JP4967135B2 - Evaluation method of earwax type or armpit odor - Google Patents

Description

  The present invention relates to a method for evaluating an earwax type or an armpit odor of an individual using a specific single nucleotide polymorphism of ABCC11 gene as an index.

Ear wax is a secretory product of the apocrine gland of the external auditory canal and is a Mendelian inheritance consisting of two types, wet and dry. Wet earwax is a prototype in humans and is characterized as a light tan to dark brown resinous sticky earwax. On the other hand, the dry type is a trait lacking earwax. The wet mold is completely dominant over the dry mold.
Dry earwax is quite common in East Asians, including Mongolians, North Chinese, Koreans, Tibetans, and Japanese (mainland) (80-95%) and occupies a large number (References 1-8). However, the dry type is rare (~ 1%) in people from Northwestern Europe and Africa. In contrast, dryness in South Asia (~ 30%), Pacific Islands (~ 40%), Central Asia (~ 40%), Asian minorities (~ 30%) and Eastern Europe (~ 3%). The frequency of the mold shows an intermediate value (References 1, 9, 10) as in the case of Asian American natives (30-50%) and Inuit (˜50%). Accordingly, these numbers indicate a geographical gradient distribution.
The present inventor has previously conducted a linkage analysis of a Japanese family with about 5. between the D16S3093 marker and the D16S3117 marker in which the ear locus is located near the centromere of chromosome 16 (16q11.2-q12.1). It was positioned in the genomic region of 9 cM (centiorgan) (Reference 11). However, the gene that determines the earwax type and its polymorphism were not known.
Reference:
1. Matsunaga E: The dimorphism in human normal cerumen. Ann J Hum Genet 25: 273-286, 1962
2. Petrakis NL, Molohon KT, Tepper DJ: Cerumen in American Indians: Genetic implications of sticky and dry types. Science 158: 1992-1993, 1967
3. Petrakis NL: Dry Cerumen-a prevalent genetic trait among American Indians. Nature 222: 1080-1081, 1969
4). Martin LM and Jackson JF: Cerumen types in Choctaw Indians. Science 163: 677-668, 1969.
5. Alfred BM, Stout T .; D, Lee M, Birkbeck J, Petrakis NL: Blood groups, phosphoglucomutase, and cerumen types of the Anaham (Chilcottin) Indians. Am J Phys Anthropol 32: 329-338, 1970
6). Omoto K: Polymorphic traits in people of eastern Asia and the Pacific. Israel J Med Sci 9: 1195-1215, 1973
7). Patel S: Study on some genetic traits of Tibetans at a Chandragiri, district Ganjam, Orissa. Am J Phys Anthopol 38: 755-756, 1973
8). Norakmal I, Tan SG: Cerumen polymorphism in the three major ethnic groups of Malaysia. Jpn J Hum Genet 24: 119-121,1979
9. Spitsyn VA, Afanas e va I: Genetic geometry of inherited dimorphism of ear wax by consistency. Genetika 25: 184-1860, 1989
10. Petrakis NL, Pingke U, Petrakis SJ, Petrakis SL: Evidence for genetic line in the neareast type and Southeast Asia. Am J Phys Anthropol 35: 141-144, 1971
11. Tomita H-A, Yamada K, Ghadami M, Ogura T, Yanai Y, Nakatomi K, Sadamatsu M, Masui A, Nanko S, Kato N, Niwa wa wa wa: Mapping. . Lancet 359: 2000-2002, 2002

An object of the present invention is to provide a method for evaluating an earwax type (dry type or wet type) of an individual using a genetic variation (polymorphism) of the ABCC11 gene, and a method for evaluating armpit odor.
In order to solve the above-mentioned problems, the present inventor diligently conducted genomic medicine research. And in the gene which codes ABCC11, the base substitution mutation (single nucleotide polymorphism) of the 538th base sequence and 27 base deletion ranging from the 3939th to the 3965th were found. The former single nucleotide polymorphism is referred to as “c.538G> A”. This mutation was a polymorphism resulting in substitution of the 180th glycine to arginine in the amino acid sequence of ABCC11. Furthermore, the present inventor has revealed for the first time that the single nucleotide polymorphism and the 27 nucleotide deletion are DNA polymorphisms that directly determine human dimorphic inheritance, thereby completing the present invention. It came.
That is, the present invention is as follows.
(1) A method for evaluating earwax characterized by associating the gene polymorphism of the 538th base in the base sequence of the gene encoding ABCC11 with the dry or wet type of individual earwax.
(2) Of the nucleotide sequence of the gene encoding ABCC11, the gene polymorphism of the following (a) or (b) is associated with the dry or wet type of individual earwax, characterized in that .
(A) Gene polymorphism of the 538th base and gene polymorphism in which the 27th base from the 3939th to the 3965th is deleted (b) Gene polymorphism in which the 27th base from the 3939th to the 3965th is deleted (3) In the above (1) or (2), the gene polymorphism of the 538th base is preferably a single nucleotide polymorphism. The gene polymorphism of the 538th base may form a linkage disequilibrium block.
In the above method (1), earwax is evaluated by diagnosing it as a wet type when the polymorphism of the 538th base is a heterozygous GA or a homozygous GG. In the method of (2) above, the evaluation of earwax is based on homozygous alleles in which the genetic polymorphism is deleted from the 27th base of 3939th to 3965th. Or a heterozygote of a deleted allele of the 27th base from the 3939th to the 3965th base and a normal allele and the 538th base of the normal allele is A is diagnosed as a dry type In addition, when the heterozygote of the deleted allele of the 27th base from the 3939th to the 3965th and the normal allele and the 538th base of the normal allele is G is diagnosed as a wet type It is possible .
(4) A method for evaluating armpit odor, which comprises associating a genetic polymorphism of the 538th base in the base sequence of the gene encoding ABCC11 with the armpit odor of an individual.
(5) A method for evaluating earwax characterized by associating the following gene polymorphism (a) or (b) with the armpit odor of an individual in the base sequence of the gene encoding ABCC11.
(A) Gene polymorphism of the 538th base and gene polymorphism in which the 27th base from the 3939th to the 3965th is deleted (b) Gene polymorphism in which the 27th base from the 3939th to the 3965th is deleted (6) In the above (4) or (5), the gene polymorphism of the 538th base is preferably a single nucleotide polymorphism. The gene polymorphism of the 538th base may form a linkage disequilibrium block.
(7) In the method of (4), when the genetic polymorphism at the 538th base is heterozygous for GA or homozygous for GG, it is estimated that the armpit odor is evaluated. It can be estimated that it is not an armpit odor when homozygous for AA. In the method (5), the evaluation of the armpit odor is performed when the genetic polymorphism is homozygous for an allele from which the 3939th to 3965th 27 bases have been deleted, or from the 3939th to 3965th. It is presumed that it is not an armpit odor when it is a heterojunction of the deleted allele of the 27 th base and the normal allele and the 538 th base of the normal allele is A, and from the 3939 th to 3965 It can be presumed that it is an armpit odor when it is a heterozygote of the deleted allele of the 27 th base and the normal allele and the 538th base of the normal allele is G.
