KR101065806B1 - Mitochondrial targeting domain protein and DNA encoding it - Google Patents

Abstract

The present invention relates to a domain protein of SEQ ID NO: 5 and a gene encoding the same, which can effectively regulate the function and stability of the mitochondria by moving the protein into the mitochondria in the cell.

Since the domain protein of the present invention acts as a target sequence for transferring CRIF1 or a heterologous protein to the mitochondria in a fused form with CRIF1 or a heterologous protein, the neuronal and muscle degenerative diseases, metabolic syndromes, cancers, etc. Substances that exhibit pharmacological activity (including chemicals, proteins, or genes) are allowed to act directly on the mitochondria.

Mitochondria, target sequences, domain proteins

Description

Mitochondrial targeting domain protein and DNA encoding it}

The present invention relates to a domain protein that can effectively regulate the function and stability of the mitochondria by moving the protein to the mitochondria in the cell and a gene encoding the same.

Mitochondria are intracellular organelles that exist in the cytoplasm in the cytoplasm, repeating continuous fusion and division and producing energy for cell survival through cellular respiration. Mitochondria are the backbone of intracellular energy metabolism, so mitochondrial dysfunction causes various diseases. Diseases caused by mitochondrial dysfunction include high incidences such as Parkinson's disease and Huntington's disease, and rare diseases such as Barth syndrome, Leigh syndrome, and MELAS syndrome. . Recent studies have also confirmed that mitochondrial abnormalities may be a cause of metabolic syndrome type 2 diabetes. These diseases, caused by the dysfunction of the mitochondria, occur in the cell's energy supply system, and are mostly accompanied by muscle diseases and brain diseases.

The mitochondrial respiratory function, which is essential for cellular energy production, is achieved through the respiratory complex in the inner membrane of the mitochondria. There are five types of respiratory complexes in the mitochondrial lining. Each complex receives electrons from specific substrates and finally delivers electrons to oxygen.

There are about 1500 proteins that make up the mitochondria, and unlike other organelles in the cell, mitochondria have their own genetic information. In other words, mitochondria exist in the nucleus and have their own genetic information in the form of mitochondrial DNA (mtDNA) in addition to genomic DNA that contains all the genetic information of the cell. The size of mtDNA is about 1600kbp, which encodes 13 proteins that make up the mitochondrial respiratory complex. Because mitochondrial respiratory complexes are composed of proteins made from two genetic materials, genomic DNA and mtDNA, their formation is controlled by more complex regulatory mechanisms than other organelles.

In addition, signaling between the mitochondria and the nucleus is expected to play a very important role in the formation and function of mitochondria, and studies on proteins that can act as mediators are required.

Thus, if the mitochondria can be transported to the mitochondria by fusion with mitochondrial target domain proteins or genes encoding them, the pharmacologically active substances (including chemicals, proteins or genes) by controlling the function and stability of the mitochondria are more active. It can be doubled.

Meanwhile, CR6 Interacting Factor 1 (CRIF 1) protein is a protein that binds to CR6 (Gadd45gamma) protein. The CRIF1 gene is characterized by increased expression during the cancer process. In other words, the expression of CRIF1 mRNA was not observed in horse follicular mononuclear cells (PBMC) obtained from normal human body, whereas fetal kidney cell line, prostate cancer cell line, cervical cancer cell line, fibrosarcoma cell line, chorionic carcinoma cancerized by adenovirus It is known that its expression is increased in cell lines, human blood cancer cell lines, HL-60, K-562, Jurkat, MOLT-4 and the like. Patent No. 439489 discloses a kit for diagnosing cancer using this characteristic of the CRIF1 gene. The relationship between CRIF1 and cancer is related to its role in the nucleus of CRIF1, but its function in mitochondria has not been reported at all.

The present inventors have discovered that CRIF1 plays an important role in the function of mitochondria and have conducted a careful study, confirming that this function is related to mitochondrial target domain protein in CRIF1 and completed the present invention.

The present invention provides a domain protein and a gene encoding the same that can effectively regulate the function of the mitochondria by allowing a specific protein to move to and stay in the mitochondria in the cell.

The present invention for achieving the above object relates to a domain protein represented by SEQ ID NO: 5. The domain protein of the present onset is a domain protein present at the N-terminus of the CRIF1 protein and can effectively transfer the heterologous protein to the mitochondria even when combined with the heterologous protein as well as the CRIF1 protein.

The present invention also relates to a gene encoding the domain protein. The gene may be DNA, RNA or PNA.

