JP4805641B2 - Head and neck cancer inhibitor and pharmaceutical composition - Google Patents

Description

  The present invention relates to a drug or the like for suppressing or preventing the growth of malignant tumors in the head and neck region.

  BRAK (breast and kidney; also called “CXCL14” or the like) is a chemokine that is expressed in many normal tissues and is considered important for maintaining homeostasis in vivo. The BRAK gene is located at the 5q31 locus, translated as a 99-residue precursor protein, and finally becomes a 77-residue mature protein. BRAK is highly conserved among mammals, for example, the BRAK mouse homologue is consistent with humans except for two homologous amino acids out of 77 amino acid residues.

  BRAK is expressed in normal cells / tissues but not in cancer cell lines was first reported by Heromas et al. (Hromas et al., BBRC, 1999: Non-Patent Document 1), and even in human cancer tissues. It has been reported that it is not expressed (Frederick et al., Am. J. Pathol., 2000: Non-Patent Document 2).

  However, the function of BRAK is not clear, and it was unclear whether the absence of BRAK expression was merely a result or cause of cancer growth.

  Head and neck cancer, particularly oral cancer, has characteristics that distinguish it from other cancers. For example, the function of the oral and maxillofacial face is complicated, and even if the operation is successful, there is a high possibility that damage to the function such as facial deformation, pronunciation and mastication occurs. Such injury has a great impact on the patient's activities of daily living (ADL) and quality of life (QOL). Therefore, surgical therapy should be avoided if possible.

  In addition, pathological diagnosis may be difficult for squamous cell carcinoma, salivary gland cancer, and the like that frequently occur in the oral cavity region because of their frequent use. In particular, it is difficult to diagnose the presence or absence of metastasis and prognosis at an early stage.

  Excessive activation of epidermal growth factor (EGF) receptor signal has been reported in head and neck squamous cell carcinoma. In order to find a molecular target for inhibiting the progression of squamous cell carcinoma of the head and neck, the present inventors used a cDNA array method to express a molecule whose expression decreases when EGF treatment is performed on serum-free cultured head and neck squamous cell carcinoma cells. When exhaustively examined, BRAK was found to be significantly reduced in various squamous cell carcinoma cells (Ozawa, Y. et al., JDR, 2004: Non-Patent Document 3 and Ozawa, Y. et al., Metastasis Soc, Res. 2004: Non-patent document 4).

  JP 2005-501512 (Patent Document 1) discloses a vector containing a gene encoding a chemokine including BRAK and a gene encoding an antibody. However, although this document suggests that BRAK enhances their effects in combination with cytokines and antibodies, it does not describe that BRAK alone has antitumor activity.

  Schllenberger et al. (Non-Patent Document 5) describe that BRAK potently inhibits angiogenesis in the rat cornea in vivo. However, this document does not describe the inhibitory effect of BRAK on tumors.

Schwarze et al. (Non-Patent Document 6) describe that tumor growth was suppressed by overexpressing mouse or human BRAK in a prostate cancer cell line. However, BRAK mRNA is significantly up-regulated in prostate cancer, which is different from the case of head and neck squamous cell carcinoma in which BRAK expression decreases.
Special table 2005-501512 Hromas R. et al., Biochem. Biophys. Res. Commun. 1999 Feb 24; 255 (3): 703-6 Frederick MJ. Et al., Am. J. Pathol. 2000 June 156 (6): 1937-1950 Ozawa, Y. et al., JDR, 2004, "2004 IADR Program Book Honolulu March 10-13, 2004,"# 3708 Ozawa, Y. et al., "10th International Congress of the Metastasis Research Society:" Progress Against Tumor Progression "17th-20th September 2004"# 84 Schllenberger TD, et al., Cancer Res. 2004 Nov 15; 64 (22): 8262-70 Schwarze, SR. Et al., Prostate 2005 Jan 13 (online)

  The present invention is a means for treating head and neck cancer without using a surgical technique, more specifically, head and neck cancer, particularly squamous cell carcinoma in the oral region, and is a highly safe cancer. An object of the present invention is to provide an antiproliferative agent and a pharmaceutical composition containing the same.

  The present inventors have shown that BRAK is expressed in serum-free culture of head and neck squamous cell carcinoma cells, and that its expression is decreased by treatment with epidermal growth factor (EGF) or serum. We found that there was an experimental mutation. Then, it was thought that the decrease in BRAK expression (function) did not occur as a result of cancer progression, but was closely related to cancer growth / progression suppression.

Furthermore, the presence of two specific mutations Y ²⁶ → H, R ⁶⁰ → C with amino acid substitutions such that BRAK expression causes a change in charge in a head and neck squamous cell carcinoma cell line (15 of 19 = 79%). This mutation was not found in normal cells, and scarring occurred in transplantation experiments of head and neck squamous cell carcinoma cells forcibly expressing BRAK using the BRAK forced expression vector (pCL-BRAK) driven by the CMV promoter. Thus, BRAK was found to have cancer progression inhibitory activity, and the present invention was completed.