(8) A method of determining the type and / or amount of a drug for treating armpit odor or a cosmetic used for an individual using the result evaluated by any one of the methods (4) to (7) as an index.
(9) An oligonucleotide comprising a sequence of at least 10 bases including the 538th base in a base sequence of a gene encoding ABCC11 or a sequence complementary thereto.
(10) An oligonucleotide comprising a sequence of at least 10 bases sandwiching a deletion site of 27 bases ranging from the 3939th position to the 3965th position among the base sequence of the gene encoding ABCC11 or a complementary sequence thereto.
The oligonucleotide of the present invention has a length of, for example, 10 to 50 bases, but is not limited thereto.
(11) A kit for evaluation of earwax or armpit odor comprising the oligonucleotide of (9) or (10) above.

FIG. 1 is a diagram showing the relationship between various alleles and phenotypes.
FIG. 2 is a diagram showing the relationship between SNP markers and p values in various genes.
FIG. 3 is a diagram showing a geographical gradient distribution in a world contour map in which various frequencies of allele A are plotted.

Hereinafter, the present invention will be described in detail. However, the scope of the present invention is not limited to these descriptions, and modifications other than the following exemplifications can be made as appropriate without departing from the spirit of the present invention.
It should be noted that all prior art documents cited in the present specification, as well as published publications, patent publications, and other patent documents are incorporated herein by reference. This specification includes the entirety of Japanese Patent Application No. 2005-178563, which is the basis for claiming priority of the present application.
The present invention relates to the nucleotide substitution (“c.538G> A (Gly180Arg)”) or “c.538G” in the nucleotide sequence (for example, SEQ ID NO: 1) of a gene encoding ABCC11 (also referred to as “ABCC11 gene”). > A ”), and a 27-base deletion spanning from the 3939th position to the 3965th position as an index. “Evaluation” means that a certain gene mutation (the mutation revealed in the present invention is a gene polymorphism) is linked to a phenotype, and if it has a certain gene mutation (polymorphism), it has a specific phenotype. Means estimation, determination, determination or diagnosis. Here, the gene polymorphism means a gene mutation occurring at a frequency of 1% or more in the general population.
The present inventor found that at the 538th base, when the genotype was AA homozygous, it was a dry earwax type, and when it was GA heterozygous or GG homozygous, it was a wet earwax type. In addition, the present inventor has confirmed that c. A 27 base deletion (Δ27) spanning positions 3939 to 3965 in exon 28 of the ABCC11 gene, independent of 538G> A, was also found. Further, in the functional analysis assay in which a cDNA in which the 538th base of ABCC11 gene is G [allyl G (wet ear wax type)] or A [allyl A (dry ear wax type)] was introduced into LLC-PK1 cells, It was also found that LLC-PK1 cells having an A-derived arginine residue have a lower ability to transport cGMP from the inside of the cell to the outside of the cell than that of glycine derived from allyl G. The present invention has been completed based on these findings.
ABCC11 gene
ABCC11 (ATP-binding cassette, superfamily C, member 11) gene is an earwax-determining gene located in the 16q12.1 region of human chromosome 16. A gene encoding ABCC11 protein is, for example, shown in SEQ ID NO: 1, and ABCC11 consists of an amino acid sequence of 1,382 amino acid residues (SEQ ID NO: 2). ABCC11, also referred to as multidrug resistance-associated protein 8 (MRP8), contains two ATP-binding domains and 12 transmembrane domains (Yabuchi et al., 2001; Tammur et al. 2001; Bera et al., 2001). “Encode ABCC11” means that translation into the ABCC11 protein of the genomic sequence is performed.
The ABCC11 gene hybridizes under stringent conditions with DNA consisting of the base sequence shown in SEQ ID NO: 1 and DNA consisting of a base sequence complementary to the DNA consisting of the base sequence shown in SEQ ID NO: 1 above. DNA that encodes a protein that functions as ABCC11 and that is soybean (molecular hybrid formation), and includes a base in which the 538th base is G or A. As stringent conditions, for example, a salt concentration at the time of washing in hybridization is 100 to 900 mM, preferably 150 to 300 mM, and a temperature is 50 to 70 ° C., preferably 55 to 65 ° C. The hybridizing DNA is at least 50% or more, preferably 70%, more preferably 80%, even more preferably 90% (for example, 95% or more, further 99%) with respect to the base sequence shown in SEQ ID NO: 1. %)).
The ABCC11 gene can be obtained from a cDNA library and a genomic library by a method known to those skilled in the art (for example, a known hybridization method such as colony hybridization). Moreover, the ABCC11 gene is registered in GenBank, and its sequence information can be easily obtained (Accession number AF367202). In addition, the base sequence shown by sequence number 1 respond | corresponds to the base of the coding region (the 79th-4227th) of the base sequence registered into the said Accession number AF367202.
Genetic polymorphism analysis
In the present invention, gene polymorphism mainly includes single nucleotide polymorphism (SNP) and insertion / deletion polymorphism at the 538th base in the base sequence of ABCC11 gene.
SNP means a polymorphism resulting from substitution of one specific base of a gene with another base. However, in the present invention, in addition to the polymorphism by substitution of the 538th base, the polymorphism in which the 538th base is deleted or another base is inserted at the 538th (insertion / deletion polymorphism). Type). The positions “538th” and “3939th to 3965th” mean positions in the coding region of the base sequence of the ABCC11 gene.
Further, the gene polymorphism cSNP (c.538G> A) of the present invention is present in a region of linkage disequilibrium. Here, linkage disequilibrium means that a polymorphism and a polymorphism are closely linked and deviate from the equilibrium state according to Mendel's independent law. cSNP means SNP existing in a coding region in SNP that is translated into a functional protein.
The present inventor has found that the SNPs can be classified by haplotype. A haplotype means one set (genetic composition) of alleles (alleles) such as genes and SNPs adjacent to each other on the same chromosome. SNPs that are close together on the genome are inherited in blocks with strong linkage disequilibrium (linkage disequilibrium blocks). If several SNPs appear in association with a certain phenotype (eg, the development of armpit odor), a representative SNP that constitutes a linkage disequilibrium block without typing all the individual SNPs Can be used to clarify the relationship between the patient's genotype and phenotype. The present inventor was able to estimate a strong linkage disequilibrium block in the ABCC11 gene region from the results of haplotype analysis.
Therefore, the present invention provides a method using not only the above SNP but also a haplotype as a gene polymorphism used for evaluating drug sensitivity.
Therefore, by analyzing the cSNP (c.538G> A) or haplotype that has been clarified in the present invention, it is possible to evaluate whether or not it is an individual's earwax type or armpit odor. Moreover, since ABCC11 gene is a gene involved in sensitivity and resistance to anticancer drugs such as DNA analogs, the sensitivity to anticancer drugs is estimated using cSNP (c.538G> A) or haplotype of the present invention. You can also This drug sensitivity is important information for determining the type and amount of the drug. In particular, anti-cancer drugs can cause serious social problems such as causing serious side effects depending on how they are used, so it is extremely useful to know the appropriate dosage in advance for each individual before dosing. It is.