Since the domain protein of the present invention acts as a target sequence for transferring CRIF1 or a heterologous protein to the mitochondria in a fused form with CRIF1 or a heterologous protein, the neuronal and muscle degenerative diseases, metabolic syndromes, cancers, etc. Substances that exhibit pharmacological activity (including chemicals, proteins, or genes) are allowed to act directly on the mitochondria.

Hereinafter, the present invention will be described in more detail by way of examples. However, these embodiments are merely illustrative for easily describing the content and scope of the technical idea of the present invention, and thus the technical scope of the present invention is not limited or changed. In addition, it will be apparent to those skilled in the art that various modifications and changes are possible within the scope of the technical idea of the present invention based on these examples.

Example

Example 1 Distribution of CRIF1 in Cells

1) Analysis by software

The possibility of CRIF1 consisting of 222 amino acids in mitochondria was analyzed by software of Target P, PSORTII and MitoProtII, respectively. Table 1 shows that CRIF1 is very likely to be present in the mitochondria as a result of analysis using each software.

2) Observation of CRIF1 in Cells

GFP was attached to the C-terminus of CRIF1 and then introduced into cells. The vector expressing the CRIF1-GFP protein was constructed using the following method. First, the CRIF1 full-length DNA of SEQ ID NO: 1 using the primers of SEQ ID NOs: 2 and 3 are linked to the N-terminus and C-terminus of the DNA sequence encoding the CRIF1 protein so that the nucleotide sequences recognizable by the restriction enzymes XhoI and EcoRI are linked. Was amplified by PCR and cleaved with XhoI and EcoRI (TOYOBO) to obtain a CRIF1 insertion sequence. The CRIF1 full-length DNA was extracted from the HeLa cell line by using RT-PCR method using EX-Taq (TkKaRa) and transferred to pGEM T-Easy vector (Promega).

SEQ ID NO: 2: ACTCGAGATGGCGGCGTCCGTG (Forward)

SEQ ID NO: 3 CCCCGTGGGTCGAGGGCTTAAGT (Reverse)

pEGFP-N1 (BD Biosciences Clontech) was also digested with restriction enzymes XhoI and EcoRI, followed by ligation at 16 ° C for 4 hours with Ligase (TOYOBO), a linking enzyme, along with the CRIF1 insertion sequence obtained above. The completed CRIF1-GFP vector was transformed into DH-5α host cells (Real Biotech Corporation). It was plated in kanamycin medium (Sigma) and incubated at 37 ° C, and plasmid DNA was extracted from colonies.

Expression of CRIF1-GFP was confirmed by transfection of CRIF1-GFP in HeLa cell lines. CRIF1-GFP transfection was performed by mixing CRIF1-GFP vector in OPTI MEM (GIBCO) and adding PLUS Reagent (invitrogen) and reacting for 15 minutes at room temperature. Separately, Lipofectamine Reagent (invitrogen) was added to OPTI MEM, followed by reaction at room temperature for 15 minutes, and mixed with the above PLUS reaction solution for 15 minutes. The culture of HeLa cell line was exchanged with OPTI MEM, and the mixed reaction solution was treated with cells and incubated for 3 hours. After 3 hours the cultures were exchanged for DMEM cultures (including 10% fetal bovine serum, 2 mM glutamine, non-essential amino acids, 100 units / ml penicillin and 100 μg / ml streptomycin) to replace transfected HeLa cell lines with 5% CO ₂ and 37 Incubated for 24 hours at ℃. 45 minutes before the observation of the cultured cells, the cells were stained with 50% of MitoTracker Red CMXRos (invitrogen), which stained mitochondria for 45 minutes, and fixed with 4% paraformaldehyde. After fixing, three times washing with PBS, mounting using MOUNTING MEDIUM (SIGMA) and observed with a confocal microscope and the results are shown in Figures 1 and 2. As can be seen in Figures 1 and 2, CRIF1 was found in the nucleus in some cells (20%) but in the mitochondria in most cells (80%).

