JP4565891B2 - Novel protein having cell recognition and cytotoxic activity derived from Bacillus thuringiensis A1470 strain and gene encoding the same - Google Patents

Description

  The present invention relates to a novel protein derived from a microorganism and a gene encoding the same. More specifically, the present invention relates to a novel recombinant protein having cell recognition and cytotoxic activity derived from Bacillus thuringiensis (hereinafter abbreviated as “BT”) A1470 strain and a gene encoding the same. .

  Bacillus thuringiensis was discovered in 1901 by a Japanese researcher Shigego Ishiwatari as a pathogenic bacterium of the moth. Since then, the toxin protein produced by this bacterium has been widely used as a microbial insecticide for the control of agricultural and sanitary pests.

It has been known by studies so far that crystalline proteins having insecticidal activity are activated by protease treatment as necessary after solubilization with alkali and exhibit toxicity against insects. Crystalline proteins with insecticidal activity
(1) Cry protein (usually having a molecular weight of 60 to 75 kDa in the activated form) which shows selective destruction activity to insect cells in the state activated by protease, and (2) non-selective destruction to insect cells. Cyt protein having activity and erythrocyte hemolytic activity (normally in the activated form, molecular weight 22-30 kDa)
It is clear that it is classified as

  Crystalline protein of Bacillus thuringiensis as a cell recognition protein is highly selective, typified by Cry protein, and is prokaryotic-derived protein. In other words, it has excellent characteristics not found in other cell recognition proteins such as antibodies. However, its use is currently limited to use as insecticides targeting insect cells. In addition, only 30 to 40% of BT strains expressing crystalline protein having insecticidal activity. Regarding the properties of crystalline protein that does not have insecticidal activity produced by BT strain, It was unknown.

  We have about 2000 Bacillus thuringiensis strains (50 H serotypes) isolated from soil, arable land, forest soil, sericulture farm dust, stored grain dust, sick and dead insects, plants, fresh water, etc. Vertebrate cells (including cancer cells) are selected when activated by proteases after solubilization with alkali among crystalline proteins whose activity has been unknown, belonging to unknown serotypes) The world's first clarified that there is a group of novel proteins that are recognized and destroyed (Non-patent Documents 1 and 2). This protein which does not have insecticidal activity, has a molecular weight of 20 to 70 kDa, and does not have erythrocyte hemolytic activity is described in Patent Document 1.

A protein having cell recognition and cytotoxic activity derived from Bacillus thuringiensis A1470 strain is described in Patent Document 2.
JP-A-11-222498 JP 2003-284568 A Mizuki, E., Ohba, M., Akao, T., Yamashita, S., Saitoh, H. and Park, “Journal Of Applied Microbiology ”, 1999, 86, p.477-486 Mizuki, E., Park, YS, Saitoh, H., Yamashita, S., Akao, T., Higuchi, K. and Ohba , M.), “Clinical and Diagnostic Laboratory Immunology”, 2000, 7, p.625-634.

  There are many unexplained groups of toxin proteins produced by Bacillus thuringiensis, and we search for those with medically useful activity to treat human diseases. There is still a need to help.

  The present inventors derived from Bacillus thuringiensis A1470 strain among Bacillus thuringiensis strains, and have novel cell recognition and cytotoxic activity selective to vertebrate cells (including cancer cells). A protein was found, its amino acid sequence and nucleic acid sequence encoding it were determined, and a protein having such cell recognition and cytotoxic activity and a precursor protein of the protein were prepared by a gene recombination technique.

  In the first aspect, the present invention provides a precursor protein of a protein having cell recognition and cytotoxic activity, which is derived from Bacillus thuringiensis A1470 strain and has a molecular weight of 34 kDa.

  The precursor protein of the present invention preferably has an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 1. Preferably, the precursor protein of the present invention has the amino acid sequence shown in SEQ ID NO: 2. Furthermore, the precursor protein of the present invention may have an amino acid sequence in which one to several amino acids are deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 2.

  The precursor protein of the present invention is derived from the Bacillus thuringiensis A1470 strain. The stock was deposited on March 20, 2002, under the accession number FERM BP-8344 at the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center (Chuo 6-1-1, Tsukuba City, Ibaraki, Japan). It is.

  In the second aspect, the present invention provides an activated protein having cell recognition and cytotoxic activity obtained from the 34 kDa precursor protein. The activated protein has a molecular weight of 26 kDa, and can be obtained by solubilizing the precursor protein with an alkali and then activating with a protease (such as proteinase K).

  The 26 kDa active protein of the present invention has the amino acid sequence shown in SEQ ID NO: 4. The amino acid sequence shown in SEQ ID NO: 4 corresponds to amino acid residues 2 to 246 of SEQ ID NO: 2, which is the amino acid sequence of the precursor protein of the present invention. The 26 kDa active protein of the present invention may have an amino acid sequence in which one to several amino acids are deleted, substituted, added or inserted in the amino acid sequence.