In the present invention, a method for obtaining genetic polymorphism information can be obtained using a general polymorphism detection method. For example, cSNP (c.538G> A), which is a single nucleotide polymorphism at the 538th base in the ABCC11 gene, is a base sequence determination method, a method by PCR, a TaqMan PCR method, an invader method, a DNA chip method, A method using a primer extension reaction or the like is employed.
A commercially available kit can be used for polymorphism information analysis represented by SNP, and automation is also possible.
Phenotypic analysis
c. 538G> A is a determinant of earwax type, and in the earwax phenotype, both GG homozygous and GA heterozygous genotypes are wet earwax types, and the AA homozygous genotype is associated with dry earwax types be able to. C. A haplotype consisting of three polymorphic sites including 538G> A forms a strong linkage disequilibrium block in the Japanese.
c. 538G> A causes a glycine → arginine substitution (Gly180Arg) at amino acid position 180 of the ABCC11 (MRP8) protein. A cell having MRP8 (cell membrane protein) in which amino acid position 180 is an arginine residue has a lower secretion function of cGMP than a cell having a glycine residue. This amino acid substitution site is located in the first transmembrane domain of MRP8, and the glycine → arginine substitution is presumed to cause functional impairment as a drug efflux pump protein.
Although the physiological substrate of MRP8 in vivo is still unknown, in recent studies, MRP8 is an amphipathic anion transport protein (transporter) and drugs of purine / pyrimidine nucleotide analogues such as cAMP and cGMP. It is known to function as an evacuation pump (Guo et al., 2003; Chen et al., 2005). The findings regarding the function of MRP8 found in the present invention are based on the previously reported results of earwax, that is, wet earwax gland contains secreted granules of light color (Shuguyo et al., 1988), earwax Is consistent with containing amphiphilic and aromatic compounds (Burkhart et al., 2001) and that MRP8 can transport a variety of lipophilic substances (Chen et al., 2005), ABCC11 can be said to be a determinant of earwax type having a function of secreting earwax.
In the method of the present invention, for example, the 538th base substitution in the ABCC11 gene (SEQ ID NO: 1) is a single nucleotide polymorphism of G (guanine) / A (adenine). In the evaluation of earwax, when the genotype of the 538th base is heterozygous for GA or homozygous for GG, it is diagnosed as wet type, and when it is homozygous for AA, it is diagnosed as dry type. be able to.
Furthermore, in the present invention, the polymorphism (double junction) of the 538th base and the 3939th to 3965th bases in the ABCC11 gene (SEQ ID NO: 1) is used to dry the gene. It is also possible to diagnose whether it is a mold or a wet mold.
The allele of which the 538th base is “A” is “allyl A”, the allele of “G” is “allyl G”, and alleles from which the 27th base from the 3939th to the 3965th is not deleted are “ When “normal allele” and the deleted allele are “Δ27 allyl”, the diagnosis of dry type or wet type can be performed as follows (FIG. 1).
When one allele has a combination of allyl A or allyl G and Δ27 allyl and the other allele has a combination of allyl A and normal allyl (FIG. 1 (a)): Dry mold
In the case of double homojunction of allyl A or allyl G and Δ27 allyl (FIG. 1 (b)): dry type
When one allyl is a combination of allyl A or allyl G and Δ27 allyl and the other allyl is a combination of allyl G and normal allyl ((c) in FIG. 1): wet type
That is, when the gene polymorphism is homozygous for an allele from which the 3939th to 3965th 27 bases have been deleted (FIG. 1 (b)), or a deleted allele of the 3939th to 3965th 27th bases. Is diagnosed as a dry type when it has a genetic polymorphism of a heterozygote between the allelic and normal allyl and the 538th base of the normal allele is A (FIG. 1 (a)).
In addition, when a heterozygote of a deleted allele of the 27th base from the 3939th to the 3965th and a normal allele has a genetic polymorphism in which the 538th base of the normal allele is G (FIG. 1) (C)) can be diagnosed as a wet type.
In addition, when Δ27 allyl is homozygous, since the 538th base is in the dry type in both A and G, in the above-described evaluation of earwax, the genotype of the 538th base is heterozygous or GA. When homozygous for GG, this contradicts the point of diagnosing the wet type. However, since the frequency of deletion alleles is very low, it is sufficient to investigate whether they are homozygous for Δ27 allele when a dry phenotype appears even in the case of GA heterozygous or GG homozygous. The evaluation of the present invention is not hindered.
Evaluation of earwax mold and armpit odor
The axillary, mammary and auditory canal glands are all apocrine glands. Underarm odor (also known as odor sweating) is associated with wet earwax and is well known to be promoted by sweating. A large and large apocrine gland has been found by histological studies of axillary skin in patients with odorhidrosis (Bang et al., 1996).
Various lipophilic substances such as aliphatic and aromatic compounds produced by wet type individual apocrine sweat glands can cause odorhidrosis as their number and size increase. This is supported by the functional study of the present inventor that pig-derived LCC-PK1 cells into which allyl G of the ABCC11 gene has been introduced have an increased secretory function compared to cells into which allyl A has been introduced. .
Therefore, armpit odor can be estimated or diagnosed using the earwax type determined by the earwax type determination method as an index. In mammals, apocrine sweat gland secretions such as body odor can contribute to sexual attraction like certain pheromones. According to the inventor's genome sequence database and PCR search, chimpanzees, orangutans, white-handed gibbons, Japanese monkeys and dogs have ABCC11 gene but not in mice and rats. It is speculated that ancient northern mongoloids lived in a cold environment and may have gained some selective advantage as an adaptation to the cold climate. However, there is no evidence that dry race has better reproductive fitness.
In the present invention, when the 538th base of the ABCC11 gene in the earwax phenotype indicates a GA heterozygous or GG homozygous genotype, it is associated with a wet earwax type, and this GA heterozygous or GG homozygous type. It can be estimated that this individual has the possibility of armpit odor. Moreover, when showing the AA homozygous genotype, it is related with dry earwax type, and it can be estimated that there is little possibility of armpit odor.
In the present invention, two polymorphisms (double junction) of deletion of the 538th base of the ABCC11 gene (SEQ ID NO: 1) and 27 bases from the 3939th position to the 3965th position are represented. It is also possible to diagnose whether it is a dry type or a wet type.
The embodiment shown in FIGS. 1 (a) and (b) is a dry type, and it can be estimated that there is little possibility of armpit odor in these types. Moreover, the aspect shown in FIG.1 (c) is a wet type, and it can be estimated that there is a possibility of armpit odor.
Thus, the degree of armpit odor is clarified by estimating whether it is armpit odor using the earwax mold determined by the earwax type determination method as an index. Furthermore, using the result as an index, it is possible to determine the type and amount of a drug or cosmetic for treatment of armpit odor to be administered to an individual.
