amount of intracellular protein.

  As shown in FIG. 5, apoB secretion was suppressed in HepG2 cells cultured in the presence of nitrogenistin. Therefore, in Example 3, it was revealed that nitrogenistein, which was shown to suppress gene expression of HTP-4α target genes MTP and apoB, actually suppressed apoB secretion.

Example 6
Using the following ingredients, one tablet of 200 mg was produced according to a conventional method.

Example 7
Using the following ingredients, one tablet of 200 mg was produced according to a conventional method.

Example 8
100 g of tea leaves were extracted with 1000 g of distilled water at a temperature of 80 ° C. for 10 minutes to prepare a filtered tea extract. Next, the following components were mixed, degassed, heat-treated at 139 ° C. for 10 seconds, and then filled into a 500 mL plastic bottle to produce a container-packed beverage.

The graph which showed the ability to inhibit HNF-4α activity of nitrogenistin. Mean ± S.D. **: p <0.01 The graph which showed the ability to regulate HNF-4α target gene expression of nitrogenistin. Mean ± S.D. *: p <0.05, **: p <0.01 The graph which showed the FXR target gene expression control ability of nitrogenistin. Mean ± S.D. *: p <0.05, **: p <0.01 The graph which showed the LXR (alpha) target gene expression control ability of nitrogenistin. Mean ± S.D. *: p <0.05, **: p <0.01 The graph which showed the apoB secretion suppression ability of nitrogenistin. Mean ± S.D. *: P <0.05

Claims (6)

  An HNF-4α activity inhibitor containing nitrogenistain as an active ingredient.   FXR target gene expression regulator containing nitrogenistain as an active ingredient.   A LXRα target gene expression regulator comprising nitrogenistain as an active ingredient. An apolipoprotein B secretion inhibitor containing nitrogenistain as an active ingredient.   A lipid metabolism regulator containing nitrogenistain as an active ingredient.   A glucose metabolism regulator comprising nitrogenistain as an active ingredient.

Images