JP4868914B2 - New antibacterial peptide - Google Patents

Description

  The present invention relates to a novel antibacterial peptide having a broad antibacterial spectrum useful for storage and preservation of foods and the like.

  Many of the foods that are ingested on a daily basis contain natural antibacterial substances. In recent years, technology that suppresses the growth of harmful microorganisms using such natural antibacterial substances has been regarded as important because many consumers hate synthetic antibacterial agents. Examples of natural antibacterial substances that have been put to practical use include wasabi, chili and other spice extracts, hops, hinokitiol, etc., but these substances have their unique taste and smell. Therefore, practical examples are limited to only a part, and since the water solubility of the active ingredient is poor, sufficient efficacy cannot be exhibited in an aqueous solution. On the other hand, lactic acid bacteria are one of the useful microorganisms that have been used for the production of various fermented foods and beverages such as soy sauce, miso, pickles and sake since ancient times. When lactic acid bacteria are used in the manufacturing process of the product, the action of lactic acid and antibacterial peptides produced from the lactic acid bacteria can suppress the growth of bacteria during the manufacturing process and storage of the product, and prevent deterioration of the product quality. It is known that As an example using such a technique, a method using a culture product of Enterococcus microorganisms or Lactococcus microorganisms is known (see, for example, Patent Documents 1 to 3 and Non-Patent Document 1).

JP 2003-235529 A JP 2003-164276 A JP 2004-105118 A Journal of Bacteriology, 180, 1988-1994 (1998)

Antibacterial peptides produced by such lactic acid bacteria are expected to be safe antibacterial substances because they are degraded by proteolytic enzymes, but they are not always satisfactory in their antibacterial activity, etc. There are few things that can be sufficiently used as sex substances.
An object of the present invention is to provide a natural antibacterial substance having excellent antibacterial activity and high safety by using lactic acid bacteria which have been used for food and food processing for a long time.

  The present inventors have studied to solve the above-mentioned problems, and have isolated lactic acid bacteria from various fermented foods and screened for strains that produce antibacterial peptides. As a result, we succeeded in isolating lactic acid bacteria that can be easily grown and efficiently produced in a medium with a simple composition, and some of the proteins produced by these lactic acid bacteria have a very broad antibacterial spectrum. As a result, the present invention has been completed.

That is, the gist of the present invention is as follows.
(1) An antibacterial peptide having an amino acid sequence represented by SEQ ID NO: 1 or 2 in the sequence listing. (2) DNA comprising a region encoding the antibacterial peptide according to (1) shown in SEQ ID NO: 3 in the sequence listing.

  Since the novel antibacterial peptide of the present invention is produced by lactic acid bacteria isolated from fermented foods that have been ingested for many years, it is highly safe, and against Bacillus bacteria, lactic acid bacteria, staphylococci, and Listeria. It exhibits excellent antibacterial activity and can effectively suppress the growth of these bacteria. Therefore, this antibacterial peptide exerts an effect that it is possible to prevent deterioration of the quality of the product due to bacterial propagation during the production process and storage of foods and other products.

  The present inventors separated a large number of lactic acid bacteria using various fermented foods as the separation source, and screened the strains using the antibacterial activity against Bacillus bacteria having strong heat resistance as an index. As a result, a particularly high antibacterial activity was found in one strain of lactic acid bacteria belonging to the genus Enterococcus isolated from pickles, and the novel antibacterial peptide of the present invention was obtained from the culture solution.

  First, lactic acid bacteria for screening were isolated and obtained as follows. That is, samples collected from various fermented foods were cultured using an MRS medium (manufactured by Merck) containing 0.5% calcium carbonate, and subcultured several times as necessary. Subsequently, this culture broth was smeared on an MRS agar medium, and lactic acid bacteria were collected from the colonies formed there. The composition of the MRS medium is as shown in Table 1.

