JP4224395B2 - PanCAM nucleic acids and polypeptides - Google Patents

Description

(Related application)
This application claims priority from PCT / US01 / 19904 filed June 22, 2001, which is from US Provisional Patent Application No. 60 / 213,611 filed June 22, 2000. Claim priority. Both the disclosures of PCT applications and provisional patent applications are hereby incorporated by reference in their entirety.

(Field of Invention)
The present invention relates generally to the field of molecular biology. More particularly, the present invention relates to members of the immunoglobulin superfamily.

(Background of the Invention)
Many proteins have been classified into superfamilies based on conserved structural motifs and biological functions. A superfamily is broadly defined as a group of proteins that share a certain degree of sequence homology (usually at least 15%). Conserved sequences shared by superfamily members often contribute to the formation of compact tertiary structures called domains, and the entire sequence of domains that often characterize a particular superfamily is encoded by a single exon ( (See, for example, Abbas et al., CELLULAR AND MOLECULAR IMMUNOLOGY, WB Saunders Co., Philadelphia, PA. 1997). Superfamily members appear to be derived from a common precursor gene by branching evolution, and multidomain proteins can belong to one more superfamily. Examples of protein superfamily include: ligand-gated ion channel receptor superfamily, voltage-gated ion channel receptor superfamily, receptor tyrosine kinase superfamily, receptor protein tyrosine phosphatase superfamily, G protein coupled receptor superfamily And the immunoglobulin (Ig) superfamily.

  This Ig superfamily includes proteins that share partial amino acid sequence homology and tertiary structural features that were originally identical in Ig heavy and light chains. A common structural motif of the Ig superfamily is the so-called “Ig domain”. The Ig domain is a three-dimensional spherical structure having about 70 to 110 amino acid residues and an internal Cys-Cys disulfide bond. These domains comprise two layers of β-pleated sheets, each layer being composed of 3-5 antiparallel chains of 5-10 amino acid residues. Ig domains are classified as V-like or C-like based on the nearest homology to either the IgV or IgC domain. For a general view, see, for example, Abbas et al., Supra.

  The most identified member of the Ig superfamily is an integral plasma membrane protein (usually without intrinsic enzyme activity) that has an Ig domain in the extracellular part and the widely branched cytoplasmic tail. One repetitive property of Ig superfamily members is that interactions between Ig domains in different polypeptide chains (of the same or different amino acid sequences) are essential for the biological activity of this molecule. Heterophilic interactions can also occur between Ig domains in totally distinct molecules that are expressed on the surface of different cells. Such an interaction provides an adhesive force that stabilizes the cell-cell bond.

  Many members of the Ig superfamily are cell surface or soluble molecules that mediate cell recognition, adhesion and binding functions in the vertebrate immune system. Two prominent cell types that produce Ig superfamily molecules are B lymphocytes and T lymphocytes. Exemplary Ig superfamily member proteins important in the immune system include: antibodies, T cell receptors, major histocompatibility complex (MHC) class I molecules and major histocompatibility complex class II molecules, CD2, CD3, CD4, CD5, CD8, CD28, CD20 (B1), CD32 (FcgRII), CD44, CD54 (ICAM-1), CD80 (B7-1), CD86 (B7-2), CD90 (Thy-1) ), CD102 (ICAM-2), CD106 (VCAM-1), CD121 (IL-1R), CD152 (CTLA-4), p-IgR, NCAM, and CD140 (PDGFR) (Abbas et al., Supra).

  Some Ig superfamily members have been identified outside the immune system (eg, nervous system). Based on these conserved structural motifs and the well-known functions of such motifs in the immune system, these Ig superfamily members appear to perform cell recognition, binding and adhesion functions in non-immune tissues as well. is there. Novel Ig superfamily members that are localized to specific cell types are useful cell and tissue markers for diagnostic purposes. Tissue-specific Ig superfamily members also have abnormalities associated with inappropriate cell-cell adhesion and signal transduction in tissues, particularly during tissue development or during tissue regeneration (eg, after tissue injury or after tissue injury). Suitable therapeutic target for the treatment of various conditions, disorders and / or diseases.

(Summary of the Invention)
The present invention is based, at least in part, on the discovery of a gene encoding a previously unknown Ig superfamily member (referred to as GP354). Unless indicated otherwise, the name gp354 in the following cases refers to the novel nucleic acid of the present invention, whereas the name GP354 in the above case refers to the novel polypeptide of the present invention. .

  GP354 is an integral membrane protein expressed primarily in the pancreas. This protein, also called PanCAM, is a pancreatic cell adhesion molecule. In the pancreas, GP354 (ie PanCAM) expression is localized to β cells. GP354 is also detected at low levels in the central nervous system (CNS) (eg, the brain). GP354 has a predicted single membrane span domain and five extracellular Ig domains. Human GP354 shares approximately 44% identity with the 494 amino acid fragment of human NEPH1, and 47% amino acid identity with the 368 amino acid fragment of mouse NEPH1. Both fragments are present in the extracellular portion of NEPH1. GP354 appears to play a role in cell-cell interactions (eg, adhesion) in the pancreas and CNS, affecting the structure and function of those organs.

  The present invention provides an isolated polynucleotide encoding a vertebrate GP354 (eg, a mammal (eg, human or mouse)) or a biologically active portion thereof. The present invention also provides polynucleotide fragments suitable for use as primers or hybridization probes for the detection of polynucleotides encoding GP354. Although this disclosure illustrates specific GP354 or gp354 sequences, all allelic variants (eg, polymorphisms) of these sequences are included in the present invention.

  In some embodiments, the present invention provides an isolated human GP354 polypeptide comprising amino acid residues 68-594 of SEQ ID NO: 12. Such an isolated polypeptide can comprise SEQ ID NO: 12, SEQ ID NO: 26, SEQ ID NO: 28, or SEQ ID NO: 8. The polypeptide can further comprise a heterologous sequence. The present invention also provides an isolated murine PanCAM polypeptide comprising SEQ ID NO: 31.

  The present invention also provides an isolated polypeptide comprising the extracellular domain of the PanCAM protein, wherein the isolated polypeptide is, for example, amino acid residues 4 to 513 of SEQ ID NO: 8; or at least 10 amino acids (Eg, 25 or 50) including that portion having residues. The polypeptide can be used to induce PanCAM specific antibodies or can be used as a PanCAM modulator.

  The present invention also provides an isolated polypeptide comprising the intracellular domain of the PanCAM protein, wherein the isolated polypeptide includes, for example, amino acid residues 535-708 of SEQ ID NO: 8 or the amino acid residue of SEQ ID NO: 26. Including groups 535-633 or portions thereof having at least 10 amino acid (eg, 25 or 50) residues. The polypeptide can bind to a heterologous extracellular domain so as to form a hybrid molecule. This hybrid molecule can transduce PanCAM-like intracellular signals by stimulation of non-PanCAM extracellular domains.

  The present invention provides an isolated polynucleotide comprising a nucleotide sequence encoding the isolated polypeptide described above. Exemplary isolated polynucleotides include a portion (eg, nucleotides 202-1782) or all of SEQ ID NO: 11; a portion (eg, nucleotides 196-2319) or all of SEQ ID NO: 7; A polynucleotide comprising a part or all of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 25, SEQ ID NO: 27, and SEQ ID NO: 32. In some embodiments, the polynucleotide further comprises a transcriptional regulatory sequence operably linked to the nucleotide sequence described above.

  Also included in the present invention are vectors containing these isolated polynucleotides. This vector can be a plasmid vector or a viral vector derived from the following viruses: baculovirus; adenovirus; parvovirus; herpes virus; poxvirus; adeno-associated virus; Semliki Forest virus; vaccinia virus; Retro virus.

  The present invention also includes host cells harboring the isolated polynucleotide of the present invention. The host cell can be, for example, a bacterial cell, an insect cell, a yeast cell, a plant cell or a mammalian cell (eg, a mouse cell or a human cell). In some embodiments, these host cells can be used to produce PanCAM polypeptides. To do this, the host cell is cultured under conditions in which the PanCAM coding sequence is expressed, and the polypeptide is recovered from the cell or culture medium.

  The invention also features an antibody that specifically binds to the PanCAM protein. The antibody can be a complete antibody or a fragment thereof (eg, Fab fragment, F (ab ') 2 fragment). They can also be single chain antibodies, chimeric antibodies, humanized antibodies and fully human antibodies.

  The invention also features a method of isolating beta cells from a dispersed pancreatic cell population (eg, a bovine pancreatic cell population or a porcine pancreatic cell population). The method comprises the steps of: providing an antibody specific for the PanCAM protein; and dispersing the pancreatic cell population and antibody under conditions that allow β cells in the population to bind to the antibody. Contacting; and separating the cells not bound by the antibody from the β cells bound to the antibody, thereby isolating the β cells.

  Beta cells isolated in this way can be used to treat humans who exhibit signs or symptoms of diabetes or pre-diabetes. This method of treatment involves introducing isolated beta cells into a human (eg, subcutaneously). The beta cells can be encapsulated in a biologically acceptable carrier, such as an alginate sphere (see Ryu et al., J. Clin. Invest. 2001, 108 (1): 31-3. ).

  The invention further includes SEQ ID NO: 2 (encoded by the putative gp354 cDNA); SEQ ID NO: 4 (encoded by the partial gp354 pancreatic cDNA); SEQ ID NO: 8 (encoded by the derived gp354 cDNA); SEQ ID NO: 10 (Encoded by partially derived gp354 cDNA); or SEQ ID NO: 12 (insert of plasmid FL86-3, encoded by gp354 pancreatic cDNA, this is the American Type Culture Collection (ATCC) on June 11, 2002) Or at least 80% (85%, 95%, or 98%) identical to at least one Ig domain of any one of SEQ ID NOs: 2, 4, 8, 10, and 12 Amino acids And wherein the polynucleotide comprising a nucleotide sequence encoding a protein comprising a sequence.

  In some embodiments, the polynucleotide comprises the sequence of SEQ ID NO: 1 (gp354 cDNA), or a fragment thereof having at least 17 nucleic acid units (eg, nucleotides). An example of such a fragment is SEQ ID NO: 3. In another embodiment, the polynucleotide comprises the sequence of SEQ ID NO: 5 (genomic DNA comprising gp354), or a fragment thereof having at least 17 nucleic acid units. An exemplary fragment is the fragment of SEQ ID NO: 6 (gp354 upstream genomic DNA). In other embodiments, the polynucleotide comprises the sequence of SEQ ID NO: 7 (derived gp354 cDNA), or a fragment thereof having at least 17 nucleic acid units. An exemplary fragment is SEQ ID NO: 9 (C-terminal fragment of derived gp354 cDNA). In other embodiments, the polynucleotide comprises the sequence of SEQ ID NO: 11 (pancreatic gp354 cDNA), or a fragment thereof having at least 17 nucleic acid units. Preferred fragments encode at least one extracellular Ig domain and / or part or all of the intracellular domain of GP354.

  The invention also provides a polynucleotide encoding a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2. Here, this nucleic acid hybridizes to SEQ ID NO: 1 or SEQ ID NO: 11 under stringent conditions. The present invention also provides a polynucleotide encoding a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO: 4, 8, 10, or 12. Here, this nucleic acid hybridizes to SEQ ID NO: 1 or SEQ ID NO: 11 under stringent conditions.

  An amino acid sequence of SEQ ID NO: 2, 4, 8, 10, or 12; or an amino acid that is at least 80% (85%, 95%, or 98%) identical to an Ig domain encoded by any one of those sequences An isolated GP354 protein comprising is also provided by the present invention.

  The invention also provides at least about 65%, preferably 75% with a portion of SEQ ID NO: 1, 3, 5, 7, 9, or 11; or any one of those sequences encoding at least one Ig domain. An isolated GP354 protein encoded by a polynucleotide comprising a sequence that is 85% or 95% identical is provided. Also provided is an isolated GP354 protein encoded by a polynucleotide having a sequence that hybridizes under stringent conditions to a nucleic acid having the sequence of SEQ ID NO: 1 or 11.

  The present invention provides gp354 polynucleotides that specifically detect gp354 nucleic acids relative to nucleic acids encoding other members of the Ig superfamily. The invention also provides nucleic acid constructs (eg, recombinant vectors (eg, cloning vectors, targeting vectors, or expression vectors)) comprising the gp354 polynucleotides of the invention.

  Isolated or recombinant GP354 proteins and polypeptides are provided by the present invention. In some embodiments, GP354 proteins and polypeptides exhibit at least one of the following (overlapping) biological activities: (1) ligands that naturally bind to GP354 protein (eg, protein receptors, polysaccharides, etc.) (2) binding to an autoantibody against naturally occurring human GP354 or an antibody raised against naturally occurring human GP354; (3) pancreatic function (eg Involvement in the signal transduction function in the pancreas or stages in organ development of the pancreas); (4) involvement in neural functions (eg, signal transduction functions in the nervous system or stages in development of the nervous system); and (5) intercellular interactions Mediating actions (eg recognition, binding and / or adhesion).

  The GP354 protein or biologically active portion thereof is a non-GP354 polypeptide (eg, a heterologous amino acid sequence (eg, a sequence that facilitates protein stability, detection, purification, or in vivo delivery to a target cell)). Operably linked to form a GP354 fusion protein.

  The present invention provides a pharmaceutical composition comprising at least one gp354 related isolated polynucleotide, GP354 protein or biologically active portion thereof, antibody or fusion protein. The composition optionally includes a pharmaceutically acceptable carrier. Such compositions are useful in therapeutic methods for alleviating a condition in a subject suffering from abnormal GP354 cell localization, expression, and / or activity.

  Accordingly, the present invention also provides a method of treatment comprising administering a gp354 related compound or composition of the present invention. Such methods are useful, for example, for treating abnormal conditions, disorders or diseases that correlate with cellular recognition, binding, signaling and adhesion functions in the developing or adult pancreas and central nervous system.

  As a protein enriched in the pancreas, GP354 is in the developing and adult pancreas, especially during tissue development and after tissue regeneration and / or healing (eg after pancreatic injury, trauma or degenerative conditions). Are suitable therapeutic targets for treating abnormal conditions, disorders and / or diseases associated with inappropriate cell-cell binding, adhesion and signaling during It is also contemplated that GP354 is a suitable therapeutic target for inhibiting pancreatic cell death associated with immune, autoimmune, and degenerative conditions, including type I and type II diabetes. The The neural form of GP354 is also a suitable therapeutic target for treating tissue abnormalities in the central nervous system, for tissue regeneration and repair, and to inhibit tissue degeneration and cell death. GP354-related compositions can also be used to treat diseases in the pituitary gland (eg, pituitary hormone deficiency, growth hormone deficiency, and pituitary tumors).

  The present invention provides a method for modulating GP354 activity. In this method, the target cell is contacted with an agent that modulates (eg, inhibits or stimulates) the activity or expression of GP354, such that the activity or expression of GP354 is altered. In some embodiments, the agent is an antibody that specifically binds to GP354. In other embodiments, the agent modulates GP354 activity or expression by modulating gp354 gene transcription, gp354 RNA splicing, or gp354 mRNA translation. In still other embodiments, the agent is a nucleic acid having a sequence that is antisense to the coding strand of gp354 mRNA or the gp354 gene. In other embodiments, the agent can be a GP354 protein, a nucleic acid encoding the GP354 protein, or an antagonist or agonist of a GP354 protein (eg, a peptide, peptidomimetic, or other small molecule).

  The invention also provides a method for identifying a compound that binds to GP354 protein. In another aspect, the invention provides a method for identifying a compound that modulates the biological activity of a GP354 protein, the method comprising the biological of the protein in the presence and absence of a test compound. Measuring activity or expression, and identifying a compound that alters the activity of the protein. Combination libraries can be used as a source of candidate compounds in these methods.

  The present invention provides a method for detecting the presence of a gp354 polynucleotide, GP354 protein or activity thereof in a biological sample (eg, a fluid or tissue sample from a patient), the method comprising: By contacting the gp354 polynucleotide sequence, GP354 protein or an agent capable of detecting the presence of its activity.

  A diagnostic assay is provided for identifying the presence or absence of a genetic lesion or mutation associated with gp354, wherein the lesion or mutation is characterized by at least one of the following: (i) a gene encoding a GP354 protein (Ii) misregulation of a gene encoding the GP354 protein (eg, transcription, splicing or translation); and (iii) an abnormal post-translational modification or localization of the GP354 protein; where the gene The wild-type form of encodes a protein having the biological activity of GP354.

  The present invention provides non-human animals (eg, mammals such as mice, rats, guinea pigs, sheep, goats, horses or cows) in which at least some of the cells contain an isolated polynucleotide of the present invention. Such an animal can be chimeric if only some of its somatic cells and / or germ cells carry the polynucleotide. Alternatively, such an animal can be transgenic if all of its somatic cells and germ cells carry this polynucleotide.