  The activated protein of the present invention has selective cell recognition and cytotoxic activity against specific vertebrate cells (including cancer cells), especially from leukemia cells, liver cancer cells, uterine cancer cells and colon cancer cells. It specifically exhibits cell recognition and cytotoxic activity against at least one cell selected from the group consisting of:

  In its third aspect, the present invention provides a DNA encoding the 34 kDa precursor protein of the present invention. The DNA encoding the 34 kDa precursor protein of the present invention has the nucleotide sequence shown in SEQ ID NO: 1. The DNA of the present invention also includes DNA that hybridizes under stringent conditions with DNA having a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1.

  In its fourth aspect, the present invention provides a DNA encoding the 26 kDa activation protein of the present invention. The DNA encoding the 26 kDa activation protein of the present invention has the nucleotide sequence shown in SEQ ID NO: 3. The nucleotide sequence shown in SEQ ID NO: 3 corresponds to nucleotide residue 4 to nucleotide residue 738 of SEQ ID NO: 1, which is a nucleotide sequence encoding the precursor protein of the present invention. The DNA of the present invention includes a DNA that hybridizes with a DNA having a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 3 under stringent conditions and encodes a protein having cell recognition and cytotoxic activity. To do.

  The DNA encoding the 34 kDa precursor protein of the present invention and the DNA encoding the 26 kDa activation protein are preferably derived from the Bacillus thuringiensis A1470 strain.

  In its fifth aspect, the present invention provides a recombinant vector comprising DNA encoding the 34 kDa precursor protein of the present invention or DNA encoding a 26 kDa activation protein.

  In its sixth aspect, the present invention provides a host cell transformed with the recombinant vector of the present invention.

  In its seventh aspect, the present invention provides a pharmaceutical composition comprising the 26 kDa activated protein of the present invention.

  In its eighth aspect, the present invention provides an anticancer agent comprising the 26 kDa activating protein of the present invention.

Hereinafter, the present invention will be described in more detail.
The present inventors cloned a gene encoding the 34 kDa precursor protein of the present invention from Bacillus thuringiensis A1470 strain, and prepared the recombinant 34 kDa protein by incorporating the gene of the 34 kDa precursor protein into E. coli.
In addition, the 26 kDa activating protein of the present invention was also successfully isolated and purified from natural Bacillus thuringiensis A1470 strain.

  When the 34 kDa precursor protein of the present invention is solubilized with alkali and then treated with protease, a 26 kDa active protein is obtained. That is, the 26 kDa protein is a large fragment obtained when the 34 kDa precursor protein is hydrolyzed. Specifically, the large fragment when the C-terminal fragment of the 34 kDa precursor protein is cleaved is the 26 kDa protein. The 34 kDa precursor protein of the present invention has the amino acid sequence shown in SEQ ID NO: 2, but the 26 kDa active protein obtained from this precursor protein has the amino acid sequence shown in SEQ ID NO: 4 (amino acid residues 2 to 2 of SEQ ID NO: 2). Amino acid sequence corresponding to group 246).

Cloning of the gene encoding the 34 kDa precursor protein of the present invention from Bacillus thuringiensis A1470 strain was performed as follows.
When cloning the gene encoding the 32 kDa protein described in JP-A-2003-284568, a gene encoding the 34 kDa protein of the present invention can be obtained together with the gene encoding the 32 kDa protein. That is, as described in the Examples, a 6.6 kb DNA fragment is contained in the pSHAN32.1 plasmid obtained when cloning the gene encoding the 32 kDa protein, and the 34 kDa protein of the present invention is contained in this DNA fragment. It was found that the encoding gene was included.

  Primers are prepared based on the 5 ′ and 3 ′ terminal nucleotide sequences of this 34 kDa protein gene, amplified by PCR, and the resulting PCR product is treated with a predetermined restriction enzyme and then introduced into an expression vector, and then an appropriate host. Cells such as E. coli BL21 cells can be transformed.

  The recombinant vector and expression vector for producing the protein of the present invention by genetic recombination technology are not particularly limited as long as they can be replicated and autonomously propagated in various prokaryotic and / or eukaryotic host cells. A plasmid vector, a viral vector, etc. are included. The recombinant vector is a known cloning vector or expression vector available in the technical field, and a DNA encoding the protein of the present invention is used with an appropriate restriction enzyme and ligase, or, if necessary, a linker or adapter DNA. Can be prepared by linking them together. Examples of such vectors include E. coli-derived plasmids such as pBR322, pBR325, pUC18, and pUC19, yeast-derived plasmids such as pSH19 and pSH15, and Bacillus subtilis-derived plasmids such as pUB110, pTP5, and pC194. . Examples of the plasmid derived from Bacillus thuringiensis include pHT3101 and pHT315. Moreover, bacteriophage such as λ phage, papovirus such as SV40, bovine papilloma virus (BPV), retrovirus such as Moloney murine leukemia virus (MoMuLV), adenovirus (AdV), adeno-associated virus (AAV), Animal and insect viruses such as vaccinia virus and baculovirus are exemplified.