Examples of compounds that cause odors detected in the population of armpit odor include linear or branched saturated or unsaturated fatty acids, aldehydes and alcohols having 1 to 20 carbon atoms, especially n-hexanoic. Acid, n-heptanoic acid, n-octanoic acid, n-nonanoic acid, n-decanoic acid, n-undecanoic acid, n-dodecanoic acid, 2-methylpentanoic acid 2-methylhexanoic acid, 2-methylheptanoic acid, 2-methyloctanoic acid, 2-methylnonanoic acid, 2-methyldecanoic acid, 3-methylpentanoic acid, 3- Methylhexanoic acid, 3-methylheptanoic acid, 3-methylo Tanoic acid, 3-methylnonanoic acid, 3-methyldecanoic acid, (Z) -3-methyl-2-pentenoic acid, (E) -3-methyl-2-pentenoic acid, ( Z) -3-methyl-2-hexenoic acid, (Z) -3-methyl-2-heptenoic acid, (E) -3-methyl-2-heptenoic acid, (Z) -3- Methyl-2-octenoic acid, (E) -3-methyl-2-octenoic acid, 3-hydroxy-3-methyl-2-pentenoic acid, 3-hydroxy-3-methyl-2-he Xenoic acid, 3-hydroxy-3-methyl-2-heptenoic acid, 3-hydroxy-3-methyl-2-octenoic acid, 2-ethyl Sanoic acid, 4-ethylpetanoic acid, 4-ethylhexanoic acid, 4-ethyloctanoic acid, 4-ethylnonanoic acid, 4-ethyldecanoic acid, 5-hexenoic acid, 6-heptenoic acid, 7-octenoic acid, 8-nonenoic acid, 9-decenoic acid, 10-undecenoic acid, 11-dedecenoic acid, and the like are estimated. These compounds are secreted from sweat glands, or produced by oxidation, reduction, decomposition or reaction of precursors thereof by the action of skin resident bacteria, light, air or the like. Therefore, drugs, cosmetics or fragrances that reduce or mask the odor of these compounds are used, or precursors thereof are oxidized, reduced, decomposed or reacted by the action of skin resident bacteria, light, air, etc. By using drugs, cosmetics or fragrances to suppress, armpit odor can be avoided. In the present invention, by examining the 538th base of the ABCC11 gene, it is possible to determine what kind of drug or cosmetic should be used.
By the way, a study showing a relation between earwax type and breast cancer sensitivity has been reported previously (Petrakis, 1971). For example, it is known that Asian races (dry ear wax type superiority) have a lower incidence of breast cancer than whites and blacks (wet ear wax type advantage) (Chen et al., 2004). This can be estimated that the incidence of breast cancer is high when the earwax is a wet type, and the incidence of breast cancer is low when the earwax is a dry type. Furthermore, the ABCC11 gene is strongly expressed in breast cancer cells (Bera et al., 2001; Bieche et al., 2004). Therefore, c. Breast cancer susceptibility can be predicted by the difference in the genotype of the 538G> A site, that is, the earwax phenotype.
Use as a probe or primer
The present invention relates to an earwax type-determining nucleotide and an armpit odor evaluation oligonucleotide that are used in the above-described method for determining the earwax type. These oligonucleotides can be used as Taqman probes or PCR primers for evaluation of earwax type or armpit odor.
The evaluation of armpit odor is performed using the earwax type as an index. Therefore, since the oligonucleotide for evaluating armpit odor is similar to the oligonucleotide for evaluating the earwax type, the Taqman probe or PCR primer for determining the earwax type will be described below.
Genomic DNA samples from subjects, which are materials used for the evaluation of armpit odor, can be extracted from blood, saliva, skin, etc., but if DNA samples can be collected, It is not limited. Methods for extracting and purifying genomic DNA are well known. For example, genomic DNA is purified from specimens such as blood, saliva, skin, etc. collected from humans using the phenol / chloroform method or the like. In that case, you may use commercially available genomic DNA extraction kits and apparatuses, such as GFX Genomic Blood DNA Purification Kit.
The oligonucleotide used in the method of the present invention is an oligonucleotide containing the 538th base in the ABCC11 gene base sequence (for example, SEQ ID NO: 1) or a deletion of 27 bases ranging from the 3939th to the 3965th base (Δ27) An oligonucleotide consisting of a sequence of at least 10 bases designed to include a site, or a sequence of at least 10 bases designed to sandwich the deletion site.
The length of the oligonucleotide is not particularly limited as long as it is at least 10 bases, and preferably 10 to 100 bases. The oligonucleotide of the present invention can be obtained by ordinary chemical synthesis based on the base sequence described in SEQ ID NO: 1.
The oligonucleotide used as a primer and / or probe in the present invention is designed and synthesized to include the 538th base when detecting the 538th polymorphism, for example. In the present invention, complementary strands (complementary sequences) of these sequences are also included.
The oligonucleotide is designed so that the polymorphic site is present at the 5 ′ end or 3 ′ end of the base sequence. However, the oligonucleotide is not limited to those designed so that the polymorphic site is present at the 5 ′ end or 3 ′ end of the base sequence, and is designed so that it exists inside the 5 ′ or 3 ′ end. Also good.
When the prepared oligonucleotide is used as a probe, a polymorphism can be determined or detected by utilizing whether or not the probe is hybridized to a test DNA.
When detecting a polymorphism of Δ27, an oligonucleotide can be used as a probe or a primer for PCR.
The probe is designed so as to be composed only of a part of the 2739 base sequence from the 3939th position to the 3965th position in the base sequence shown in SEQ ID NO: 1 (that is, composed of bases within the 27 bases). (Referred to as “probe 27”). Further, among the base sequence shown in SEQ ID NO: 1, it includes the 2739 base sequence from the 3939th position to the 3965th base, and is located on the upstream side of the 3939th base and on the downstream side of the 3965th base. It can also be designed to include a base (referred to as “probe 27α”). Alternatively, in consideration of a deletion of 27 bases, the deletion site can be designed to be sandwiched between a base downstream of the deletion site and a base upstream of the deletion site. In this case, the 3938th base (“a” of 3938 in SEQ ID NO: 1) and the base that newly became the 3939th base by deletion of 27 bases (“a” of 3966 in SEQ ID NO: 1) ]) Are connected. The oligonucleotide thus prepared in consideration of the deletion of 27 bases is designated as “probe Δ27”. Then, since the probe 27 and the probe 27α are hybridized with DNA having a normal base sequence (a base sequence having no 27 base deletion), it is determined (detected) whether or not the allele is Δ27 depending on the presence or absence of a band. be able to. In addition, probe Δ27 does not hybridize with the normal base sequence (base sequence without 27 base deletion) but can hybridize with the base sequence in which deletion has occurred. It can be judged (detected).
In addition, the PCR method can be used to detect the deletion (Δ27) of 27 bases ranging from the 3939th position to the 3965th position in the exon 28 of the ABCC11 gene. Design and make a set.