  The present invention also provides non-human animals in which the endogenous ortholog of the gp354 gene has been disrupted (ie, “knocked out”) by the gene target. Biological samples such as cells, tissues and fluids containing gp354 polynucleotides, and GP354 related products from these and the aforementioned animals are also within the scope of the present invention.

  The present invention provides computer readable means for storing the nucleic acid and amino acid sequences of the present invention. This computer readable record can be accessed for reading and displaying the sequences and for comparing, aligning and aligning the sequences of the present invention with other sequences.

  Other features and advantages of the invention will be apparent from the following detailed description, drawings, and claims.

(Detailed description of the invention)
The present invention is based at least in part on the discovery of a novel human gene that encodes a previously unknown protein, GP354 (ie, PanCAM). This gene (gp354) was identified by computer analysis of the public (“mining”) published nucleic acid sequence of the human genome. The gp354 gene contains at least 14 exons and is usually present on human chromosome 19. The mRNA transcribed from this gene has an open reading frame of 1779 base pairs (including the stop codon) and encodes a protein predicted to be 592 amino acid residues. This novel GP354 protein is specifically expressed in the pancreas and brain.

(Definition)
As used herein, “nucleic acid” (also referred to as “polynucleotide”) includes DNA molecules (eg, cDNA or genomic DNA or synthetic DNA) and RNA molecules (eg, mRNA). The term is also intended to include DNA analogs or analogs of RNA, including non-natural nucleotide analogs, non-natural internucleoside linkages, or both. The nucleic acid can be any topological structure. For example, the nucleic acid can be single stranded, double stranded, triple stranded, four stranded, partially double stranded, branched, hairpin, circular, or padlocked. For example, Baner et al., Curr. Opin. Biotechnol. 12: 11-15 (2001); Escude et al., Proc. Natl. Acad. Sci. USA 14; 96 (19): 10603-7 (1999); Nilsson et al., Science 265 (5181): 2085-8 (1994); Praseth et al., Biochim. Biophys. Acta. 1489 (1): 181-206 (1999); Fox, Curr. Med. Chem. 7 (1): 17-37 (2000); Kochetkova et al., Methods Mol. Biol. 130: 189-201 (2000); Chan et al., J. MoI. Mol. Med. 75 (4): 267-82 (1997).

  As used herein, an “isolated nucleic acid” (also referred to as an “isolated polynucleotide”) is a nucleic acid that is separated from other nucleic acid molecules present in the natural source of the nucleic acid. It is. In particular, isolated, non-recombinant natural chromosomes and fragments over 500 kb thereof are excluded. Preferably, an “isolated” nucleic acid is substantially free of sequences that naturally flank the nucleic acid in the genome of the organism from which the nucleic acid is derived. For example, a preferred isolated gp354 nucleic acid is about 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0 naturally adjacent to the nucleic acid in the genomic DNA of the cell from which the isolated nucleic acid is derived. Adjacent to a nucleotide sequence of less than 1 kb. Even more preferably, the isolated polynucleotide is 5000 base pairs or less, often 1000 base pairs or less, 500 base pairs or less, 100 base pairs or less, or 50 base pairs or less.

  However, “isolated” does not necessarily require that the nucleic acid so described or the polynucleotide itself be physically removed from its natural environment. For example, an endogenous nucleic acid sequence in the genome of an organism has a heterologous sequence (ie, a sequence that is not naturally adjacent to the endogenous nucleic acid sequence) placed adjacent to the endogenous nucleic acid sequence, An expression is considered “isolated” herein if it changes. As an example, a non-native promoter sequence can be replaced in the genome of a human cell (eg, by homologous recombination) in place of the native promoter of the gp354 gene so that the gene exhibits altered expression patterns. Have. This gene is now “isolated” because it has been separated from at least some of the naturally-occurring sequences.

  A nucleic acid is also considered “isolated” if the corresponding nucleic acid contains any modifications that do not naturally occur in the genome. For example, an endogenous gp354 coding sequence is considered “isolated” if it contains an insertion, deletion or point mutation introduced artificially, eg, by human intervention. An “isolated nucleic acid” also includes nucleic acids that are integrated at heterologous sites in the host cell chromosome, nucleic acid constructs that exist as episomes, and nucleic acid constructs that are integrated into the host cell chromosome. In addition, an “isolated nucleic acid” can be substantially free of other cellular material or substantially free of culture medium when produced by recombinant techniques. Alternatively, it may be substantially free of chemical precursors or other chemicals when chemically synthesized.

  A polynucleotide of the present invention is considered "full length" if it can encode the full length GP354 protein.

  As used herein, the phrase "degenerate variant" of a reference nucleic acid sequence is an amino acid sequence that is translated according to the standard genetic code and identical to the sequence translated from that reference nucleic acid sequence Including a nucleic acid sequence.

  As used herein, the term “microarray” (also referred to as “nucleic acid microarray”) refers to a plurality of nucleic acids bound to a substrate, and hybridization to each of the bound nucleic acids can be detected individually. It is. The substrate can be in a solid or porous configuration, a planar or non-planar configuration, a single or dispersed configuration, or any other configuration.

  When so defined, the term “microarray” refers to Schena (eds.), DNA Microarrays: A Practical Approaches (Practical Appropriate Series), Oxford University Press (1999) (ISBN: 0996 etur. Get). 21 (1) (Appendix): 1-60 (1999); and Schena (eds.), Microarray Biochip: Tools and Technology, Eaton Publishing Company / BioTechnologies Books Div. (Procedure), Pron. Natl. Acad. Sci. USA 97 (4): 1665-1670 (2000) includes all devices so called or similarly called. The entire disclosures of these references are hereby incorporated by reference in their entirety.

  As used herein with respect to nucleic acid hybridization, the term “probe” (also referred to as a “nucleic acid probe” or “hybridization probe”) is either detectably labeled or is detectably labeled. An intended isolated nucleic acid of known sequence. As used herein with respect to nucleic acid microarrays, the term “probe” (equivalently, “nucleic acid probe” or “hybridization probe”) is bound to or bound to a substrate. An isolated nucleic acid intended as such. In any such situation, the term “target” refers to a nucleic acid that is intended to bind to a probe by sequence complementarity.

  Unless indicated otherwise, “a nucleic acid comprising SEQ ID NO: X” refers to a nucleic acid having at least a portion of either (i) the sequence of SEQ ID NO: X or (ii) a sequence complementary to SEQ ID NO: X. . The choice between the two is defined by the situation. For example, if a nucleic acid is used as a probe, the choice between the two is defined by the requirement that the probe be complementary to the desired target.

  For purposes herein, “high stringency conditions” are defined as 6 × SSC at 65 ° C. (where 20 × SSC is 3.0 M NaCl and 0.1. Aqueous (ie, no formaldehyde) hybridization was performed in 1% SDS for 8-12 hours followed by 0.2 × SSC at 65 ° C., 20% with 0.1% SDS. It is defined as washing twice for a minute. It will be appreciated by those skilled in the art that hybridization at 65 ° C. occurs at different rates depending on a number of factors, including the length of the hybridizing sequence and the percent identity.

  For microarray-based hybridization, standard “high stringency conditions” are 50% formaldehyde, 5 × SSC, 0.2 μg / μl poly (dA), 0.2 μg / μl human in a humidified oven at 42 ° C. overnight hybridization in cot1 DNA and 0.5% SDS, followed by 1 × SSC at 55 ° C., 5 minutes in 0.2% SDS, then 0.1 × SSC, 0.2 at 55 ° C. Defined as a continuous wash of the microarray in% SDS for 20 minutes. For microarray-based hybridization, “moderate stringency conditions” are suitable for cross-hybridization to mRNAs that encode structurally and functionally related proteins and are the same as those for high stringency conditions However, it is prescribed that the temperature of hybridization is lowered and washing is performed at room temperature (about 25 ° C.).

  As used herein, the terms “protein”, “polypeptide” and “peptide” are used interchangeably to denote a polymer of naturally occurring or synthesized amino acids, regardless of length. Here, amino acids herein include naturally occurring amino acids, structural variants of naturally occurring amino acids, and synthetic non-naturally occurring analogs that can participate in peptide bonds. The terms “protein”, “polypeptide” and “peptide” expressly permit post-translational and post-synthesis modifications such as N-terminal or C-terminal amino acid cleavage reactions and glycosylation. As used herein, the term “oligopeptide” refers to a protein, polypeptide or peptide having 25 or fewer amino acid residues.

  A protein, polypeptide, peptide or oligopeptide is encoded by an isolated polynucleotide; if present in a purity not found in nature (where purity is determined with respect to the presence of other cellular material) And / or amino acid analogs or amino acid derivatives not found in nature, or linkages other than standard peptide bonds are considered “isolated”. “Isolated” as so defined does not necessarily require that the protein, polypeptide, peptide or oligopeptide so described be physically removed from the natural environment.

  A protein, polypeptide, peptide or oligopeptide is present at a concentration of at least 65% (eg, at least 75%, 85% or 95%) (measured based on mass for total protein in the composition) Are considered “purified” herein. A “substantially purified” is considered when the concentration is at least 85%.

  As used herein, the term “homolog” (also referred to as “homologue”) includes “ortholog” and “paralog”. An “ortholog” is a distinct presence of the same gene in different species. This separate entity has a similar or identical amino acid sequence, where the degree of sequence similarity depends in part on the evolutionary distance of the species from a common ancestor having that same gene . “Paralog” refers to the discrete presence of one gene in one species. This separate entity has a similar or identical amino acid sequence, where the degree of sequence similarity is partially related to the evolutionary distance of these separate entities from the gene replication event that results in this presence. Depends on.

  A “homologous” amino acid sequence comprises an amino acid sequence that includes conservative amino acid substitutions, wherein the polypeptides have substantially the same binding and / or activity. However, homologous amino acid sequences do not include amino acid sequences encoding other known Ig superfamily members. Homology (% identity) can be determined, for example, by the GAP program using the default settings (Wisconsin Sequence Analysis Package, Version 8 for Unix®, Genetics Computer Group, University Research, I). The GAP program uses the algorithm of Smith and Waterman (Adv. Appl. Math., 2: 482-489 (1981), which is incorporated herein by reference in its entirety)).

As used herein, the term “antibody” refers to a complete antibody (consisting of two heavy chains and two light chains) or a fragment thereof. Such fragments include, but are not limited to, as long as the fragment can specifically bind to the antigen: fragments generated by digestion with various proteases, chemical cleavage and / or chemical dissociation As well as fragments produced recombinantly. These fragments include Fab fragments, Fab ′ fragments, F (ab ′) ₂ fragments and single chain Fv (scFv) fragments.

  Also within the scope of the term “antibody” are antibodies that have been altered in sequence but are capable of specifically binding to an antigen. Examples of engineered antibodies are interspecies chimeric and humanized antibodies; antibody fusions; and heteromeric antibody complexes (eg, diabodies (bispecific antibodies), single chain diabodies and intrabodies). (Eg, Marasco (eds.), Intracellular Antibodies: Research and Disease Applications, Springer-Verlag New York, Inc. (1998) (ISBN: 3540415513), the disclosure of which is incorporated herein by reference in its entirety. )checking).

“Specific binding” refers to the ability of two molecules to bind to each other in preference to binding to other molecules in the environment. Typically, “specific binding” distinguishes at least 2-fold, more typically at least 10-fold, often at least 100-fold, from accidental binding during the reaction. Typically, the affinity or avidity of a specific binding reaction is at least about 10 ⁻⁷ M (eg, at least about 10 ⁻⁸ M or 10 ⁻⁹ M).

  The term “region” means a physically continuous location of the primary structure of a biomolecule. In the case of a protein, a region is defined by consecutive positions in the amino acid sequence of the protein.

  The term “domain” refers to the structure of a biomolecule that contributes to a known or suspected function of the biomolecule. Domains can be coextensive with those regions or portions thereof; domains can also include different non-contiguous regions of biomolecules. Examples of GP354 protein domains include, but are not limited to, an extracellular Ig domain (ie, N-terminus), a transmembrane domain, and a cytoplasmic domain (ie, C-terminus).

  As used herein, the term “compound” means any molecule, including but not limited to small molecules, peptides, proteins, sugars, nucleotides, nucleic acids, lipids, etc. Can be natural or synthetic.

  Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Exemplary methods and materials are described below, but methods and materials similar or equivalent to the methods and materials described herein can also be used in the practice of the present invention, and It will be obvious to those skilled in the art. All publications and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. These materials, methods and examples are illustrative only and are not intended to be limiting.

  Standard references showing the general principles of recombinant DNA technology known to those skilled in the art include the following: Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York (supplement to 1998 and 2001). Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition, Cold Spring Harbor Laboratory Press, Plainview, New York (L) Raton (1995); McPherson, eds., DIRECTED MUTAGENESIS: A PRACTICAL APPROACH, IRL Press, Oxford (1991). Standard reference materials showing the general principles of immunology known to those skilled in the art include: Harlow and Lane, ANTIBODIES: A LABORARY MANUAL, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold. Spring Harbor, N.A. Y. (1999); and Roitt et al., IMMUNOLOGY, 3rd edition, Mosby-Year Book Europe Limited, London (1993). Standard references showing the general principles of medical physiology and pharmacology known to those skilled in the art include: Harrison's PRINCIPLES OF INTERNAL MEDICINE, 14th edition, (Anthony S. Fauci et al. Ed.), McGraw-Hill Companies, Inc. 1998.

(GP354-related nucleic acid)
The gp354 gene was identified in the BAC clone contig 38 with GenBank accession number AC022315 (which was registered on February 10, 2000). This deposit has the human genomic sequence of gp354 (FIG. 4 and SEQ ID NO: 5), which contains non-transcribed genomic sequences 5 ′ upstream (positions 1-6278) and 3 ′ downstream (16490-2050).

  The present invention provides an isolated polynucleotide encoding the entire GP354 protein. As noted above, such “full length” polynucleotides of the invention can be used to express a full length GP354 protein, among others. This full length polynucleotide can also be used as a nucleic acid probe (as a probe), and the isolated polynucleotides of these embodiments hybridize to gp354 polynucleotides and related polynucleotide sequences.

  In a preferred embodiment, the present invention provides an isolated polynucleotide comprising some or all of the following: (i) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 25, SEQ ID NO: 27 or SEQ ID NO: 32, (ii) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, A degenerate variant of the nucleotide sequence of SEQ ID NO: 11, SEQ ID NO: 25, SEQ ID NO: 27 or SEQ ID NO: 32, or the complement of (iii) (i) or (ii).

  SEQ ID NO: 1 shows the deduced gp354 cDNA sequence. SEQ ID NO: 3 shows an exemplary gp354 cDNA fragment resulting from RT-PCR. SEQ ID NO: 5 shows a genomic DNA sequence comprising a gp354 coding sequence, including a 5 'non-transcribed region and a 3' non-transcribed region. SEQ ID NO: 6 shows the genomic DNA sequence contained upstream of the non-coding region. SEQ ID NO: 7 shows the derived long form of the gp354 cDNA sequence. SEQ ID NO: 11 shows another exemplary pancreatic gp354 cDNA sequence. SEQ ID NO: 25 and SEQ ID NO: 27 show the coding sequences of PanCAM-1 and PanCAM-2, which are alternative splice variants of SEQ ID NO: 7, respectively.

  In other embodiments, the invention provides an isolated polynucleotide comprising: (i) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 26, A nucleotide sequence encoding a polypeptide having the amino acid sequence of SEQ ID NO: 28 or SEQ ID NO: 31, or (ii) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 26, SEQ ID NO: A complement of a nucleotide sequence encoding a polypeptide having the amino acid sequence of 28 or SEQ ID NO: 31.

  SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 26, SEQ ID NO: 28, and SEQ ID NO: 31 are SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 9, respectively. SEQ ID NO: 11, SEQ ID NO: 25, SEQ ID NO: 27 and SEQ ID NO: 32 show the amino acid sequence of GP354. For example, see FIGS.

  In other embodiments, the present invention provides an isolated polynucleotide having the following nucleotide sequence: (i) encoding a polypeptide having the sequence of SEQ ID NO: 2, SEQ ID NO: 8 or SEQ ID NO: 12; A nucleotide sequence, (ii) a nucleotide sequence encoding a polypeptide having the sequence of SEQ ID NO: 2, SEQ ID NO: 8 or SEQ ID NO: 12 with conservative amino acid substitutions, or the complement of (iii) (i) or (ii) A nucleotide sequence. Here, SEQ ID NO: 2 shows the amino acid sequence of GP354 encoded by the cDNA of SEQ ID NO: 1, SEQ ID NO: 8 shows the amino acid sequence of GP354 encoded by the sequences derived from SEQ ID NO: 5 and SEQ ID NO: 11, SEQ ID NO: 12 shows the amino acid sequence of GP354 encoded by the pancreatic cDNA of SEQ ID NO: 11.