The present invention
[1] A head and neck cancer inhibitor comprising any of the following (A) to (C) as an active ingredient;
(A) an expression vector comprising a nucleic acid having a sequence encoding a BRAK polypeptide or a functional equivalent thereof in an expressible form;
(B) a cell, tissue or cell line comprising the expression vector of (A);
(C) BRAK polypeptide or a functional equivalent thereof;
[2] The cancer inhibitor according to [1], wherein the head and neck cancer is oral cancer;
[3] The cancer inhibitor according to [1] or [2] above, wherein the head and neck cancer is squamous cell carcinoma;
[4] The cancer suppressor according to any one of [1] to [3], wherein the BRAK polypeptide has a sequence represented by any one of SEQ ID NOs: 4 to 6 in the sequence listing;
[5] The cancer inhibitor according to [4], wherein the nucleic acid has a sequence represented by any one of SEQ ID NOs: 1 to 3 in the Sequence Listing;
[6] A pharmaceutical composition comprising the cancer suppressant according to any one of [1] to [5] above and a pharmaceutically acceptable carrier,
I will provide a.

  The present invention provides a drug that can safely suppress head and neck cancer regardless of a surgical technique. The cancer-suppressing agent of the present invention is effective for head and neck cancer, particularly cancer in the oral region and / or squamous cell carcinoma. In addition, since the BRAK mutation we found has been found in cancer cells other than squamous cell carcinoma of the head and neck, the present invention provides a universal cancer progression inhibitor and method applicable to other cancers. Provided.

  As described above, the head and neck cancer inhibitor of the present invention comprises (A) an expression vector comprising a nucleic acid having a sequence encoding a BRAK polypeptide or a functional equivalent thereof in an expressible form; (B) the (A) Any of cells, tissues or cell lines containing the expression vector of (C) BRAK polypeptide or a functional equivalent thereof, as an active ingredient.

  The “BRAK polypeptide or functional equivalent thereof” in the above (A) and (C) is not limited to the BRAK polypeptide having a natural amino acid sequence derived from humans, mice, or any other organism, as described below. As long as the activity of suppressing cancer growth is maintained, it has an amino acid sequence modified by deletion, addition, insertion, substitution, etc. of one to several amino acid residues as compared with the natural amino acid sequence Including polypeptides. Such alteration of the amino acid sequence may be caused by the nucleic acid sequence encoding the amino acid sequence, or may be caused by modification of the polypeptide, or the alteration may be artificial. It may be spontaneous. For example, a polypeptide having the amino acid sequence described in SEQ ID NOs: 4 to 6 in the sequence listing and a polypeptide having an amino acid sequence obtained by adding the above-described modification thereto can be mentioned. SEQ ID NO: 4 is the amino acid sequence of the precursor polypeptide of human BRAK, SEQ ID NO: 5 is the amino acid sequence of the precursor polypeptide, and SEQ ID NO: 6 is the amino acid sequence of the mature polypeptide. Preferably, the BRAK polypeptide or functional equivalent thereof comprises about 70 residues from the N-terminal side of BRAK or a sequence corresponding thereto. In the context of the present invention, the terms “polypeptide” and “protein” are not strictly distinguished and are used interchangeably.

  The “sequence encoding a BRAK polypeptide or a functional equivalent thereof” in the above (A) means any sequence encoding any such polypeptide. Examples thereof include nucleotide sequences described in SEQ ID NOs: 1 to 3 in the sequence listing and nucleotide sequences having such modifications that result in modified polypeptides as described above. SEQ ID NO: 1 is the full-length cDNA sequence of human BRAK, SEQ ID NOS: 2 and 3 are cDNA sequences of human BRAK mRNA (nucleotide number 1 of SEQ ID NO: 2 corresponds to the 502nd nucleotide of SEQ ID NO: 1) . The nucleic acid having such a sequence may be either single-stranded or double-stranded, and may be either DNA or RNA corresponding to this sequence.

  The vector that can be used for the preparation of the expression vector in (A) is not particularly limited as long as it can express the sequence encoding the BRAK polypeptide in a cell. For example, a commercially available product such as a vector containing a selectable marker can be used advantageously, and it can be any form of vector such as a plasmid or virus (vaccinia virus, adenovirus, retrovirus, etc.). An expression vector can be produced by inserting a nucleic acid having a sequence encoding the BRAK polypeptide or a functional equivalent thereof into such a vector according to any method known in the art.