  In particular, the present invention provides an expression vector in which a DNA encoding the protein of the present invention is placed under the control of a promoter functional in the target host cell. Examples of the vector used include a promoter region that functions in various host cells of prokaryotic and / or eukaryotic cells and can control transcription of a gene located downstream thereof (for example, trp promoter when the host is E. coli, When the host is Bacillus subtilis, such as lac promoter, lectA promoter, etc. When the host is a yeast, SPO1 promoter, SPO2 promoter, penP promoter, etc. When the host is yeast, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, etc. When the host is a mammalian cell SV40-derived early promoter, MoMuLV-derived long terminal repeat, adenovirus-derived early promoter, and the like, and a transcription termination signal of the gene, that is, a terminator region, There is no particular limitation as long as the region and the terminator region are linked via a sequence containing at least one restriction enzyme recognition site, preferably a unique restriction site that cleaves the vector only at that site, It further contains a selection marker gene for selection of transformants (a gene that confers resistance to drugs such as tetracycline, ampicillin, kanamycin, hygromycin, phosphinothricin, a gene that complements auxotrophic mutations, etc.) Preferably it is. Further, when the DNA encoding the protein of the present invention does not contain an initiation codon and a termination codon, the initiation codon (ATG or GTG) and the termination codon (TAG, TGA, TAA) are respectively located downstream of the promoter region and the terminator region. A vector containing upstream of is used.

  When a bacterium is used as a host cell, the expression vector generally needs to contain a replicable unit capable of autonomous replication in the host cell in addition to the promoter region and terminator region described above. The promoter region includes an operator and a Shine-Dalgarno (SD) sequence in the vicinity of the promoter.

  When the protein of the present invention is secreted into the medium of the transformant and the DNA encoding the protein of the present invention does not contain a signal peptide coding sequence, an appropriate signal codon is used as a vector after the initiation codon. Furthermore, it is preferable to use a secretory expression vector.

  When the DNA encoding the protein of the present invention is isolated from genomic DNA and obtained in a form containing the original promoter and terminator region, the expression vector of the present invention can be replicated or autonomously propagated in the target host cell. It can be prepared by inserting the DNA into an appropriate site of a known cloning vector.

  The present invention also provides a transformant obtained by transforming a host cell with the above expression vector. The host cell used in the present invention is not particularly limited as long as it is compatible with the above-described expression vector and can be transformed. Natural cells or artificially established mutations usually used in the art Various cells such as cells or recombinant cells (for example, bacteria (E. coli, Bacillus subtilis, lactic acid bacteria, Bacillus thuringiensis or mutants thereof (preferably a Bacillus thuringiensis strain that does not produce toxin protein), yeast ( Saccharomyces genus, Pichia genus, Kriveromyces genus), animal cells or insect cells, etc.), but prokaryotic cells are more preferred, and Bacillus thuringiensis mutations suitable for expressing the protein of the present invention Strains can be created by those skilled in the art, for example, producing toxin proteins. A Bacillus thuringiensis strain that does not produce toxin protein can be obtained by curing from the C. thuringiensis strain and removing the plasmid DNA. In addition, any Bacillus thuringiensis strain that produces the protein of the present invention can be obtained (for details, see Gonzalez, JM et al. PLASMID 5, 351-365 (1981)).

  The expression vector can be introduced into a host cell by a conventionally known method. For example, in the case of bacteria, the method of Cohen et al. (Proc. Natl. Acad. Sci. USA., 69,2110 (1972)), protoplast method, competent method, etc., and in the case of yeast, the method of Hinnnen et al. Proc. Natl. Acad. Sci. USA., 75, 1927 (1978)), in the case of animal cells, Graham's method (Virology, 52, 456 (1973)), etc. In some cases, transformation can be performed by the method of Summers et al. (Mol. Cell. Biol. 3, 2156-2165 (1983)).

  The present invention provides a DNA encoding the 34 kDa precursor protein or 26 kDa protein of the present invention. The DNA of the present invention has a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2 (precursor protein of the present invention), has a nucleotide sequence shown in SEQ ID NO: 1, and is complementary to the nucleotide sequence shown in SEQ ID NO: 1. One that hybridizes under stringent conditions with DNA having a typical nucleotide sequence, one that has a nucleotide sequence that encodes the amino acid sequence shown in SEQ ID NO: 4 (the activated protein of the present invention), and nucleotide sequence that shows SEQ ID NO: 3 And those that hybridize with DNA having a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 3 under stringent conditions and encode a protein having cell recognition and cytotoxic activity. The DNA encoding the 26 kDa protein of the present invention has the nucleotide sequence shown in SEQ ID NO: 3, and this nucleotide sequence corresponds to nucleotide residue 4 to nucleotide residue 738 of the nucleotide sequence shown in SEQ ID NO: 1.

