JP4839583B2 - Antibody specific for Fcγ receptor IIIa and method for measuring Fcγ receptor IIIa using the same - Google Patents

Description

  The present invention relates to an antibody specific for Fcγ receptor IIIa, a method for measuring Fcγ receptor IIIa using the same, and a method for diagnosing rheumatoid arthritis by measuring the amount of soluble Fcγ receptor IIIa by the method. is there.

  Rheumatoid Arthritis (hereinafter abbreviated as RA) is a systemic inflammatory disease with the synovial membrane as the main lesion, and it causes bone and joint destruction as it progresses. The number of patients in Japan is between 7 and 1 million, and the incidence of women in their 30s to 50s, the working age, is high. In addition, in RA patients, not only physical aspects such as pain and deformed joints, but also an incurable disease lowers the quality of life (QOL) mentally. Recently, however, various therapeutic agents have been developed, and it has become possible to prevent a decrease in QOL by appropriate treatment from the early stage of onset.

  The diagnosis of RA is comprehensively judged based on clinical experience based on the results of blood tests such as Lansbury Index, red sediment, CRP, and RF factors, and X-ray tests. However, these values vary from case to case and are not sufficient for early diagnosis of RA, and the development of an index that can quantitatively evaluate the onset of RA is desired.

On the other hand, Fcγ receptors (FcγRs) are receptors for the Fc portion of IgG, and are classified into three subgroups, namely FcγRI, FcγRII, and FcγRIII. Among these, FcγRIII has two types, FcγRIIIa and FcγRIIIb. FcγRIIIa is a transmembrane glycoprotein expressed in natural killer (NK) cells, part of T lymphocytes, part of monocytes, and macrophages (Ravetch, JV et al., J. Exp Med., 170, 481-497, 1989). FcγRIIIa (NK cell type FcγRIIIa, hereinafter abbreviated as FcγRIIIa ^NK ) expressed in NK cells and FcγRIIIa (macrophage type FcγRIIIa, hereinafter abbreviated as FcγRIIIa ^Mφ ) expressed in macrophages are modified sugars. It is thought that there is a difference in the chains (de Haas, M. et al., J. Immunol., 152, 900-907, 1994). When FcγRIIIa ^Mφ and FcγRIIIa ^NK (hereinafter abbreviated as FcγRIIIa ^NK ) are activated, a soluble protease [soluble FcγRIIIa ^Mφ (hereinafter referred to as sFcγRIIIa ^Mφ ) and soluble FcγRIIIa ^NK ( Hereinafter, each is abbreviated as sFcγIIIa ^NK ), and these are collectively abbreviated as sFcγRIIIa. (Harrison, D. et al., J. Immunol., 147, 3459-3465, 1991, Levy, PC et al., Am. J. Resp. Cell Mol. Biol., 5, 307-314, 1991).

  FcγRIIIb is a glycoprotein of GPI (glycosyl-phosphatidyl-inositol) -anchor type and is expressed exclusively in neutrophils (Huizinga, T. W. J. et al., Nature, 333, 667-669, 1988). FcγRIIIb has two allotypes of NA1 and NA2 (hereinafter abbreviated as NA1-FcγRIIIb and NA2-FcγRIIIb) and is released as soluble FcγRIIIb (hereinafter abbreviated as sFcγRIIIb) during neutrophil activation and apoptosis. (Huizinga, TWJ et al., Blood, 75, 213-217, 1990, Hamburg, CHE, et al., Blood, 85, 532-540, 1995).

Total soluble FcγRIII (hereinafter abbreviated as total sFcγRIII) has been detected in saliva, synovial fluid, semen, serum and plasma (de Haas, M. et al., J. Immunol., 152, 900- 907, 1994, Huizinga, TWJ et al., Blood, 75, 213-217, 1990, Huizinga, TWJ et al., Br. J. Haematol., 87, 459-463, 1994, Sautes, C. et al. , Immunobiol., 185, 207-221, 1992, Galon, J. et al., Eur. J. Immunol., 28, 2101-2107, 1998, Koene, HR et al., Br. J. Haematol., 93 , 235-241, 1996). Among them, plasma total sFcγRIII is mainly neutrophil-derived sFcγRIIIb, and NK cell-derived sFcγRIIIa ^{NK and} macrophage-derived sFcγRIIIa ^Mφ are considered to be trace amounts (de Haas, M. et al., J. Immunol., 152, 900-907, 1994, Huizinga, TWJ et al., Br. J. Haematol., 87 459-463, 1994, Masuda, M. et al., J. Rheumatol., 30, 1191-1197, 2003, Masuda, M. et al., Clin. Exp. Immunol., 132, 466-484, 2003).

  Until now, specific detection of sFcγRIIIa had to use a sensitive but complicated measurement method such as Immuno-PCR (Masuda, M. et al., Clin. Exp. Immunol., 132, 466-484, 2003, Masuda, M. et al., J. Rheumatol., 30, 1191-1197, 2003). Furthermore, the monoclonal antibody that has been used for the measurement of sFcγRIIIa so far binds not only to sFcγRIIIa but also to NA2-FcγRIIIb (Masuda, M. et al., Clin. Exp. Immunol., 132, 466-484, 2003, Masuda, M. et al., J. Rheumatol., 30, 1191-1197, 2003), and it was virtually impossible to measure sFcγRIIIa and sFcγRIIIb separately in NA2 + phenotype patients.

Increased NK cells, monocytes, macrophages, lymphocytes, plasma cells, etc. in the synovial fluid of RA-affected joints, as well as elevation of metalloprotease protein and resulting destruction of intercellular matrix (non-patented) Reference 1). Moreover, in NK cells isolated from lesion joint synovial fluid, the expression level of FcγIIIa is decreased (Non-patent document 2, Non-patent document 3). It is presumed that FcγRIIIa is cleaved. Furthermore, reports that sFcγRIIIa in RA patient plasma is increased compared to that in healthy subject plasma (Non-patent Documents 4 and 5), and sFcγRIIIa and sFcγRIIIa ^Mφ in RA patient plasma are present in healthy subject plasma. There is a report (Non-Patent Document 6) that it is increased compared to However, since sFcγRIIIa in plasma is very small, and an antibody that specifically binds to sFcγRIIIa but does not bind to FcγRIIIb has not been obtained, a simple and useful method for measuring sFcγRIIIa has not been reported. .

Brinckerhoff CE, Arthritis Rheum, 34, 1073-1075, 1991 Hendrich, C. et al., Arthritis Rheum, 34, 423-431, 1991 Tak PP et al., Arthritis Rheum, 37, 1735-43, 1994 de Haas, M. et al., J Immunol 152, 900-907, 1994 Masuda, M. et al., J Rheumatol, 30, 1191-1197, 2003 Masuda, M. et al., Clin Exp Immunol, 132, 466-484, 2003

  The present invention has been made in view of the above circumstances, and an object thereof is to provide an antibody that specifically binds to FcγRIIIa and a hybridoma that produces the monoclonal antibody. Furthermore, the present invention provides a method for easily measuring the amount of FcγRIIIa using an antibody that specifically binds to FcγRIIIa, and a method for early diagnosis of RA by measuring the amount of soluble FcγRIIIa by the method. With the goal.

  Unless otherwise specified, hereinafter, “FcγRIIIa” may include FcγRIIIa and sFcγRIIIa.

  As a result of intensive studies to obtain an antibody specific to FcγRIIIa that has not been obtained so far, the present inventors obtain a monoclonal antibody that specifically binds to FcγRIIIa but has no reactivity to FcγRIIIb. I was able to. Furthermore, when sFcγRIIIa content in biological samples (eg blood, serum, plasma, etc.) was measured using this antibody and the relationship between this value and RA was investigated, the content of sFcγRIIIa was significantly increased in RA patients. As a result, it was found that measurement of the content of sFcγRIIIa makes it possible to diagnose whether or not it is RA, and the present invention has been completed.

That is, this invention consists of the following structures.
(1) A monoclonal antibody MKGR155 that specifically binds to Fcγ receptor IIIa produced by a hybridoma deposited under accession number FERM BP-10062 .
(2) A hybridoma producing the monoclonal antibody according to (1), deposited under the deposit number FERM BP-10062 .
(3) A method for measuring the amount of Fcγ receptor IIIa, which comprises measuring by an immunological measurement method using the monoclonal antibody according to (1 ) above .
(4) Using the antibody described in (1 ) above and an antibody that binds to FcγRIIIa, measure the amount of soluble Fcγ receptor IIIa in the sample by the method described in (3) above, and determine based on the measurement result A method for obtaining data for the determination of rheumatoid arthritis, characterized by:
(5) A kit for measuring Fcγ receptor IIIa, comprising the monoclonal antibody according to (1 ) above .
(6) A RA determination kit comprising an antibody that binds to Fcγ receptor IIIa and the monoclonal antibody according to (1) above .

  The present invention provides an antibody that specifically binds to FcγRIIIa, a hybridoma that produces this monoclonal antibody, and a method for measuring the amount of FcγRIIIa using the antibody. By measuring the amount of FcγRIIIa using the antibody, it is possible to measure the amount of FγRIIIa in a sample more simply, quickly and specifically than before.

Moreover, the amount of sFcγRIIIa in a biological sample can be measured using the method for measuring the amount of FcγRIIIa of the present invention, and whether or not it is RA can be diagnosed based on the measurement result.
In this specification, the case of “diagnosing” whether or not RA is included includes the case of “determining” whether or not RA is based on the measurement result of the amount of FcγRIIIa.

The antibody that specifically binds to FcγRIIIa according to the present invention (hereinafter referred to as anti-FcγRIIIa-specific antibody) has reactivity with both FcγRIIIa ^Mφ (including sFcγRIIIa ^Mφ ) and FcγRIIIa ^NK (including sFcγRIIIa ^NK ) (FcγRIIIa). ^Mφ and FcγRIIIa ^NK ), which have substantially no reactivity to FcγRI (including sFcγRI), FcγRII (including sFcγRII), FcγRIIIb (including sFcγRIIIb), etc. (FcγRI and FcγRII, FcγRIIIb etc. are not recognized).

  In the present specification, unless otherwise specified, “reactive”, “react”, “bind”, and “recognize” are all the reactivity of an antibody (what can it bind to? ) Is used as a synonym. The description “specifically binds” is used to mean that it binds only to a certain object and does not bind to other objects.

  The origin of the anti-FcγRIIIa specific antibody is not particularly limited, and it may be a polyclonal antibody or a monoclonal antibody.

  In order to obtain the anti-FcγRIIIa-specific antibody according to the present invention, FcγRIIIa used as an immunogen was isolated from, for example, human citrated blood by Percoll density gradient centrifugation and counterflow centrifugal elutriation. It can be prepared from a lysed NK cell. Protein purification may be performed by a method known per se, for example, by combining several chromatographic techniques such as affinity chromatography using Sepharose beads coated with anti-FcγRIII antibody or anti-FcγRIIIa antibody.