In addition, we divided the fractions by organelles and examined the intracellular location of CRIF1. Fractions of organelles were harvested and cultured according to the above method, washed with PBS and then buffered for fractionation (250 mM sucrose, 10 mM KCl, 1.5 mM MgCl2, 1 mM Na-EDTA, 1 mM Na-EGTA, 1 mM dithiothreitol, 0.1 mM phenylmethylsulfonylfluoride) , 10mM Tris-HCl, pH7.4, each SIGMA) and proteinase inhibitor cocktail (Roche) was put into a homogenizer and pulverized 80 times. The supernatant was harvested after centrifugation at 30 x g for 5 minutes using a centrifuge to remove uncrushed cells. Using the harvested supernatant, the mitochondrial fraction and nuclear fraction were obtained by centrifugation at 80 x g for 10 minutes and 6,000 x g for 20 minutes, respectively. The mitochondrial fraction was centrifuged once more at 20,000 x g to remove the cytoplasm fraction. Each fraction obtained was dissolved using RIPA buffer. The lysed cell lysate was sonicated twice for 20 seconds while being put on ice, precipitated for 10 minutes at 13200 rpm at 4 ° C. using a centrifuge, and the supernatant was separated and quantified by Bradford (BIO-RAD) method. Thereafter, 3X SDS sample buffer was added and boiled at 100 ° C. for 5 minutes, followed by electrophoresis on polyacrylamide gel. The electrophoresis gel was blocked on nitrocellulose membrane (Amersham Bioscience) and then blocked for 1 hour in 5% skim milk. Since the fractional markers of the primary antibody VDAC (Cell Signaling), tubulin (SIGMA), ORC2 (BD Bioscience) was reacted by over night at 4 ℃. After reacting with the primary antibody, it was washed three times with TBS / T for 10 minutes and again with the mouse and rabbit secondary antibody (CELL SIGNALING) for 1-3 hours. After reacting with the secondary antibody, it was washed three times with TBS / T for 10 minutes and detected on an x-ray photosensitive film (FUJIFILM) using ECL solution (iNtRON). After confirming the exact division of the cell fraction with each fraction marker, the location of CRIF1 was confirmed that CRIF1 was also present in the nucleus and mitochondria (FIG. 3).

Example 2 Prediction of Mitochondrial Target Sequences in CRIF1

In order to confirm the presence of the MTS sequence in CRIF1, the CRIF1 protein sequence of SEQ ID NO: 4 was analyzed using the MitoProt II program. As a result, it could be predicted that the number 1-35 (MAASVRQARS LLGVAATLAP GSRGYRARPP PRRRP; SEQ ID NO: 5) present at the N-terminus of the CRIF1 sequence had an MTS probability of 90.16%.

Example 3 Confirmation of the Function of Mitochondrial Target Sequences

(1) Preparation of Vector

In order to confirm the function of the N-terminal 1-35 domain protein predicted to act as a mitochondrial target sequence among the domain proteins of CRIF1, GFP-CRIF1 and C-terminus, in which GFP was inserted at the N-terminus of CRIF1, were first inserted. CRIF1 MTS-GFP in which only MTS present in one CRIF1-GFP and CRIF1 was bound to GFP, and a CRIF1 (delta MTS) -GFP vector in which MTS was removed were prepared, respectively.

The specific manufacturing method of each vector is as follows.

1) GFP-CRIF1

First, the full length of the CRIF1 of SEQ ID NO: 1 using the primers of SEQ ID NO: 6 and 7 so that the nucleotide sequences recognizable by the restriction enzymes XhoI and EcoRI are linked to the N- and C-terminus of the DNA sequence encoding the CRIF1 protein, respectively From DNA Amplified by PCR and digested with EcoRI and BamHI (New England Biolads) to obtain a CRIF1 insertion sequence.

SEQ ID NO: 6: AGAATTCATGGCGGCGTCCGTG (Forward)

SEQ ID NO: 7 GGATCCTCAGGAGCTGGGTGCCCC (Reverse)

pEGFP-C2 (BD Bioscience) was also digested with restriction enzymes EcoRI and BamHI, and then ligated with Ligase (Roche), a linking enzyme, and then ligation with the CRIF1 DNA overnight at 16 ° C with insertion sequence. The completed GFP-CRIF1 vector was transformed into DH-5α host cells (Real Biotech Corporation), plated in kanamycin medium (Sigma), incubated at 37 ° C, and plasmid DNA was extracted from colonies.

2) CRIF1-GFP

CRIF1-GFP plasmid DNA was extracted by the method described in 2) of Example 1.

3) CRIF1 MTS-GFP

First, the nucleotide sequences recognizable by XhoI and EcoRI, restriction enzymes, are linked to the N-terminus and C-terminus of the DNA sequence encoding the MTS domain protein of CRIF1 of SEQ ID NO: 8 (SEQ ID NOS: 1-105 bp). From the CRIF1 full-length DNA of SEQ ID NO: 1 using primers of SEQ ID NOs: 9 and 10 Amplified by PCR and cleaved with XhoI and EcoRI (TOYOBO) to obtain the MTS insertion sequence.