(Nucleic acid encoding a part of GP354)
The invention also provides an isolated polynucleotide encoding a selected portion of GP354. As discussed further herein below, these “nucleic acid molecules” can be used to express a particular portion of GP354, for example, alone or as an element of a fusion protein. Nucleic acid fragments can also be used as region-specific nucleic acid probes.

  In a preferred embodiment, the present invention provides an isolated polynucleotide comprising: (i) a nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 6 or SEQ ID NO: 9, (ii) SEQ ID NO: 3, SEQ ID NO: 6 Or a degenerate variant of the nucleotide sequence of SEQ ID NO: 9, or the complement of (iii) (i) or (ii). SEQ ID NO: 3 shows a 785 base pair RT-PCR fragment derived from gp354 pancreatic RNA. SEQ ID NO: 6 shows the genomic sequence upstream from the gp354 coding sequence and SEQ ID NO: 9 shows a 1782 base pair RT-PCR fragment derived from gp354 pancreatic RNA.

  In other embodiments, the isolated polynucleotide, or complement thereof, has at least one, preferably 2, 3, 4, or Ig domains characteristic of the N-terminal extracellular portion of GP354. Encodes a polypeptide having five. Specifically, the five extracellular Ig domains are nucleotides 103 to 306, 406 to 609, 715 to 870, 967 to 1122, and 1228 to 1445 (see FIG. 1) of the gp354 cDNA sequence of SEQ ID NO: 1, respectively, and Encoded by nucleotides 307-510, 610-813, 919-1074, 1171-1326, and 1432-1659 (see FIG. 5) of the gp354 cDNA sequence of SEQ ID NO: 8, respectively. In preferred embodiments, the isolated polynucleotide encodes at least 1, preferably 3, more preferably 4, and most preferably all 5 domains in at least one copy.

  For some uses, such protein products, nucleic acid fragments (or their complements) include a sequence that encodes a signal secretion sequence that mediates transport of the encoded polypeptide across the membrane. Such signal secretion sequences are typically cleaved from the polypeptide when transport across the membrane occurs. The GP354 signal secretion sequence is encoded by nucleotides 1 to 54 of the gp354 cDNA sequence of SEQ ID NO: 1 (see FIG. 1) and nucleotides 1 to 57 of the gp354 cDNA of SEQ ID NO: 8 (see FIG. 5). More preferably, the signal secretion sequence of the isolated polynucleotide of the present invention is derived from gp354. Assuming that the signal sequence of GP354 is also cleaved during secretion, the mature GP354 polypeptide sequence is nucleotides 55-57 of SEQ ID NO: 1 (see FIG. 1) and nucleotide 259 of the gp354 cDNA of SEQ ID NO: 8. It has an N-terminal proline residue encoded by ~ 261 (see Figure 5).

  Another preferred embodiment of the polynucleotide of the present invention is a polynucleotide encoding a polypeptide having the transmembrane domain of GP354, or a complement thereof. The preferred isolated polynucleotides described above can optionally encode a transmembrane domain, for example, where insertion of the encoded polypeptide into the membrane is desired. This transmembrane domain can be encoded by the gp354 sequence or can be encoded by a heterologous gene that encodes the transmembrane domain of a heterologous membrane-associated protein. The gp354 transmembrane domain is encoded by nucleotides 1521 to 1590 of the gp354 cDNA sequence of SEQ ID NO: 1 (see FIG. 1) and nucleotides 1726 to 1794 of the gp354 cDNA of SEQ ID NO: 8 (see FIG. 5).

  If desired, the isolated polynucleotide of the present invention can contain a sequence encoding an intracellular C-terminal domain (or their complement), for example, where a specific signal response in response to GP354 binding interactions is desired. May be included. This intracellular domain can be encoded by gp354 (see below) or by a heterologous gene that encodes the intracellular domain of a heterologous membrane-associated protein. A preferred polynucleotide of the invention is a polynucleotide encoding a polypeptide having the (C-terminal) intracellular domain of GP354, or a complement thereof. Specifically, one intracellular domain of GP354 is encoded by nucleotides 1591 to 1776 (see FIG. 1) of the gp354 cDNA sequence of SEQ ID NO: 1. The longer form of the intracellular domain of GP354 is encoded by nucleotides 1795-2319 (see FIG. 5) of the gp354 cDNA sequence of SEQ ID NO: 8.

  One preferred isolated polynucleotide of the invention is shown in FIG. 3 (see SEQ ID NO: 3) and comprises nucleotides 139-923 (see FIG. 1) of the gp354 cDNA sequence of SEQ ID NO: 1. This polynucleotide comprises the sequence of an RT-PCR fragment that is amplified from pancreatic RNA using primers GX1-218 (SEQ ID NO: 16) and GX1-219 (SEQ ID NO: 17). See Example 2. This preferred isolated polynucleotide encodes amino acids 47-307 of SEQ ID NO: 2, ie, the polynucleotide comprises amino acids 13-68 of the first N-terminal Ig domain (ie, the first of the Ig domain). And the second and third Ig domains of GP354.

(Cross-hybridizing nucleic acid)
In another series of nucleic acid embodiments, the present invention provides isolated polynucleotides that hybridize to the various gp354 nucleic acids of the present invention. These “cross-hybridizing nucleic acids” drive, in particular, as probes for proteins related to the gp354 of the present invention (and also for isoforms, homologs, paralogs or orthologs) and the expression of these proteins. Can be used.

  In some such embodiments, the invention provides, under high stringency conditions, SEQ ID NO: 1, 5, 7, 9 or 11; the complement of SEQ ID NO: 1, 5, 7, 9 or 11; or at least An isolated polynucleotide comprising a sequence that hybridizes to a probe having a nucleotide sequence comprising fragments thereof having 17 nucleic acid units is provided.

(Preferred nucleic acid)
Nucleic acids (or their complements) expressed in pancreatic or neural tissue are particularly preferred among the above nucleic acids. Also particularly preferred among the above nucleic acids are nucleic acids encoding polypeptides having the biological activity of gp354 as described above (or their complements).

(Nucleic acid fragment)
In another series of nucleic acid embodiments, the present invention demonstrates utility, particularly as a region-specific nucleic acid probe, as an amplification primer, and for directing the expression or synthesis of epitope protein fragments or immunogenic protein fragments. Provided are fragments of the various isolated polynucleotides of the present invention.

  In some embodiments, the invention provides at least 17 nucleotides, at least 18 nucleotides, at least 20 nucleotides, at least 24 nucleotides, or at least 25 of a contiguous nucleic acid sequence selected from SEQ ID NOs: 1, 5, 7, 9 or 11. An isolated polynucleotide comprising a nucleotide is provided.

  In another embodiment, the invention provides (i) a nucleotide sequence encoding a polypeptide having a sequence of at least 8 consecutive amino acids of SEQ ID NO: 2, 4, 8, 10 or 12, (ii) conservative amino acids A nucleotide sequence encoding a polypeptide having a sequence of at least 8 contiguous amino acids of SEQ ID NO: 2, 4, 8, 10 or 12 having a substitution, or the complement of (iii) (i) or (ii) An isolated nucleic acid comprising a nucleotide sequence.

(Single exon probe)
The present invention further provides a genome-derived single exon probe having a portion of only one exon of the gp354 gene. Such single exon probes have particular utility in identifying and characterizing splice variants. In particular, such a single exon probe is useful for identifying and distinguishing the expression of different isoforms of gp354.

  In some embodiments, the invention is from one of the following exon specific portions of SEQ ID NO: 1, 5, 7, 9 or 11 or the complement of SEQ ID NO: 1, 5, 7, 9 or 11 Provided is an isolated nucleic acid comprising a selected nucleotide sequence. Wherein this portion is at least 17 contiguous nucleotides, at least 18 contiguous nucleotides, at least 20 contiguous portions of any one of SEQ ID NOs: 1, 5, 7, 9 or 11 or their complement portions. It comprises at least 24 contiguous nucleotides, at least 25 contiguous nucleotides, or at least 50 contiguous nucleotides.

  (Table 1: Exon coordinates of gp354 cDNA sequence (SEQ ID NO: 1 or 2) and genomic sequence (SEQ ID NO: 5))

（表２：ｇｐ３５４ ｃＤＮＡ−４配列（配列番号１１）およびゲノム配列（配列番号５）のエキソン座標）

(Table 2: Exon coordinates of gp354 cDNA-4 sequence (SEQ ID NO: 11) and genomic sequence (SEQ ID NO: 5))

（転写制御核酸）
別の局面において、本発明は、ｇｐ３５４遺伝子の転写を制御する核酸配列エレメントを含む、ゲノム由来の単離されたポリヌクレオチドを提供する。これらの核酸は、特に、組み換え構築物中の異種コード領域の発現を駆動するために使用され得、従って、このような異種コード領域に、ネイティブｇｐ３５４遺伝子の発現パターンを与える。これらの核酸はまた、逆に、ｇｐ３５４のゲノム遺伝子座に異種転写制御エレメントを標的化するために使用され得、ｇｐ３５４遺伝子自体の発現パターンを変化させる。

(Transcriptional control nucleic acid)
In another aspect, the present invention provides an isolated polynucleotide derived from a genome comprising a nucleic acid sequence element that controls transcription of the gp354 gene. These nucleic acids can be used in particular to drive the expression of heterologous coding regions in recombinant constructs, thus conferring the expression pattern of the native gp354 gene to such heterologous coding regions. Conversely, these nucleic acids can also be used to target heterologous transcriptional control elements to the gp354 genomic locus, altering the expression pattern of the gp354 gene itself.

  In a first series of such embodiments, the present invention relates to nucleotides 1 to 6483 of SEQ ID NO: 5; nucleotides 1483 to 6482 of SEQ ID NO: 5; nucleotides 2483 to 6482 of SEQ ID NO: 5; 6482; nucleotides 4483-6482 of SEQ ID NO: 5; nucleotides 5483-6482 of SEQ ID NO: 5; or nucleotides 5983-6482 of SEQ ID NO: 5; or the complement of such a sequence is provided .

  In other embodiments, the invention provides nucleotides 1 to 6483 of SEQ ID NO: 5; nucleotides 1483 to 6482 of SEQ ID NO: 5; nucleotides 2483 to 6482 of SEQ ID NO: 5; A single nucleotide comprising at least 17, 18, 20, 24, or 25 nucleotides of nucleotides 4483-6482; nucleotides 5483-6482 of SEQ ID NO: 5; or nucleotides 5983-6482 of SEQ ID NO: 5; or the complement of such sequences A released polynucleotide is provided.

  SEQ ID NO: 5 nucleotides 1 6483; SEQ ID NO: 5 nucleotides 1483-6482; SEQ ID NO: 5 nucleotides 2483-6482; SEQ ID NO: 5 nucleotides 3483-6482; SEQ ID NO: 5 nucleotides 4483-6482; SEQ ID NO: 5 nucleotides 5483-6482; or nucleotides 5983-6482 of SEQ ID NO: 5; or each of the isolated polynucleotides comprising the complement of such a sequence mediates developmental and tissue-specific expression and regulation of the gp354 gene. A transcription control sequence. Such transcription control sequences are useful for providing such developmental and tissue specific expression patterns to heterologous nucleic acid sequences operably linked thereto.

(Other defined features of the gp354 nucleic acid molecule)
All nucleic acid sequences shown in detail herein are shown as sequences of deoxyribonucleotides. However, the sequence shown is intended to be construed as appropriate for the polynucleotide composition: for example, if the isolated nucleic acid is composed of RNA, the sequence shown is intended for ribonucleotides and thymidine Is replaced with uridine.

  Polymorphisms (eg, single nucleotide polymorphisms (SNPs)) occur frequently in eukaryotic genomes. More than 1,400,000 SNPs have already been identified in the human genome (International Human Genome Sequencing Consortium, Nature 409: 860-921 (2001)) and the sequence determined from one individual of one species is It can be different from other allelic forms present in the population. Alternatively, small deletions and insertions that are not single nucleotide polymorphisms are not uncommon in the entire population and often do not alter the function of the protein.

  Accordingly, the present invention provides an isolated polynucleotide that is identical in sequence to a polynucleotide described in detail herein (eg, SEQ ID NOs: 1, 3, 5, 6, 7, 9, and 11). It is particularly emphasized that not only are provided, but also isolated polynucleotides that are allelic variants of the nucleic acid sequences described in their details. Further, the present invention is at least about 65% identical in sequence to SEQ ID NO: 1, 3, 5, 6, 7, 9, and 11 or any one portion of these sequences encoding at least one Ig domain. Is typically at least about 70%, 75%, 80%, 85%, or 90% identical in sequence to the polynucleotides described in detail herein, usefully Polynucleotides and sequences that are at least about 91%, 92%, 93%, 94%, or 95% identical in sequence and more usefully described in detail herein. At least about 96%, 97%, 98%, or 99% identical, and most conservatively in the polynucleotides and sequences described in detail herein About 99.5% even without, 99.6%, 99.7%, 99.8%, or 99.9% identical, to provide homologs of Gp354 (e.g., paralogs and orthologs). These sequence variants can be naturally occurring or can result from human intervention, such as by random mutagenesis or specific mutagenesis.

  Nucleic acid sequence variants were found to occur, for example, at positions 252, 703, 770, 1249, and 1811-1816 of the sequence present in SEQ ID NO: 7.

  For purposes herein, the percent identity of two nucleic acid sequences is determined by Tatiana et al., “Blast 2 sequences-a new tool for comparing protein and nucleotide sequence”, FEMS Microbiol Lett. 174: 247-250 (1999). This procedure is accomplished by the computer program BLAST2 SEQUENCES available online at the National Center for Biotechnology Information.

  To assess the percent identity of nucleic acid sequences, the BLAST2 SEQUENCES BLASTN module is used with the following default values, and both sequences are entered in their entirety: (i) Reward for match (reward) for a match): 1; (ii) penalty for a mismatch: -2; (iii) open gap 5 penalty and extension gap 2 penalty; (iv) gap X_ Dropoff 50 expect (gapX_dropoff 50 expect) 10 word size 11 filter.

  The isolated polynucleotides of the present invention are useful for the expression of GP354 proteins and protein fragments, and thus the present invention provides isolated polynucleotides that encode GP354 proteins and portions thereof (herein). Not only polynucleotides identical in sequence to the polynucleotides described in detail in the text, but also their degenerate variants). As is well known, the genetic code is degenerate and the selection of codons for optimal expression varies between species.

  Also, as is well known, amino acid substitutions frequently occur among natural allelic variants, and often conservative substitutions result in minimal changes in protein function.

  Thus, the present invention encodes GP354 and portions thereof that have conservative or moderate conservative amino acid substitutions, as well as polynucleotides that are identical in sequence to the polynucleotides described in detail herein. A polynucleotide is also provided.

  There are various criteria to call conservative amino acid substitutions (primarily based on either observed changes between evolutionary related proteins or expected chemical similarity), but the specification For purposes herein, a conservative substitution is any change having a positive value in the PAM250 log-likelihood matrix (Gonnet et al., Science 256 ( 5062): 1443-5 (1992)).

本明細書における目的のために、「中程度の保存的」置換は、本明細書の上に複写したＰＡＭ２５０対数尤度行列においてマイナスではない値を有する任意の変化である。

For purposes herein, a “moderately conservative” substitution is any change that has a non-negative value in the PAM250 log-likelihood matrix copied above.

  To avoid severe reduction or elimination of biological activity, amino acid residues that are conserved among GP354 proteins or Ig family members of various species are not altered during genetic manipulation (except for conservative substitutions). For example, cysteine residues should be conserved in order to maintain the Ig domain of GP354.

  Polynucleotide associations can also be characterized using functional tests, the ability of two polynucleotides to pair with each other with a defined hybridization stringency. Thus, the present invention not only provides isolated polynucleotides that are specifically identical in sequence to the polynucleotides described herein, but also provides high stringency conditions (as defined herein). Also provided is an isolated polynucleotide (“cross-hybridizing nucleic acid”) that hybridizes to all or various portions of an isolated gp354 polynucleotide (“reference nucleic acid”) of the present invention.

  Such cross-hybridizing nucleic acids are useful, particularly as probes for proteins related to the proteins of the invention, such as alternative splicing variants and homologs (eg, orthologs and paralogs), It is useful for driving the expression of this protein. Particularly useful orthologs are derived from other primate species (eg, chimpanzees, cynomolgus monkeys, baboons, orangutans, and gorillas); from rodents (eg, rats, mice, guinea pigs); Rabbits (eg, rabbits) and livestock An ortholog of origin (eg, cow, pig, sheep, horse, goat).