  In addition, recombinant FcγRIIIa obtained by a genetic method known per se can also be used as an immunogen.

  As a method for preparing recombinant FcγRIIIa by a genetic method, for example, selected from the 3′-terminal region of the nucleotide sequence (SEQ ID NO: 1) of Human FcγRIIIa cDNA (GenBank accession No. BC017865) encoding FcγRIIIa gene by a conventional method Reverse primer designed from any position, forward primer designed from any position between the 5'-end of SEQ ID NO: 1 to the start codon, and cDNA live containing Human FcγRIIIa cDNA (GenBank accession No.BC017865) as a template A DNA fragment of a sequence containing the target FcγRIIIa gene or a gene fragment thereof (for example, positions 43 to 672 of SEQ ID NO: 1, shown in SEQ ID NO: 3) was amplified by a PCR reaction using a rally (Human Leucocyte cDNA or the like). Thereafter, the obtained DNA fragment is incorporated into an appropriate vector DNA according to a conventional method to obtain a recombinant vector.

  The base sequence of the DNA fragment incorporated into the recombinant vector is analyzed to confirm that the target FcγRIIIa gene or a sequence containing the fragment is incorporated.

  The DNA fragment (including the FcγRIIIa gene or a sequence containing the fragment) to be incorporated into the vector can be used as it is or after digestion with a restriction enzyme or adding a linker as desired.

  Examples of expression vectors used herein include plasmid vectors, phage vectors, and virus vectors.

  Specifically, for example, plasmid vectors such as pcDNA3.1 / myc-His vector (Invitrogen), pUC119 (Takara Shuzo), pBR322 (Takara Shuzo), pBluescript II KS + (Stratagene), λENBL3 ( And bacteriophage vectors such as λDASHII (manufactured by Funakoshi), cosmid vectors such as Charomid DNA (manufactured by Wako Pure Chemical Industries, Ltd.) and Lorist6 (manufactured by Wako Pure Chemical Industries, Ltd.).

  In addition, plasmids derived from E. coli (eg, pTrc99A, pKK223, pET3a), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, pC194), plasmids derived from yeast (eg, pSH19, pSH15), bacteriophages such as λ phage, retroviruses, vaccinia In addition to animal viruses such as viruses and baculoviruses, pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNA I / Neo, p3 × FLAG-CMV-14, and the like can also be used.

  In order to facilitate detection and purification, the target FcγRIIIa protein may be expressed as a fusion protein with another tag peptide or protein. Examples of tag peptides to be fused include FLAG tag, 3XFLAG tag and His6 tag, and examples of proteins include β-galactosidase (β-Gal), green fluorescent protein (GFP), maltose binding protein (MBP) and the like.

  Actually, the PCR reaction using a primer designed with a sequence encoding the tag peptide as described above before and after the open reading frame is subcloned into an expression vector, or between the gene and the expression vector. The FcγRIIIa protein is expressed as a fusion protein with these peptides and proteins by inserting a linker of the sequence encoding the tag peptide or using an expression vector containing a sequence encoding the tag peptide or protein in advance. For example, if a myc epitope tag gene, a pcDNA3.1 / myc-His vector (manufactured by Invitrogen) incorporating a His tag gene is used as an expression vector, and a sequence containing the FcγRIIIa gene or a fragment thereof is incorporated upstream, this His By confirming the expression of the tag or myc epitope tag, the expression of the FcγRIIIa gene in the upstream region is also confirmed.

Using the obtained recombinant vector, for example, Escherichia coli , E. coli K-12 (American Type Culture Collection (ATCC)), E. coli JM109 (manufactured by Nippon Gene Co., Ltd.), DH5α ((strain) ) Produced by Nippon Gene Co., Ltd.), VCS257, etc., preferably E. coli K-12 is transformed to obtain a transformant.

  Transformation can be performed, for example, by the method of D. M. Morrison (Method in Enzymology, 68, 326-331, 1979).

  After mass-culturing the obtained transformant, the plasmid is recovered from the obtained transformant by a conventional method.

  When cultivating a transformant in which the host of the transformant is Escherichia coli, a liquid medium is suitable as a medium used for the culture, and a carbon source and a nitrogen source necessary for the growth of the transformant are included therein. In addition, inorganic substances and the like are contained. Examples of the carbon source include glucose, dextrin, soluble starch, and sucrose. Examples of the nitrogen source include ammonium salts, nitrates, corn steep liquor, peptone, yeast extract, casein, meat extract, soybean cake, potato Examples of inorganic or organic substances and inorganic substances such as extracts include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5-8.

  As a medium for culturing a transformant whose host of the transformant is E. coli, for example, LB medium, 2 × YT medium, M9 medium [Miller, Journal of Experiments in Molecular -Genetics (Journal of Experiments in Molecular Genetics, 431-433, Cold Spring Harbor Laboratory, New York, 1972). If necessary, a drug such as isopropyl-β-D-thiogalactopyranoside (IPTG) or 3β-indolylacrylic acid can be added.

  The resulting expression plasmid is then introduced into a suitable host cell.

  Animal cells are desirable as the host used to obtain the transductant.

  Examples of animal cells include African green monkey cells COS-7, Vero, Chinese hamster cells CHO (eg CHO-K1), dhfr gene-deficient Chinese hamster cells CHO, mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3. , Human FL cells and the like are used. Furthermore, various normal human cells such as hepatocytes, spleen cells, nerve cells, glial cells, pancreatic β cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, Muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, NK cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synoviocytes, chondrocytes , Bone cells, osteoblasts, osteoclasts, mammary cells, hepatocytes or stromal cells, precursor cells of these cells, stem cells, cancer cells, etc.).

  In order to introduce the obtained plasmid into animal cells, see, for example, Cell Engineering Supplement 8 New Cell Engineering Experimental Protocol, 263-267, 1995) (published by Shujunsha), Virology, 52, 456, 1973) It can be carried out according to the method described.

  Moreover, it can also carry out according to the protocol, using a commercially available transduction reagent. An example is an electroporation method using GenePulser Xcell (manufactured by Bio-Rad).

Here, as a method for confirming that an introducer into which an expression plasmid incorporating a target FcγRIIIa gene sequence or a sequence containing a fragment thereof has been introduced is obtained, for example, the vector used for obtaining the expression plasmid is previously possessed. There is a method of checking the drug resistance of the introduced body by using the drug resistance gene that is present and confirming the resistance. For example, when the pcDNA3.1 / myc-His vector is used as an expression vector, the vector has a gene for neomycin resistance ( neo ). Therefore, for example, culturing in a medium supplemented with geneticin, and confirming that the cultured introducer (neomycin resistant strain) is an introducer into which an expression plasmid incorporating a sequence containing the target FcγRIIIa gene or a fragment thereof is introduced. A method is mentioned.

  In order to confirm that the introduced FcγRIIIa protein or a fragment thereof (hereinafter referred to as “recombinant FcγRIIIa protein”) is produced (the FcγRIIIa gene is expressed), the recombinant FcγRIIIa protein Is secreted into the culture medium of the introduced body, for example, a conventional immunoassay method using the antibody against the tag peptide (dot western blotting method, western blotting). And the like, and the introduction of the recombinant FcγRIIIa protein of interest can be obtained by selecting the introduction of which the tag peptide is confirmed to be expressed in the culture supernatant.

  In addition, when the recombinant FcγRIIIa protein is not secreted into the culture medium of the introduced body, for example, when expressed as a transmembrane protein, the cells are disrupted or lysed by a conventional method (for example, treated with a homogenizer, The resulting introduced body is treated with a suitable solubilizing agent such as a surfactant to obtain a lysate. For the lysate, the usual immunoassay is performed in the same manner as in the case of the culture supernatant described above, and an introducer expressing the desired recombinant FcγRIIIa protein may be selected and obtained by the same method.

  Furthermore, for the culture supernatant or lysate, for example, by performing a conventional immunoassay such as ELISA using an anti-FcγRIIIa antibody, and selecting the transfectant that has confirmed the presence of the recombinant FcγRIIIa protein, the desired recombinant A method of obtaining an introduced body expressing FcγRIIIa protein may also be used.

  The FcγRIIIa protein can be obtained by culturing an introduction plasmid into which an expression plasmid incorporating a sequence containing the FcγRIIIa gene obtained as described above or a fragment thereof is introduced in a nutrient medium to produce a recombinant FcγRIIIa protein. it can.

  When cultivating an introduced body in which the host is an animal cell, as a medium, GIT medium (manufactured by Wako Pure Chemical Industries, Ltd.), Opti-MeM medium (manufactured by GIBCO), for example, about 5 to 20% fetal bovine serum MEM medium containing (FCS) [Science, 122, 501 (1952)], Tarbecco's modified Eagle medium (DME medium [Virology, 8, 396 (1959)]), RPMI1640 medium [Journal The Jounal of the American Medical Association 199, 519 (1967)], 199 medium [Proceeding of the Society for the Biological Medicine (Proceeding of the The Society for the Biological Medicine), 73, 1 (1950)]. The pH is preferably about 6-8. The culture is usually performed at about 30 ° C. to 40 ° C. for about 15 to 120 hours, and aeration and agitation are added as necessary.

  Next, when the recombinant FcγRIIIa protein is secreted into the culture solution, the introduced body and the culture supernatant are separated by a method known per se after the completion of the culture, and the culture supernatant is collected. When the recombinant FcγRIIIa protein is expressed as a transmembrane protein, for example, when it is not secreted into the culture medium of the transduct, the transduct obtained by a conventional method for destroying or lysing cells as described above And get that lysate. It is optional to subject the lysate to a treatment such as centrifugation before the purification of the recombinant FcγRIIIa protein, if necessary.

  Purification of the recombinant FcγRIIIa protein contained in the culture supernatant or lysate thus obtained can be performed by appropriately combining per se known separation and purification methods. These known separation and purification methods include methods utilizing differences in solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis. Mainly using the difference in molecular weight, using the difference in charge such as ion exchange chromatography, using the specific affinity such as affinity chromatography, and the difference in hydrophobicity such as reversed-phase high-performance liquid chromatography For example, a method using a difference in isoelectric point such as an isoelectric focusing method or the like is used.

  The presence of the recombinant FcγRIIIa protein thus separated and purified can be confirmed by measurement by ELISA using an anti-FcγRIIIa antibody or the like.

The FcγRIIIa protein is encoded by positions 49 to 810 in Human FcγRIIIa cDNA (GenBank accession No. BC017865, nucleotide sequence represented by SEQ ID NO: 1). Of these, positions 49 to 672 encode the extracellular part of FcγRIIIa protein, positions 678 to 735 encode the intracellular part of FcγRIIIa protein, and positions 736 to 810 encode the intracellular part of FcγRIIIa protein. . The amino acid sequence encoded by the FcγRIIIa gene is shown in SEQ ID NO: 2.
Furthermore, FIG. 6 shows the nucleotide sequence (SEQ ID NO: 1) of Human FcγRIIIa cDNA and the amino acid sequence encoded by it.