  From the lactic acid bacteria isolated as described above, one lactic acid bacterium strain having particularly strong ability to produce an antibacterial substance was selected using as an index the antibacterial activity against Bacillus bacteria having strong heat resistance. The selected lactic acid bacteria were subjected to bacteriological properties, base sequence homology analysis of 16S ribosomal DNA of lactic acid bacteria existing in the base sequence database, and carbohydrate fermentation test. From this result, it was determined that this lactic acid bacterium was a new strain belonging to Enterococcus faecalis, and this strain was designated as CACT101 strain. 305-8566 Deposited at Tsukuba City, Ibaraki Prefecture, Japan. The deposit number is FERM P-20388.

  This new strain belonging to Enterococcus faecalis (CACT101 strain) is a streptococcus that grows under standard conditions, grows under gram positive, aerobic and anaerobic conditions, and is oxidase negative, catalase negative, non-motile, non-spore formation It has the property of sex. As for the culture properties, it grows well in broth agar plate culture and forms white, glossy small colonies, good growth and no surface growth in liquid broth culture, and acidification in litmus milk.

Next, the novel antimicrobial peptide of the present invention will be described.
The novel antibacterial peptide of the present invention can be obtained by culturing the above-mentioned Enterococcus faecalis (CACT101 strain) using MRS medium under predetermined conditions, and separating and purifying it from the culture solution. That is, the novel antibacterial peptide of the present invention is sufficiently produced by culturing for about 24 hours by culturing Enterococcus faecalis (CACT101 strain) in an MRS medium at a culture temperature of about 30 ° C. When culturing this bacterium in large quantities for the purpose of obtaining antibacterial peptides, corn medium (composition: 10 g corn steep liquor (manufactured by Shono Starch) per liter), 2 g yeast extract (manufactured by Oriental Yeast), glucose It is preferable to use 10 g) (manufactured by Wako Pure Chemical Industries, Ltd.), and culture can be performed for 24 to 48 hours at a culture temperature of about 30 ° C. using this medium.

  Separation and purification of the novel antibacterial peptide of the present invention can be performed by conventional methods. For example, the culture solution is centrifuged, and the supernatant is subjected to ammonium sulfate fractionation, followed by fractionation by anion exchange column chromatography and fractionation by reverse phase column chromatography to fractionate a fraction exhibiting antibacterial activity. Thus, the purified antimicrobial peptide of the present invention can be obtained.

  The amino acid sequence of the obtained novel antibacterial peptide of the present invention was analyzed by the following method. That is, about 70% of the total amino acid sequence was determined from the N-terminal side of this antibacterial peptide by Edman degradation method, a primer was designed based on the result, and the DNA base sequence of the neighboring region where this primer hybridized was determined. Were determined. The obtained DNA base sequence is as shown in SEQ ID NO: 3 in the sequence listing. The entire amino acid sequence of the antibacterial peptide was determined from the base sequence encoding the amino acid exhibiting antibacterial activity in this DNA base sequence. The total amino acid sequences of these antibacterial peptides of the present invention are as shown in SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence listing, and consist of 44 and 43 amino acids, respectively.

  As a peptide similar to the antibacterial peptide of the present invention, Non-Patent Document 1 describes enterocins L50A and L50B produced from Enterococcus faecalis L50. These are also composed of 44 and 43 amino acids, respectively, but the constituent amino acids are different as follows when compared with the antimicrobial peptides of the present invention of SEQ ID NO: 1 and SEQ ID NO: 2. That is, the difference is that the 38th amino acid of the peptide of SEQ ID NO: 1 is aspartic acid (D), whereas L50A is “glutamic acid (E)”. The difference is that the second amino acid is alanine (A) and phenylalanine (F), respectively, whereas L50B is "threonine (T)" and "leucine (L)", respectively. As a result of the difference between the two constituent amino acids, the antibacterial peptide of the present invention has a very wide antibacterial spectrum, and in particular exhibits excellent antibacterial activity against bacteria belonging to the genus Bacillus. Thus, L50A and L50B do not show antibacterial activity against Bacillus cereus, which is known as a causative agent of food poisoning, and it is understood that both are different proteins showing different characteristics. Therefore, the antibacterial peptide of the present invention of SEQ ID NO: 1 and SEQ ID NO: 2 is a novel peptide that is not known even in Non-Patent Document 1.