  In the present invention, “stringent conditions” refers to about 60% or more, preferably about 70% or more, more preferably about 75% or more, more preferably about 80% or more, even more preferably about 85% in nucleotide sequence. % Or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, and most preferably about 99% or more. The stringency can be adjusted by appropriately changing the salt concentration, temperature, etc. during the hybridization reaction or washing. The degree of homology is calculated, for example, by using the BLAST search of the National Center for Biotechnology Information (NCBI) by default.

  The protein of the present invention can be obtained from a transformant containing a cell that naturally produces the protein of the present invention, ie, Bacillus thuringiensis A1470 strain, and an expression vector encoding a DNA that expresses the protein of the present invention. it can. The protein of the present invention can be produced by culturing a transformant containing the expression vector prepared as described above in a medium and recovering the protein of the present invention from the obtained culture. The protein of the present invention can be obtained by culturing Bacillus thuringiensis A1470 strain, which is a cell that naturally produces the protein of the present invention, and recovering the protein of the present invention from the obtained culture. The protein thus recovered can be activated by treatment with a protease after solubilization with an alkaline buffer.

  The medium used for culturing the transformant preferably contains a carbon source, an inorganic nitrogen source or an organic nitrogen source necessary for the growth of the transformant. Examples of the carbon source include glucose, dextran, soluble starch, and sucrose, and examples of the inorganic or organic nitrogen source include ammonium salts, nitrates, amino acids, corn steep liquor, peptone, casein, meat extract, large Examples include soybean cake, potato extract and the like. Further, other nutrients [for example, inorganic salts (for example, calcium chloride, sodium dihydrogen phosphate, magnesium chloride), vitamins, antibiotics (for example, tetracycline, neomycin, ampicillin, kanamycin, etc.)] may be included as desired. .

  Culturing is performed by methods known in the art. Specific media and culture conditions used according to the host cells are exemplified below, but the culture conditions in the present invention are not limited to these.

  When the host cell is a bacterium, actinomycete, yeast, filamentous fungus or the like, a liquid medium containing the above nutrient source is suitable, for example. Preferably, the medium has a pH of 5-8. When the host cell is Escherichia coli, preferred media include LB medium, M9 medium (Miller. J., Exp. Mol. Genet, p. 431, Cold Spring Harbor Laboratory, New York (1972)) and the like. The culture can be performed usually at 14 to 43 ° C. for about 3 to 24 hours with aeration and stirring as necessary. When the host cell is Bacillus subtilis, it can be performed usually at 30 to 40 ° C. for about 16 to 96 hours with aeration and stirring as necessary. When the host cell is Bacillus thuringiensis or a mutant strain thereof (preferably Bacillus thuringiensis BFR1), CYS medium (Yamamoto, T., ACS Symp. Ser. 432, 46-60 ( (In this case, the culture is performed, for example, on an agar plate at 20 ° C. for 96 hours). When the host cell is yeast, examples of the medium include Burkholder's minimal medium (Bostian. KL et al, Proc. Natl. Acad. Sci. USA, 77, 4505 (1980)), and the pH is 5-8. It is desirable to be. The culture is usually carried out at about 20 to 35 ° C. for about 14 to 144 hours, and if necessary, aeration and agitation can be performed.

  When the host cell is an animal cell, the medium is, for example, a minimum essential medium (MEM) containing about 5 to 20% fetal calf serum (Science, 122, 501 (1952)), Dulbecco's modified minimum essential medium (DMEM) (Virology, 8, 396 (1959)), RPMI 1640 medium (J. Am. Med. Assoc., 199, 519 (1967)), 199 medium (Proc. Soc. Exp. Biol. Med., 73, 1 (1950 )) Etc. can be used. The pH of the medium is preferably about 6 to 8, and the culture is usually carried out at about 30 to 40 ° C. for about 15 to 72 hours, and if necessary, aeration and stirring can be performed.

  The protein of the present invention can be purified by appropriately combining various commonly used separation techniques. For example, salting out, solvent precipitation, dialysis, ultrafiltration, gel filtration, non-denaturing PAGE, SDS-PAGE, ion exchange chromatography, hydroxylapatite chromatography, affinity chromatography, reverse phase high performance liquid chromatography, isoelectric focusing It can be obtained by appropriately selecting a known separation method such as electrophoresis.

  The 34 kDa recombinant protein obtained according to the present invention is activated by incubating with a protease (such as proteinase K) at 37 ° C. for 1-2 hours after solubilization with alkali to produce an activated protein of 26 kDa.