  The method for obtaining the target recombinant FcγRIIIa protein will be described in more detail as follows.

  First, for example, a reverse primer from any position selected from the 3′-terminal region of the nucleotide sequence (SEQ ID NO: 1) of Human FcγRIIIa cDNA (GenBank accession No. BC017865) encoding FcγRIIIa gene by a conventional method, The forward primer is designed from any position between the 5'-end of 1 and the start codon. Then, a normal PCR reaction using a cDNA library (Human Leucocyte cDNA, etc.) containing the reverse primer, forward primer and human FcγRIIIa cDNA (GenBank accession No. BC017865) as a template is performed, and the target FcγRIIIa gene or gene fragment thereof is obtained. Is amplified. The reaction may be performed for 15 to 40 cycles.

The obtained DNA fragment is digested with an appropriate restriction enzyme such as HindIII or NotI, if necessary, and inserted into an appropriate restriction enzyme site of an expression vector such as a pcDNA3.1 / myc-His vector. The expression vector may incorporate a drug resistance gene [for example, neomycin resistance ( neo )] in order to confirm whether the transformant has integrated the target gene. Moreover, in order to confirm whether the target protein performed later was expressed, the sequence which codes tag peptides, such as a myc epitope tag gene and a His tag gene tag peptide, may be included beforehand.

Subsequently, the resulting recombinant vector is used to transform a host such as a bacterium such as E. coli , and the obtained transformant is cultured in large quantities, followed by conventional methods [cesium chloride density gradient centrifugation, plasmid purification. The plasmid is recovered using a kit (Qiagen). The expression plasmid thus obtained is introduced into an appropriate host cell such as CHO-K1 cell, for example, by electroporation using GenePulser Xcell (manufactured by Bio-Rad). Thereafter, an introduced body incorporating the target gene is selected based on drug resistance and the like, and then cloned by a conventional method such as a limiting dilution method.

  Then, when selecting the clone of the introduced body that purifies the target recombinant FcγRIIIa protein, if the protein is secreted into the culture supernatant of the introduced body, the cloned introduced body is cultured, for example, a tag A cell line that expresses the desired recombinant FcγRIIIa protein by a method of selecting a positive clone that secretes the desired recombinant FcγRIIIa protein in the culture supernatant by an ordinary method such as dot western blotting using an antibody against the peptide Can be obtained.

  In addition, when the target recombinant FcγTIIIa protein is not secreted into the culture medium of the introduced body as described above, the obtained introduced body is treated by a conventional method for destroying or lysing cells as described above. Get a lysate. Then, for the lysate, in the same manner as in the case of the culture supernatant, for example, an antibody against the tag peptide is used, and a positive clone producing the desired recombinant FcγRIIIa protein is selected by a conventional method such as a dot western blotting method. Thus, a cell line expressing the desired recombinant FcγRIIIa protein can be obtained.

  In order to obtain the target recombinant FcγRIIIa protein, when the protein is secreted into the culture supernatant of the transductant, a cell line stably expressing the obtained recombinant FcγRIIIa protein is added to a medium [eg, GIT medium. (Manufactured by Wako Pure Chemical Industries, Ltd.), after culturing to 100% confluent state, change to another medium if necessary [for example, Opti-MEM medium (GIBCO)], and repeat the medium exchange to collect the culture supernatant . The target recombinant FcγRIIIa protein can be obtained by subjecting the collected culture supernatant to conventional methods for producing and concentrating proteins such as centrifugation, ultrafiltration, and affinity column chromatography.

  Further, when the protein is not secreted into the culture medium of the introduced body, a conventional method for destroying or lysing the cells as described above after culturing the obtained cell line stably expressing the recombinant FcγRIIIa protein To obtain lysate. The lysate is subjected to a conventional method for producing and concentrating proteins such as centrifugation, ultrafiltration and affinity column chromatography in the same manner as in the case of the culture supernatant, thereby obtaining the target recombinant FcγRIIIa protein. be able to.

  As a method for obtaining an anti-FcγRIIIa-specific polyclonal antibody according to the present invention, FcγRIIIa obtained by the method as described above or a fragment thereof can be obtained by a conventional method [eg, Introduction to Immunological Experiments, Second Printing, Nao Matsuhashi et al. According to the method described in the center, 1981, etc.], it may be prepared by a conventional method for immunizing animals such as horses, cows, sheep, rabbits, goats, guinea pigs, rats and mice.

Further, as a method for obtaining the anti-FcγRIIIa-specific monoclonal antibody according to the present invention, for example, an animal such as a rat or a mouse immunized with the FcγRIIIa obtained by the method as described above or a fragment thereof, for example, spleen cells, lymph A cell fusion technique developed by Keller and Milstein et al. (Nature, 256, 495) is used for immunized cells such as spheres and cells having a permanently proliferating property such as myeloma cells. , 1975) to produce a hybridoma and select a hybridoma that produces a monoclonal antibody specific for the measurement target, and the hybridoma is cultured in a culture medium or administered into the peritoneal cavity of an animal. A method for producing an antibody and collecting a target monoclonal antibody from the culture or ascites, for example, a method known per se (Eur. J. Immunol., 6 , 511, 1976), and producing a cell producing an antibody having the above-described properties, and culturing the cell to collect a target monoclonal antibody.

  The method for obtaining the anti-FcγRIIIa-specific monoclonal antibody according to the present invention using the recombinant FcγRIIIa protein obtained by the method as described above is taken as an example, and more specifically, for example, as follows.

  That is, a suspension is prepared by mixing the recombinant FcγRIIIa protein obtained by the above method and an adjuvant such as complete (or incomplete) Freund's adjuvant. This suspension is applied to an appropriate animal as described above in an appropriate amount, for example, the amount of FcγRIIIa protein, usually in a single dose of 0.1 to 100 μg, preferably 0.1 to 10 μg, usually every 1 to 5 weeks, preferably 2 Immunization is usually administered 3 to 10 times, preferably 3 to 8 times, subcutaneously, intravenously or intraperitoneally every 5 weeks. After immunization, blood is collected from the animal, and the serum reacts with FcγRIIIa by, for example, a method known per se such as a solid-phase enzyme immunoassay (ELISA method) using a solid phase in which FcγRIIIa is bound to an insoluble carrier. Check. After confirmation, 3 to 4 days after the final immunization, the spleen is removed from the immunized animal, and splenocytes are prepared by a conventional method. The obtained spleen cells are fused with myeloma cells such as NS-1, Sp2, and X63 according to a conventional method, and the fused cells are HAT-selected according to the conventional method. The selected fused cells are cultured, and the culture supernatant is subjected to usual ELISA, indirect immunofluorescence, SDS-polyacrylamide gel electrophoresis, Western blot immunostaining using polyvinylidene difluoride (PVDF) membrane, etc. To further select cells that produce an anti-FcγRIIIa antibody having the above properties. Subsequently, cloning by limiting dilution is performed several times, and those that are confirmed to stably produce high titer antibodies are selected as anti-FcγRIIIa monoclonal antibody-producing hybridoma strains.

  In addition, the fact that the selected anti-FcγRIIIa monoclonal antibody does not react with FcγRI, FcγRII, FcγRIIIb, etc. is obtained by binding, for example, FcγRI, FcγRII, FcγRIIIb, etc. to an insoluble carrier using the culture supernatant of the hybridoma strain producing the antibody. Confirm by known immunological methods such as solid phase enzyme immunoassay (ELISA) using solid phase, or conventional methods such as flow cytometry or immunoprecipitation to evaluate the antigen specificity of antibodies. To select as an anti-FcγRIIIa-specific monoclonal antibody-producing hybridoma strain.

  Then, according to a conventional method, the obtained hybridoma is injected into the abdominal cavity of the animal to produce an anti-FcγRIIIa-specific antibody in the ascites. The ascites is collected and purified according to a purification method usually used in this field such as ammonium sulfate salting out, dialysis using a buffer solution such as phosphate buffer, for example, DEAE-cellulose chromatography, FcγRIIIa affinity chromatography, etc. The anti-FcγRIIIa-specific monoclonal antibody according to the present invention is obtained.

Fc [gamma] RIIIa-specific antibody according to the present invention, Fc [gamma] RIIIa, i.e. specifically bind Fc [gamma] RIIIa ^NK expressed on NK cells described above, Fc [gamma] RIIIa ^{M [phi} and their soluble forms (sFcγRIIIa ^NK, sFcγRIIIa Mφ) is expressed in macrophages It has the property to do. Therefore, if an immunological measurement method using the FcγRIIIa-specific antibody is performed, the amount of FcγRIIIa expressed on the membrane surface of these cells and the amount of sFcγRIIIa released from the cells can be specifically measured.

  The subclass of the monoclonal antibody may be determined by a method known per se, such as a double immunodiffusion method (required clinical test method, 30th edition, pages 842-843, Kanehara Publishing Co., Ltd.).

Specific examples of the anti-FcγRIIIa specific antibody according to the present invention include the monoclonal antibody MKGR155 produced by the hybridoma cell line MKGR155. Hybridoma MKGR155 is, the National Institute of Advanced Industrial Science and Technology Patent Organism Depositary Center (zip code 305-8566, Higashi, Tsukuba, Ibaraki, Japan 1-chome address 1 1 Central 6), commissioned Date: July 8, 2004, Deposit number : FERM BP -10062.

In addition, these antibodies may be used as antibody molecules themselves, and may be used as F (ab ′) ₂ , Fab ′, or Fab after digestion with an enzyme such as pepsin or papain, if necessary.

  Examples of the method for measuring the amount of FcγRIIIa according to the present invention include a method of measuring by an immunological measurement method using the anti-FcγRIIIa specific antibody according to the present invention.

  For example, known enzyme immunoassay (Enzyme immunoassay, EIA), enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), chemiluminescence immunoassay (CLEIA) ), Immunofluorescence assay (Fluoimmunoassay, FIA), immuno-polymerase chain reaction (Furuya, D. et al., J. Immunol. Methods, 238, 173-180, 2000), high performance liquid chromatography (HPLC) measurement method (JP 9-301995 A), method using hybrid enzyme as a labeling substance (JP 2002-65283), method using fluorescence resonance energy transfer technology (Kaj B. et al., Ckin Chem, 45, 855-861, 1999) and the like, and it may be measured by an immunological method known per se usually used in this field. However, it is preferable to use chemiluminescence immunoassay (CLEIA) or fluorescence immunoassay (FIA) as a highly sensitive and simple measurement method.