  The cell, tissue or cell line of (B) can be prepared by introducing the expression vector into a cell, tissue or cell line according to a known method. These cells, tissues or cell lines are preferably derived from animals, particularly mammals, and examples include tumor cells or tissues, or cell lines derived therefrom. Examples of cells or tissues that can be used include oral epithelial cancer and salivary gland cancer. As the cell line, for example, HSC-3 line, KB line, oral stem cell, bone marrow stem cell and the like can be used.

  The cancer suppressor of the present invention contains any one or more of (A) to (C) as an active ingredient. Examples of the cancer to be suppressed include head and neck cancer, particularly squamous cell carcinoma and / or oral cancer.

  The presence or absence of an activity to suppress cancer can be examined by comparing the survival, growth, increase, etc. of tumor with and without applying a candidate for a suppressant by any known test method. it can. In such a comparative study, if a candidate for an inhibitor is applied and there is a statistically significant adverse effect on tumor growth (eg, reduction or delay in growth, tumor shrinkage, etc.), that candidate The substance is determined to have inhibitory activity.

The effective dose of the cancer suppressor of the present invention varies depending on various factors such as the nature, size, type, site, etc. of the cancer to be suppressed; the state of the individual to be administered; As an indication, when the active ingredient is the expression vector of (A), about 1 femto (10 ⁻¹⁵ ) to 1 microgram per time, and when the active ingredient is the polypeptide of (C), 1 pico ( ^10-12 ) grams to about 1 milligram. In addition, when the active ingredient is the cell (B) or the like, the number of cells is approximately in the range of about 10 ⁴ to 10 ¹⁰ per 1 kg body weight of the administration target individual.

  The cancer suppressor of the present invention can be administered alone as it is, or can be administered as a pharmaceutical composition.

  The pharmaceutical composition of the present invention contains at least one cancer suppressant of the present invention and at least one pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is not particularly limited, and a desired dosage form is selected from any known in the pharmaceutical field such as liposomes or lipid components thereof, buffers, disintegrants, binders, preservatives and the like. It can be used as appropriate depending on the route of administration and can be used alone or in combination.

  Examples of the dosage form include powder, granule, tablet, capsule, solution, suspension, paste, ointment, patch and the like.

  Examples of the administration route include oral, transdermal, subcutaneous, intradermal, transmucosal, intramuscular, transvaginal, buccal, sublingual, rectal, intrathecal, epidural and the like. Further, systemic administration or local administration may be used. Topical administration is preferred.

Example 1: Reduction of tumor mass by BRAK expression Sequence complementary to messenger RNA of human BRAK precursor (NM 004887; DNA having SEQ ID NO: 2) was inserted into a cloning site of a commercially available expression vector for mammalian cells “pTargeT ™ Mammalian Expression Vector (Promega)”. This expression vector (referred to as “pCL-BRAK”) was introduced into human tongue-derived squamous cell carcinoma cells (HSC-3 cells) cultured in serum-free Dulbecco's modified Eagle's medium using lipofectamine for 6 hours. The introduced cells (“BRAK Expression”) were selected using G418 resistance.

  As a control, a pTargeT Mammalian Expression Vector not containing the BRAK precursor sequence was similarly introduced into HSC-3 cells (“Mock”).

HSC-3 (“BRAK Expression”) or Mock cells (1 × 10 ⁷ each) forcibly highly expressing BRAK, obtained as described above, were added to the back of a 6-week-old female BALBc nude mouse. After transplanting subcutaneously and fixing the tumor cells, the size of the formed tumor mass was measured every 4 days.

  The results are shown in FIG. The transplanted cell mass (human cancer tissue) into which the pCL-BRAK vector was introduced was always smaller than the Mock tumor mass, indicating that the pCL-BRAK vector has a tumor growth inhibitory action.

Example 2: Confirmation of human BRAK protein expression by Western blot Almost confluent cells (HSC-3 or Mock cells in which BRAK was forcibly highly expressed) were added to serum-free DMEM (Dulbecco's modified Eagle medium). ) Overnight and further cultured in DMEM without new serum for 2 days, and the culture supernatant was collected. The culture supernatant was dialyzed against water, and then the protein was concentrated by lyophilization. After measuring the protein concentration by the Raleigh method, 20 micrograms of protein was separated by SDS (sodium dodecyl sulfate) electrophoresis using 15% polyacrylamide gel and transferred to an Immobilon P (Millipore) membrane (Bio-Rad tank). Type transfer device, 50V, 2 hours). The buffer for transcription was 25 mM Tris / 192 mM glycine / 0.05% SDS / 20% methanol.