SEQ ID NO: CCGCTCGAGATG GCGGC GTCCGTGC (Forward)

SEQ ID NO: 10 CCGGAATTCGCGGCCTGCGGCGCG (Reverse)

pEGFP-N1 (BD Biosciences Clontech) was also digested with restriction enzymes XhoI and EcoRI, and then ligated with Ligase (TOYOBO), a linking enzyme, followed by ligation at 16 ° C for 4 hours with the MTS insertion sequence. The completed CRIF1 MTS-GFP vector was transformed into DH-5α host cell (Real Biotech Corporation). This was plated in kanamycin medium (Sigma) and incubated at 37 ° C to extract plasmid DNA from colonies.

4) CRIF1 (△ MTS) -GFP

In order to prevent the MTS domain of CRIF1 from functioning normally, the sequences recognized by XhoI and EcoRI, which are restriction enzymes, are linked to the N-terminus and C-terminus of the DNA sequence encoding CRIF1 protein, which is cleaved 1-15 times. The primers of SEQ ID NOS: 11 and 12 were used to amplify by PCR from the CRIF1 full-length DNA of SEQ ID NO: 1 and cleaved with XhoI and EcoRI (TOYOBO) to obtain a CRIF1 (ΔMTS) insertion sequence.

SEQ ID NO: 11 CCGCTCGAGAT GGCGACCCTGGCCC (Forward)

SEQ ID NO: 12 CCGGAATTCGGGAGCTGGGTGCCCCA (Reverse)

pEGFP-N1 (BD Biosciences Clontech) was also digested with restriction enzymes XhoI and EcoRI, and then ligated with Ligase (TOYOBO), a linking enzyme, followed by ligation at 16 ° C for 4 hours with the CRIF1 (△ MTS) insertion sequence. The completed CRIF1 (ΔMTS) -GFP vector was transformed into DH-5α host cells (Real Biotech Corporation). This was plated in kanamycin medium (Sigma) and incubated at 37 ° C to extract plasmid DNA from colonies.

(2) Confirmation of protein distribution by each vector

Each vector obtained in (1) was cultured after transfection into HeLa cell line. 45 minutes before cell observation, MitoTracker Red CMXRos (invitrogen), which stains mitochondria, was stained with 50 nM and washed three times with PBS. After mounting using MOUNTING MEDIUM (SIGMA) was observed with a confocal microscope and the results are shown in FIG. 5 is a graph showing the distribution of each protein by organelles.

As can be seen in Figures 4 and 5, CRIF1-GFP and CRIF1 MTS-GFP is present in the mitochondria more than 80%, while GFP-CRIF1 and CRIF1 (ΔMTS) -GFP was almost in the nucleus. It can be seen that the MTS acts as a mitochondrial target sequence for transferring CRIP and heterologous proteins to the mitochondria, and functions as a mitochondrial target sequence only when the MTS is present at the N-terminus.

1 is a photograph showing that CRIF1 is mainly present in mitochondria.

2 is a graph showing that CRIF1 is mainly present in mitochondria.

3 is a graph showing the distribution of CRIF1 in intracellular organelles.

Figure 4 is a photograph showing that the domain protein of SEQ ID NO: 1 mitochondrial target sequence.

5 is a graph showing that the domain protein of SEQ ID NO: 1 is a mitochondrial target sequence.