  The hybridizing portion of the reference nucleic acid is typically at least 15 nucleotides long, and often at least 17 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, or 50 nucleotides (Nt) length. Larger portions of the reference nucleic acid, eg, at least 50 nt, up to 100 nt, up to 150 nt, up to 200 nt, up to 250 nt, up to 300 nt, up to 350 nt, up to 400 nt, up to 450 nt, up to 500 nt, and the full length of the reference nucleic acid Also useful are cross-hybridized nucleic acids that hybridize to portions that contain moss.

  The hybridizing portion of the cross-hybridizing nucleic acid is at least 75% identical in sequence to at least a portion of the reference nucleic acid. Typically, the hybridizing portion of the cross-hybridizing nucleic acid is at least 80%, often at least 85%, 86%, 87%, 88%, 89%, and even at least relative to at least a portion of the sequence of the reference nucleic acid. 90% of the sequences are identical. Often, the hybridizing portion of the cross-hybridizing nucleic acid is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% relative to at least a portion of the sequence of the reference nucleic acid sequence. Or 99% of the sequences are identical. Sometimes, the hybridizing portion of the cross-hybridizing nucleic acid is identical in at least 99.5% sequence to at least a portion of the reference nucleic acid.

  The invention also provides various fragments of the isolated polynucleotides or nucleic acids of the invention. By “fragment” of a reference nucleic acid is herein intended an isolated polynucleotide or nucleic acid, which, in any way obtained, has a nucleic acid sequence that is identical to a portion of the reference nucleic acid sequence. Where the portion of the reference nucleic acid is at least 17 nucleotides and less than the full length of the reference nucleic acid.

Theoretically, a 17 nucleotide oligonucleotide is long enough to occur less frequently than once in a 3 billion base human genome, and thus a reference in a nucleic acid mixture of a complex of the mammalian genome It is long enough to provide a nucleic acid probe that can uniquely identify the sequence. Further specificity is to probe nucleic acid samples of subgenomic complexity and / or to collect and initiate amplification of nucleic acids, eg, by polymerase chain reaction (PCR). Can be obtained by using multiple fragments as long as 17 nucleotides.

  The nucleic acid probes of the invention can be used to detect RNA transcripts or genomic sequences that encode homologs or the same protein. The probe can include a labeling group (eg, a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor) attached thereto. Such probes can be mutated (eg, deleted, inserted, Or as a part of a diagnostic kit for identifying cells or tissues having a point mutation). Such diagnostic kits preferably include the incorporation of labeled reagents and instructions for use.

  The isolated polynucleotides of the present invention can also be used as primers in PCR, primer extension, and the like. To be useful as a primer, the polynucleotide can be, for example, at least 6 nucleotides long (eg, at least 7 nucleotides, 8 nucleotides, 9 nucleotides or 10 nucleotides long). These primers can hybridize to exon sequences of the gp354 gene, for example, for amplification of gp354 mRNA or cDNA. Alternatively, these primers can be hybridized to intron sequences of the gp354 gene, or upstream or downstream regulatory sequences in order to take advantage of regulatory portions of the genomic structure of the gp354 gene that are not transcribed, for example.

  The nucleic acid primers of the invention can also be used to prime, for example, a single base extension (SBE) for SNP detection (see, eg, US Pat. No. 6,004,744, the disclosure of which is hereby incorporated by reference). (Incorporated in its entirety by reference)). An isothermal amplification approach (eg, rolling circular amplification) is also well described herein. See, for example, Schweitzer et al., Curr. Opin. Biotechnol. 12 (1): 21-7 (2001); US Pat. Nos. 5,854,033 and 5,714,320, and WO 97/19193 and WO 00/15779, the disclosures of which are herein See incorporated by reference in its entirety). Circulating circular amplification can be combined with other techniques to facilitate SNP detection. For example, Lizardi et al., Nature Genet. 19 (3) 225-32 (1998).

  Expression of peptides, as described below, wherein a nucleic acid fragment encoding at least 6 contiguous amino acids (ie, a fragment of 18 or more nucleotides) has utility in mapping an epitope of a protein encoded by a reference nucleic acid Or useful for directing synthesis. See, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1984) and U.S. Pat. Nos. 4,708,871 and 5,595,915.

  And as described below, nucleic acids encoding at least 8 consecutive amino acids (ie, fragments of 24 nucleotides or more) are useful in directing the expression or synthesis of peptides that have utility as immunogens. See, for example, Lener, “Tapping the immunological repertoire to production antigens of predicated properties” Nature 299: 592-596 (1982); Shinnick et al., Annu. Rev. Microbiol. 37: 425-46 (1983); Sutcliffe et al., Science 219: 660-6 (1983).

  Thus, a nucleic acid fragment of the invention is at least 17 nucleotides long, typically 18 nucleotides long, and often at least 24 nucleotides long, 25 nucleotides long, 30 nucleotides long, 35 nucleotides long, 40 nucleotides long or 45 It is nucleotide (nt) long. Of course, as will be appreciated by those skilled in the art, larger fragments having at least 50 nt, 100 nt, 150 nt, 200 nt, 250 nt, 300 nt, 350 nt, 400 nt, 450 nt, 500 nt or more are also useful and sometimes preferred.

  Since the present invention is not based on an exploration of the expressed message, but rather based on a mimic of the genomic sequence, an isolated genomic-derived polynucleotide or nucleic acid comprising a portion of the gp354 gene is further provided. provide. In particular, the present invention provides genome-derived single exon probes, which include at least a portion of exons (“reference exons”) and, under high stringency conditions, to nucleic acids from transcripts containing the reference exons. Can hybridize detectably. However, this single exon probe lacks a reference exon but does not detectably hybridize to nucleic acids containing one or more exons found adjacent to the reference exon in the genome under high stringency conditions.

  The present invention also provides isolated genomic-derived polynucleotides or nucleic acids that contain nucleic acid sequence elements that control transcription of the gp354 gene. The transcription control sequence includes, for example, a promoter, an enhancer, an operator, a terminator, a silencer and the like.

  If desired for use in antisense inhibition of transcription or translation, or for antisense-mediated targeting of enzymatic nucleic acid molecules such as ribozymes, an isolated polynucleotide or nucleic acid of the present invention comprises one or more A modified base (see below) and / or one or more modified or altered internal nucleoside linkages can be usefully included, often providing nuclease resistance. Hartmann et al. (Eds.), Manual of Antisense Methodology (Perspectives in Antisense Science), Kluwer Law International (1999) (ISBN: 079238539X); Stein et al. (Eds.), Applied Antisense Oligonucleotide Technology, Wiely-Liss (Cover (1998) (ISBN See: Chadwick et al. (Eds.), Oligonucleotides as Therapeutic Agents-Symposium 209, John Wiery & Sons Ltd (1997) (ISBN: 047197297). Such modified base and internal nucleoside linkages are often Gamper et al., Nucl. Acids Res. 28 (21): 4332-9 (2000), the disclosure of which is incorporated herein by reference in its entirety. It is also desirable if the isolated nucleic acid of the invention is to be used for modification of a targeted gene, as described in.

  The antisense nucleic acid molecules of the invention (and enzymatic nucleic acids targeted by antisense) can be used in therapeutic settings. These molecules can be expressed from expression vectors that include operably linked transcriptional regulatory sequences, and their activity can be determined by the cell type into which the vector has been introduced. For a discussion of the regulation of gene expression using antisense genes, see Weintraub et al., Antisense RNA as a molecular tool for genetic analysis, Trends. Genet. 1 (1) (1986).

  The antisense nucleic acid of the invention can be a ribozyme. A ribozyme is a catalytic RNA molecule having ribonuclease activity, which can cleave a single-stranded nucleic acid (eg, mRNA), and the ribozyme has a region complementary to the single-stranded nucleic acid. Thus, ribozymes can be used to catalytically cleave gp354 mRNA transcripts, thereby inhibiting translation of gp354 mRNA. A ribozyme having specificity for a nucleic acid encoding gp354 can be designed based on the nucleotide sequence (SEQ ID NOs: 1-3) of the gp354 polynucleotide disclosed herein.

  Oligonucleotide mimics of gp354 (eg, peptide nucleic acids (PNA)) can be used in therapeutic and diagnostic applications. See, for example, Hyrup et al., Bioorg. Med. Chem. Lett. 4: 5-23 (1996). In PNA compounds, the phosphodiester backbone of nucleic acids is replaced with an amide-containing backbone, in particular by repetitive N- (2-aminoethyl) glycine units linked by amide bonds. For example, PNA can be used as an antisense agent or an anti-gene agent for sequence-specific regulation of gene expression by, for example, inducing transcriptional or translational arrest, or replication inhibition. The gp354 PNA is also used as an artificial restriction enzyme when used in combination with other enzymes (eg, S1 nuclease), eg, in the analysis of single base pair mutations in genes, eg, by PNA-directed PCR clamping. Or as probes or primers for DNA sequences and hybridization (Hyrup et al., Supra; and Perry-O'Keefe, supra). gp354 PNA is modified, for example, by attaching a helper group to a lipid or other PNA, by formation of a PNA-DNA chimera, or drug delivery liposomes or others known in the art Can be used to enhance their stability or cellular uptake.

  The oligonucleotides of the invention may contain other additional groups, such as peptides or agents that facilitate transport across the cell membrane or blood brain barrier (eg, to target host cell receptors in vivo). In addition, the oligonucleotides can be modified with hybridization-induced cleavage or insertion agents. To this end, the oligonucleotide can be conjugated with another molecule (eg, a peptide, a hybridization-inducing cross-linking agent, a transport agent, a hybridization-inducing cleavage agent, etc. (see below)). .

  Differences from nucleic acid constructs found in nature (eg, unnatural bases, changes in internal nucleoside linkages, post-synthetic modifications) can exist throughout the length of a gp354 polynucleotide or are useful for dispersed portions thereof Can be arranged. As an example of the latter, chimeric nucleic acids having dispersed DNA and RNA domains can be synthesized and US Pat. Nos. 5,760,012 and 5,731,181 (the disclosures of which are herein incorporated by reference). The use for targeted gene repair has been demonstrated as further described in (incorporated in its entirety by reference). Chimeric nucleic acids containing both DNA and PNA have been demonstrated to have utility in modified PCR reactions. Misra et al., Biochem. 37: 1917-1925 (1998); see also Finn et al., Nucl. Acids Res. 24: 3357-3363 (1996), which are incorporated herein by reference.

  The polynucleotides and nucleic acids of the invention can also be usefully bound to a substrate. The substrate can be porous or solid, flat or non-flat, unified or dispersed; the bond can be covalent or non-covalent. When bound to a substrate, the nucleic acids of the invention can be used as probes in an unlabeled state. For example, the nucleic acids of the invention can be usefully bound to a porous substrate (usually a membrane, typically nitrocellulose, nylon or positively charged derivatized nylon); The nucleic acids of the invention can be used to detect gp354 nucleic acid present in a labeled nucleic acid sample (either a sample of genomic nucleic acid or a sample of nucleic acid from a transcript), eg, by reverse dot blot.

  The nucleic acids of the invention can also be usefully attached to a solid support (eg, glass), although other solid materials (eg, amorphous silicon, crystalline silicon or plastic) can also be used. The nucleic acids of the invention can be covalently bound to a solid support surface or derivatized surfaces in chaotropic agents that facilitate denaturation and support by putative non-covalent interactions or some combination thereof. Can be applied to.

  The nucleic acids of the invention can be bound to a substrate to which a plurality of other nucleic acids are bound together (hybridization to each of the bound nucleic acids can be detected separately). For example, at low density, these substrate-bound collections on porous membranes are typically referred to as macroarrays, and at high density, these substrates are typically attached to these substrates on a solid support (eg, glass). A collection of combined nucleic acids is colloquially referred to as a microarray. As used herein, the term microarray includes arrays of all densities. Accordingly, the present invention provides a microarray comprising the nucleic acid of the present invention.

  The isolated nucleic acids of the present invention can be used as hybridization probes to detect, characterize, and quantify gp354 nucleic acids in both genomic and transcript-derived nucleic acid samples and from them gp354 nucleic acids Can be isolated. Such probes are typically (but not non-variable) detectable labels when released in solution; when bound to a substrate as a microarray, such probes are typically ( But not immutable) and unlabeled.

  For example, an overall change in the gp354 genomic locus (eg, of the gp354 genomic locus via fluorescent in situ hybridization (FISH) to chromosomal spread using the isolated nucleic acid of the invention as a probe. Deletions, insertions, translocations, and duplications) can be detected and characterized. For example, Andreweff et al. (Eds.), Introduction to Fluorescence In Situ Hybridization: Principles and Clinical Applications, and John Wily & Sons (1999) (Reference: ISBN: 0410) See, isolated nucleic acids of the invention can be used as probes to assess smaller genomic alterations, for example using Southern blot detection of restriction fragment length polymorphisms. Nucleic acids can be used as probes to isolate genomic clones containing the nucleic acids of the invention, which are then deleted at the sequence level by deletions, insertions, translocations and substitutions (single nucleotide polymorphisms (S In order to identify NP)), a restriction map can be generated and sequenced.

The isolated nucleic acids of the present invention can also be used as probes to detect, characterize, and quantify gp354 nucleic acids in transcript-derived nucleic acid samples and to isolate gp354 nucleic acids therefrom. For example, gp354 mRNA can be detected, characterized by length, and quantified by Northern blot of total RNA samples or poly A ⁺ selected RNA samples using the isolated nucleic acids of the invention as hybridization probes. obtain. The isolated nucleic acids of the present invention can also be used as hybridization probes to detect, characterize, and quantify gp354 messages by in situ hybridization to tissue sections (eg, Schwarzacher et al., In See Situ Hybridization, Springer-Verlag New York (2000) (ISBN: 0387915966), the disclosure of which is incorporated by reference in its entirety).

  Furthermore, the expression level of the gp354 clone in a cDNA library can be measured using the nucleic acid of the present invention as a hybridization probe. For example, an isolated nucleic acid of the invention can be used as a hybridization probe to isolate a gp354 nucleic acid from a cDNA library, and sequence level characteristics (deletion, insertion, reduction (alternatively spliced) of the gp354 RNA message. Including exon deletions, insertions and deletions), as well as the identification of single nucleotide polymorphisms).

  As described in the Examples herein below, the isolated nucleic acids of the invention are also used to detect and quantify gp354 nucleic acid in samples derived from transcripts, and to express gp354 gene expression levels. Can be measured. The measurement of gp354 expression is measured in pancreatic and neural tissues in which gp354 is normally expressed and in a manner in which it is normally expressed, as described in more detail in the Examples herein below, and this is misexpressed. It has particular utility in diagnostic assays for conditions, disorders, and diseases associated with abnormal gp354 expression in any of the tissues that can be done.

  Thus, as will be readily apparent to one of skill in the art, each gp354 nucleic acid probe (labeled, bound to a substrate, or both) is typically pancreatic tissue and neural tissue (expression is already determined). Are available for use as a tool to measure the level of gp354 expression.

  For tissues that have not yet been demonstrated to express gp354, the gp354 nucleic acids of the invention typically detect the presence of gp354 nucleic acid, eg, abnormal intracellular expression of gp354 in the pancreas or nervous system, or other tissues It can be used as a tool to investigate such tissues to detect gp354 RNA expression in patient tissues exhibiting a condition, disorder or disease associated with abnormal tissue distribution.

  As noted above, the nucleic acid probes of the present invention are useful in constructing microarrays; the microarrays are then useful for measuring and investigating gene expression in, for example, drug discovery and target validation programs. It is a product. Each gp354 nucleic acid probe, when included on a microarray, constitutes a macroarray that is specifically useful for detecting that portion of the gp354 gene contained in the probe, and thus on the microarray device. Confer the ability to detect signals (no signal in the absence of such probes has been reported).

  A change in the expression level of gp354 need not be observed for measuring the amount of expression that has utility. When assessing the toxicity of a chemical agent to cells using gene expression analysis, for example, the drug cannot alter the expression level of the gene because the drug is a pathway that is part of the expressed protein of the gene. It is proof that it is not likely to affect. Similarly, when using gene expression analysis to assess side effects of a pharmacological drug (whether lead compound discovery or subsequent lead compound derivative screening), the drug can alter gene expression levels. The lack of evidence is that the drug does not affect the pathway that this gene expressed protein is part of. WO 99/58720 (incorporated herein by reference in its entirety) describes the first gene expression profile and the second gene expression regardless of the individuality or function of the gene (this expression is used in the calculation) Methods are provided for quantifying profile relevance, as well as methods for organizing the relevance of multiple gene expression profiles.