  Further, the measurement principle of the measurement method as described above may be any of a sandwich method, a competitive method, a two-antibody method, and the like. In addition, the measurement can be performed by a heterogeneous method in which BF separation is performed using an insoluble carrier or the like, or by a homogeneous method in which BF separation is not performed. Among them, as a highly sensitive and simple measuring method, an immunological measuring method based on the sandwich method using the anti-FcγRIIIa specific antibody according to the present invention and an antibody that binds to FcγRIIIa (anti-FcγRIIIa antibody) is used. It is more preferable.

  As an example of a homogeneous measurement method, for example, an anti-FcγRIIIa-specific antibody and an anti-FcγRIIIa antibody according to the present invention are used, and a specific substance derived from a labeling substance is determined depending on whether one of the antibodies forms a complex. Using an antibody (labeled antibody) labeled with a substance with a variable signal amount, the immunoassay method by the sandwich method is performed by the above-described measurement method, and (a) an unlabeled antibody and (b) A method of forming a complex of FcγRIIIa in a sample and (c) a labeled antibody, and measuring the amount of FcγRIIIa in the sample based on the amount of signal change corresponding to the amount of the complex. Further, the amount of FcγRIIIa in a sample can be similarly measured by using two types of anti-FcγRIIIa specific antibodies having different epitopes instead of the anti-FcγRIIIa specific antibody and the anti-FcγRIIIa antibody.

  Further, as an example of a heterogeneous measurement method using an insoluble carrier, for example, one of the anti-FcγRIIIa specific antibody and the anti-FcγRIIIa antibody according to the present invention is immobilized on an insoluble carrier, and the other is labeled with a labeling substance. (A) the immobilized antibody and (b) the FcγRIIIa in the sample and (c) formed by carrying out the sandwich immunoassay by the measurement method as described above, using the prepared antibody. A method of measuring the amount of FcγRIIIa in the sample based on the amount of the labeling substance in the complex with the labeled antibody can be mentioned.

  In the sandwich immunoassay using the above-described insoluble carrier, (1) a labeled FcγRIIIa specific antibody and an anti-FcγRIIIa antibody immobilized on an insoluble carrier may be used. An FcγRIIIa antibody and an anti-FcγRIIIa-specific antibody immobilized on an insoluble carrier may be used, or (3) an anti-FcγRIIIa-specific antibody immobilized on an insoluble carrier and having an epitope different from that of the anti-FcγRIIIa-specific antibody Even if an antibody is used, the amount of FcγRIIIa can be measured.

  The anti-FcγRIIIa antibody used in the method for measuring the amount of FcγRIIIa according to the present invention may be reactive to FcγRI, FcγRII, FcγRIIIb, etc., as long as it has a property of binding to FcγRIIIa, and is specific to FcγRIIIa. There is no need to be correct.

  Further, the origin of the anti-FcγRIIIa antibody is not particularly limited, and it may be a polyclonal antibody or a monoclonal antibody. In addition, a target-specific binding molecule produced using evolutionary molecular engineering such as a phage antibody or aptamer having the property of binding to FcγRIIIa can be used in place of the above-described antibody. These may be used alone or in appropriate combination.

  In view of the specificity of antibodies having uniform properties, monoclonal antibodies are preferred over polyclonal antibodies.

  As a method for obtaining an anti-FcγRIIIa polyclonal antibody, FcγRIIIa or a fragment thereof is used as an immunogen, which is described in a conventional method [for example, Introduction to Immunological Experiments, Second Printing, Nao Matsuhashi, Society Publishing Center, 1981], etc. According to this method, for example, it may be prepared by a conventional method for immunizing animals such as horses, cows, sheep, rabbits, goats, guinea pigs, rats and mice.

  In addition, as a method for obtaining an anti-FcγRIIIa monoclonal antibody, FcγRIIIa or a fragment thereof is used as an immunogen, and immunized cells of animals such as rats and mice, such as spleen cells and lymphocytes, are immunized therewith. For example, myeloma cells and other cells having a permanently proliferating property are fused by a cell fusion technique (Nature, 256, 495, 1975) known per se developed by Keller and Milstein et al. A hybridoma that produces and produces a monoclonal antibody specific for the measurement target is selected, and the hybridoma is cultured in a medium or administered intraperitoneally to produce an antibody in ascites, and the culture Alternatively, a method for collecting a target monoclonal antibody from ascites, for example, a method known per se (Eur. J. Immunol., 6, 511, 1976) applying a gene recombination technique or the like. Properties such as to produce cells which produce antibodies with, and a method of harvesting the desired monoclonal antibodies are exemplified by culturing the cells.

These antibodies may be commercially available, or may be used as F (ab ′) ₂ , Fab ′, or Fab after digestion with an enzyme such as pepsin or papain if necessary.

  In addition, the method described in US Pat. No. 270,163 can be used to prepare an aptamer used instead of an antibody.

  In addition, FcγRIIIa used as an immunogen can be prepared from, for example, a lysed NK cell isolated from human citrated blood by Percoll density gradient centrifugation and counterflow centrifugal elutriation. . Protein purification may be performed by a method known per se, for example, by combining several chromatographic techniques such as affinity chromatography using Sepharose beads coated with anti-FcγRIIIa antibody or anti-FcγRIIIa-specific antibody. In addition, recombinant FcγRIIIa obtained by a genetic method known per se can also be used as an immunogen.

Specific examples of the anti-FcγRIIIa monoclonal antibody include CLBFcRgranI, CLB-LM6.30, GRM1 (de Haas, M. et al., Leukocyte typing V, SF Schlossmann et al. Eds. Oxford University Press, 811-817, 1995. MKGR248 is particularly preferable. Hybridoma MKGR248 to produce a monoclonal antibody MKGR248 is, the National Institute of Advanced Industrial Science and Technology Patent Organism Depositary Center (zip code 305-8566, Higashi, Tsukuba, Ibaraki, Japan 1-chome address 1 1 Central 6), commissioned Date: 2004 On July 8, 2000, the deposit number was FERM BP- 10063. CLBFcRgranI, CLB-LM6.30, and MKGR248 recognize FcγRIIIa ^NK , FcγRIIIa ^Mφ , NA1-FcγRIIIb, and NA2-FcγRIIIb. GRM1 recognizes FcγRIIIa and NA2-FcγRIIIb and does not react with NA1-FcγRIIIb.

  As the insoluble carrier used in the method for measuring the amount of FcγRIIIa according to the present invention, any carrier can be used as long as it is used in a usual immunoassay. For example, polystyrene, polypropylene, polyacrylic acid, polyacrylic acid, Synthetic polymer compounds such as methacrylic acid, polyacrylamide, polyglycidyl methacrylate, polyvinyl chloride, polyethylene, polychlorocarbonate, silicone resin, silicone rubber, such as porous glass, ground glass, alumina, silica gel, activated carbon, metal oxide, etc. An inorganic substance etc. are mentioned. These insoluble carriers can be used in a wide variety of forms such as tubes, beads, disk-like pieces, fine particles (latex particles), microplates and the like. Of these, microplates and beads are particularly preferred from the standpoints of ease of washing and operability when simultaneously processing a large number of samples.

  In addition, as a method for immobilizing the antibody on such an insoluble carrier, a method known per se, for example, a method of immobilizing by covalent bond or a method of immobilizing by physically adsorbing (Japanese Patent Publication No. 5-41946). No. Gazette etc.) may be used.

  More specifically, a solution containing an anti-FcγRIIIa-specific antibody or anti-FcγRIIIa antibody in a range of usually 0.1 μg / mL to 20 mg / mL, preferably 1 μg / mL to 5 mg / mL, and an insoluble carrier are brought into contact with each other at an appropriate temperature. And a method for obtaining an insoluble carrier (solid phase) to which an antibody is bound by reacting for a predetermined time.

  The solvent for preparing the anti-FcγRIIIa-specific antibody or anti-FcγRIIIa antibody solution may be any solvent as long as it does not prevent the antibody from adsorbing or binding to the insoluble carrier. For example, purified water such as pH 5.0 to 10.0, preferably having a buffering action near neutral pH 6.5 to 8.5, such as phosphate buffer, Tris buffer, Good buffer, glycine buffer, borate buffer and the like are preferable. Further, the buffering agent concentration in these buffers is appropriately selected from the range of usually 10 to 500 mM, preferably 10 to 300 mM. In addition, this solution contains, for example, saccharides, salts such as NaCl, surfactants, preservatives, proteins, etc., as long as they do not prevent the antibody from adsorbing or binding to the insoluble carrier. Also good.

  The blocking treatment usually performed in this field, that is, an insoluble carrier bound with the antibody obtained as described above, and a protein unrelated to the antibody, such as milk protein such as bovine serum albumin and skim milk In addition, it is desirable to perform a treatment of immersing in a solution containing ovalbumin or the like from the viewpoint of preventing a nonspecific reaction during measurement.

In the present invention, the anti-FcγRIIIa-specific antibody or the labeling substance used for labeling the anti-FcγRIIIa antibody used when measuring the amount of FcγRIIIa is, for example, alkaline phosphatase, β-galactosidase used in enzyme immunoassay (EIA) , Peroxidase, microperoxidase, glucose oxidase, glucose-6-phosphate dehydrogenase, acetylcholinesterase, malate dehydrogenase, luciferase and other enzymes such as ^99m Tc, ¹³¹ I, ¹²⁵ I, ¹⁴ C used in RIA , ³ H and other radioisotopes such as fluorescein, dansyl, fluorescamine, coumarin, naphthylamine or their derivatives used in fluorescence immunoassay (FIA), such as luciferin, isoluminol, luminol, bis (2,4,6-Trifluorophe Nyl) oxalates and other luminescent substances such as phenol, naphthol, anthracene or derivatives thereof having absorption in the ultraviolet region such as 4-amino-2,2,6,6-tetramethylpiperidine-1-oxyl, 3-Amino-2,2,5,5-tetramethylpyrrolidine-1-oxyl, 2,6-di-t-butyl-α- (3,5-di-t-butyl-4-oxo-2,5 -Cyclohexadiene-1-ylidene)-Labeling substances usually used in this field, such as labeling substances having properties as spin labeling agents typified by compounds having an oxyl group such as p-tolyloxyl Are all listed.

  Further, in order to bind (label) the labeling substance as described above to the antibody, for example, a per se known labeling method generally used in per se known EIA, RIA, FIA, etc. [eg, Medical Chemistry Laboratory, No. 8 Volume, supervised by Yuichi Yamamura, 1st edition, Nakayama Shoten, 1971; Illustrated fluorescent antibody, Akira Kawaio, 1st edition, Soft Science, Inc., 1983; Enzyme immunoassay, Eiji Ishikawa, Tadashi Kawai, Kiyoshi Muroi Ed., 2nd edition, medical school, 1982 etc.]. Needless to say, a conventional method using a reaction between avidin (or streptavidin) and biotin may be used as a labeling method.