As used herein, “cytotoxic activity” refers to the ability to specifically destroy specific cells. For example, for a particular cell, for example, about 2 μg / ml or less, preferably about 1 μg / ml or less, more preferably about 0.5 μg / ml or less, as measured by the MTT assay described in the Examples. More preferably, it is considered to have “cytotoxic activity” if it exhibits an EC ₅₀ (μg purified protein / ml) of about 0.25 μg / ml or less. When measuring by a method other than the MTT assay, if the cytotoxic activity against a specific cell is significantly higher than the cytotoxic activity against a negative control, the cell is considered to have cytotoxic activity against that cell. It is. Examples of the negative control include any cells in which the protein of the present invention does not exhibit cytotoxic activity. For example, Jurkat cells, K562 cells, HeLa cells, UtSMC cells, HC cells, A549 cells, MRC-5 cells, Vero Cells arbitrarily selected from cells, COS-7 cells, CHO-K1 cells and NIH3T3 cells can be used as a negative control.

  In addition, the protein of the present invention specifically recognizes and destroys specific cells, thereby exhibiting specific cytotoxic activity against specific cells. Therefore, the protein of the present invention has specific “cell recognition activity”. For example, when the cell recognition activity for a specific cell is significantly higher than the cell recognition activity for a negative control, as measured by an immunoprecipitation assay, interaction analysis using BIAcore, the cell recognition activity for that cell Is considered to have The negative control includes any cell in which the protein of the present invention does not show cell recognition activity. Those skilled in the art can appropriately select cells that can be used as a negative control.

  The 26 kDa protein of the present invention includes leukemia T cells (preferably MOLT-4 cells) derived from human, promyelocytic leukemia cells (preferably HL60 cells), lymphoma cells (preferably U-937DE-4 cells), uterus, among others. Cancer cells (preferably Savano cells and TCS cells), liver cancer cells (preferably HepG2 cells) and colon cancer cells (preferably colon cancer cells, more preferably CACO-2 cells), and rat-derived cancer cells (preferably PC12). Cells) are specifically recognized and exhibit cytotoxic activity against these cells.

  As described above, the 26 kDa protein of the present invention specifically recognizes specific human-derived cancer cells and selectively shows cytotoxic activity against these cancer cells, and therefore can be used as an anticancer agent. Therefore, the present invention includes a pharmaceutical composition comprising the 26 kDa protein of the present invention as an active ingredient, particularly an anticancer agent. Applicable diseases of the anticancer agent of the present invention include leukemia, preferably leukemia caused by abnormal T cells, promyelocytic leukemia, lymphoma, cervical cancer, uterine cancer, liver cancer, colon cancer and the like.

  The pharmaceutical composition or anticancer agent of the present invention can be prepared by mixing the 26 kDa protein of the present invention as an active ingredient with a usual pharmacologically acceptable excipient or carrier. The pharmaceutical composition or anticancer agent of the present invention is suitably in a dosage form suitable for powders, tablets, pellets, capsules, suppositories, liquids, emulsions, suspensions, aerosols, sprays, and other uses. It may be. The therapeutically effective dose of the 26 kDa protein of the invention, which is the active ingredient, will also vary depending on its purity, activity and mode of administration, and the age, health, weight, sex and type of disease of the individual patient to be treated. However, those skilled in the art can appropriately determine the dose in consideration of these factors.

When the 26 kDa activating protein of the present invention is used as an anticancer agent, the protein of the present invention alone is effective, but a complex with another anticancer agent (covalent or noncovalent) may be used to enhance the effect. It can also be used as a combination agent. For example, although a complex of an immunoglobulin and an anticancer agent has been reported, the protein of the present invention can also be used as a complex with another anticancer agent. In addition, the protein of the present invention can be labeled with a radioisotope (eg, ¹³¹ I). For example, it has been reported that treatment with ¹³¹ I-labeled anti-CD20 monoclonal antibody has yielded very good results in patients with B-cell lymphoma, but the protein of the invention is also labeled with ¹³¹ I The destructive effect on cancer cells is enhanced. The protein of the present invention can also be used as a complex with a toxin (for example, ricin). For example, there is a report that a remarkable effect was confirmed in a T cell lymphoma patient by a complex of an anti-CD5 antibody and ricin A chain, but the protein of the present invention is also used as a complex with ricin A chain. be able to.

  In addition to the above features, the protein of the present invention can be used in drug delivery systems because of its very high selectivity. For example, the protein of the present invention can impart specific directivity to the substance by fusion with another substance. It will be appreciated that the proteins of the invention have excellent selectivity and can be used in targeting therapy as well as immunoglobulins (antibodies).

Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited thereto.
In the following examples, HeLa cells (human cervical cancer cells), Sawano cells (human endometrial adenocarcinoma cells), TCS cells (human keratinized squamous cell carcinoma cells), HepG2 cells (liver cancer cells) ), MOLT-4 cells (human leukemia T cells), Jurkat cells (human leukemia T cells), HL60 cells (human promyelocytic leukemia cells), MRC-5 cells (human embryonic lung-derived normal fibroblasts), A549 cells (Human lung cancer cells), CACO-2 cells (human colon cancer cells), COS-7 cells (African green monkey kidney-derived cells), K562 cells (chronic myeloid leukemia cells), CHO cells (hamster ovary-derived cells), PC12 cells (Rat melanoma-derived cells), U937DE-4 cells (human lymphoma-derived cells) Vero cells (African green monkey kidney-derived cells) and NIH3T3 cells (ma Scan embryonic fibroblasts) from the Institute of Physical and Chemical Research, from UtSMC cells (normal human uterine smooth muscle cells) Takara Shuzo Co., Ltd., HC cells (human normal liver cells) were purchased from each cell Systems Incorporated.

Example 1 [Preparation of 26 kDa protein from Bacillus thuringiensis A1470 strain]
Inclusion bodies formed at the time of sporulation by Bacillus thuringiensis A1470 strain (accession number FERM BP-8344) (hereinafter abbreviated as “BT A1470 strain”) were collected, and solubilized buffer (50 mM sodium carbonate (pH 10. 5), 10 mM DTT, 1 mM EDTA) was added and incubated at 37 ° C. for 1 hour. This was centrifuged at 7,000 × g for 20 minutes to obtain a supernatant. The supernatant thus obtained was passed through a 0.45 μm filter, insoluble matter was filtered, adjusted to pH 9.2 with 1N hydrochloric acid, and 1 mg / ml proteinase K (manufactured by Wako Pure Chemicals; lot number PAQ7953) at a final concentration of 50 μg. / ml and incubated at 37 ° C. for 1.5 hours. Processing with proteinase K was stopped by adding 100 mM PMSF to a final concentration of 1 mM, and at the same time, ice-cooled and applied again to a 0.45 μm filter. This sample was passed through a Resource Q column (Amersham Biosciences anion exchange chromatography column) (running buffer used 50 mM Glycine NaOH, pH 10.8), and the fraction passed through was collected. This fraction was dialyzed with 10 mM Hepes and 10 mM DTT (pH 7.8) and passed through a Resource S column (Amersham Biosciences cation exchange chromatography column) (running buffer with 10 mM Hepes, 10 mM DTT and pH 7.8). Used), and the fractions passed through were collected. This fraction is a purified 26 kDa protein. The 26 kDa protein thus obtained was transferred to a PVDF membrane, and the amino acid sequence on the N-terminal side was determined using an automatic amino acid sequencer Model 473A (Applied Biosystems).

Example 2 [Preparation of transformant containing DNA encoding 34 kDa protein]
The 32 kDa protein derived from BT A1470 strain was transferred to a PVDF membrane (Bio-Rad, Hercules, Ca, USA), and the N-terminal sequence was determined using a protein sequencer Model 473A (Applied Biosystems, Foster, CA, USA). This N-terminal 10 amino acid sequence (AlaIleIleAsnLeuAlaAsnGluLeuAla: SEQ ID NO: 5) was used to design a 20-mer degenerate oligonucleotide probe (GAAATT (A) TATGGT (A) ATGCAATA: SEQ ID NO: 6) (32 kDa F2 oligonucleotide). used. This oligonucleotide sequence corresponds to E (10th) to Y (16th) of the 32 kDa protein N-terminal sequence.

  Furthermore, the amino acid sequence other than the N-terminus of this protein was obtained from Cleveland et al. (Cleveland DW, Fischer SG, Kirschner MW and Laemmli UK (1977) Peptide mapping by limited proteolysis in sodium dodecyl sulfate and analysis by gel electrophoresis, J. Biol. Chem. , 252 (3), 1102-1106). This protein was treated with Staphylococcus aureus V8 protease (Roche Diagnostics, Mannheim, Germany) and the resulting internal peptides were separated by 15% SDS-PAGE. The N-terminal sequence of one of the separated internal peptides was determined by the method described above. The first 19 amino acid sequences (GlyAlaValThrAsnGluAsnLysTyrThrLeuAspAlaThrGlnAspPheArgAsp: SEQ ID NO: 7) were used for the design of a 20-mer degenerate oligonucleotide probe (GTATATTTATTTTCATTT (A) GT: SEQ ID NO: 8) (32 kDa R2 oligonucleotide). This oligonucleotide sequence corresponds to T (10th) to T (4th) of the 19 amino acid sequences.

  Next, PCR was performed on all plasmids of BTA1470 strain using 32 kDa F2 oligonucleotide and 32 kDa R2 oligonucleotide. As a result, a 400 bp PCR product was obtained and purified. The purified 400 bp PCR product was then labeled with peroxidase by the ECL nucleic acid labeling system (Amersham Pharmacia Biotech, Uppsala, Sweden) to produce a probe. Next, all plasmid DNA contained in BTA1470 strain was extracted, and this plasmid DNA was cleaved into fragments by treatment with restriction enzyme (ClaI). The peroxidase-labeled probe specifically hybridized to the approximately 6.6 kb ClaI fragment of the above fragments.