  The genome-derived single exon probes and genome-derived single exon probe microarrays of the present invention have additional utility that allows high-throughput detection of splicing variants of the nucleic acids of the present invention.

  A polynucleotide of the invention inserted into a nucleic acid construct, such as a vector flanking a polynucleotide insert with a promoter, to drive in vitro expression of RNA complementary to either strand of the nucleic acid of the invention Can be used. This RNA can be used in a cDNA-mRNA subtraction or as a single stranded probe for in vitro translation. These polynucleotides, such as encoding GP354 protein or portions thereof, can further be used to express GP354 protein or protein fragments, either alone or as part of a fusion protein. Expression can be from the genome or from a polynucleotide from the transcript of the invention.

  Where protein expression is performed from genomic DNA, expression is typically performed in eukaryotic cells, typically mammalian cells, which can splice introns from the initial RNA transcript. Expression can be driven from an episomal vector or from genomic DNA integrated into the host cell chromosome. As described below, when expression is from a transcript of the invention (or otherwise without introns), the expression is in a wide variety of prokaryotic or eukaryotic cells. Can be done at.

  Expressed in vitro, a protein, protein fragment, or protein fusion can then be isolated and used as a standard in an immunoassay specific for the protein or protein isoform of the invention; used as a therapeutic agent; For example, it can be administered as passive replacement therapy in an individual deficient in the protein of the invention; it can be administered as a vaccine; it can be used for the in vitro production of specific antibodies; As an analytical agent for the detection and quantification of proteins or as an immunotherapeutic agent.

  Isolated polynucleotides and nucleic acids of the invention can also be used to drive in vivo expression of the proteins of the invention. In vivo expression can be driven from vectors intended for gene therapy—typically vectors based on viral vectors, often non-replicating lentiviruses, retroviruses, adenoviruses, or adeno-associated viruses (AAV). In vivo expression can be driven from expression control signals that are endogenous to the nucleic acid or exogenous (eg, from a vector). Other viral vectors of the present invention include, for example, vectors derived from baculovirus, adenovirus, parvovirus, herpes virus, pox virus, adeno-associated virus, Semliki Forest virus, vaccinia virus, and retrovirus.

  Various forms of isolated gp354 polynucleotides of the invention (eg, genomic or cDNA) can be microinjected into the male or female pronucleus or incorporated into embryonic stem (ES) cells, Transgenic non-human animals that can produce the proteins of the invention can be made.

  The genomic nucleic acids of the invention can also be used to target homologous recombination to the gp354 locus in a subject. For example, U.S. Pat. Nos. 6,187,305; 6,204,061; 5,631,153; 5,627,059; 5,487,992; 5,464,764; 5,614,396; 5,527,695 and 6,063,630; and Kmiec et al. (Eds.), Gene Targeting Protocols. 133, Humana Press (2000) (ISBN: 0896033600); Joyner (ed.), Gene Targeting: A Practical Approach, Oxford University Press, Inc. (2000) (ISBN: 0199637938); Sedivy et al., Gene Targeting, Oxford University Press (1998) (ISBN: 071677013X); Tymms et al. (Ed.), Gene Knockout Protocols. Humana Press (2000) (ISBN: 0896035727); Mak et al. (Eds.), The Gene Knockout FactsBook, Volume 2, Academic Press, Inc. (1998) (ISBN: 0124660444); Torres et al., Laboratory Protocols for Conditional Gene Targeting, Oxford University Press (1977) (ISBN: 099663677X); 94, Gene, T )checking. These disclosures are incorporated herein by reference in their entirety.

  If the genomic region contains transcriptional regulatory elements, homologous recombination can be used to modify the expression of GP354, both for in vitro production of GP354 protein from human cells and for gene therapy purposes. See, for example, US Pat. Nos. 5,981,214, 6,048,524; 5,272,071, the entire disclosures of which are incorporated herein by reference. Fragments of the polynucleotides of the invention that are smaller than those typically used for homologous recombination are also likely to be targeted by targeted gene correction or by a cellular mechanism different from that involved during homologous recombination. Can be used for modification. For example, U.S. Pat. Nos. 5,945,339, 5,888,983, 5,871,984, 5,795,972, 5,780,296, 5,760,012, 5,756,325, 5,731,181; and Culver et al., “Collection of chromosomal points in human cells with bifunctional oligonucleotides. 17 (10): 989-93 (1999); Gamper et al., Nucl. Acids Res. 28 (21): 4332-9 (2000). These disclosures are incorporated herein by reference.

  The polynucleotides of the invention can be obtained by using the labeled probes of the invention to probe nucleic acid samples, such as genomic libraries, cDNA libraries, and mRNA samples, by standard techniques. The polynucleotides of the present invention can also be obtained by amplification using the nucleic acid primers of the present invention, as further illustrated herein in Example 1 below. The polynucleotides of the present invention can also be chemically synthesized, typically by solid phase synthesis using commercially available automated synthesizers, particularly when less than about 100 nucleotides.

(Vector and host cell)
(A. Nucleic acid construct)
The invention provides nucleic acid constructs such as vectors, and host cells into which such vectors have been introduced, comprising one or more isolated polynucleotides of the invention.

  Such a vector is present in the host cell chromosome to increase the polynucleotide of the present invention in a host cell (cloning vector), or to shuttle the polynucleotide of the present invention between host cells from different organisms (shuttle vector). To insert a polynucleotide of the invention (insertion vector), to express a sense RNA transcript or antisense RNA transcript of a polynucleotide of the invention in vitro or in a host cell, and as a fusion to a single or heterologous polypeptide Can be used to express a polynucleotide encoded by the polynucleotide of the present invention (expression vector). The vectors of the invention are often suitable for some such uses.

  Vectors are now well known in the art, and in particular, Jones et al. (Eds.), Vectors: Cloning Applications: Essential Technologies (Essential Techniques Series), John Wiley & Sons 62 (Nd 66); ), Vectors: Expression Systems: Essential Technologies (Essential Technologies Series), John Wiley & Son Ltd 1998 (ISBN: 047196678); Gessa et al., Sent. SBN: 0471948411); Cid-Arregui (eds.), Viral Vectors: Basic Science and Gene Therapy, Eaton Publishing Co. , 2000 (ISBN: 188129935X); Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory Press, 2001 (ISBN: 087995773); Ausubol of Methods from Current Protocols in Molecular Biology (4th edition), John Wiley & Sons, 1999 (ISBN: 047132938X). These disclosures are hereby incorporated by reference in their entirety. A wide variety of vectors are commercially available. The use and modification of existing vectors is well within the skill of the art.

  Typically, the vector is derived from a virus, plasmid, prokaryotic or eukaryotic chromosomal element, or some combination thereof, and some integrative vectors are in a host in which the chromosome is modified. It lacks an origin that is functional, and some vectors lack a selectable marker, but at least one origin of replication, at least one site for insertion of a heterologous nucleic acid (typically multiple tightly In the form of a polylinker with a single cleavage restriction site clustered), and at least one selectable marker. The vectors of the present invention further comprise at least one isolated polynucleotide nucleic acid of the present invention inserted into the vector at at least one position. If present, the origin of replication and selectable marker are selected based on the desired host cell; the host cell is then selected based on the desired application.

  For example, prokaryotic cells, typically E. coli. E. coli is typically selected for cloning, i.e., amplification of the polynucleotide sequence in the host cell. In such cases, vector replication includes replication strategies for phage that infect E. coli (such as λ phage, M13, T7, T3, and P1), or autonomously replicating episomes, prominently including the pBR322 and pUC series plasmids. , Based on the origin of replication of the ColE1 plasmid and subsequent derivatives. E. When E. coli is used as a host, selectable markers are similarly selected for selectivity in Gram-negative bacteria: for example, representative markers are ampicillin, tetracycline, chloramphenicol, kanamycin, streptomycin, zeocin Confer resistance to such antibiotics; auxotrophic markers can also be used.

  As another example, S. Yeast cells that are cerevisiae are specifically selected for eukaryotic genetic studies, for identification of interacting protein components (eg, through the use of a two-hybrid system), and for protein expression. The vectors of the invention for use in yeast typically include, but not always, a suitable origin of replication for use in yeast and a selectable marker that is functional in yeast.

  Examples of suitable yeast vectors include integrated YIp vectors, replicative episomal YEp vectors containing the centromere sequence CEN, and the autonomously replicating sequence ARS. YAC is based on a yeast linear plasmid called YLp that contains homologous or heterologous DNA sequences that function as telomeres (TEL) in vivo and that contain a yeast ARS (origin of replication) segment and a CEN (centromere) segment.

  Selection markers in yeast vectors include various autotrophic markers that complement specific autotrophic mutations (eg, ura3-52, his3-D1, leu2-D1, trpl-Dl and lys2-201) (these Most common (in Saccharomyces cerevisiae) are URA3, HIS3, LEU2, TRP1 and LYS2. The URA3 and LYS2 yeast genes inhibit the growth of prototrophic strains, but are 5-fluoro-orotic acid (FOA), a specific inhibitor that allows the growth of ura3 and lys2 mutants, respectively. ) And α-aminoadipic acid (αAA) further allow negative selection based on each. Other selectable markers confer resistance to, for example, zeocin.

Insect cells are often selected for high efficiency protein expression. If the host cell is derived from Spodoptera frugiperda (eg, Sf9 and Sf21 cell lines, and express SF ^™ cells (Protein Sciences Corp., Meriden, CT, USA)), the vector replication strategy is typically baculo Based on the viral life cycle. Typically, a baculovirus transfer vector is used to replace the wild type AcMNPV polyhedrin gene with a heterologous gene of interest. The sequences flanking this polyhedrin gene in the wild type genome are located 5 ′ and 3 ′ of the expression cassette on this transfer vector. After co-transfection with AcMNPV DNA, a homologous recombination event occurs between these sequences, resulting in a recombinant virus carrying the gene of interest and the polyhedrin or p10 promoter. Selection can be based on visual screening for lacZ fusion activity.

  Mammalian cells are often selected for the expression of proteins intended as pharmaceutical agents, and are also selected as host cells for screening for potential agonists and antagonists of proteins or physiological pathways. Vectors intended for autonomous extrachromosomal replication in mammalian cells are typically of viral origin (eg, for replication in (cell lines expressing large T antigen (eg, COS1 and COS7 cells)). ) SV40 origin, papillomavirus origin, or EBV origin for long-term episomal replication (eg for use in 293-EBNA cells that constitutively express EBV EBNA-1 gene product and adenovirus E1A)) Can be mentioned. A vector that integrates as part of a mammalian chromosome and is therefore intended to replicate can contain, but need not necessarily contain, an origin of replication (eg, of SV40 origin) that is functional in mammalian cells. Vectors based on viruses (eg, lentiviruses, adenoviruses, adeno-associated viruses, vaccinia viruses, and various mammalian retroviruses) typically replicate according to viral replication strategies.

  Selectable markers for use in mammalian cells include resistance to neomycin (G418), blasticidin, hygromycin and zeocin, and selection based on the purine salvage pathway using HAT medium.

  Plant cells are also typically expressed using a vector replicon from a plant virus (eg, cauliflower mosaic virus (CaMV); tobacco mosaic virus (TMV)) and a selectable marker selected for suitability in the plant. Can be used for.

  For propagation of the polynucleotides of the invention that are larger than those that can be readily adapted in plasmid or virus-derived vectors, the present invention provides artificial chromosomes (BAC, YAC, and HAC, including gp354 nucleic acids, often genomic nucleic acids). ).

  For propagation of polynucleotides of the invention that are larger than polynucleotides that can be readily adapted in plasmid or virus-derived vectors, the present invention includes artificial chromosomes (BAC, YAC, And HAC). See, for example, Shizuya et al., Keio J. et al. Med. 50 (1): 26-30 (2001); Shizuya et al., Proc. Natl. Acad. Sci. USA 89 (18): 8794-7 (1992); Kuroiwa et al., Nature Biotechnol. 18 (10): 1086-90 (2000); Henning et al., Proc. Natl. Acad. Sci. USA 96 (2): 592-7 (1999); Harrington et al., Nature Genet. 15 (4): 345-55 (1997) (the disclosures of which are incorporated herein by reference).

  The vectors of the invention also often contain elements that allow in vitro transcription of RNA from the inserted heterologous nucleic acid. Such vectors typically include a phage promoter (eg, from T7, T3 or SP6 adjacent to the nucleic acid insert). Often, two different such promoters are adjacent to the inserted nucleic acid and can separate separate in vitro production of both the sense and antisense strands.

  Expression vectors of the invention that drive the expression of a polypeptide from an inserted heterologous nucleic acid often have various other genetic elements (typically transcriptional) operably linked to the protein-encoded heterologous nucleic acid insert. Genetic elements that drive and regulate (eg, promoter and enhancer elements), genetic elements that facilitate RNA processing (eg, transcription termination, splicing signals and / or polyadenylation signals), and facilitate translation Including genetic elements (eg, ribosome consensus sequences) Other transcription control sequences include, for example, operators, silencers, etc. Such expression control elements (inducible expression and developmental or tissue regulated expression) Expression control Use of including Remento) are well known in the art.

  Tissue-specific regulatory elements capable of expressing GP354 in the pancreas, nervous system or mammary gland can be particularly useful and are known in the art (eg, neurospecific neurofilament promoters (Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86: 5473-5477), pancreas specific promoter (Edrund et al. (1985) Science 230: 912-916), and mammary gland specific promoter (eg, whey promoter; No. 4,873,316 and European Patent Application Publication No. 264,166)). Developmentally regulated promoters can also be selected and include, but are not limited to, the mouse hox promoter (Kessel and Gruss (1990) Science 249: 374-379) and the alpha-fetoprotein promoter. (Campes and Tilghman (1989) Genes Dev. 3: 537-546). A vast variety of inducible promoters are known and can be selected based on the specific application.

  Expression vectors can be designed to fuse the expressed polypeptide to a small protein tag that facilitates purification and / or visualization. Many such tags are known and available. Expression vectors can also be designed to fuse the protein encoded by the heterologous nucleic acid insert to a polypeptide that is larger than the purification tag and / or the identification tag. Useful protein fusions include protein fusions that allow for display of the encoded protein on the surface of phage or cells, proteins with endogenous fluorescent proteins (eg, luciferase or green fluorescent protein (GFP) -like chromophores) ), Fusions to IgG Fc regions or other immunoglobulin type constant domains, and fusions for use in two-hybrid selection systems.

  A wide variety of vectors are available for secretion of the expressed protein, including the appropriate sequence encoding a secretion signal, such as a leader peptide. Vectors designed for phage display, yeast display, and mammalian display target recombinant proteins using, for example, N-terminal cell surface targeting signals and C-terminal transmembrane anchoring domains.

  Proteins encoded by heterologous nucleic acids can be colored by substrate-independent, originally fluorescent luminescent green fluorescent protein (“GFP”) from Aequorea victoria and many of its color shift and / or stabilizing variants A wide variety of vectors currently exist that fuse to clusters.

  Enables fusion of heterologous sequences to the IgG Fc region to increase the serum half-life of protein pharmaceutical products through interaction with FcRn receptors (also called FcRp and Brambell receptors, FcRb) Vectors are also widely available.

  Stable expression is preferred for long-term, high-yield recombinant production of the proteins, protein fusions and protein fragments of the present invention. Stable expression is readily achieved by integration of the vector (preferably with a selectable marker) into the host cell genome followed by selection of the integrant.

(B. Host cell)
The present invention relates to a host cell (prokaryotic) comprising a nucleic acid construct, such as a vector of the present invention, that is either episomally present in the cell or is totally or partially incorporated into the host cell chromosome. Further included are biological (bacterial) cells or eukaryotic cells (eg, any of yeast cells, insect cells, plant cells and animal cells).

  Among other considerations, some of which are described above, host cell lines can be selected for their ability to process the expressed protein in the desired manner. Such post-translational modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acetylation, and this includes such post-translational modifications. It is an aspect of the present invention to provide a GP354 protein with modifications.

Representative, non-limiting examples of suitable host cells include bacterial cells (eg, E. coli, Caurobacter crecentus, Streptomyces species, and Salmonella typhimurium); , Pichia methanolica); insect cell lines (eg, cells from Spodoptera frugiperda (eg, Sf9 and Sf21 cell lines, and express SF ^TM cells (Protein Sciences Corp., Meriden, CT, USA), D, ro). Yo Trichoplusia ni High Five® cells (Invitrogen, Carlsbad, CA, USA); and mammalian cells, including representative COS1 and COS7 cells, Chinese hamster ovary (CHO) cells, NIH 3T3 cells, 293 cells, HEPG2 cells, HeLa cells, L cells, HeLa, MDCK, HEK293, WI38, mouse ES cell lines (eg, 129 / SV strain, C57 / BL6 strain, DBA-1 strain, 129 / SVJ strain) Origin), K562, Jurkat cells, and BW5147. Other useful mammalian cell lines are well known and American Type Culture Collection (ATCC) (Manassa) , VA, USA) and the National Institute of General medical Sciences (NIGMS) Human Genetic Cell Repository at the Coriell Cell Repositories (Camden, NJ, USA) from easily available.