  When utilizing a reaction between avidin (or streptavidin) and biotin, as a method for binding biotin to the antibody, for example, a commercially available biotinylation reagent, more specifically, for example, biotin having a succinimide group introduced (for example, NHS- Biotin) or a method in which N-hydroxysuccinimide (NHS) and biotin bonded via a spacer react with the amino group of an antibody or antigen protein (for example, J. Biol. Chem., 264, 272-279 , 1989, etc.), for example, commercially available N- [6- (Biotinamide) hexyl] -3 '-(2'-pyridyldithio) propionamide (biotin-HPDP) or N-Iodoacetyl-N-biotinylhexylenediamin, thiol group of antigen or antibody (For example, Ann. New York Acad. Sci., 254, 203, 1975, etc.), biotin into which a hydrazino group has been introduced, and an aldehyde group of an antigen or antibody (for example, J. Biol. Che m., 172, 71, 1948, Biotech. Appl. Biochem., 9, 488-496, 1987, etc.).

  The degree of modification of the antigen or antibody with biotin is about 0.2 to 10 times, preferably about 1 to 5 times in molar ratio to the antigen or antibody. When the amount of modification with biotin is large, problems such as increased insolubility of the antigen or antibody and the inhibition of the antigen-antibody reaction occur, and conversely, when the modification amount is small, problems such as the sensitivity not reaching the intended target. Care must be taken because it occurs.

  As the enzyme-labeled avidin or streptavidin, a commercially available product can be used as it is, and the quality and the degree of purification are not particularly limited. The amount used varies depending on the amount of biotin modified with the antigen (or antibody) to be measured and the measurement item, and is not particularly limited. However, the concentration in the reaction solution is usually 0.01 to 5000 μg / L, preferably Is suitably selected from the range of 0.1 to 1000 μg / L, more preferably 5 to 1000 μg / L.

  In this solution, what is usually used as a stabilizer in this field, for example, sugars, proteins, surfactants, etc. may be contained within the concentration range normally used in this field. .

  In addition, as a method for measuring the amount of label in the antigen-antibody complex produced as a result of the antigen-antibody reaction, depending on the type of the labeling substance, depending on the nature of the labeling substance that can be detected, Each may be carried out according to a predetermined method. For example, when the labeling substance is an enzyme, a conventional EIA method such as “Enzyme Immunoassay” (Protein Nucleic Acid Enzyme Separate Volume No.31, Kitagawa, Tsuneo, Minamihara, Toshio, Ishikawa, Yuji, 51-63, Kyoritsu Measurement may be performed according to the method described in Publications, Inc., 1987), etc. When the labeling substance is a radioactive substance, according to the standard method of RIA, depending on the type and intensity of radiation emitted by the radioactive substance Measurement equipment such as immersion type GM counter, liquid scintillation counter, well type scintillation counter, HPLC counter etc. can be selected and used as appropriate (for example, supervised by Dr. Yuichi Yamamura, Medical Chemistry Laboratory, Vol. 8) , 1st edition, Nakayama Shoten, 1971 etc.). In addition, when the labeling substance is a fluorescent substance, a conventional FIA method using a measuring instrument such as a fluorometer, for example, “Illustrated fluorescent antibody, Akira Kawai, 1st edition, Soft Science Co., Ltd., 1983” In the case where the labeling substance is a luminescent substance, a conventional method using a measuring instrument such as a photocounter, for example, “enzyme immunoassay” (protein nucleic acid enzyme separate volume No. 31, Kitagawa, Tsuneo, Minamihara, Toshio, Atsuo, Ishikawa, Yuji, 252-263, Kyoritsu Shuppan Co., Ltd., 1987) and the like. Further, when the labeling substance is a substance having absorption in the ultraviolet region, the measurement may be performed by a conventional method using a measuring instrument such as a spectrophotometer. When the labeling substance has a spin property, an electron spin resonance apparatus is used. Common methods used, such as “Enzyme Immunoassay” (Protein Nucleic Acid Enzyme Separate Volume No.31, Kitagawa Tsuneo, Minamihara Toshio, Akio Ishikawa, 264-271, Kyoritsu Shuppan Co., Ltd., 1987) Measurements may be performed according to the methods described above.

  More specifically, for example, when the labeling substance is an enzyme, it reacts with a coloring reagent to lead to a coloring reaction, and a method known per se, such as a method for measuring the amount of dye produced as a result with a spectrophotometer or the like Is mentioned.

  Examples of the coloring reagent used for such purpose include tetramethylbenzidine, o-phenylenediamine, o-nitrophenyl-β-D-galactoside, 2,2′-azino-bis (3-ethylbenzthiazoline-6- Coloring reagents usually used in this field such as sulfonic acid (ABTS), N-ethyl-N-sulfopropyl-m-anisidine (ADPS), p-nitrophenyl phosphoric acid and the like can be mentioned.

  In order to stop the color reaction, a reaction stopping method usually used in this field may be used, for example, an enzyme activity inhibitor such as 1 to 6N sulfuric acid is added to the reaction solution.

  For example, as chemiluminescent materials, isoluminol, luminol, aminoethylisoluminol, aminoethylethylisoluminol, aminopropylisoluminol, aminobutylisoluminol, aminohexylethylisoluminol, etc. Examples thereof include luminol derivatives, luciferin, bis (2,4,6-trifluorophenyl) oxalate and the like.

  For example, fluorescent substances include, for example, fluorescein, dansyl, fluorescamine, coumarin, naphthylamine, fluorescein isothiocyanate, rhodamine, rhodamine X isothiocyanate, sulferodamine 101, lucifer yellow, acridine, acridine isothiocyanate, riboflavin used in fluorescent immunoassay. Or these derivatives, europium (Eu), etc. are mentioned.

  In a measurement method using HPLC known per se, in order to more clearly separate an antigen-antibody complex from a free labeled FcγRIIIa-specific antibody (or labeled FcγRIIIa antibody), for example, Japanese Patent Laid-Open Nos. 7-91027 and Using an FcγRIIIa-specific antibody (or FcγRIIIa antibody, etc.) bound to a substance for improving the separation (hereinafter abbreviated as “separation enhancing substance”) disclosed in JP-A-9-901995 Also good.

Examples of the separation improving substance used for such purposes include nucleic acids such as DNA and RNA, α-chymotrypsinogen, β-galactosidase, lysozyme, cytochrome C, trypsin inhibitor and other proteins such as phenylalanine, proline, arginine, lysine, Peptides containing amino acids such as aspartic acid and glutamic acid, for example, halogen atoms such as bromine, chlorine and iodine, synthetic polymers such as polyethylene glycol, such as polyglutamic acid, polyaspartic acid, polylysine, polyarginine, polyphenylalanine and polytyrosine Polyamino acids, C 3-10 alkyl chains, for example fatty acids such as palmitic acid, oleic acid, stearic acid, such as N- (ε-maleimidoaproyloxy) uccinimide (EMCS) ), N-sc It has a reactive group capable of binding to proteins such as N-Succinimidyl-6-maleimidohexanoate, Bismaleimido hexane (BMH), octylamine, and specific sugar chain binding proteins. Hydrophobic or ionic chemical substances such as 4- (p-maleimidophenyl) butyryl Ala- (Tyr (SO ₃ H)) ₅ , 4- (p-maleimidophenyl) described in JP-A-9-301995 ) A peptide containing a strong acid residue such as butyryl Ala- (Tyr (SO ₃ H)) ₈ is preferred. The separation enhancing substance may be appropriately selected and used in consideration of the properties of the anti-FcγRIIIa specific antibody and anti-FcγRIIIa antibody (for example, pH stability, hydrophobicity, solubility in aqueous solution, isoelectric point, etc.).

  The method of binding the separation enhancing substance to the anti-FcγRIIIa-specific antibody or the anti-FcγRIIIa antibody is also as follows. (1) Binding of a known labeling substance commonly used in EIA (ELISA), RIA or FIA with the antibody. Methods (for example, Medical Laboratory, Vol. 8, supervised by Yuichi Yamamura, 1st edition, Nakayama Shoten, 1971; Illustrated fluorescent antibody, Akira Kawaio, 1st edition, Soft Science Co., Ltd., 1983; Enzyme immunoassay Law, Eiji Ishikawa, Tadashi Kawai, Kiyoshi Miyai, 2nd edition, School of Medicine, 1982, etc.), (2) Modification and binding methods of substances known per se (for example, chemical modification of proteins <top> <bottom>, Shinzo Sugaya, Kensuke Shimura, Michinori Nakamura, Katsu Funatsu, 1st edition, Japan Society of Publishing Press, 1981; Polyethylene glycol modified protein, Yuji Inada, Biochemistry, Vol. 62, No. 11, P1351-1362 , Japan Biochemical Society, 1990; DNA PROBES, George HK and Mark MM STOCKTON PRESS, 1989, Etc.).

  As an immunological measurement method of FcγRIIIa amount of the present invention, among the immunological measurement methods by sandwich method using an insoluble carrier, the measurement method of sFcγRIIIa amount in biological samples by chemiluminescence immunoassay method (CLEIA) is taken as an example For example, it is as follows.

  That is, a sample derived from a living body is contacted with a solid phase in which the anti-FcγRIIIa specific antibody (primary antibody) according to the present invention is immobilized on an insoluble carrier, and reacted at 4 to 40 ° C. for 3 minutes to 16 hours to produce an antigen on the insoluble carrier. An antibody complex (an immobilized anti-FcγRIIIa specific antibody-sFcγRIIIa complex, referred to as complex-1) is generated. Next, a labeled anti-FcγRIIIa antibody (secondary antibody) is reacted at 4 to 40 ° C. for 3 minutes to 16 hours to react with a labeled antigen-antibody complex (an immobilized anti-FcγRIIIa specific antibody-sFcγRIIIa-labeled anti-FcγRIIIa antibody) Complex and complex-2) are produced on an insoluble carrier, and the amount of labeling substance in complex-2 is measured. By applying the obtained labeled substance amount to a calibration curve showing the relationship between the labeled substance amount and the sFcγRIIIa concentration obtained by performing the same operation using the same reagent as described above for a sFcγRIIIa solution with a known concentration in advance, The amount (concentration) of sFcγRIIIa can be determined. The amount (concentration) of sFcγRIIIa may be determined as a relative value using an appropriate standard (for example, healthy person pooled plasma) as an amount of 100 AU (arbitrary units).

  When the labeled antibody (secondary antibody) is a biotin-labeled antibody, the sample is reacted with a solid phase in which the primary antibody is immobilized on an insoluble carrier, and then the biotin-labeled antibody is reacted to form a biotin-labeled antibody on the insoluble carrier. A biotin-labeled antigen-antibody complex is generated between the enzyme and the antigen, and then reacted with an enzyme-labeled streptavidin labeled with an enzyme such as peroxidase to generate an enzyme-labeled streptavidin-biotin-labeled antigen-antibody complex on the solid phase. Next, the substrate for the labeled enzyme is reacted, and the amount of the labeled enzyme in the enzyme-labeled streptavidin-biotin-labeled antigen-antibody complex on the solid phase is measured. Subsequently, the amount of sFcγRIIIa in the sample can be determined from the calibration curve by the same method as described above.