  A BT A1470 strain plasmid fragment (5-7 kb) was inserted into the ClaI site of pBluescript SK (+). Hybridization to Escherichia coli DH5α transformed with this plasmid was confirmed using a labeled probe. This E. coli DH5α contained the pSHAN32.1 plasmid. This plasmid had a 6.6 kb DNA fragment, which contained the gene for ORF1 and the 34 kDa protein of the present invention in addition to the 32 kDa protein.

  Based on the 5 'and 3' terminal nucleotide sequences of this 34 kDa protein gene, 34 kDa F1 oligonucleotide (GGTGGATCATATGGCGATTAT: SEQ ID NO: 9) and 34 kDa R1 oligonucleotide (CTAGCTCGAGCTGAAGAGATACCACAGGGTCAA: SEQ ID NO: 10) were designed. PCR was performed using the two oligonucleotides using pSHAN32.1 as a template. As a result, a nucleotide sequence of a 34 kDa protein with a restriction enzyme NdeI added at the 5 'end and a restriction enzyme XhoI added at the 3' end was obtained as a PCR product. This PCR product was then treated with restriction enzymes NdeI and XhoI and inserted into the expression vector pET30a (+) (Stratagene, La Jolla, Calif.) Treated with the same restriction enzymes, resulting in plasmid pSHAN34.2. This plasmid pSHAN34.2 was then transformed into E. coli BL21 (Stratagene, La Jolla, Calif.) To obtain the E. coli BL21 (pSHAN34.2) strain.

Example 3 [Preparation of 34 kDa protein from transformants]
The E. coli strain obtained in Example 2 was planted in LB medium and cultured overnight at 37 ° C. with shaking. The cells were collected by centrifugation at 8,000 × g for 15 minutes and frozen at −20 ° C. E. coli collected and frozen is dispersed in 10 mL of lysate (50 mM Tris-HCl (pH 8), 25% Sucrose, 1 mM EDTA), 0.5 mL of 10 mg / mL lysozyme is added and left at room temperature for 30 minutes. The mixture was treated with a crusher for 3 minutes, 10 mL of a surfactant solution (0.2 M NaCl, 1% sodium deoxycholate, 1% Nonidet P-40) was added and left at room temperature for 30 minutes. When this was centrifuged at 8,000 × g for 30 minutes, inclusion bodies containing the target protein could be recovered. The procedure of washing with 20 mL of 1% TritonX-100 and 1 mM EDTA solution and centrifuging at 8,000 × g for 15 minutes was repeated twice and washed with distilled water three times. The inclusion body containing the target protein thus obtained was solubilized at 37 ° C. for 1 hour by adding 240 μl of an alkaline buffer consisting of 50 mM Na ₂ CO ₃ (pH 10.8), 10 mM DTT and 1 mM EDTA. Next, the supernatant containing the target protein was recovered by centrifugation.

Example 4 [Preparation of activated protein from 34 kDa protein]
The supernatant obtained in Example 3 was passed through a 0.45 μm filter, the insoluble material was filtered, adjusted to pH 9.2 with 1N hydrochloric acid, and 1 mg / ml proteinase K to a final concentration of 30 μg / ml. (Wako Pure Chemicals; lot number PAQ7953) was added and incubated at 37 ° C for 1.5 hours. Thereafter, 100 mM PMSF was added to a final concentration of 1 mM to stop proteinase K processing. The pH of the solution was returned to near neutral with 1N HCl and sterilized by filtration through a filter to obtain an activated protein solution.

Example 5 [SDS-PAGE electrophoresis and Western blotting]
In order to examine the proteins expressed by the Escherichia coli BL21 (pSHAN34.2) strain obtained in Example 2, the profiles of the proteins produced by the Escherichia coli strain were compared before and after the proteinase K treatment.
(1) SDS-PAGE electrophoresis
SDS-PAGE electrophoresis was performed using 15% electrophoresis gel and 4% concentrated gel. The molecular weight markers used were Bio-Rad (250, 150, 100, 75, 50, 37, 25, 15 and 10 kDa), and the protein solution obtained in Example 3 and the activated protein solution obtained in Example 4 were used. Was run. The results are shown in FIG. 1 (Std: molecular weight marker; lane 1: before proteinase K treatment; lane 2: after proteinase K treatment).

(2) Western blotting Furthermore, Western blotting was performed on the protein after proteinase K treatment. The electrophoresed protein is transferred to a PVDF membrane (Bio-Rad, Hercules, CA, USA), and the primary antibody (prepared using the activated purified protein obtained in Example 1) and the secondary antibody (alkaline phosphatase label) The active protein was detected using anti-rabbit IgG).