The antibacterial peptide of the present invention thus obtained is a novel antibacterial substance having the following characteristic properties not found in conventionally known antibacterial peptides.
The antimicrobial peptide of the present invention does not lose its activity even when left at 100 ° C. for 30 minutes, and has excellent thermal stability. Further, it has a broad antibacterial spectrum against Bacillus bacteria and lactic acid bacteria, and particularly exhibits an extremely wide antibacterial spectrum that has not been found in various conventionally known antibacterial peptides against almost all Bacillus bacteria. In addition, when trypsin or proteinase, which is a digestive enzyme, is added, it decomposes and loses its activity. Therefore, it is considered that the antibacterial peptide of the present invention is easily degraded in the digestive tract even when ingested to become an amino acid, and is extremely excellent in terms of safety.

  The antibacterial peptide of the present invention has excellent heat stability, high safety, high heat resistance, and antibacterial activity against Bacillus bacteria and lactic acid bacteria, thus preventing deterioration of the quality of heat-processed products due to bacteria. Application as food and other materials can be expected.

  In addition, when actually used for foods and the like, it is not always necessary to purify the antibacterial peptide as described above, and the culture solution itself of Enterococcus faecalis (CACT101 strain) using food materials as a raw material, or this culture A concentrate obtained by concentrating the liquid or a dried product may be used.

  Next, although an Example is given to below and this invention is demonstrated still in detail, this invention is not limited at all by these. In each example, “%” is based on mass unless otherwise noted.

(1) Preparation of antibacterial peptide coarse powder Enterococcus faecalis (CACT101 strain) was inoculated into 100 mL of TYG medium (1% tryptone, 0.5% yeast extract, 1% glucose, 0.5% salt) at 30 ° C. A preculture was obtained by culturing for 24 hours. Next, corn medium (corn steep liquor (manufactured by Shono Starch Co., Ltd.) 1%, yeast extract (manufactured by Oriental Yeast Co., Ltd.) 0.2%, glucose (manufactured by Wako Pure Chemical Industries, Ltd.) 1%, salt 0.2%, manganese sulfate 0 0.02% (adjusted to pH 6.5)) The above pre-cultured solution was added to 10 liters and cultured at 30 ° C. for 36 hours under control at the lower limit of pH 5.5 to obtain a culture solution containing an antimicrobial peptide. After removing the cells from this culture by centrifugation (20000 G × 10 minutes), the culture supernatant is sterilized at 80 ° C. for 30 minutes and then spray-dried to obtain about 500 g of the antibacterial peptide crude powder of the present invention. It was.

(2) Purification of antibacterial peptide crude powder A 2% aqueous solution of the antibacterial peptide crude powder obtained in (1) above was prepared, and the antibacterial peptide was purified by the following procedure.
(i) Ammonium sulfate fraction A fraction dissolved in a 40% saturated aqueous ammonium sulfate solution and precipitated in an 80% saturated aqueous ammonium sulfate solution was obtained, and the aqueous solution of the fraction was desalted with a dialysis membrane manufactured by Funakoshi.
(ii) Cation exchange chromatography The aqueous solution obtained in (i) above was subjected to cation exchange chromatography under the following conditions, and components that were not adsorbed on the column were removed by washing with water, and then the eluent was passed through and flowed out. The fraction was collected as antibacterial fraction A.
Carrier: SP Sepharose Fast Flow (Amershum)
Eluent: 1M NaCl in 20nM Na phosphate (pH 5.9)
(iii) Hydrophobic interaction chromatography The antibacterial fraction A obtained in (ii) above is subjected to hydrophobic interaction chromatography under the following conditions to remove components that are not adsorbed on the column by washing with water, and then the eluent is removed. The fraction that flowed out through the solution was collected as an antibacterial fraction B.
Carrier: Octyl Sepharose (Amershum)
Eluent: EtOH / 20 mM Na phosphate (pH 5.9) (7/3)
(iv) Reversed phase HPLC
The antibacterial fraction B obtained in the above (iii) is subjected to reverse phase HPLC under the following conditions, and components not adsorbed on the column are removed by washing with water. And E were separated.
Column: Capcell Pak C18MG 4.6mm × 150mm (Shiseido)
Eluent A: 0.1% trifluoroacetic acid aqueous solution Eluent B: 0.1% trifluoroacetic acid acetonitrile solution
Eluent B is 20% → 40% 120 minute linear gradient detection: 220nm
Injection volume: 0.5ml (per time)
Fractions D and E containing the antibacterial peptide thus obtained each showed a single band in tricine-SDS-polyacrylamide gel electrophoresis.