  Methods for introducing the vectors and nucleic acids of the invention into host cells are well known in the art; the choice of technology depends primarily on the specific vector being introduced and the host cell selected.

(GP354 protein, GP354 polypeptide and GP354 fragment)
The present invention relates to GP354 proteins suitable for use as antigens (eg, epitope mapping), as immunogens (eg, for raising antibodies or as vaccines), and for use in therapeutic compositions and these Various fragments are provided. Also provided are fusions of GP354 polypeptides and fragments to heterologous polypeptides, and conjugates to other parts of this protein, fragments and fusions of the invention (eg, to a chromophore, to a carrier protein).

  In some embodiments, the present invention provides an isolated GP354 polypeptide comprising a full-length gp354 cDNA (SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 11), or an amino acid sequence encoded by a modified variant. To do. The invention also provides an isolated GP354 poly having an amino acid encoded by a full length gp354 cDNA (SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 11), optionally having one or more conservative amino acid substitutions. A peptide is provided.

  The present invention also provides an amino acid encoded by a polynucleotide sequence that hybridizes under highly stringent conditions to a probe having a portion or all of the nucleotide sequence of gp354 cDNA (SEQ ID NO: 1, SEQ ID NO: 7 or SEQ ID NO: 11). An isolated GP354 polypeptide comprising a sequence is provided. Preferably, an isolated GP354 polypeptide encoded by a polynucleotide of the invention that cross-hybridizes stringently or moderately stringently has at least one GP354 biological activity.

  In another series of embodiments, the present invention provides an isolated GP354 comprising the GP354 amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 8 or SEQ ID NO: 12, optionally having one or more conservative amino acid substitutions. A polypeptide is provided. An isolated GP354 polypeptide having an amino acid sequence encoded by the GP354 polypeptide sequence of SEQ ID NO: 2, SEQ ID NO: 8, or SEQ ID NO: 12, optionally having one or more conservative amino acid substitutions, Provided. The present invention further provides a fragment of each of the above isolated polypeptides, in particular from at least 6 amino acids, 8 amino acids, 15 amino acids of the sequence given in SEQ ID NO: 2, SEQ ID NO: 8 or SEQ ID NO: 12. Fragments having up to the entire sequence are provided.

  Each of the above isolated polypeptides contains an N-terminal 18 or 21 amino acid signal sequence, which is typically removed upon insertion of the protein across the membrane. Thus, the present invention provides the above isolated GP354 polypeptide from which the N-terminal signal sequence has been removed. Cleavage is presumed to occur between G and P residues at positions 18-19 of SEQ ID NO: 2 or 21-22 of SEQ ID NO: 8.

  Thus, the present invention provides an isolated GP354 polypeptide comprising all or part of the putative mature N-terminal extracellular domain of GP354 (for GP354 domain and GP354 sequence, FIGS. 1 and 5 and SEQ ID NO: 2 and (See number 8). The putative mature N-terminal extracellular domain of GP354 (ie, lacking the secretory signal sequence) consists of amino acids 19-507 of SEQ ID NO: 2 or amino acids 22-510 of SEQ ID NO: 8. Also included are fragments of the above sequences having at least 6 amino acids, 8 amino acids, 15 amino acids up to the entire sequence of the identified sequence.

  The present invention also provides an isolated GP354 polypeptide comprising or having all or a portion of the N-terminal extracellular domain of GP354 (for the GP354 domain and GP354 sequence, see FIGS. 1 and 5 and SEQ ID NO: 2 and See SEQ ID NO: 8). The N-terminal extracellular domain of GP354 consists of amino acids 1 to 507 of SEQ ID NO: 2 or amino acids 1 to 510 of SEQ ID NO: 8. Also included are fragments of the above sequences having at least 6 amino acids, 8 amino acids, 15 amino acids up to the entire sequence of the identified sequence.

  In a preferred embodiment, the isolated GP354 polypeptide has or includes the entire extracellular domain of GP354 and lacks a functional GP354 transmembrane domain. This transmembrane domain can be excluded, deleted, or mutated to become non-functional. The transmembrane domain of GP354 consists of amino acids 508 to 530 of SEQ ID NO: 2 or amino acids 511 to 533 of SEQ ID NO: 8.

  In other preferred embodiments, the isolated GP354 polypeptide consists of part or all of the GP354 N-terminal extracellular domain fused to a heterologous protein domain. Preferably, the isolated GP354 polypeptide comprises at least one extracellular Ig domain, more preferably two GP354 extracellular Ig domains, and most preferably 3, 4, or 5 GP354 cells. Contains the outer Ig domain.

  Also preferred is an isolated GP354 polypeptide comprising a GP354 fragment selected from the group consisting of the transmembrane domain of GP354 and the C-terminal cytoplasmic region of GP354. In other preferred embodiments, the isolated GP354 polypeptide consists of part or all of a GP354 cytoplasmic or transmembrane domain fused to a heterologous protein domain.

  The GP354 fragment of the present invention can be a contiguous portion of the native GP354 protein. However, it is understood that knowledge of the GP354 gene and protein sequence as provided herein allows recombination of various domains that are not sequential in the native GP354 protein.

  The invention also provides a polypeptide comprising a selected portion of GP354 and related proteins. As discussed further herein below, these protein fragments target factors to specific cell types, eg, via protein-protein interactions, particularly when bound to heterologous protein fragments. Can be used to inhibit protein-protein interactions between Ig domain-containing proteins; for competitive binding assays; and to elicit fragment-specific GP354 antibodies.

  In a first series of such embodiments, the protein fragment contains an Ig domain characteristic of the N-terminal extracellular portion of GP354 in one, two, three, four, or five in at least one copy. Including. Specifically, the five extracellular Ig domains are amino acids 35 to 102, 136 to 203, 239 to 290, 323 to 374, and 410 to 485 of the GP354 amino acid sequence of SEQ ID NO: 2, respectively (see FIG. 1). ) And is encoded by amino acids 38-109, 139-206, 242-293, 326-377 and 413-488 (see FIG. 5) of the GP354 amino acid sequence of SEQ ID NO: 8, respectively. In a preferred embodiment, the protein fragment encodes at least 2, preferably 3, more preferably 4, and most preferably all 5 domains in at least one copy.

  Preferably, the protein fragment includes an N-terminal signal secretion sequence that mediates the polypeptide transport across the membrane. This GP354 signal secretion sequence is encoded by amino acids 1-18 of the GP354 amino acid sequence of SEQ ID NO: 2 (see FIG. 1) and amino acids 1-21 of the GP354 amino acid sequence of SEQ ID NO: 8 (see FIG. 5). Is done. More preferably, the signal secretion sequence of this protein fragment is derived from GP354.

  The preferred protein fragments described above can optionally include a transmembrane domain if insertion of the polypeptide into the membrane is highly desired. This transmembrane domain can be a GP354 domain (see below) or can be encoded by a heterologous gene that encodes the transmembrane domain of a heterologous membrane-bound protein.

  If so desired, the preferred protein fragments described above may further comprise an intracellular C-terminal domain if a specific signaling reaction is desired in response to GP354 binding interactions. This intracellular domain can be derived from GP354 (see below) or can be encoded by a heterologous gene that encodes the intracellular domain of a heterologous membrane-bound protein.

  Another preferred embodiment of the protein fragment of the present invention is a fragment comprising the transmembrane domain of GP354. Specifically, this GP354 transmembrane domain is encoded by amino acids 508 to 530 (see FIG. 1) of the GP354 amino acid sequence of SEQ ID NO: 2.

  Yet another preferred embodiment of the above protein fragment has the C-terminal intracellular domain of GP354. Specifically, one intracellular domain of GP354 is encoded by amino acids 531-592 (see FIG. 1) of the GP354 amino acid sequence of SEQ ID NO: 2. Another form of the intracellular domain of GP354 is encoded by amino acids 534-708 (see FIG. 5) of the GP354 amino acid sequence of SEQ ID NO: 8. It is believed that these different intracellular domain forms can be generated by alternative splicing.

  A preferred protein fragment of the invention is encoded by nucleotides 139-923 of the gp354 cDNA sequence of SEQ ID NO: 1 (see FIG. 1). It is encoded by an RT-PCR fragment amplified from pancreatic RNA using primers, GX1-218 (SEQ ID NO: 16) and GX1-219 (SEQ ID NO: 17; see Example 2) and Consisting of amino acids 47-307 of number 2, ie, it encodes the first N-terminal Ig domain of GP354 (which lacks the first 12 amino acids out of 68 amino acids) and most of the second and third Ig domains. ing.

  As mentioned above, the present invention provides a hybridization-related protein having only a sequence of insertions or deletions, conservative substitutions or moderately conservative substitutions, having a sequence that substantially retains preferred GP354 activity. Or, as a cross-hybridizing protein, there is further provided, in particular, a protein that differs in sequence from the described protein having characteristics in the sequence identifiers (SEQ ID NOs) referred to above (SEQ ID NOs). As discussed above, the present invention further provides fusions of the polypeptides, proteins and protein fragments described herein to heterologous polypeptides.

  When used as an immunogen, various protein embodiments of the invention can be used to raise antibodies that specifically bind to various epitopes of the GP354 protein.

(Another definition of the characteristics of GP354 protein)
FIG. 1 shows the deduced amino acid sequence (SEQ ID NO: 2) encoded by the gp354 cDNA clone (SEQ ID NO: 1). Similarly, the amino acid sequences provided in SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 12 are the nucleotides provided in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 9, and SEQ ID NO: 11, respectively. Deduced from the sequence. Unless otherwise indicated, the amino acid sequence of the protein of the invention was determined as a putative translation from the nucleic acid sequence. Thus, any amino acid sequence set forth herein can include errors due to errors in this nucleic acid sequence as described in detail above. Furthermore, single nucleotide polymorphisms (SNPs) occur frequently in eukaryotic genomes (over 1.4 million SNPs have already been identified in the human genome (International Human Genome Sequencing Consortium, Nature 409: 860-921 (2001)). ), And the sequence determined from one individual of one species may differ from other allelic forms present in the population. Small amounts of deletions and insertions that do not alter the function of the protein can be found frequently.

  Accordingly, the present invention is not limited to GP354 polypeptides that are identical in sequence to the described polypeptides having the characteristics herein, but to at least about 80 in the described polypeptides and sequences having the characteristics herein. % Isolated protein, typically at least about 85%, 90%, 91%, 92%, 93%, 94% or 95 in the described polypeptides and sequences having the characteristics herein. An isolated protein that is% identical, typically at least about 96%, 97%, 98%, or 99% identical in sequence to the described polypeptide having the characteristics herein, and Most conservatively, the described polypeptides having the characteristics herein have at least about 99.5%, 99.6%, 99.7%, 9 in sequence. .8% and 99.9% identical to the isolated protein. These sequence variants can be naturally occurring or can result from human intervention by random mutagenesis or directed mutagenesis.

  For purposes herein, the percent identity of two amino acid sequences is determined by Tatiana et al., “Blast 2 sequences-a new tool for comparing protein and nucleotide sequence”, FEMS Microbiol Lett. 174: 247-250 (1999). This procedure is accomplished by the computer program Blast 2 SEQUENCES and is available online from the National Center for Biotechnology Information.

  To assess the percent identity of amino acid sequences, the Blast 2 SEQUENCES BlastP module is used with the following default values: (i) BLOSUM62 matrix (Henikoff et al., Proc. Natl. Acad. Sci USA 89 ( 22): 10915-9 (1992)); (ii) open gap 11 penalty and extension 1 gap penalty; and (iii) gap x_dropoff50 expect 10 word size 3 filter, and both sequences are The whole was entered.

  As is well known, amino acid substitutions frequently occur in natural allelic variants, and conservative substitutions often cause only minimal changes in protein function. Accordingly, the present invention provides an isolated protein having a sequence of GP354 protein or a portion thereof having not only a protein identical in sequence to the described protein having the characteristics herein, but also having conservative amino acid substitutions. ,I will provide a. Also provided are isolated proteins having the sequence of GP354 protein and portions thereof, with moderate conservative amino acid substitutions. These conservatively substituted or moderately conservatively substituted variants can exist naturally or can occur through human intervention.

  Allelic modification can be responsible for differences in the amino acid sequence between SEQ ID NO: 2 and SEQ ID NO: 8, for example, at positions 195, 196, 539, and 540. Splice variants (eg, differential 5 ′ splice site selection, or 3 ′ splice site selection) are also responsible for differences between the C-terminal amino acid sequence of SEQ ID NO: 2 and the C-terminal amino acid sequence of SEQ ID NO: 8 It can be.

  As is well known in the art, protein associations are also characterized using functional tests, the ability of the encoding nucleic acids to base pair with each other with a predetermined hybridization stringency. Thus, not only does it provide an isolated protein that is identical in sequence to the described protein having the characteristics herein, but also a variety of isolated polynucleotides of the present invention ("reference nucleic acids"). Providing an isolated protein (“hybridization related protein”) encoded by a nucleic acid that hybridizes under high stringency conditions (as defined herein above) in whole or in part Is another aspect of the present invention.

  Hybridization-related proteins can be alternative isoforms, homologs, paralogs, and orthologs of the GP354 protein of the invention. Particularly useful orthologs are derived from other primates such as chimpanzees, rhesus macaques, baboons, orangutans, and gorillas; from rodents such as rats, mice, guinea pigs; Rabbit animals such as rabbits Orthologs from domestic animals such as cattle, pigs, sheep, horses, goats.

  Protein relevance can also be characterized using a second functional test (the ability of the first protein to competitively inhibit the second protein from binding to the antibody). Accordingly, another aspect of the present invention not only provides isolated proteins that are identical in sequence to the proteins described in detail herein, but also provides various isolated GP354 proteins of the present invention ( Also provided is an isolated protein (“cross-reactive protein”) that competitively inhibits antibody binding to all or a portion of a “reference protein”). Such competitive inhibition can be readily determined using immunoassays well known to those skilled in the art.

  Details herein including proteins with deletions and insertions that result in up to 10% non-identity, proteins with conservative or moderately conservative substitutions, hybridization-related proteins, and cross-reactive proteins Among the proteins of the invention that differ in amino acid sequence from the proteins described in 1), proteins that substantially retain one or more GP354 activities are preferred (see above).

Residues that are tolerant of change but retain function are described in alanine scanning mutagenesis, Cunningham et al., Science 244 (4908): 1081-5 (1989); transposon linker scanning mutagenesis, Chen et al., Gene 263 (1-2) ): 39-48 (2001); a combination of homologous scanning mutagenesis and alanine scanning mutagenesis, Jin et al. Mol. Biol. 226 (3): 851-65 (1992); combinatorial alanine scanning followed by a functional assay, Weiss et al., Proc. Natl. Acad. Sci. USA 97 (16): 8950-4 (2000) can be identified by altering the protein at a known residue using methods known in the art. Transposon linker scanning kits are commercially available (New England Biolabs, Beverly, MA, USA, Catalog No. E7-102S; EZ :: TN ^™ In-Frame Linker Insertion Kit, Catalog No. EZI04KN, Epicentre Tech. , USA).

  As described further below, the isolated proteins of the present invention are specific immunogens that elicit antibodies that specifically recognize GP354 proteins, their isoforms, homologs, paralogs, and / or orthologs. Can be used as easily. These antibodies can then be assayed, inter alia, for the GP354 protein of the invention (eg, by ELISA for detection of protein fluid samples (eg, serum) or immunohistochemistry or for detection of proteins in tissue samples). Specific antibody-mediated isolation and / or purification (eg immunization) of GP354 protein for laser scanning cytometry or by flow cytometry for detection of intracellular proteins in cell suspensions Can be used specifically for (by sedimentation) and for use as a specific antagonist or agonist of GP354 action.

  The isolated protein of the present invention is also readily available for use as a specific standard in assays used to specifically determine the concentration and / or amount of the GP354 protein of the present invention. . As is well known, ELISA kits for the detection and quantification of protein analytes typically contain a known concentration of isolated and purified protein for use as a measurement standard (eg, human interferon). γ OptEIA kit, catalog number 555142, Pharmingen, San Diego, CA USA, contains human recombinant γ interferon produced by baculovirus).