When designing an oligonucleotide as a primer for detecting allyl Δ27, it is designed from the upstream side of the 3938th base and from the downstream side of the 3966th base (base sequence for a normal gene). design. Thereby, since the fragment amplified by PCR differs in the size of the detected fragment by 27 bases depending on the presence or absence of the deletion, the deletion can be detected by the difference in the size of the fragment. The length of the primer is designed to be at least 15 bases, preferably 15 to 30 bases, more preferably 18 to 24 bases. The primer sequence at this time is appropriately selected from the template DNA region so that the amplified fragment is 1000 bp or less, preferably within 500 bp, more preferably within 200 bp (100 to 200) bp.
The oligonucleotide primer or oligonucleotide probe designed as described above can be chemically synthesized by a known means / method, but is generally synthesized using a commercially available chemical synthesizer.
It is possible to automate the work by adding a fluorescent label (for example, FAM, VIC, etc.) to the probe in advance.
The PCR product sequencing method can be applied to the genomic nucleotide sequence analysis for the 538th base substitution of ABCC11 gene and the deletion of 27 bases ranging from the 3939th to 3965th positions. One of wet and dry DNA samples can be set to an appropriate annealing temperature and used as a PCR template. PCR may be performed using ExTaq Hot Start version (Takara, Otsu, Japan) according to the manufacturer's instructions.
When the PCR product is electrophoresed and visualized by ethidium bromide staining, the wild type allele and the deleted allele are obtained as a band of fragments of different sizes derived from the deleted fragment. Similarly, Δ27 can be detected by base sequence determination.
Sequencing can be performed in Autosequencer Model 3100 (Applied Biosystems) using BigDye Terminator version 3.1 after ExoSAP-IT processing. The resulting sequences can be aligned with AutoAssembler (Applied Biosystems) to visualize SNPs or mutations.
Functional assays of cells with AA, GG and GA genotypes can be performed as follows. That is, allyl A or G of the human ABCC11 gene is incorporated into an appropriate expression vector. Examples of expression vectors that can be used in the present invention include pGEX from Pharmacia. Any promoter may be used as long as it can be expressed in a host such as Escherichia coli. When yeast is used as a host, examples of expression vectors include YEp13 and YCp50. Examples of the promoter include gal1 promoter and gal10 promoter. When a mammalian cell is used as a host, examples of expression vectors include pcDNA3.1-Hygro (-), pcDNA3 (Invitrogen Corporation, Carlsbad, California) and the like.
A cDNA containing allyl A- or G- is expressed in a host using an appropriate method. Examples of the expression method include a method using a lipofectamine reagent, an electroporation method, a calcium chloride method, a spheroplast method, a lithium acetate method, and the like, but a lipofectamine reagent (Invitrogen) is preferable.
Examples of hosts that can be used for transfection include bacteria such as Escherichia coli and Bacillus subtilis, yeasts such as Saccharomyces cerevisiae, animal cells, and insect cells.
Although this functional assay is not particularly limited to host cells, animal cells such as LLC-PK1 cells (JCRB cell bank), which are pig proximal tubule-derived epithelial cells, are preferred. After culturing the host cells for an appropriate time, the cells are transferred to a culture medium containing hygromycin B. After further culturing for an appropriate time, colonies of hygromycin B resistant cells are isolated, and expression of allele A or allele G is determined by RT-PCR. Detect and confirm with. Thereafter, by culturing the cells and extracting the membrane fraction from a large number of cells, the transport ability can be measured by adding a molecule serving as a substrate for membrane transport such as cGMP as an in vitro experiment.
Ear wax type evaluation method or armpit odor evaluation kit
In the present invention, among the nucleotide sequences of the ABCC11 gene, an oligonucleotide containing the 538th base of the coding region and an oligonucleotide containing nucleotide sequences close to both sides of the 27 base deletion site extending from the 3939th to 3965th positions Can be included in a kit for ear wax type determination.
The kit of the present invention contains one or more components necessary for carrying out the present invention. Such components include, but are not limited to, for example, the oligonucleotides of the invention, buffers, dNTPs, control reagents (eg, tissue samples, target oligonucleotides for positive and negative controls, etc.), labeling and And / or a detection reagent, a solid support, and instructions. Further, the kit of the present invention may be a partial kit containing only a part of necessary components, and in that case, the user can prepare other components.
The kit of the present invention can also be provided as a microarray in which the oligonucleotide is immobilized on a support. The microarray is obtained by fixing the oligonucleotide of the present invention on a support, and includes a DNA chip, a Gene chip, a microchip, and the like.
The kit of the present invention comprises a nucleotide polymorphism found in the present invention, an oligonucleotide containing the 538th base in the base sequence of the ABCC11 gene, and a 27 base deletion extending from the 3939th to 3965th positions. Oligonucleotides for the base sequence adjacent to both ends of Thus, for example, blood is extracted before a drug for treatment of armpit odor is used on a patient or the like (eg before surgery), DNA is extracted, and this DNA is reacted with an oligonucleotide in the kit to obtain a genotype. Determine. From the determined genotype, an administration plan such as the type or dose of the drug is created. As a result, a drug effect suitable for an individual can be obtained, which is useful for tailor-made medical care.
EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited to an Example.

Example 1: Determination of the earwax-determining gene Since the known polymorphic markers were rare around the ~ 5.9-cM region where we mapped the earwax locus in previous studies, we first introduced the NCBI gene CA-repeat markers were searched in the bank (Genbank, http://www.ncbi.nih.gov/GenBank). At the same time, in the JSNP database (http://snp.ims.u-tokyo.ac.jp), a single nucleotide variation between two genomic sequences (AC003034 and AC007728) where the ear locus locus should be specified is specified. The type (SNP) was searched.
A set of 134 fluorescently labeled primers corresponding to the genomic sequence deposited at Genbank was designed to amplify the CA-repeat marker in the interval between the AC003034 and AC007728 sequences. This interval includes previously mapped D16S3093, D16S3117 and earwax loci (Tomita et al., 2002).
Next, using these markers, the genotypes of 118 volunteers (64 dry individuals and 54 wet control individuals) were determined, and a case (dry individual) / control (wet individual) test was conducted. Volunteer DNA samples were collected in an anonymous manner and their earwax type was self-reported. PCR products in the sample were separated with Autosequencer Model 377 (Applied Biosystems, Foster City, Calif.) Using GeneScan software (Applied Biosystems), and the resulting allele was subjected to Genotyper (Applied Biosystems) and Genotyper (Applied Biosystems 2). Statistical analysis was performed using a test. Genotyping of SNPs was performed with ExoSAP-IT (Amersham Biosciences Corp., Piscataway, NJ), followed by BigDye terminator ver 3.1 using Autosequencer Model 3100 (Applied Bios Directed by Applied Bios Direct. SNP data was also analyzed by chi-square test.