(3) Determination of amino acid sequence of antibacterial peptide In (1) above, DNA was extracted from the cells obtained as a centrifuge when the cells were removed from the culture solution by centrifugation. The extraction method followed Appl. Environ. Microbiol. 1983 September, 46 (3), 549-552.
Next, an amino acid sequence of about 30 to 40 amino acids from the N-terminus of the peptides contained in fractions D and E containing the antibacterial peptide obtained in (2) above was determined by Edman degradation. The results are shown below and shown as SEQ ID NOS: 4 and 5 in the sequence listing.
Fraction D:
Met Gly Ala Ile Ala Lys Leu Val Ala Lys Phe Gly Trp Pro Ile Val Lys Lys Tyr Tyr Lys Gln Ile Met Gln Phe Ile Gly Glu Gly Trp Ala Ile Asn Lys Ile Ile
Fraction E:
Met Gly Ala Ile Ala Lys Leu Val Ala Lys Phe Gly Trp Pro Phe Ile Lys Lys Phe Tyr Lys Gln Ile Met Gln Phe Ile Gly Gln Gly
Primers AB-1, A-2, and B-2 were designed based on the amino acid sequences of the above peptides. The DNA base sequence is shown below.
AB-1: AA YTT NGC NAC NAR YTT NGC DAT
A-2: TGG CCN ATH GTN AAR AAR TAY TA
B-2: TGG CCN TTY ATH AAR AAR TTY TA
Here, R represents A and G, Y represents C and T, D represents A, G and T, H represents A, C and T, and N represents a mixture of A, C, G and T.

Using these primers, PCR was directly performed using DNA extracted from the cells as a template, and the base sequence of the amplified DNA fragment was determined by a DNA sequencer. Based on the DNA base sequence determined here, the following primers were synthesized, and the DNA base sequence of 1863 bases before and after the region encoding the peptide was determined.
N-1F: GATGGGCAATTAACAAAATTATTG
N-1C: AATATGTTTTTTGATCCAATCAAT
N-2F: TGATGAAAAAGACCAACAGGGTATAC
N-2C: GCTATTTCTGGAAATAGAATATCCTC
The result of the determined DNA base sequence is as shown in SEQ ID NO: 3. The entire amino acid sequence of the portion encoding the antibacterial peptide contained in fractions D and E was determined from the DNA base sequence of SEQ ID NO: 3. The peptide of fraction D consists of a total of 44 amino acids, as shown in SEQ ID NO: 1 in the sequence listing, and the peptide of fraction E consists of a total of 43 amino acids, shown in SEQ ID NO: 2 of the sequence listing. It is as follows.
・ Peptide 1 (peptide of fraction D)
Met Gly Ala Ile Ala Lys Leu Val Ala Lys Phe Gly Trp Pro Ile Val Lys Lys Tyr Tyr Lys Gln Ile Met Gln Phe Ile Gly Glu Gly Trp Ala Ile Asn Lys Ile Ile Asp Trp Ile Lys Lys His Ile
・ Peptide 2 (peptide of fraction E)
Met Gly Ala Ile Ala Lys Leu Val Ala Lys Phe Gly Trp Pro Phe Ile Lys Lys Phe Tyr Lys Gln Ile Met Gln Phe Ile Gly Gln Gly Trp Thr Ile Asp Gln Ile Glu Lys Trp Leu Lys Arg His

Antibacterial peptide antibacterial spectrum TYG agar medium supplemented with the antibacterial peptide coarse powder obtained in Example 1 (tryptone 1%, yeast extract 0.5%, glucose 1%, salt 0.5%, agar 1.5% ) Were inoculated with various test bacteria shown in the following Tables 2 to 4, cultured at 30 ° C. for 2 days, and then the growth of the bacteria was observed. The results are shown in Table 2, Table 3 and Table 4.