  As a specific example of the immunological measurement method of FcγRIIIa amount of the present invention, a peroxidase (POD) labeled secondary antibody is used as a labeled antibody, and the amount of sFcγRIIIa in a biological sample is measured by chemiluminescence immunoassay (CLEIA). An example of the method is as follows.

That is, a biological sample is contacted with a solid phase in which the anti-FcγRIIIa specific antibody (primary antibody) of the present invention is immobilized on an insoluble carrier, and an antigen-antibody complex (immobilized anti-FcγRIIIa specific antibody-sFcγRIIIa complex) , To produce complex-1). Next, the POD-labeled antibody-antigen complex (immobilized anti-FcγRIIIa-specific antibody-sFcγRIIIa-POD-labeled anti-FcγRIIIa antibody complex, complex-2) is reacted with a POD-labeled anti-FcγRIIIa antibody (secondary antibody) as an insoluble carrier. Generate above. Subsequently, a luminol solution (luminescent substrate) and an H ₂ O ₂ solution are added, and the labeling activity in the labeled antigen-antibody complex (complex-2) on the insoluble carrier is measured as the amount of chemiluminescence. By applying the obtained chemiluminescence amount to a calibration curve showing the relationship between the chemiluminescence amount and the sFcγRIIIa amount obtained by performing the same operation using the same reagent as above for a sFcγRIIIa solution with a known concentration in advance, The amount of sFcγRIIIa can be determined.

  According to the method for measuring the amount of FcγRIIIa using the anti-FcγRIIIa specific antibody according to the present invention, the amount of FcγRIIIa expressed in NK cells and macrophages and the amount of soluble FcγRIIIa released from these cells are specifically determined. Can be measured.

  Examples of the sample used in the present invention include biological samples such as blood, serum, and plasma. Among them, since sFcγRIIIa and the like are released from the respective leukocytes by activation or the like, EDTA-added plasma with less influence after blood collection is desirable. In addition, sFcγRIIIa concentration in EDTA-added plasma has been reported to be unaffected by repeated exposure to freezing and thawing (Koene, HR et al., Br. J. Haematol., 93, 235- 241, 1996).

  Specific examples of the buffer used in the measurement method of the present invention include, for example, a measurement method using a normal antigen-antibody reaction, such as Tris buffer, phosphate buffer, veronal buffer, borate buffer, Good buffer, etc. Examples of the buffer used in the above include all the buffer solutions, and the pH is not particularly limited as long as it does not inhibit the antigen-antibody reaction, but a range of 5 to 9 is usually preferable.

  Note that the present invention is not limited to the method used, but can be sufficiently used for a measurement system using an automatic analyzer, and can perform measurement easily and quickly. Note that there are no particular restrictions on the combination of reagents, etc., when measuring using an automatic analyzer, and there are no particular restrictions, such as the reagents that are considered to be the best, taking into account other factors. A combination may be appropriately selected and used.

  As a method for diagnosing RA according to the present invention, an FcγRIIIa-specific antibody according to the present invention and, if necessary, an anti-FcγRIIIa antibody are used, and the amount of sFcγRIIIa in a sample to be diagnosed is measured by the method for measuring the amount of FcγRIIIa according to the present invention. The method of performing based on the result is mentioned.

  For example, first, the amount of sFcγRIIIa in a sample of a healthy subject sample is measured by the measurement method of the present invention, and the value is set as a reference value (100 arbitrary units (AU)). Separately, the amount of sFcγRIIIa in the sample to be diagnosed is measured by the same method, and a relative value to the reference value is obtained. Then, there is a diagnosis method in which it is determined whether or not the relative value is significantly different from the reference value, and when it is significantly high, RA is diagnosed.

  Further, the amount of sFcγRIIIa (measured values of absorbance, luminescence, etc.) in the sample of a healthy subject sample is measured by the measurement method of the present invention, and this value is used as a reference value. Separately, the amount of sFcγRIIIa in the sample to be diagnosed (measured values of absorbance, luminescence, etc.) is measured by the same method. Further, there is a diagnosis method in which it is determined whether or not this value is significantly different from a reference value, and when it is significantly high, RA is diagnosed.

  Furthermore, a sFcγRIIIa sample with a known concentration is used for measurement by the measurement method of the present invention, and a calibration curve is created from the measurement results obtained. Separately, the measurement method of the present invention is performed using a sample of a healthy subject sample, and the normal range is obtained by statistically processing the amount of sFcγRIIIa obtained from the calibration curve. Further, measurement is performed in the same manner using the sample to be diagnosed, and the amount of sFcγRIIIa is obtained from the calibration curve. A diagnosis method is also possible in which RA is diagnosed when this value is significantly higher than the normal range.

  As a statistical analysis method for testing to determine significance, for example, the difference in data between the two groups is a correlation test such as Fisher's PLSD analysis of variance (ANOVA). May be performed by Bartlett's test or the like.

  The FcγRIIIa measurement kit of the present invention includes at least the above-described (1) an anti-FcγRIIIa-specific antibody, (2) an anti-FcγRIIIa-specific antibody and an anti-FcγRIIIa antibody, and (3) an insoluble carrier. An anti-FcγRIIIa-specific antibody immobilized on the antibody and a labeled anti-FcγRIIIa antibody, (4) an anti-FcγRIIIa antibody immobilized on an insoluble carrier, and an antibody comprising a labeled anti-FcγRIIIa-specific antibody, Preferred embodiments and specific examples of the constituent elements are as described above.

The kit used for diagnosing RA of the present invention includes at least (1) an anti-FcγRIIIa-specific antibody, (2) an anti-FcγRIIIa-specific antibody, and an anti-FcγRIIIa antibody, 3) An anti-FcγRIIIa specific antibody immobilized on an insoluble carrier and a labeled anti-FcγRIIIa antibody, (4) An anti-FcγRIIIa antibody immobilized on an insoluble carrier and a labeled anti-FcγRIIIa specific antibody The preferred embodiments and specific examples of the constituent elements are as described above.

The present invention provides an anti-FcγRIIIa-specific antibody that specifically binds to FcγRIIIa, and if used, it is simple, quick and accurate, and further depends on the allotype of FcγRIIIb contained in a biological sample. The amount of FcγRIIIa can be measured. Furthermore, by measuring the amount of sFcγRIIIa, which is a useful marker of RA, using the antibody, and diagnosing RA based on the results, it is possible to measure more easily and quickly than in the past using immuno-PCR etc. RA can be diagnosed without considering the FcγRIIIb phenotype of the elderly.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

[Expression of FcγRIIIa protein]
(1) Cloning of FcγRIIIa protein gene
Based on the base sequence (SEQ ID NO: 1) of Human FcγRIIIa cDNA (GenBank accession No. BC017865), two types of primer oligonucleotides (GAAGCTTGGCATCATGTGGCAGCTGCTC) (SEQ ID NO: 4) and (GCGGCCGCTTGGTACCCAGGTGGAAAGAATG) (SEQ ID NO: 5) are synthesized. (Manufactured by SIGMA genesys).
Next, of the two synthesized oligonucleotides, the oligonucleotide of SEQ ID NO: 4 is used as a forward primer, the oligonucleotide of SEQ ID NO: 5 is used as a reverse primer, and Human Leucocyte cDNA (BioChain Institute, Inc.) as a template, PCR was performed as follows.
First, 10 mM Tris-HCl buffer (pH 8.9) containing 0.4 μM forward primer and reverse primer 2 mM magnesium sulfate, dATP, dCTP, dGTP, dTTP and PlatinumTaq polymerase (manufactured by Invitrogen) was prepared, and PCR was performed. The reaction solution was used.
A PCR reaction solution (25 µL) to which 1 µg of Human Leucocyte cDNA was added was used as a PCR sample, and PCR (94 ° C, 60 seconds: 94 ° C, 15 seconds) was performed using a DNA thermal cycler (DNA Engine PTC200) manufactured by MJ Research. , 55 ° C., 30 seconds, 68 ° C., 60 seconds for 25 cycles), and the sequence containing the FcγRIIIa gene (SEQ ID NO: 3 and SEQ ID NO: 1 are encoded from position 43 to position 672. FcγRIIIa protein) A gene encoding the extracellular part of the cell membrane). The obtained fragment was digested with HindIII (Nippon Gene Co., Ltd.) and Not I (Nippon Gene Co., Ltd.), and the pcDNA3.1 / myc-His vector (Invitrogen, neomycin resistance gene ( neo ) was In the HindIII and Not I sites. As a result, a pcDNA3.1 / myc-His vector having a sequence in which the myc epitope tag gene and the His tag gene are arranged downstream of the sequence containing the FcγRIIIa gene (SEQ ID NO: 3) is obtained. Subsequently, E. coli (JM109) was transformed with the pcDNA3.1 / myc-His vector into which the sequence containing the FcγRIIIa gene (SEQ ID NO: 3) was inserted, and the resulting transformant was cultured in large quantities. The plasmid (expression plasmid) was recovered using Qiagen Endofree Maxi Kit (manufactured by Qiagen).

(2) Gene transfer to cultured mammalian cells The expression plasmid obtained in (1) above was electroporated using GenePulser Xcell (Bio-Rad) (Square wave, Voltage: 160V, Pulse length: 15 mSec). , Cuvette: 0.2 cm) and introduced into CHO-K1 cells. Since the target transducer has acquired resistance to neomycin (Geneticin), geneticin (Wako Pure Chemical Industries, Ltd.) is added to the culture solution to a final concentration of 0.75 mg / mL 24 hours after the introduction, Geneticin selective culture was performed for about 2 weeks. Thereafter, geneticin resistant strains were cloned by limiting dilution, and 72 geneticin resistant strains were obtained.