As a result, 12 CA-repeat markers showed a significant p-value of log ₁₀ <−2.3. Here, the p value is a value representing a statistical significance level. The p-value in the CA-repeat marker of the long arm of chromosome 16 was lower than the p-value in the short arm, but since the marker could not identify the earwax locus further, the present inventor , By performing sequencing around the CA-repeat (Genbank accession No. AC007600 (FIG. 2, “AC007600-M1”)) that includes the ABCC12 gene, the p-value is newly set to log ₁₀ <−2.3. The indicated SNPs were searched.
As a result, out of the 62 identified SNPs (16 were newly identified SNPs and 46 were registered SNPs), two of B-81540 and IMS-JST141676 were 4.0 × 10 4 each. Significant p-values of ⁻⁹ and 7.6 × 10 ⁻⁵ were shown (FIG. 2).
In addition, for the two SNP alleles, all 64 dry individuals tested were homozygous. These findings are consistent with dry recessive traits and founder effects, strongly suggesting that the earwax locus is in this region. According to Genbank genomic information, the two SNP sites are separated by 600 kb from each other, and during this time, ABCC12 (ABCC sub-family, member12), ABCC11, LONP (peroxisomal LON proteogene) and SIAH1 (seven in hose) It can be seen that these four genes are included (FIG. 2).
Here, the present inventor focused on the four gene regions and performed a complete sequence for eight persons who were sure to have wet earwax. If a given SNP within a gene is closely linked to the earwax locus, the eight in the light of earwax phenotypic data in previously reported Japanese populations (Matsunaga, 1962; Omoto, 1973) 80-90% heterozygosity is expected. The present inventor found such a SNP in the region, and performed a case (dry individual) / control (wet individual) test again on the same 118 samples as described above.
Three SNPs: B357760 (c.538G> A) in exon 4 of ABCC11, B475340 (IVS12 + 7508A> G) in intron 12 of LONP, and B482500 in Alu-repeat sequence in intron 14 of LONP ( IVS14 + 320A> G) showed the lowest p-value (<2.0 × 10 ⁻¹⁴ ) (FIG. 2), and those SNPs were in strong linkage disequilibrium (LD) (r ² > 0.97) in the Japanese population. It was.
As a result of genotype analysis, out of 64 samples self-reported as dry type, 63 samples were AA homozygotes and 1 sample was GA heterozygotes at the B357760 locus. In the B475340 locus, 62 samples were AA, 2 samples were GA, and in the B482500 locus, 63 samples were AA and 1 sample was GA. In the remaining 54 wet samples, at each of the three loci, 6 samples are GG, GG and GG homozygotes respectively, 33 samples are GA, GA and GA heterozygotes respectively, 15 samples Were AA, AA and AA homozygotes.
Two major 3-locus haplotypes, GGG and AAA, are found in 117 samples, and one rare haplotype, AGA, is a dry sample. Found in. These data strongly suggested that one of the three SNPs was a mutation that determined earwax type, but some samples showed discrepancies between earwax phenotype and genotype.
In parallel with the above analysis, a BAC (Bacterial Artificial Chromosome) and a cosmid library covering three SNPs were constructed from one individual that was clearly heterozygous as judged from the family, and each of the wet and dry alleles Two contig sets corresponding to were sequenced. As a result, these clones were not structurally abnormal, and no other new base changes were observed.
Thereafter, the present inventor determined genotypes for the above three SNP loci in 126 Japanese volunteers (88 dry type and 38 wet type individuals) whose earwax type was newly identified by doctors. In the first otolaryngological examination, the earwax type of 8 individuals was unclassifiable, but the value of 0.06 (8/126) is comparable to the previously reported 0.05 (Matsusunaga, 1962), self-reported and The fact that the earwax type from otolaryngological diagnosis does not always match the true phenotype was derived. However, 6 out of 8 could clearly determine whether it was wet or dry by reassessing earwax collected with a cotton swab. The other two were still unable to classify, but were eventually classified as dry based on the ear-shaped transmission pattern within the family members. To summarize the results, the B357760 (c.538G> A) locus genotype was 87 out of 88 dry type AA homozygotes, and all 38 wet types were GA heterozygotes or GG homozygotes. (Table 1).
There was one exception, with discrepancies between phenotype (dry) and genotype (GA heterozygote). However, in this individual, 27 bases from the 3939th to the 3965th were deleted (3939-3965de127) in the exon 28 downstream of the G / A site in the G allele in ABCC11. This deletion (Δ27) resulted in functional impairment of allyl G, resulting in a dry phenotype. Therefore, the allyl A frequency among Nagasaki residents in Japan can be calculated as 88/126, that is, 0.829.
The inventor found several recombinant alleles between B357760 and B475340 in DNA from CEPH (a white man with ancestors from Western and Northern Europe) families, but 126 earwax phenotypes were determined. No such recombinants were identified in Japanese. When the data was combined with another series of 118 Japanese samples, one recombination event was revealed. The spacing between the two markers is almost complete linkage disequilibrium (r ² ▲ = ▼ 1.00, D ′ ▲ = ▼ 1.00; and r ² > 0.64, D ′> 0.84, 126 each. The Japanese AA haplotype (dry haplotype) is probably derived from the founder. Two other SNPs, B334000 and B404940, are about 24 kb closer to the centromere and about 47 kb closer to the end than B357760, respectively (FIG. 2), with minor allele frequencies of 0.3 and 0. across at 87 dry type sample-related research 5 showed a high p- value (1.3 x 10 ^-3 and 1.5 × 10 ^-3). This result indicates that the two SNPs are not involved in earwax typing.
Taking these analysis results together, it can be estimated that B357760 is a determinant of the earwax type, and that rare mutations at other sites in ABCC11 also contribute to dry formation of a part of the individual.

Example 2: Frequency distribution in different populations of alleles A and alleles with 27 base deletions A number of studies on dryness-earwax phenotypic frequency between different populations have been conducted (Matsunaga, 1962; Petrakis et al., 1967; Petrakis, 1969; Martin and Jackson, 1969; Petrakis et al., 1971; Alfred et al., 1970; Omoto, 1973; Patel, 1973; Norakmal and Tan, 1979; (Table and Online table). The inventor directly sequenced the genotypes of a total of 33 populations worldwide (one nationality or one ethnicity in one country counted as one population) and real-time using the allele “A” specific Taqman probe. Determined using PCR or single-stranded polymorphism analysis (SSCP).
As expected from the phenotypic distribution of dry earwax shown in previous studies, East Asian races have a very high allele A frequency. The highest value (100%) is found in Koreans in the Daegu region (Southeastern Korea) and northern Chinese, where allele G is absent and neither GA nor GG genotype exists. (Table 1).
The next group with the highest allyl A was Mongolian, Chinese other than Northern Chinese, and Japanese mainland (Nagasaki residents). On the other hand, those with the lowest allyl A frequency are Africans from various countries in sub-Saharan Africa and American citizens from Africa. Intermediate frequencies were observed in Ainu- and Okinawa-Japanese, South Asians, Oceanians, North and South American Natives, and less frequently Americans from Europe, and Europeans, and other races . As previously shown in the earwax phenotype (Omoto, 1973), world contour maps plotting various frequencies of allyl A peaked in Korea and North China, with north-south and east-west in the Eurasian continent. It became clear to show a downward geographical gradient distribution (FIG. 3).