  The transferred membrane was washed with TBS-T buffer (20 mM Tris-HCl (pH 7.6), 137 mM NaCl, 0.05% Tween-20), and Blocking regent-N102 diluted 5-fold with TBS-T. Blocking was performed at 37 ° C. for 1 hour. The primary antibody (manufactured by B & R) was diluted 500-fold with Blocking reagent-N102 diluted 10-fold with TBS-T, and the membrane was treated overnight at 4 ° C. After washing with TBS-T, it was treated with a biotinylated secondary antibody attached to Immunostar (Wako Pure Chemical Industries) at 37 ° C. for 20 minutes. Further, after washing with TBS-T, treatment was performed at 37 ° C. for 20 minutes with a complex in which horseradish peroxidase was bound to avidin attached to the kit, and a luminescent substrate attached to the kit was added. The X-ray film was exposed to light and BRAK protein was detected (FIG. 2, panel (A)).

Example 3: Confirmation of expression of human BRAK mRNA by RT-PCR method The layer of cells (HSC-3 or Mock cells in which BRAK was forcibly highly expressed) was lysed with Trizol (Invitrogen Life Technology), and SuperScript First- cDNA was prepared by strand synthesis system (Invitrogen Life Technology), and PCR was performed using hBRAKS1 and hBRAKA2 primers as a template (equivalent to 50 ng RNA). The conditions for PCR amplification were denaturation at 94 ° C. for 2 minutes, followed by 22 cycles of 94 ° C., 30 seconds; 58 ° C., 30 seconds; 72 ° C., 30 seconds, followed by reaction at 72 ° C. for 5 minutes. Amplified products were separated by agarose electrophoresis, and DNA was stained with ethidium bromide, followed by photography (FIG. 2, panel (B)). Β-actin was used as an internal control.
hBRAKS1: AATGAAGCCAAAGTACCCGC
hBRAKA2: AGTCCTTTGCACAAGTCTCC

  In FIG. 2, panel (A) is the result for protein, and (B) is the result for RNA. In cells into which the pCL-BRAK vector was introduced, a large amount of BRAK RNA and protein were detected. Therefore, it was shown that the introduced BRAK gene was successfully transcribed in the cell and translated into a protein. On the other hand, BRAK was not detected in Mock cells under the same conditions as either RNA or protein.

Example 4: Reduction of tumor mass due to BRAK expression (2)
The pCL-BRAK vector-introduced cells obtained in Example 1 were seeded at a cell concentration of 1 per well and cloned. The three clones thus obtained were transplanted in the same manner as in Example 1 except that Scid (severe combined immuno-deficiency) mice were used, and the size of the tumor mass was measured every 3 days after the 3rd day. For comparison, the above operation was also performed on the control (Mock) cells obtained in Example 1.
The results are shown in FIG. The transplanted cell mass (human cancer tissue) into which the pCL-BRAK vector has been introduced is significantly smaller than the Mock cell mass after the 7th day after transplantation (p <0.001), and particularly after the 27th day after the transplantation. All of them were reduced to 500 mm ³ or less so that they could hardly be detected. From this result, the tumor suppressive action of BRAK was more clearly confirmed.

FIG. 1 shows the time course of a transplanted cell mass (human cancer tissue; “BRAK expression”) into which a transplanted BRAK Expression vector has been introduced and a vector-introduced transplanted cell mass (“Mock”) that does not contain a BRAK sequence for comparison. It is a figure which shows the change of a magnitude | size with the appearance frequency according to size range. FIG. 2 is a diagram showing expression of proteins (panel (A)) and RNA (panel (B)) in cells (“pCL-BRAK”) and non-transfected cells (“Mock”) into which a pCL-BRAK expression vector has been introduced. It is. In panel (B), the expression of β-actin RNA as an internal control is also shown for comparison. FIG. 3 shows the time course of a transplanted cell mass (human cancer tissue; “BRAK expression”) into which a cloned BRAK Expression vector was introduced and a vector-introduced transplanted cell mass (“Mock”) that does not contain a BRAK sequence for comparison. It is a figure which shows the change of a big magnitude | size by the appearance frequency according to size range.

Claims (6)

A head and neck cancer inhibitor comprising any of the following (A) to (C) as an active ingredient:
(A) an expression vector comprising a nucleic acid having a BRAK polypeptides de a sequence encoding an expressible form;
(B) a cell, tissue or cell line comprising the expression vector of (A);
(C) BRAK polypeptide de.   The cancer inhibitor according to claim 1, wherein the head and neck cancer is oral cancer.   The cancer inhibitor according to claim 1 or 2, wherein the head and neck cancer is squamous cell carcinoma.   The cancer inhibitor according to any one of claims 1 to 3, wherein the BRAK polypeptide has a sequence represented by any one of SEQ ID NOs: 4 to 6 in the sequence listing.   The cancer inhibitor according to claim 4, wherein the nucleic acid has a sequence represented by any one of SEQ ID NOs: 1 to 3 in the sequence listing. A pharmaceutical composition for suppressing head and neck cancer comprising the cancer inhibitor according to any one of claims 1 to 5 and a pharmaceutically acceptable carrier.

Images