(3) Selection of high FcγRIIIa protein expression strain 72 clones of geneticin resistant strain obtained in (2) above were cultured in Opti-MEM medium (manufactured by Gibco), and 200 μL of each culture supernatant (serum-free medium) was used as a sample. Anti-His tag antibody (manufactured by Oncogene) as the primary antibody, POD-labeled anti-mouse IgG rabbit F (ab ') ₂ (manufactured by Wako Pure Chemical Industries, Ltd.) as the secondary antibody, and ECL plus (manufactured by Amersham Bioscience) as the detection reagent Using dot western blotting, 10 clones with confirmed chemiluminescence were selected.
After 10 selected clones were cultured in Opti-MEM medium (Gibco), 20 μL of 10-fold concentrated solution obtained by ultrafiltration of the culture supernatant was used as a sample. After SDS-PAGE, anti-His tag antibody and secondary antibody were used as primary antibodies. Western blotting was performed using POD-labeled anti-mouse IgG rabbit F (ab ′) ₂ and ECL plus as a detection reagent to confirm the expression of the protein (FcγRIIIa).
That is, since the myc epitope tag gene and the His tag gene are located downstream of the sequence (SEQ ID NO: 3) containing the FcγRIIIa gene in (1) above, FcγRIIIa is a fusion protein (FcγRIIIa− linked to the myc epitope and His tag). expressed as myc epitope-His tag). Therefore, if the expression of this His tag is confirmed, the expression of the sequence (SEQ ID NO: 3) containing the FcγRIIIa gene in the upstream region is also confirmed.
As a control, the pcDNA3.1 / myc-His vector into which the sequence containing the FcγRIIIa protein gene (SEQ ID NO: 3) is not inserted was introduced into CHO cells by the method (2) above, and the obtained geneticin resistant strain was cultured. Electrophoresis and Western blotting were performed in the same manner using 20 μL of the purified 10-fold concentrated solution.

The results are shown in Figure 1. In FIG. 1, lanes 1 to 10 show the results when 20 μL of the 10-fold concentrated culture supernatant of clones Nos. 1 to 10 is used, respectively. Lane 11 is a pcDNA3.1 / myc-His vector into which a sequence containing the FcγRIIIa gene (SEQ ID NO: 3) is not inserted into CHO cells by the method (2) above, and the culture supernatant 10 of the geneticin-resistant strain thus obtained is obtained. The result (control) when 20 μL of the double concentrated solution is used is shown.
As is clear from FIG. 1, bands were strongly confirmed in clones No. 3 and No. 9. Note that no band was observed in Lane 11 (control) of a geneticin resistant strain using the pcDNA3.1 / myc-His vector into which the sequence containing the FcγRIIIa gene (SEQ ID NO: 3) was not inserted. Based on the above, the target FcγRIIIa (consisting of the first to 208th amino acids out of the total 250 amino acids of FcγRIIIa, hereinafter referred to as “recombinant FcγRIIIa protein”) is expressed using CHO-K1 cells. I was able to obtain a cell line.

[Preparation of anti-FcγRIIIa protein monoclonal antibody]
(1) Preparation of immunogen (recombinant FcγRIIIa protein) The CHO cell line expressing recombinant FcγRIIIa protein obtained in Example 1 was added to a GIT medium [Wako Pure Chemical Industries, Ltd., 10% bovine serum albumin (BSA). ) Contained]) after culturing to 100% confluent in 10 500 cm ² flasks, the medium was replaced with Opti-MEM medium (GIBCO, serum-free). The medium was changed three times at intervals of 3 days, and the culture supernatant was collected and collected.
2 L of the culture supernatant obtained by the above culture was centrifuged at 3000 rpm for 30 minutes, and the supernatant was concentrated to about 100 mL by ultrafiltration. The concentrate was equilibrated with 20 mM phosphate buffer (pH 7.4, 500 mM NaCl, 50 mM 3-[(3-colamidopropyl) dimethylammonio] propanesulfonic acid (CHAPS), containing 40 mM imidazole). The target recombinant FcγRIIIa protein was adsorbed on the 5 mL Chelating Sepharose Fast Flow (Amersham Bioscience) column. The column is thoroughly washed with 20 mM phosphate buffer (pH 7.4, 500 mM NaCl, containing 100 mM imidazole), and then passed through 20 mM phosphate buffer (pH 7.4, 500 mM NaCl, containing 300 mM imidazole). Thus, a fraction containing the recombinant FcγRIIIa protein was obtained.

(2) Production of anti-FcγRIIIa monoclonal specific antibody Recombinant FcγRIIIa protein obtained in (1) above is mixed with Freund's complete adjuvant and placed intraperitoneally at 3 μg per BALB / c mouse (♀). The first immunization was performed after administration. Two weeks after the first immunization, recombinant FcγRIIIa was mixed with Freund's complete adjuvant and administered intraperitoneally at a dose of 10 μg per BALB / c mouse (♀), followed by a second immunization. After a week, it was administered intraperitoneally in the same manner as the second time, and the third immunization was performed. One month after the third immunization, the recombinant FcγRIIIa protein was mixed with physiological saline and administered intraperitoneally at a dose of 20 μg per BALB / c mouse (♀), and the final immunization was performed.
The spleen was removed 3 days after the final immunization. The spleen was loosened on a sterilized stainless mesh, suspended in Daigo T medium (manufactured by Wako Pure Chemical Industries, Ltd.), and then washed by repeated centrifugation. The collected splenocytes 1.5 × 10 ⁸ cells was the mouse myeloma cells (P3X63Ag8U1) 3 × 10 ⁷ cells were washed in the same manner as splenocytes Daigo T medium was mixed in Daigo T medium, centrifuged 10 min at 1450 rpm separated.
To the obtained precipitate, 1 mL of 50% polyethylene glycol 1540 was gradually added with stirring at 37 ° C over 1 minute to cause cell fusion, and 9 mL of 37 ° C Daigo T medium was added with stirring over 5 minutes. Thereafter, it was centrifuged at 1450 rpm for 10 minutes. The obtained fused cells were suspended in 60 mL of HAT medium, dispensed in 0.2 mL portions into a 96-well microplate, and the culture was continued while changing the HAT medium at intervals of 2 to 3 days. Culture supernatants were collected 8 to 10 days after cell fusion, and anti-FcγRIIIa antibody activity was screened using ELISA, and cells in wells with strong antibody activity were cloned by limiting dilution. Eight days after the cloning, a culture supernatant of 1 colony / well was collected and screened for anti-FcγRIIIa protein antibody activity using ELISA to obtain a monoclonal antibody-producing hybridoma.
Among these clones, 2 clones were selected and designated as hybridoma MKGR155 producing monoclonal antibody MKGR155 and hybridoma MKGR248 producing monoclonal antibody MKGR248.

The hybridoma MKGR155 was entrusted to the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center (Postal Code 305-8566, 1st, 1st East, 1st Street, Tsukuba City, Ibaraki, Japan), July 8 , 2004. The deposit number is FERM BP- 10062. The hybridoma MKGR248 was entrusted to the National Institute of Advanced Industrial Science and Technology Patent Biological Depositary Center (Postal Code 305-8566, 1st, 1st East, 1-chome, Tsukuba City, Ibaraki, Japan), July 8 , 2004. The deposit number is FERM BP- 10063.

[Specificity evaluation of acquired monoclonal antibody]
(1) Antibody specificity evaluation by flow cytometry
Using FITC-labeled MKGR155, MKGR248, and MKGR14 (anti-FcγRIIIa ^Mφ monoclonal antibody) and CLBFcRgranI (anti-FcγRIII monoclonal antibody) as comparative controls, react with leukocytes including peripheral blood-derived NK cells, neutrophils and monocytes on ice I let you. After the reaction, flow cytometry analysis was performed.

The result is shown in FIG. In FIG. 2, (a) shows lymphocytes, (b) shows monocytes, and (c) shows the reactivity of neutrophils with each antibody. As is apparent from FIG. 2, the obtained monoclonal antibody MKGR155 reacted with NK cells expressing FcγRIIIa and a part of monocytes, but did not react with neutrophils expressing FcγRIIIb. The obtained monoclonal antibody MKGR248 reacted with all the cell types examined.
On the other hand, the anti-FcγRIIIa ^Mφ monoclonal antibody MKGR14 bound to some monocytes but did not react with neutrophils or NK cells. The FcγRIII monoclonal antibody CLBFCRgranI reacted with all cell types examined.
From the above, it was confirmed that the monoclonal antibody MKGR248 binds to FcγRIII and the monoclonal antibody MKGR155 specifically binds to FcγRIIIa.

(2) Antibody specificity evaluation by immunoprecipitation
LGL fraction containing monocytes, neutrophils and NK cells cultured for 4 days, 50 μg / L phenylmethanesulfonyl fluoride (PMSF), 1 mM Na-p-tosyl-L-lysine chloromethyl ketone and 40 μg / mL In the presence of soybean trypsin inhibitor, 1% NP-40 (110 mM NaCl, 50 mM Tris buffer (pH 7.5)) was added and dissolved.
Protein G Sepharose 4 First Flow (manufactured by Amersham Bioscience) with immobilized monoclonal antibodies MKGR155, MKGR248 and CLBFcRgranI (anti-FcγRIII monoclonal antibody) as a comparative control, or MKGR14 (anti-FcγRIIIa ^Mφ monoclonal antibody) ) Was added to the immobilized Sepharose CL-4B beads and reacted at 4 ° C. for 1 hour. Then 1% NP-40 (110 mM NaCl, 50 mM Tris buffer (pH 7.5) in the presence of 50 μg / L PMSF, 1 mM Na-p-tosyl-L-lysine chloromethyl ketone and 40 μg / mL soybean trypsin inhibitor. After washing the beads in step)), the beads were suspended in an SDS-PAGE sample preparation buffer containing no reducing agent, heated at 65 ° C. for 5 minutes, and subjected to SDS-PAGE. After electrophoresis, the protein in the gel was transferred to a nitrocellulose membrane, and then an anti-FcγRIII monoclonal antibody CLB-LM6.30 and a peroxidase-labeled anti-mouse IgG (manufactured by Jackson Immuno Research) were sequentially reacted. For detection of peroxidase activity on the membrane, an ECL detection system (manufactured by Boehringer Mannheim GmbH (Germany)) was used.

The results are shown in FIG. In FIG. 3, (a) shows a case where NK cell lysate and each antibody are reacted, (b) shows a case where culture monocyte lysate and each antibody are reacted, and (c) shows neutrophil lysate. And the results when each antibody is reacted. As is clear from FIG. 3, monoclonal antibody MKGR155 reacted with FcγRIIIa expressed in NK cells and cultured monocytes, but did not react with FcγRIIIb expressed in neutrophils. Monoclonal antibody MKGR248 reacted with FcγRIII of monocytes, NK cells, and neutrophils. On the other hand, the anti-FcγRIIIa ^Mφ monoclonal antibody MKGR14 reacted with FcγRIIIa ^Mφ expressed in cultured monocytes, but did not react with FcγRIII of NK cells or neutrophils. Further, the FcγRIII monoclonal antibody CLBFcRgranI reacted with any FcγRIII of monocytes, NK cells, and neutrophils.
From the above results, it was found that the monoclonal antibody MKGR248 is an antibody that binds to FcγRIII, and the monoclonal antibody MKGR155 is an antibody that specifically binds to FcγRIIIa.

  In addition, since no antibody specific to FcγRIIIa has been obtained in the past, in order to measure the amount of FcγRIIIa, a highly sensitive but complicated measurement method such as Immuno-PCR had to be used. . However, since an antibody that specifically binds to FcγRIIIa was obtained according to the present invention, FcγRIIIa (including sFcγRIIIa) can be specifically detected by performing an immunoassay such as ELISA or EIA using the antibody. Can be measured.