On the other hand, the inventor has also determined the genotype of individuals from various populations for 27 base deletions by PCR and subsequent gel electrophoresis analysis.
The inventor designed a PCR primer set for detection of 27 base deletions. PCR primer sequences, PCR reaction composition, and cycle conditions are as follows.
Primer (F): CATCAGACATCATCTTATCGATG (SEQ ID NO: 3)
Primer (R): CACAGTTCAGCACAGGTGGA (SEQ ID NO: 4)
Reaction solution composition: 10 mM Tris-HCl (pH 8.3, 25 ° C.)
50 mM KCl
1.5 mM MgCl ₂
200 μM dNTP
0.5 μM primer cycle conditions: (95 ° C. × 20 seconds, 60 ° C. × 20 seconds, 72 ° C. × 20 seconds) × 35 cycles PCR products were electrophoresed and visualized by ethidium bromide staining. The wild type allele was 143 bp in size, while the deletion type allele was 116 bp.
Surprisingly, the 27 base deletion is caused by 1 out of 500 Japanese (0.001), 2 out of 20 native Americans (frequency of deletion allele is 0.050), 10 people in the Andes Mountains It was observed in 1 of them (0.050), 9 of 30 Bolivians (0.150), and 1 of 50 Thais (0.020). 27 base deletions are Korean, Chinese, Mongolian, Yonaguni Island and Ainu Japanese, Pacific Islander, CEPH family, Ukrainian, Russian, Iberian, Jewish, Hungarian, Colombian, Venezuela Neither was seen in humans or African Americans (Table 1). The 27 base deletion is independent of genotype at the B357760 (c.538G> A) locus (1 AA and 6 GG homozygotes and 4 GA heterozygotes), It is a deletion polymorphism that occurs relatively frequently in some indigenous people. Thus, the 27 base deletion is rare, but like allyl A, the homozygote is considered to have no armpit odor.

Example 3 Assay for Gene Expression and cGMP Transport in LLC-PK1 Cells Introduced with Allele A or Allele G of Human ABCC11 Gene Full-length cDNA having human ABCC11 gene allele A or G is integrated into plasmid pcDNA3.1-Hygro , Porcine-derived LLC-PK1 cells (JCRB cell bank) were transfected using Lipofectin (Invitrogen, Carlsbad, California) according to the manufacturer's instructions. After 48 hours, the cells were transferred to a culture medium containing 200 μg / ml hygromycin B. After 14 days, hygromycin B resistant cell colonies were isolated. Total mRNA was extracted from cells expressing allyl A or allyl G, and the expression level was quantified by a real-time PCR (RT-PCR) method using 7900HT Sequence Detection System (Applied Biosystems). The ratio of ABCC11-mRNA to GAPDH (control) was calculated and compared statistically. As a result, the copy number of each allele introduced was unknown, but the expression level of allyl A in LLC-PK1 cells was about three times higher than that of allyl G.
Hygromycin B resistant cells were cultured to 5 × 10 ⁸ cells, and cell membrane fractions were collected and cGMP was recovered according to a previously reported method (Mitomo H, et al., 2003; Masuzaki et al., 2004). Membrane transport ability was measured. As a result, it was confirmed that the transport of the MRP8 protein encoded by ABCC11 is ATP-dependent, and further, the transport ability of the cell membrane having glycine-180 residue (allyl G) to cGMP is not limited to that of the cell membrane having allyl A. It was shown to be higher than that of the cell membrane into which only the vector not incorporated was introduced. The Km value calculated for cGMP was too high compared to the physiological concentration in vivo, but it is presumed that MRP8 having a glycine-180 residue may transport other endogenous substrates. .
References Yabuchi, H .; Shimizu, H .; Takayanagi, S .; & Ishikawa, T .; Multiple splicing variants of two new human ATP-binding cassette transporters, ABCC11 and ABCC12. Biochem. Biophys. Res. Commun. 288, 933-939 (2001).
Tammur, J .; et al. Two new genes from the human ATP-binding cassette transporter superfamily, ABCC11 and ABCC12, tentatively duplicated on chromosome 16q12. Gene 273, 89-96 (2001).
Guo, Y. et al. et al. MRP8, ATP-binding cassette C11 (ABCC11), is a cyclic nucleotide efflux pump and a resistance factor for fluoropyrimidines 2 ', 3'-deoxyney'2 J. et al. Biol. Chem. 278, 29509-29514 (2003).
Chen, Z .; S. Guo, Y .; Belinsky, M .; G. Kotova, E .; & Kruh, G .; D. Transport of bills acids, sulfated steroids, stradiol 17-beta-D-glucuronide, and leukotriene C4 by human multidrug resistance protein 11 (ACC). Mol. Pharmacol. 67, 545-557 (2005).
Shugyo, Y .; et al. Morphological differentials between scripture cells of wet and dry type of human celuminous grands. Am. J. et al. Anatom. 181, 377-384 (1988).
Burkhart, C.I. N. Kruge, M .; A. Burkhart, C .; G. & Black, C.I. Cerumen composition by flash pyrolysis-gas chromatography / mass spectrometry. Otol. Neurotol. 22, 715-722 (2001).
Bang, Y. et al. H. et al. Histopathology of apocrine bromohydrosis. Plast. Reconstr. Surg. 98, 288-292 (1996).
Petrakis, N.M. L. , Pingke, U.S. Petrakis, S .; J. et al. & Petrakis, S .; L. Evidence for a genetic line in earwax type in the Middle East and Southeast Asia. Am. J. et al. Phys. Anthropol. 35, 141-144 (1971).
Chen, Z .; et al. Does mammographic density reflect electrical differentials in breast cancer incident rates? Am. J. et al. Epidemiol. 159, 140-147 (2004).
Bera, T .; K. Lee, S .; Salvatore, G .; Lee, B .; & Pastan, I .; MRP8, a new member of ABC transporter superfamily, identified by EST database mining and gene prediction program, is highly expressed in. Mol. Med. 7, 509-516 (2001).
Bieche, I.D. , Girault, I .; Urbain, E .; , Tozlu, S .; & Lidereau, R .; Relationship between intra-expression of of genes encoding for aquatic ensembles and phenotypes in the form of phenotypes and phenotypes. Breast Cancer Res. 6, R252-263 (2004).
Tomita, HA. et al. Mapping of the wet / dry earwax locus to the percentric region of chromosome 16. Lancet 359, 2000-2002 (2002).
Matsunaga, E .; The dimorphism in human normal cerumen. Ann. Hum. Genet. 25, 273-286 (1962).
Petrakis, N.M. L. Molohon, K .; T.A. & Topper, D .; J. et al. Cerumen in American Indians: Genetic implications of sticky and dry types. Science 158, 1992-1993 (1967).