  From the above results, it can be seen that the E. coli BL21 (pSHAN34.2) strain produces a protein having the same molecular weight (34 kDa) as the BTA1470 strain, and that the obtained 34 kDa protein is solubilized with an alkaline buffer, and then proteinase. It was revealed that after treatment with K, an active 26 kDa protein was produced in the same manner as BTA1470 strain.

Example 6 [Preparation of cultured cells]
Various cell lines were cultured under the conditions shown in Table 1, and 90 μl of each cultured cell was dispensed into a 96-well multiwell plate at a concentration of 2.2 × 10 ⁵ cells / ml. Cells were cultured in this 96-well multiwell plate for an additional 24 hours and then used for testing.

Example 7 [Measurement of cytotoxic effect on various cancer cells]
The cytotoxic activity of the 26 kDa protein derived from the E. coli recombinant strain was measured by the cell viability by the MTT method, and the EC ₅₀ was calculated. First, an active 26 kDa protein prepared by the method described in Example 4 was obtained. Next, 26 kDa protein was added to the cultured cells in each well of the 96-well multititer plate so that the final concentration was from 2 μg / ml to 1/2 dilution. Cell viability was measured 20 hours after protein addition. The cell viability was measured by the MTT method using a commercially available CellTiter96 ^™ reagent (manufactured by Promega Corporation). The EC ₅₀ calculation results are shown in Table 2. In addition, cell survival curves of CACO-2 cells and Sawano cells, in which the present protein showed particularly high cytotoxic activity, are shown in FIGS. 2 and 3, respectively. Further, FIG. 4 shows a cell survival curve for HC cells in which this protein hardly showed cytotoxic activity.

  From the results shown in Table 2, it was revealed that the 26 kDa protein of the present invention specifically recognizes specific cells, particularly specific human cancer cells, and exhibits selective cytotoxicity.

  The present invention provides novel proteins and precursor proteins thereof that have selective cell recognition and cytotoxic activity against specific cells. The active protein of the present invention is particularly useful as an anticancer agent that attacks a specific cancer because it selectively shows cytotoxic activity against specific cells, particularly specific human cancer cells.

The result of SDS-PAGE electrophoresis before and after proteinase K treatment of the protein derived from Bacillus thuringiensis A1470 strain of the present invention is shown.

The cell survival curve by MTT method of the CACO-2 cell after processing with the active protein of this invention is shown.

The cell survival curve by MTT method of the Sawano cell after processing with the active protein of this invention is shown.

The cell survival curve by MTT method of the HC cell after processing with the active protein of this invention is shown.

Claims (20)

  A precursor protein of a protein having cell recognition and cytotoxic activity, derived from Bacillus thuringiensis A1470 strain, having a molecular weight of 34 kDa and having an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 1. A precursor of a protein having cell recognition and cytotoxic activity having the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence in which one to several amino acids are deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 2 protein.   The precursor protein according to claim 1 or 2, wherein Bacillus thuringiensis A1470 strain is deposited at the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center under the accession number FERM BP-8344.   The precursor protein according to any one of claims 1 to 3, which is obtained by a gene recombination technique. A protein having cell recognition and cytotoxic activity, having the amino acid sequence shown in SEQ ID NO: 4 or an amino acid sequence in which one to several amino acids are deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 4 . The molecular weight is 26 kDa. The protein according to 1. The protein according to claim 5 or 6 , which is obtained by cleaving a C-terminal fragment from the precursor protein according to any one of claims 1 to 4 . Cell recognition and cytotoxicity is specific for leukemic cells, hepatoma cells, at least one cell is selected from the group consisting of uterine cancer and colon cancer cells, according to any one of claims 5 to 7 Protein.   DNA encoding the precursor protein according to any one of claims 1 to 4. The DNA according to claim 9 , which has the nucleotide sequence shown in SEQ ID NO: 1. A precursor of a protein that hybridizes under conditions that allow hybridization of DNA having a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1 and DNA having 90% or more homology, and having cell recognition and cytotoxic activity encoding in body protein, DNA. DNA encoding the protein according to any one of claims 5 to 8 . The DNA according to claim 12 , which has the nucleotide sequence shown in SEQ ID NO: 3. A protein that hybridizes under conditions where DNA having a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 3 and DNA having 90% or more homology can hybridize and has cell recognition and cytotoxic activity to, DNA. The DNA according to any one of claims 9 to 14 , which is derived from Bacillus thuringiensis A1470 strain. The DNA according to claim 15 , wherein Bacillus thuringiensis A1470 strain is deposited at the Patent Organism Depositary of the National Institute of Advanced Industrial Science and Technology under the accession number FERM BP-8344. A recombinant vector comprising the DNA according to any one of claims 9 to 16 . A host cell comprising the recombinant vector according to claim 17 . A pharmaceutical composition comprising a protein according to any one of claims 5 to 8. Anticancer agent comprising a protein according to any one of claims 5 to 8.

Images