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Mitochondrial targeting domain protein and DNA encoding it <160> 12 <170> KopatentIn 1.71 <210> 1 <211> 666 <212> DNA <213> DNA encoding CRIF1 protein <400> 1 atggcggcgt ccgtgcgaca ggcacgcagc ctactaggtg tggcggcgac cctggccccg 60 ggttcccgtg gctaccgggc gcggccgccc ccgcgccgca ggccgggacc ccggtggcca 120 gaccccgagg acctcctgac cccgcggtgg cagctgggac cgcgctacgc ggctaagcag 180 ttcgcgcgtt acggcgccgc ctccggggtg gtccccggtt cgttatggcc gtcgccggag 240 cagctgcggg agctggaggc cgaagaacgc gaatggtacc cgagcctggc gaccatgcag 300 gagtcgctgc gggtgaagca gctggccgaa gagcagaagc gtcgggagag ggagcagcac 360 atcgcagagt gcatggccaa gatgccacag atgattgtga actggcagca gcagcagcgg 420 gagaactggg agaaggccca ggctgacaag gagaggaggg cccgactgca ggctgaggcc 480 caggagctcc tgggctacca ggtggaccca aggagtgccc gcttccagga gctgctccag 540 gacctagaga agaaggagcg caagcgcctc aaggaggaaa aacagaaacg gaagaaggag 600 gcgcgagctg ctgcattggc tgcagctgtg gctcaagacc cagcagcctc tggggcaccc 660 agctcc 666 <210> 2 <211> 22 <212> DNA <213> forward primer <400> 2 actcgagatg gcggcgtccg tg 22 <210> 3 <211> 23 <212> DNA <213> reverse primer <400> 3 ccccgtgggt cgagggctta agt 23 <210> 4 <211> 222 <212> PRT <213> CRIF1 <400> 4 Met Ala Ala Ser Val Arg Gln Ala Arg Ser Leu Leu Gly Val Ala Ala   1 5 10 15 Thr Leu Ala Pro Gly Ser Arg Gly Tyr Arg Ala Arg Pro Pro Pro Arg              20 25 30 Arg Arg Pro Gly Pro Arg Trp Pro Asp Pro Glu Asp Leu Leu Thr Pro          35 40 45 Arg Trp Gln Leu Gly Pro Arg Tyr Ala Ala Lys Gln Phe Ala Arg Tyr      50 55 60 Gly Ala Ala Ser Gly Val Val Pro Gly Ser Leu Trp Pro Ser Pro Glu  65 70 75 80 Gln Leu Arg Glu Leu Glu Ala Glu Glu Arg Glu Trp Tyr Pro Ser Leu                  85 90 95 Ala Thr Met Gln Glu Ser Leu Arg Val Lys Gln Leu Ala Glu Glu Gln             100 105 110 Lys Arg Arg Glu Arg Glu Gln His Ile Ala Glu Cys Met Ala Lys Met         115 120 125 Pro Gln Met Ile Val Asn Trp Gln Gln Gln Gln Arg Glu Asn Trp Glu     130 135 140 Lys Ala Gln Ala Asp Lys Glu Arg Arg Ala Arg Leu Gln Ala Glu Ala 145 150 155 160 Gln Glu Leu Leu Gly Tyr Gln Val Asp Pro Arg Ser Ala Arg Phe Gln                 165 170 175 Glu Leu Leu Gln Asp Leu Glu Lys Lys Glu Arg Lys Arg Leu Lys Glu             180 185 190 Glu Lys Gln Lys Arg Lys Lys Glu Ala Arg Ala Ala Ala Leu Ala Ala         195 200 205 Ala Val Ala Gln Asp Pro Ala Ala Ser Gly Ala Pro Ser Ser     210 215 220 <210> 5 <211> 35 <212> PRT <213> MTS domain protein <400> 5 Met Ala Ala Ser Val Arg Gln Ala Arg Ser Leu Leu Gly Val Ala Ala   1 5 10 15 Thr Leu Ala Pro Gly Ser Arg Gly Tyr Arg Ala Arg Pro Pro Pro Arg              20 25 30 Arg Arg Pro          35 <210> 6 <211> 22 <212> DNA <213> forward primer <400> 6 agaattcatg gcggcgtccg tg 22 <210> 7 <211> 24 <212> DNA <213> reverse primer <400> 7 ggatcctcag gagctgggtg cccc 24 <210> 8 <211> 105 <212> DNA <213> DNA encoding MTS domain protein <400> 8 atggcggcgt ccgtgcgaca ggcacgcagc ctactaggtg tggcggcgac cctggccccg 60 ggttcccgtg gctaccgggc gcggccgccc ccgcgccgca ggccg 105 <210> 9 <211> 25 <212> DNA <213> forward primer <400> 9 ccgctcgaga tggcggcgtc cgtgc 25 <210> 10 <211> 24 <212> DNA <213> reverse primer <400> 10 ccggaattcg cggcctgcgg cgcg 24 <210> 11 <211> 25 <212> DNA <213> forward primer <400> 11 ccgctcgaga tggcgaccct ggccc 25 <210> 12 <211> 26 <212> DNA <213> reverse primer <400> 12 ccggaattcg ggagctgggt gcccca 26  

Claims (4)

Mitochondrial target domain protein, characterized in that SEQ ID NO: 5. Gene encoding the domain protein according to claim 1. The method of claim 2, The gene is characterized in that the DNA, RNA or PNA. The method of claim 2, A gene characterized in that the sequence of the gene is SEQ ID NO: 8.

Images