Petrakis, N.M. L. Dry cerumen-a prevalent genetic trait among American Indians. Nature 222, 1080-1081 (1969).
Martin, L.M. M.M. & Jackson, J.A. F. Cerumen types in Choctaw Indians. Science 163, 677-668 (1969).
Alfred, B .; M.M. , Stout, T .; D. Lee, M .; Birkbeck, J .; & Petrakis, N .; L. Blood groups, phosphoglucomutase, and cerumen types of the Anaham (Chilcottin) Indians. Am. J. et al. Phys. Anthropol. 32, 329-338 (1970).
Omoto, K.M. Polymorphic traits in people of eastern Asia and the Pacific. Israel J, Med. Sci. 9, 1195-1215 (1973).
Patel, S.M. Study on some genetic traits of Tibetans at a Chandagiri, district Ganjam, Orissa. Am. J. et al. Phys. Anthopol. 38, 755-756 (1973).
Norakmal, I.K. & Tan, S.A. G. Cerumen polymorphism in the three major ethnic groups of Malaysia. Jpn. J. et al. Hum. Genet. 24, 119-121 (1979).
Spitsyn, V.M. A. & Afanas ▲ e ▼ va, I. Genetic geometry of inherited dimorphism of ear wax by it consistency. Genetika (Russian) 25 :, 1854-1860 (1989).
Petrakis, N.M. L. Cerumen genetics and human breast cancer, Science 173, 347-349 (1971).
Mitomo, H.M. et al. A functional study on polymorphism of the ATP-binding cassette transporter ABCG12: Critical role of argon-482 in methanolate transport. Biochem. J. et al. 373, 767-774 (2003).
Masuzaki, H .; et al. Detection of cell free presidential DNA in material plasma: direct evidence from three cases of confined mosaic mosaic. J. et al. Med. Genet. 41, 289-292 (2004).

According to the present invention, it is possible to evaluate the earwax type by utilizing the substitution of the 538th base or the deletion of 27 bases ranging from the 3939th to the 3965th in the base sequence of the ABCC11 gene. Can be evaluated. That is, in the present invention, the earwax type (dry type or wet type) is determined only by examining the genotype of one polymorphic site of the 538th base in the ABCC11 gene base sequence that determines the earwax type. Can be evaluated. Moreover, since earwax type is closely related to armpit odor, it is possible to evaluate armpit odor according to the present invention. Therefore, the method of the present invention is useful for the development of cosmetics and the like for use in the armpit odor.
Furthermore, from the genotype of the polymorphic site of the 538th base, it can be seen that there is a very high possibility that the race originates from an ancient northern mongoloid race. Therefore, the polymorphic site of the 538th base of the ABCC11 gene becomes a new marker that makes it possible to classify the ancestors of races by a much simpler method than the conventional method, and contributes to the development of archeology or anthropology. To do.

Sequence number 3: Primer Sequence number 4: Primer [sequence table]

Claims (16)

In the nucleotide sequence of the gene encoding ABCC11, a method for evaluating earwax, associating the gene polymorphism of the 538th base with the dry or wet type of individual earwax,
When the genetic polymorphism is GA heterozygous or GG homozygous, it is evaluated as a wet type, and when AA homozygous is evaluated as a dry type,
Said method. In the nucleotide sequence of the gene encoding ABCC11, (a) the gene polymorphism of the 538th nucleotide and the gene polymorphism in which the 27th nucleotide from the 3939th to the 3965th is deleted, or (b) the 3939th to the 3rd gene. A method for evaluating earwax, which associates a genetic polymorphism in which the 3965th 27th base is deleted with the dry or wet type of earwax of an individual,
When the genetic polymorphism is a homozygous allele from which the 27th base from the 3939th to the 3965th is deleted, or a heterozygote of a deleted allele of the 27th base from the 3939th to the 3965th and a normal allele Therefore, when the 538th base of the normal allele is A, it is evaluated as a dry type, and it is a heterozygote of the deleted allele of the 3939th to 3965th 27 bases and the normal allyl. When the normal allele 538th base is a G-junction, it is evaluated as a wet type,
Said method.   The method according to claim 1 or 2, wherein the gene polymorphism of the 538th base is a single nucleotide polymorphism.   The method according to claim 1 or 2, wherein the gene polymorphism of the 538th base forms a linkage disequilibrium block. In the base sequence of the gene encoding ABCC11, a genetic polymorphism of the 538th base is associated with the armpit odor of the individual,
When the genetic polymorphism is heterozygous for GA or homozygous for GG, it is presumed that it is armpit odor, and when it is homozygous for AA, it is presumed that it is not armpit odor.
Said method. In the nucleotide sequence of the gene encoding ABCC11, (a) the gene polymorphism of the 538th nucleotide and the gene polymorphism in which the 27th nucleotide from the 3939th to the 3965th is deleted, or (b) the 3939th to the 3rd gene. A method for evaluating armpit odor, which relates the genetic polymorphism of the 27th base of 3965 to the armpit odor of an individual,
When the genetic polymorphism is a homozygous allele from which the 27th base from the 3939th to the 3965th is deleted, or a heterozygote of a deleted allele of the 27th base from the 3939th to the 3965th and a normal allele Therefore, when the 538th base of the normal allele is A, it is presumed that it is not an armpit odor, and a 27-base deleted allele from the 3939th to the 3965th is heterozygous with a normal allyl. And when it is a conjugation in which the 538th base of the normal allele is G, it is presumed that it is an armpit odor,
Said method.   The method according to claim 5 or 6, wherein the gene polymorphism of the 538th base is a single nucleotide polymorphism.   The method according to claim 5 or 6, wherein the polymorphism of the 538rd base forms a linkage disequilibrium block.   The method of determining the kind and / or quantity of the cosmetics used for an individual | organism | solid using the result evaluated by the method of any one of Claims 5-8 as a parameter | index. In the nucleotide sequence of the gene encoding ABCC11, the first 538-th base consisting including 1 5-50 nucleotide sequences or a sequence complementary thereto, the method according to any one of claims 1 to 8 Oligonucleotide for use in.   The base sequence of a gene encoding ABCC11, comprising a sequence of at least 15 bases sandwiching a deletion site of 27 bases from 3939 to 3965, or a sequence complementary thereto, 9. An oligonucleotide for use in the method according to claim 1. The oligonucleotide according to claim 11, which has a length of 15 to 50 bases.   For use in the method according to any one of claims 1 to 8, comprising a sequence of at least 21 bases including the 538th base in a base sequence of a gene encoding ABCC11 or a sequence complementary thereto. Oligonucleotides.   The base sequence of a gene encoding ABCC11, comprising a sequence of at least 21 bases sandwiching a deletion site of 27 bases from 3939 to 3965, or a sequence complementary thereto, 9. An oligonucleotide for use in the method according to claim 1.   The oligonucleotide according to claim 13 or 14, which has a length of 21 to 50 bases.   A kit for evaluating earwax or armpit odor, comprising the oligonucleotide according to any one of claims 10 to 15.