  Furthermore, since the monoclonal antibody conventionally used for sFcγRIIIa binds not only to sFcγRIIIa but also to NA2-FcγRIIIb, it is practically impossible to measure sFcγRIIIa and sFcγRIIIb separately in NA2 + phenotype patients. It was. However, the anti-FcγRIIIa antibody of the present invention specifically binds to FcγRIIIa but does not react with FcγRIIIb. Therefore, if the amount of sFcγRIIIa in a biological sample is measured using the antibody, sFcγRIIIa, which is a marker useful for diagnosis of RA, can be specifically measured. These results suggest that RA can be diagnosed without considering the FcγRIIIb phenotype.

[Measurement of sFcγRIIIa concentration in patients with chronic rheumatism (RA), osteoarthritis (hereinafter abbreviated as OA), and healthy subjects]
(1) Sample preparation
Each EDTA-containing plasma diluted 100-fold with High Performance Elisa buffer (HPE buffer, CLB, Amsterdam, Netherlands) was used as a sample. In addition, the origin of EDTA plasma is as follows.
EDTA plasma from RA patients is a patient at the Rheumatology Department of Kansai Medical University from April 1994 to April 1996. From 43 patients who were recognized as RA by the American Rheumatism Association (ARA) criteria Obtained. Target OA patient EDTA plasma was obtained from 14 patients from Kansai Medical University, and healthy EDTA plasma was obtained from 32 employees from Wako Pure Chemical Industries, Ltd. When measuring concentrations of sFcγRIIIa and the like, pooled EDTA plasma for setting 100 AU was obtained from a person (19-75 years old, 42.9 ± 14.3 years old) arbitrarily selected from hospital staff.


(2) Reagent preparation • Anti-FcγRIIIa monoclonal antibody MKGR155 immobilized polystyrene beads
An anti-FcγRIIIa monoclonal antibody MKGR155 is obtained by immersing polystyrene beads having a diameter of 3.2 mm in a 10 μg / mL solution of the anti-FcγRIIIa monoclonal antibody MKGR155, which is an antibody that specifically binds to FcγRIIIa, and then blocking the non-binding portion with a 2% BSA solution. Immobilized polystyrene beads were obtained.
・ POD-labeled anti-FcγRIIIa monoclonal antibody MKGR248
Enzyme immunoassay, Eiji Ishikawa, Tadashi Kawai, Kiyoshi Muroi, 2nd edition, Medical School, 1982, etc. That is, after reacting the anti-FcγRIIIa monoclonal antibody MKGR248, which is an antibody that binds to FcγRIIIa, with N-Succinimidyl 3- [2-pyridyldithio] propionate equivalent to a 10-fold molar ratio in phosphate buffered saline (PBS) Then, gel filtration was performed using Sephadex G-25 to remove excess N-Succinimidyl 3- [2-pyridyldithio] propionate, and then reduced with DTT to form SH. Separately, POD was reacted with 10-fold molar equivalent of m-Maleimidobenzyl-N-hydroxysuccinimide ester in PBS, and then subjected to gel filtration using Sephadex G-25 to obtain excess m-Maleimidobenzyl- N-hydroxysuccinimide ester was removed to obtain POD into which m-maleimidobenzoyl-N-hydroxysuccinimide was introduced. Further, both were reacted to obtain a POD-labeled anti-FcγRIIIa monoclonal antibody MKGR248.

(3) Measuring method
The concentration of sFcγRIIIa in EDTA-containing plasma derived from RA patients, OA patients, and healthy subjects was determined by the chemiluminescence method using the automatic chemiluminescence immunizer Sphere Light180 (Sphere Light 180, manufactured by Olympus) as follows.
140 μL of sample was added to a reaction vessel containing one polystyrene beads immobilized with anti-FcγRIIIa monoclonal antibody MKGR155, and incubated at 37 ° C. for 7 minutes. After washing with PBS, 140 μL of POD-labeled anti-FcγRIIIa monoclonal antibody MKGR248 was added and incubated at 37 ° C. for 7 minutes. After the reaction, the polystyrene beads are washed with PBS, 70 μL of luminol solution (luminescent substrate) and 70 μL of H ₂ O ₂ solution are added, and each sample is prepared using an automatic chemiluminescence immunosystem Sphere Light180 (Sphere Light 180, manufactured by Olympus). The amount of chemiluminescence was measured.
Separately, the amount of sFcγRIIIa in the pooled EDTA plasma of healthy volunteers was set to a reference value, that is, 100 arbitrary units (AU), and diluted with HPE buffer (1/5, 1/10, 1/20, 1/40) , 1/80, 1/160, 1/320), the chemiluminescence amount was measured using the same reagents and equipment, and the chemiluminescence amount was plotted on the vertical axis and the sFcγRIIIa amount (AU) was plotted on the horizontal axis. A calibration curve was created (Figure 4). Using this calibration curve, the amount of sFcγRIIIa in the EDTA plasma of RA patients, OA patients or healthy subjects was determined.

(4) Results The results are shown in FIG. The significant difference test was performed by t test.
As is clear from FIG. 5, the amount of sFcγRIIIa in RA patients was higher than that in healthy subjects and OA patients, and no significant difference was observed in the amount of sFcγRIIIa between healthy subjects and OA patients. The significance level of the RA patient value relative to the value of the healthy subject is p <0.01, and the significance level of the RA patient value relative to the value of the OA patient is p <0.01.
From the above, it was suggested that sFcγRIIIa measured using anti-FcγRIIIa monoclonal antibody MKGR155 and anti-FcγRIIIa monoclonal antibody MKGR248 is useful as a diagnostic marker for RA.

It is the result of Western blotting after electrophoresis of the culture supernatant of the CHO-HK1 cell clone introduced with the FcγRIIIa gene obtained in Example 1. 5 shows the results of evaluating the specificity of each antibody obtained by Example 3 by flow cytometry. In FIG. 2, (a) shows the result of each antibody that reacted with NK cells, (b) with monocytes, and (c) with neutrophils. FIG. 4 shows the results of evaluating the specificity of each antibody by immunoprecipitation obtained in Example 3. FIG. In FIG. 3, (a) shows a case where NK cell lysate and each antibody are reacted, (b) shows a case where culture monocyte lysate and each antibody are reacted, and (c) shows neutrophil lysate. And the results when each antibody is reacted. 6 is a calibration curve showing the relationship between the amount of chemiluminescence and the amount of sFcγRIIIa (AU) obtained in Example 4. FIG. 4 shows the results of comparison of the amount of sFcγRIII in RA patient (RA) EDTA-added plasma, osteoarthritis (OA) patient EDTA-added plasma and healthy subject EDTA-added plasma obtained in Example 4. FIG. This shows the base sequence of human FcγRIIIa cDNA (SEQ ID NO: 1) and the amino acid sequence encoded by it.

The present invention provides an anti-FcγRIIIa-specific antibody that specifically binds to FcγRIIIa, and if this is used to measure the amount of FcγRIIIa, it is much simpler and faster than conventional methods using immuno-PCR. In addition, the amount of FcγRIIIa can be measured with high accuracy and without being influenced by the allotype of FcγRIIIb contained in the biological sample.
Furthermore, by measuring the amount of sFcγRIIIa, which is a useful marker of RA, using the antibody, and using the result, it is easier and faster than the conventional method, and without considering the FcγRIIIb phenotype of the subject. Diagnosis is now possible.

Claims (18)

A monoclonal antibody MKGR155 that specifically binds to Fcγ receptor IIIa produced by the hybridoma deposited under accession number FERM BP-10062 . Accession numbers are deposited in FERM BP-10062, a hybridoma producing the monoclonal antibody of claim 1. A method for measuring the amount of Fcγ receptor IIIa, wherein the monoclonal antibody according to claim 1 is used for measurement by an immunological measurement method. The measurement method according to claim 3 , further comprising using in combination an antibody that binds to Fcγ receptor IIIa. The measurement method according to claim 4 , wherein any one of the antibodies is labeled with a labeling substance. The measurement method according to claim 4 , wherein any one of the antibodies is immobilized on an insoluble carrier and the other is labeled with a labeling substance. A complex is formed between the antibody immobilized on the insoluble carrier, the soluble Fcγ receptor IIIa in the sample, and the antibody labeled with the labeling substance, and the solubility in the sample is determined based on the amount of the labeling substance in the complex. The method according to claim 6 , wherein the amount of Fcγ receptor IIIa is measured. The antibody immobilized on the insoluble carrier is reacted with the sample to form complex-1 of the immobilized antibody and soluble Fcγ receptor IIIa in the sample, and then the complex-1 is bound to the labeling substance. To form complex-2 of the complex-1 and the antibody bound to the labeling substance, and based on the amount of the labeling substance in the complex-2, soluble Fcγ receptor in the sample The measuring method according to claim 6 , wherein the amount of IIIa is measured. The measurement method according to any one of claims 4 to 8 , wherein the antibody that binds to Fcγ receptor IIIa is a monoclonal antibody. Using an antibody that binds to the antibody and FcγRIIIa according to claim 1, and measuring soluble Fcγ receptor IIIa content of the sample by the method of claim 3-9, and wherein determining, based on the measurement result A method for obtaining data for determining rheumatoid arthritis. The method according to claim 10 , wherein the measurement result is compared with a predetermined amount and is performed based on the result. The method according to claim 11, wherein the predetermined amount is determined based on the amount of soluble Fcγ receptor IIIa in the sample derived from a healthy subject. i) Using the monoclonal antibody according to claim 1 and an antibody that binds to Fcγ receptor IIIa, the amount of soluble Fcγ receptor IIIa in a sample derived from a healthy subject is measured by the method according to claims 3 to 9, and Use the value as the reference value,
ii) using the monoclonal antibody according to claim 1 and the antibody that binds to Fcγ receptor IIIa, measuring the amount of soluble Fcγ receptor IIIa in the sample to be diagnosed by the method according to claims 3 to 9 ;
The method according to claim 10, wherein iii) rheumatoid arthritis is determined by determining whether or not the amount of soluble Fcγ receptor IIIa in the sample to be diagnosed is significantly different from a reference value. A kit for measuring Fcγ receptor IIIa, comprising the monoclonal antibody according to claim 1 . The kit according to claim 14 , further comprising an antibody that binds to Fcγ receptor IIIa. 16. The kit according to claim 15 , wherein any one of the antibodies is immobilized on an insoluble carrier and the other is labeled with a labeling substance. The kit according to claim 16 , comprising the monoclonal antibody according to claim 1 immobilized on an insoluble carrier, and a monoclonal antibody that is labeled with a labeling substance and binds to Fcγ receptor IIIa. A kit for judging rheumatoid arthritis, comprising an antibody that binds to Fcγ receptor IIIa and the monoclonal antibody according to claim 1 .

Images