  The isolated protein of the present invention is also readily available for use as a specific biomolecule capture probe for surface enhanced laser desorption ionization (SELDI) detection of protein-protein interactions (WO 98). WO98 / 59360; WO98 / 59361; and Merchant et al., Electrophoresis 21 (6): 1164-77 (2000), the disclosure of which is hereby incorporated by reference in its entirety). Similarly, the isolated protein of the present invention is also readily available for use as a specific biomolecule capture probe on a BIACORE surface plasmon resonance probe. Weinberger et al., Pharmacogenomics 1 (4): 395-416 (2000); Malmqvist, Biochem. Soc. Trans. 27 (2) 335-40 (1999).

  The isolated proteins of the present invention are also useful as therapeutic supplements in patients diagnosed with a specific deficiency in GP354 production or GP354 activity.

  The present invention also provides fragments of the various proteins of the present invention. This protein fragment is useful as an antigenic and immunogenic fragment of GP354. A “fragment” of a protein, as used herein, has an amino acid sequence that is identical to a portion of a reference amino acid sequence (this portion is at least 6 amino acids and of the reference nucleic acid). Less than total isolated proteins (also polypeptides, peptides, oligopeptides) are contemplated. As defined in this way, a “fragment” need not be obtained by physical fragmentation of a reference protein. However, this does not exclude such origins.

  A fragment of at least 6 consecutive amino acids is useful in mapping the B and T cell epitopes of the reference protein. G. Natl. Acad. Sci. USA 81: 3998-4002 (1984) and U.S. Pat. Nos. 4,708,871 and 5,595,915, the disclosures of which are hereby incorporated by reference in their entirety. That. In order to be useful in such epitope mapping, this fragment need not itself be part of the immunogenicity of an immunodominant epitope, nor does it need to be recognized by native antibodies. All fragments of at least 6 amino acids of this protein have utility in such studies.

  A fragment of at least 8 consecutive amino acids (often at least 15 consecutive amino acids) has utility as an immunogen for raising an antibody that recognizes the protein of the invention. See, for example, Lerner "Tapping the immunological repertoire to production antigens of predetermined specificity", Nature 299: 592-596 (1982); Shinnick et al., "Symnet cc. Rev. Microbiol. 37: 425-46 (1983); Sutcliffe et al., “Antibodies that react with predetermined sites on proteins”, Science 219: 660-6 (1983), the disclosures of which are incorporated herein by reference in their entirety. See). As described further in the above references, substantially all 8mers conjugated to a carrier (eg, protein) are found to be immunogenic (ie, antibodies to conjugated peptides). Thus, all fragments of at least 8 amino acids of the protein of the present invention have utility as immunogenicity.

  Fragments of at least 8, 9, 10, or 12 contiguous amino acids can also comprise whole proteins or portions thereof, antibodies (as in epitope mapping), and natural binding partners (eg, subunits in multimeric complexes, Or as a competitive inhibitor of the binding of such proteins to receptors or ligands; this competitive inhibition allows the identification and separation of molecules that specifically bind to the protein of interest (US Pat. No. 5 , 539,084 and 5,783,674 (which are incorporated herein by reference in their entirety).

  Accordingly, a protein or protein fragment of the present invention is at least 6 amino acids long, typically at least 8, 9, 10, or 12 amino acids long, and often at least 15 amino acids long. Often, the proteins of the invention or fragments thereof are at least 20, 25, 30, 35, or 50 amino acids in length or longer. Larger fragments having at least 75, 100, 150 or more amino acids are also useful and sometimes preferred.

  The present invention further provides fusions of each of the GP354 proteins and protein fragments of the present invention to heterologous polypeptides. By fusion is intended herein that the protein or protein fragment of the present invention is linearly contiguous to a heterologous polypeptide in a peptide bond polymer of amino acids or a peptide bond polymer of amino acid analogs. “Heterologous polypeptide” is intended herein to be a polypeptide that does not occur naturally in sequence with the protein or protein fragment of the invention. As so defined, the fusion may consist entirely of multiple fragments of the GP354 protein in an altered configuration; in such cases, any of the GP354 fragments is It can be considered heterologous to other GP354 fragments. More typically, however, the heterologous polypeptide is not derived from the GP354 protein itself.

  The fusion protein of the invention comprises at least one fragment of the protein of the invention, which fragment is at least 6, typically at least 8, often at least 15, and usefully at least 16, 17, 18, 19, or It is 20 amino acids long. Fragments of the proteins of the invention included in the fusion can be usefully at least 25, 50, 75, 100, or 150 amino acids long. Fusions comprising the entire GP354 protein of the present invention, or functional domains (eg, N-terminal GP354 Ig domain and C-terminal intracellular domain) have particular utility. Fusions comprising GP354 Ig domains are useful in manipulating fusion proteins that recognize other Ig domain-containing molecules and cells that present them on the surface. This, in turn, may involve heterologous sequences (eg, Toxins or therapeutic agents) may be useful.

  The heterologous polypeptide contained within the fusion protein of the invention is at least 6 amino acids long, often at least 8 amino acids long, and preferably at least 15, 20, 25 amino acids long. Fusions that include larger polypeptides (eg, IgG Fc regions) and even whole proteins (eg, luciferase or GFP chromophore containing proteins) have particular utility.

  As described above in the description of the vectors and expression vectors of the present invention, the heterologous polypeptide contained in the fusion protein of the present invention usefully facilitates purification and / or visualization of the recombinantly expressed protein. A polypeptide designed as such. Purification tags can also be incorporated into chemically synthesized fusions, but chemical synthesis typically provides sufficient purity that is sufficient for further purification by HPLC; however, visualization tags as described above Retain their usefulness even when the proteins are produced by chemical synthesis, and when so included, the fusion proteins of the present invention are useful as a direct detectable marker of the presence of GP354. Become.

  As also discussed above, the heterologous polypeptide contained in the fusion protein of the invention is useful for periplasmic space or extracellular space for prokaryotic hosts via the incorporation of secretion signals and / or leader sequences. For the environment, eukaryotes, the culture medium may include a polypeptide that facilitates secretion of the recombinantly expressed protein.

  Other useful protein fusions of the invention include those that allow the use of the proteins of the invention as bait in yeast two-hybrid systems. Bartel et al. (Eds.), The Yeast Two-Hybrid System, Oxford University Press (1997) (ISBN: 0195109384); Zhu et al. Et al., Trends Genet. 10 (8): 286-92 (1994); Mendelsohn et al., Curr. Opin. Biotechnol. 5 (5): 482-6 (1994); Luban et al., Curr. Opin. Biotechnol. 6 (1): 59-64 (1995); Allen et al., Trends Biochem. Sci. 20 (12): 511-6 (1995); Dress, Curr. Opin. Chem. Biol. 3 (1): 64-70 (1999); Topcu et al., Pharm. Res. 17 (9): 1049-55 (2000); Fasena et al., Gene 250 (1-2): 1-14 (2000), the disclosures of which are incorporated herein by reference in their entirety. See Typically, such fusions are E. coli. against either E. coli LexA or the yeast GAL4 DNA binding domain. Related bait plasmids expressing baits fused to nuclear localization signals are available.

  Other useful protein fusions include fusions that allow for the display of the encoded protein on the surface of phage or cells, as described above, endogenously detectable proteins (eg, fluorescent proteins or light emission). And fusion to stable protein domains (eg, immunoglobulin heavy chain domains such as IgG Fc regions).

  The proteins and protein fragments of the present invention may also be used to produce protein toxins (eg, Pseudomonas exotoxin A, diphtheria toxin, Shiga toxin A, anthrax, for specific excision of cells that bind to or incorporate the protein of the present invention. Can be usefully fused to fungal toxin lethal factor, ricin, or other biologically harmful moieties).

  Isolated proteins, protein fragments, and protein fusions of the present invention can be composed of natural amino acids joined by native peptide bonds, or over the entire length of the protein or one or more parts thereof Can include any or all of non-natural amino acid analogs, non-native linkages, and post-synthetic (post-translational) modifications.

  As is well known in the art, when isolated proteins are used (eg, for epitope mapping), the scope of such non-natural analogs, non-native inter-residue linkages, or post-synthetic modifications are It is limited to the range that allows the binding of the peptide to the antibody. When used as an immunogen for the preparation of antibodies in non-human hosts (eg, mice), the scope of such non-natural analogs, non-native inter-residue linkages, or post-synthetic modifications is It is limited to a range that does not interfere with the originality. If the isolated protein is used as a therapeutic agent (eg, vaccine) or for replacement therapy, the scope of such changes is limited to a range that does not toxic the isolated protein.

  Techniques for incorporating unnatural amino acids during solid phase chemical synthesis or by recombinant methods are well established in the art. The procedure is described in particular by Chan et al. (Eds.), Fmoc Solid Phase Peptide Synthesis: A Practical Approach (Practical Approaches Series), Oxford Univ. Press (March 2000) (ISBN: 0199637245); Jones, Amino Acid and Peptide Synthesis (Oxford Chemistry Primers, No7), Oxford Univ. Press (August 1992) (ISBN: 01858556683); and Bodanzky, Principles of Peptide Synthesis (Springer Laboratory), Springer Verlag (December 1993) (see ISBN: 038756443). (Incorporated in the specification).

  Natural amino acid D-enantiomers can be easily incorporated during chemical peptide synthesis; peptides constructed from D-amino acids are more resistant to proteolytic attack; incorporation of D-enantiomers is also Can be used to give a specific three-dimensional conformation to the peptide. Other amino acid analogs commonly added during chemical synthesis include ornithine, norleucine, phosphorylated amino acids (typically phosphoserine, phosphothreonine, phosphotyrosine), L-malonyltyrosine (a non-hybridizable analog of phosphotyrosine). (Kole et al., Biochem. Biophys. Res. Com. 209: 817-821 (1995)) and various halogenated phenylalanine derivatives.

  Amino acid analogs with detectable labels can also be usefully incorporated during synthesis to provide labeled polypeptides. For example, biotin can be added using biotinoyl-(9-fluorenylmethoxycarbonyl) -L-lysine (FMOC biocytin) (Molecular Probes, Eugene, OR, USA). (Biotin can also be added enzymatically by incorporation of an E. coli BirA substrate peptide into the fusion protein.) FMOC and tBOC derivatives of dabcyl-L-lysine (Molecular Probes, Inc., Eugene, OR , USA) can be used to incorporate dabsyl chromophores at selected sites in the peptide sequence during synthesis. The aminonaphthalene derivative EDANS (the most common chromophore for pairing with a dub silk enchanter in a fluorescence resonance energy transfer (FRET) system) is EDANS--FMOC-L-glutamic acid or the corresponding tBOC derivative (both Molecular Probes , Inc. Eugene, OR, USA) can be introduced during automated peptide synthesis. The tetramethylrhodamine chromophore can be incorporated during automated FMOC synthesis of peptides using (FMOC)-TMR-L-lysine (Molecular Probes, Inc. Eugene, OR, USA).

  Other useful amino acid analogs that can be incorporated during chemical synthesis include aspartic acid, glutamic acid, lysine, and tyrosine analogs with allyl side chain protection (Applied Biosystems, Inc., Foster City, CA, USA). An allyl side chain allows the synthesis of cyclic, branched, sulfonated, glycosylated, and phosphorylated peptides. The majority of other FMOC-protected unnatural amino acid analogs that can be incorporated during chemical synthesis are commercially available from, for example, The Peptide Laboratory (Richmond, CA, USA).

  Unnatural amino acid residues are also added biosynthetically by engineering suppressor tRNAs (typically tRNAs that recognize UAG stop codons) by chemical aminoacylation with the desired unnatural amino acid. obtain. Conventional site-directed mutagenesis is used to introduce a selected stop codon UAG at the site of interest in the protein gene. When an acylated suppressor tRNA and a mutated gene are combined in an in vitro transcription / translation system, the unnatural amino acid is incorporated in response to a UAG codon to give a protein containing that amino acid at a specified position. Liu et al., Proc. NatlAcad. Sci. USA 96 (9): 4780-5 (1999); Wang et al., Science 292 (5516); 498-500 (2001).

  Isolated GP354 proteins, protein fragments and fusion proteins of the invention can also contain non-native interresidue linkages, including linkages that produce cyclic and branched forms. Isolated GP354 proteins and protein fragments of the present invention can also include post-translational modifications and post-synthetic modifications, either throughout the length of the protein or localized to one or more of its portions. .

  For example, when produced by recombinant expression in eukaryotic cells, isolated proteins, fragments and fusion proteins of the invention typically include N-linked and / or O-linked glycosylation, and these patterns Reflects both the availability of glycosylation sites in the protein sequence and the identity of the host cell. Further modification of the glycosylation pattern can be performed enzymatically. As another example, the recombinant polypeptides of the present invention may also include a modified starting methionine residue in some cases resulting from host-mediated processes.

  If the proteins, protein fragments, and protein fusions of the present invention are produced by chemical synthesis, post-synthetic modification can be performed either before deprotection and cleavage from the resin or after deprotection and cleavage. Modifications before deprotection and cleavage of the synthetic protein often allow greater control, for example by allowing targeting of the modified moiety to the N-terminus of a resin-bound synthetic peptide. Useful post-synthetic (and post-translational) modifications include conjugation to a detectable label such as a luminophore. A wide variety of amine- and thiol-reactive properties that react on the one hand with the N-terminal and ε-amino groups of lysine residues and on the other hand with the free thiol groups of cysteine residues under non-denaturing conditions. Chromophore derivatives have been synthesized.

  Kits are commercially available that allow conjugation of proteins to various amine- or thiol-reactive chromophores; Molecular Probes, Inc. (Eugene, OR, USA) is, for example, Alexa Fluor 350, Alexa Fluor 430, Fluorescein-EX, Alexa Fluor 488, Oregon Green 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 546, Alexa Fluor 546, Alexa Fluor 546 And kits for conjugation of proteins to Texas Red-X. Alexa Fluor (registered trademark) 350, Alexa Fluor (registered trademark) 488, Alexa Fluor (registered trademark) 532, Alexa Fluor (registered trademark) 546, Alexa Fluor (registered trademark) 568, Alexa Fluor (registered trademark) 594, Alexa Fluor. (Registered trademark) 647 (monoclonal antibody labeling kit), BODIPY dye, Cascade Blue, Cascade Yellow, Dansyl, Lisamin Rhodamine B, Marina Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, Rhodamine Green, Rhodamine Green A wide variety of other compounds, including tetramethylrhodamine, Texas Red Emissions reactive and thiol-reactive chromophores are commercially available (Molecular Probes, Inc., Eugene, OR, USA).

  The polypeptides of the present invention can also be conjugated to chromophores, other proteins, and other macromolecules using bifunctional linking reagents. Common homobifunctional reagents include, for example, APG, AEDP, BASED, BMB, BMDB, BMH, BMOE, BM [PEO] 3, BM [PEO] 4, BS3, BSOCOES, DFDNB, DMA, DMP, DMS , DPDPB, DSG, DSP (Lomant reagent), DSS, DST, DTBP, DTME, DTSSP, EGS, HBVS, Sulfo-BSOCOES, Sulfo-DST, Sulfo-EGS (all available from Pierce, Rockford, IL, USA) Common heterobifunctional crosslinkers include ABH, AMAS, ANB-NOS, APDP, ASBA, BMPA, BMPH, BMPS, EDC, EMCA, EMCH, EMCS, KMUA, KMUH, GMBS, LC-SMCC LC-SPDP, MBS, M2C2H, MPBH, MSA, NHS-ASA, PDPH, PMPI, SADP, SAED, SAND, SANPAH, SASD, SATP, SBAP, SFAD, SIA, SIAB, SMCC, SMPB, SMPH, SMPT, SPDP, Sulfo-EMCS, Sulfo-GMBS, Sulfo-HSAB, Sulfo-KMUS, Sulfo-LC-SPDP, Sulfo-MBS, Sulfo-NHS-LC-ASA, Sulfo-SADP, Sulfo-SANPAH, Sulfo-SIAB, Sulfo-SIAB, Sulfo-SIAB, Sulfo-SIAB Sulfo-SMPB, Sulfo-LC-SMPT, SVSB, TFCS (all available from Pierce, Rockford, IL, USA).

  The proteins, protein fragments, and protein fusions of the present invention can be conjugated to chromophores that are not amine or thiol reactive using such crosslinkers. Other labels that can be usefully conjugated to the proteins, protein fragments, and fusion proteins of the present invention include radiolabels, endoscopic ultrasonography contrast agents, and MRI contrast agents. The proteins, protein fragments, and protein fusions of the present invention are also carrier proteins (eg, KLH, bovine thyroglobulin, and bovine serum albumin (BSA)) to increase immunogenicity for raising anti-GP354 antibodies. Even can be usefully conjugated using cross-linking agents.