  As can be seen from the results in Table 2, the antibacterial peptide of the present invention exhibits excellent antibacterial activity against all tested Bacillus bacteria and exhibits a very broad antibacterial spectrum. Moreover, as can be seen from the results in Table 3, the antibacterial peptide of the present invention has antibacterial activity against some of the lactic acid bacteria, and as can be seen from the results in Table 4, there are other staphylococci. Antibacterial activity was also shown against (Staphylococcus aureus) and Listeria monocytogenes. Such a broad antibacterial spectrum has never been seen in the prior art and is a remarkable characteristic property of the antibacterial peptide of the present invention.

(1) Thermal stability of antibacterial peptide A 1% aqueous solution of the antibacterial peptide crude powder obtained in Example 1 was prepared, the pH was adjusted to 5 and 6 with hydrochloric acid or sodium hydroxide, and 90 ° C and 100 ° C. For 30 minutes. 0.02 mL of these samples was spotted on an MRS agar medium previously mixed with Lactobacillus plantarum (JCM1057), cultured at 30 ° C. for 2 days, and the diameter of the growth inhibition circle was measured. When the growth inhibition circle by the antibacterial peptide aqueous solution before heating was compared with the growth inhibition circle by each sample after standing at the above temperature, there was almost no difference between them. As can be seen from the results, the antibacterial peptide of the present invention is stable even when heated at 100 ° C. for 30 minutes at pH 5 to 6, and has excellent heat resistance.

(2) pH stability of antibacterial peptide A 1% aqueous solution of the antibacterial peptide crude powder obtained in Example 1 was prepared, and its pH value was adjusted to 3, 4, 5, 6, 7, with hydrochloric acid or sodium hydroxide. Adjusted to 8 and 9. Each of these samples was allowed to stand at room temperature for 1 day, and then its pH was adjusted to about 6 and 0.02 mL was spotted on an MRS agar medium previously mixed with Lactobacillus plantarum (JCM1057). The culture was cultured for days, and the diameter of the growth inhibition circle was measured. When the growth inhibition circle by the antibacterial peptide powder solution before treatment and the growth inhibition circle by the sample treated at each pH described above were compared, there was almost no difference between the samples at all pHs from pH 3 to pH 9. Furthermore, there was almost no difference from that of the sample before the treatment. As can be seen from the results, the antibacterial peptide of the present invention is stable in the range of pH 3 to 9 without a decrease in antibacterial activity.

(3) Decomposition of antibacterial peptide by digestive enzyme A 1% aqueous solution of the antibacterial peptide crude powder obtained in Example 1 was prepared, 0.01% pronase (Roche) was added, and the mixture was incubated at 37 ° C for 1 hour. . The antibacterial activity of this sample was measured by observing a growth inhibition circle on the MRS agar medium by the same method as in (1) and (2) above. As a result, it was found that when pronase was added, no growth inhibition circle was observed, and the antibacterial peptide lost its antibacterial activity by pronase treatment.

  By using the antibacterial peptide of the present invention, it exhibits excellent antibacterial action against a wide range of bacteria including Bacillus bacteria, and is useful for preventing the decay of many foods and other products. Useful in many industries.

Claims (2)

An antibacterial peptide having an amino acid sequence represented by SEQ ID NO: 1 or 2 in the sequence listing. A DNA comprising a region encoding the antibacterial peptide according to claim 1 represented by SEQ ID NO: 3 in the sequence listing.