  The GP354 proteins, protein fragments and protein fusions of the present invention can also typically be conjugated to polyethylene glycol (PEG); PEGylation increases the serum half-life of proteins administered intravenously for replacement therapy . Delgado et al., Crit. Rev. Ther. Drug Carrier Syst. 9 (3-4): 249-304 (1992); Scott et al., Curr. Pharm. Des. 4 (6): 423-38 (1998); DeSantis et al., Curr. Opin. Biotechnol. 10 (4): 324-30 (1999), the entirety of which is incorporated herein by reference. PEG monomers are PEGylated using PEG monomers activated with tresyl chloride (2,2,2-trifluoroethanesulfonyl chloride) that allow direct conjugation under mild conditions, It can be attached to the protein directly or via a linker.

  Isolated GP354 proteins of the present invention (including fusions thereof) are typically less than about 100 amino acids, either by recombinant expression using the expression vectors of the present invention as described above, or in particular less than about 100 amino acids. In some cases, it can be produced by chemical synthesis (typically solid phase synthesis) and sometimes by in vitro translation as required.

  After production of the isolated protein of the present invention, purification can be performed as necessary. Purification of recombinantly expressed proteins is now within the skill of the art. For example, Thorner et al. (Eds.), Applications of Chimeric Genes and Hybrid Proteins, Part A: Gene Expression and Protein Purification (eds.Methods in Volumes 18: A). , Cloning, Gene Expression and Protein Purification: Experimental Procedures and Process Relation, Oxford Univ. Press (2001) (ISBN: 0195132947); Marshak et al., Strategies for Protein Purification and Characterization: A Laboratory Course Manual, Cold Spring Harbor 9 (N). , Protein Purification Applications, Oxford University Press (2001), the disclosures of which are hereby incorporated by reference in their entirety. Therefore, it need not be detailed here.

  However, concisely, when a purification tag is fused through the use of an expression vector with such a tag, purification is a means appropriate to the tag (eg, immobilized metal for polyhistidine tags). The use of affinity chromatography). Other techniques common in the art include ammonium sulfate fractionation, immunoprecipitation, protein high performance liquid chromatography (FPLC), high performance liquid chromatography (HPLC) and preparative gel electrophoresis. Purification of chemically synthesized peptides can be easily effected, for example, by HPLC.

  Accordingly, it is an aspect of the present invention to provide an isolated GP354 protein of the present invention in pure or substantially pure form. A purified protein of the invention is a protein isolated as described above, which is at a concentration of at least 95% when measured on a mass basis (w / w) with respect to the total protein in the composition. Exists. Such purified products can often be obtained during chemical synthesis without further purification, for example by HPLC. The purified protein of the invention may be present even at concentrations of 96%, 97%, 98% and 99% (measured on a mass basis with respect to total protein in the composition). The proteins of the invention can still be present at levels of 99.5%, 99.6% and 99.7%, 99.8% or even 99.9% after purification as by HPLC.

  A high level of purity is preferred when the isolated protein of the present invention is used as a therapeutic (eg, as a vaccine or for replacement therapy), but the isolated protein of the present invention is also Even low purity is useful. For example, a partially purified protein of the invention can be used as an immunogen to raise antibodies in laboratory animals.

  Accordingly, the present invention provides an isolated protein of the present invention in a substantially purified form. A “substantially purified protein” of the present invention is an isolated protein as described above that is present at a concentration of at least 70% as measured on a mass basis with respect to the total protein in the composition. Typically, substantially purified protein is at least 75%, 80%, or at least 85%, 90%, 91%, 92%, 93%, as measured on a mass basis with respect to total protein in the composition, It is present at 94%, even 94.5% or even at a concentration of at least 94.9%.

  In preferred embodiments, the purified and substantially purified proteins of the invention are in a composition that lacks detectable ampholyte, acrylamide monomer, bisacrylamide monomer, and polyacrylamide.

  The GP354 proteins, fragments and fusions of the invention can usually be bound to a substrate. The substrate can be porous, substantially non-porous (eg, plastic) or solid; planar or non-planar; the bond can be covalent or non-covalent. The porous substrate (usually a membrane) typically comprises nitrocellulose, polyvinylidene fluoride (PVDF) or cationic derivatized hydrophilic PVDF; when so bound, the protein of the invention, Fragments and fusions can be used to detect and quantify, for example, antibodies in serum that specifically bind to the immobilized protein of the invention. The proteins, fragments and fusions of the present invention, when bound to a substantially non-porous substrate, such as plastic, specifically bind to the solidified protein of the present invention, eg, detect antibodies in serum and Can be used to quantify.

  The proteins, fragments and fusions of the present invention can also be bound to a substrate that is suitable for use as a surface enhanced laser desorption ionization source; A protein, fragment or fusion is useful for binding and then detecting a second protein, which protein has sufficient affinity or exhibits a biological interaction between them to the surface-bound protein or Join by avidity.

  The proteins, fragments and fusions of the invention can also be bound to substrates that are suitable for use in surface plasmon resonance detection. When so bound, the proteins, fragments or fusions of the present invention are useful for binding and then detecting a second protein, which binds a surface-bound protein to a significant organism between the two. Bind with sufficient affinity or avidity to exhibit a chemical interaction.

(Antibodies and antibody-producing cells)
The present invention includes antibodies that specifically bind to the GP354 proteins and protein fragments of the present invention or that bind to one or more proteins and protein fragments encoded by the isolated GP354 nucleic acids of the present invention (fragments and Derivatives). Antibodies are present in native conformation proteins, or in some cases, eg, in proteins that are denatured by solubilization in SDS, linear in proteins or protein fragments. It may be specific for an epitope, a non-contacting epitope or a conformational epitope.

  The invention also provides that antibody binding is competitive by one or more GP354 proteins and protein fragments of the invention or by one or more proteins and protein fragments encoded by an isolated gp354 polynucleotide of the invention. Provided are antibodies (including fragments and derivatives thereof) that can be inhibited.

  In a first series of antibody embodiments, the invention relates to an antibody (both polyclonal and monoclonal) and its binding that specifically binds to a polypeptide having an amino acid sequence in SEQ ID NO: 2, 4, 8, 10 or 12. Fragments and derivatives are provided.

  Such antibodies are useful in various in vitro immunoassays (eg, Western blotting and ELISA). Such antibodies are also useful for isolating and purifying GP354 protein (including related cross-reactive proteins) by immunoprecipitation, immunoaffinity chromatography or magnetic bead-mediated purification. . Such methods are well known in the art.

  In a second series of antibody embodiments, the invention relates to antibodies (both polyclonal and monoclonal) whose specific binding of antibodies can be competitively inhibited by the isolated proteins and polypeptides of the invention and Fragments and derivatives thereof are provided.

  In other embodiments, the present invention further provides a detectably labeled antibody as described above, and in yet other embodiments, provides the above antibody bound to a substrate.

  Using anti-PanCAM antibodies of the invention (Examples 11 and 19, below), pancreatic beta cells (eg, derived from large animals (eg, cows, pigs, and horses); or primates (eg, monkeys and chimpanzees) Origin) can be isolated. The β cells so obtained are useful for making encapsulated (and therefore immunoprotected) xenografts with limited survival in diabetic patients (eg, human patients).

  In some embodiments, the antibodies of the invention are used to target therapeutic agents against beta islets. For example, type I diabetes is labeled by T cell entry into the β islets. Thus, cytotoxic agents that are specific for these T cells (eg, anti-CD3, anti-CD4, or anti-CD8 antibodies) (ie, agents that impair cell viability and / or function) are It can be conjugated to an anti-PanCAM antibody and thereby directed to the disease site. In another example, antisense therapy (eg, antisense oligos against MHC type II molecules, which are highly expressed on T lymphocytes that attack β cells; Chaturvedi et al., J Immunol 164 (12): 6610-20 (2000)) can bind to anti-PanCAM antibodies and can be directed to beta islets.

  The antibodies of the present invention also tend to be multiple foci, so that cytotoxic agents (eg, non-specific agents such as radiopharmaceuticals) may be used to direct cytotoxicity to sites of insulinoma that are difficult to treat. Targetable toxins such as ricin and cholera toxin; and chemotherapeutic agents such as doxorubicin). Antibodies may also be used to treat gene therapy that inhibits or otherwise alters tumor behavior (eg, either a responsive oncogene or its insulin gene, or a gene in a signaling mechanism that regulates insulin release). DNA can be delivered to the insulinoma as to deliver an antisense oligonucleotide or DNA construct).

  As used herein, the term “antibody” refers to a polypeptide that can specifically bind to a first molecular species, at least in part encoded by at least one immunoglobulin gene, and such A fragment or derivative thereof that remains capable of specific binding.

  “Specific binding” and “specific binding” as used herein refers to the first molecular species rather than the antibody binding to the other molecular species in which the antibody and the first molecular species are mixed. Intended for the ability to bind to. An antibody is specifically said to “recognize” a first molecular species if the antibody can specifically bind to the first molecular species.

  As is well known in the art, the extent to which an antibody can distinguish between molecular species in a mixture depends in part on the conformational relevance of the species in the mixture; Antibodies are at least 2 times, more typically at least 5 times, typically 10 times, 25 times, 50 times, more than 75 times and often more than 100 times, and sometimes more than 500 times or 1000 times Many distinguish beyond accidental binding to non-GP354 proteins. When used to detect a protein or protein fragment of the present invention, the antibody of the present invention is sufficient when it can be used to determine the presence of the protein of the present invention in a sample derived from human pancreas and neural tissue. It is specific.

Typically, the affinity or avidity of an antibody of the invention (or antibody multimer in the case of an IgM pentamer) for the GP354 protein or protein fragment of the invention is at least about 1 × 10 ⁻⁶ molar (M), typically At least about 5 × 10 ⁻⁷ M, usually at least about 1 × 10 ⁻⁷ M, and at least 1 × 10 ⁻⁸ M, 5 × 10 ⁻⁹ M and 1 × 10 ⁻¹⁰ M affinity and avidity However, it has been found to be particularly useful.

  The antibodies of the present invention can be in naturally occurring forms from any mammalian species (eg, IgG, IgM, IgD, IgE and IgA).

  Human antibodies, although rare, can be drawn directly from human donors or human cells. In such cases, antibodies to the protein of the invention typically result from accidental immunization (eg, autoimmunization) with the protein or protein fragment of the invention. Such antibodies are typically not constant, but are polyclonal.

  Human antibodies are more frequently obtained using transgenic animals that express human immunoglobulin genes. This transgenic animal can be positively immunized with the GP354 protein immunogen of the present invention. Human Ig transgenic mice capable of producing human antibodies and methods for producing human antibodies from transgenic mice by specific immunization are well known in the art. For example, U.S. Patent Nos. 6,162,963; 6,150,584; 6,114,598; 6,075,181; 5,939,598; No. 5,877,397; No. 5,874,299; No. 5,814,318; No. 5,789,650; No. 5,770,429; No. 5,661,016 No. 5,633,425; No. 5,625,126; No. 5,569,825; No. 5,545,807; No. 5,545,806 and No. 5 , 591,669 (the disclosures of which are hereby incorporated by reference in their entirety). Such antibodies are typically monoclonal and are typically produced using techniques developed for the production of murine antibodies.

  When the antibodies of the invention are to be administered to humans as an in vivo diagnostic or therapeutic agent, the recipient immune response to the administered antibody is often administered by an antibody from another species such as a mouse. Human antibodies are particularly useful and are often preferred because they are substantially lower than the recipient immune response caused by.

  The IgG, IgM, IgD, IgE and IgA antibodies of the invention are also usefully useful in rodents (typically mice as well as rats, guinea pigs and hamsters), rabbit eyes (typically Are obtained from other mammalian species, including rabbits) and larger mammals (eg, sheep, goats, cows and horses). In such cases, accidental immunization is not required, as is the case with transgenic non-human mammals that produce human antibodies, and non-human mammals typically Alternatively, protein fragments are used to positively immunize according to standard immunization protocols.

  As noted above, the carrier, typically, using a bifunctional linker as described above elsewhere (these considerations are incorporated herein by reference), When conjugated to a protein such as bovine thyroglobulin, keyhole limpet hemocyanin or bovine serum albumin, substantially all fragments of 8 or more contiguous amino acids of the protein of the present invention are effectively used as an immunogen. Can be done.

  Immunogenicity can also be conferred by the fusion of the protein and protein fragments of the present invention with other moieties. The peptides of the invention can be produced, for example, by solid phase synthesis in a branched polylysine core matrix; these multiple antigen peptides (MAPs) improve in high purity, increased avidity, precise chemical definition and vaccine development Provide safety. Tam et al., Proc. Natl. Acad. Sci. USA 85: 5409-5413 (1988); Posnett et al., J. Biol. Biol. Chem. 263, 1719-1725 (1988).

  Protocols for immunizing non-human mammals are very well established in the art (Harlow et al. (Eds.), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1998) (ISBN: 0879793142); Ed.), Current Protocols in Immunology, John Wiley & Sons, Inc. (2001) (ISBN: 0-471-52 276) and Zola, Monoclonal antigens and preparations of uses of the ed. s: From Background to Bench), Springer Verlag (2000) (ISBN: 0387915907) (these disclosures, which is incorporated by reference herein)).

  Antibodies from non-human mammals can be polyclonal or monoclonal, where polyclonal antibodies have particular advantages in immunohistochemical detection of proteins of the invention, and monoclonal antibodies are of the proteins of the invention. There are advantages in identifying and distinguishing specific epitopes.

  Following immunization, the antibodies of the invention can be produced using any art-accepted technique. Such techniques are well known in the art (Coligan et al. (Eds.), Current Protocols in Immunology. John Wiley & Sons, Inc. (2001) (ISBN: 0-471-52276-7); Zola, Monoclonal Antibodies: and Use of Monoclonal Antibodies and Engineered Antibiotic Derivatives (Basics: From Background to Bench), Spring Verlag (2000) (B7) 909015 (ISBN: 037915) d Charactrization, CRC Press (2000) (ISBN: 08493394457); Harlow et al. (eds), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1998) (ISBN: 0879493142) (ISBN: 0879963142). Volume, Humana Press (1995) (ISBN: 0896033082); Delves (ed.), Antibody Production: Essential Techniques, John Wiley & Son Ltd (1997) (ISBN: 0471970107); ution: An Antibody Methods Manual, Chapman & Hall (1997) (ISBN: 0412141914) (the whole of these, which is herein incorporated by reference)). Therefore, it is not necessary to elaborate here.

  Recombinant expression in host cells is particularly useful when fragments or derivatives of the antibodies of the invention are desired. Host cells for production of recombinant antibodies (either whole antibodies, antibody fragments or antibody derivatives) can be prokaryotic or eukaryotic.

  Prokaryotic hosts are particularly useful for producing the phage-displayed antibodies of the present invention. Phage-displayed antibody technology where antibody variable region fragments are fused to gene III protein (pIII) or gene VIII protein (pVIII) for display on the surface of, for example, filamentous phage (eg, M13) Are well established to date (Sidhu, Curr. Opin. Biotechnol. 11 (6): 610-6 (2000); Griffiths et al., Curr. Opin. Biotechnol. 9 (1): 102-8). (1998); Hoogenboom et al., Immunotechnology, 4 (1): 1-20 (1998); Rader et al., Curr. Opin. Biotechnol. 8: 503-508 (1997); Aujame et al., Hum. bodies 8: 155-168 (1997); Hoogenboom, Trends in Biotechnol. 15: 62-70 (1997); de Kruif et al., 17: 453-455 (1996); Barbas et al., Trends Biotechnol. 1996); Winter et al., Annu. Rev. Immunol. Techniques and protocols recently edited as follows: Barbas et al., Page Display: A Laboratory Manual, Cold Spring Harbor Labo atory Press (2001) (ISBN0-87969-546-3); Kay et al. (eds), Phage Display of Peptides and Proteins: A Laboratory Manual, Academic Press, Inc. (1996); Abelson et al. (Eds.), Combinatorial Chemistry, Methods in Enzymology vol. 267, Academic Press (May 1996) (the disclosures of which are incorporated herein by reference in their entirety). Typically, the phage-displayed antibody fragment is a scFv fragment or a Fab fragment; if desired, the full-length antibody clones the variable region from the displaying phage to the complete antibody and further prokaryotic host cells or It can be produced by expressing a full-length antibody in a eukaryotic host cell.

  Eukaryotic cells are also useful for expression of the antibodies, antibody fragments and antibody derivatives of the present invention. For example, antibody fragments of the invention can be obtained from Pichia pastoris, Takahashi et al., Biosci. Biotechnol. Biochem. 64 (10): 2138-44 (2000); Freyre et al., J. MoI. Biotechnol. 76 (2-3): 157-63 (2000); Fischer et al., Biotechnol. Appl. Biochem. 30 (Pt2): 117-20 (1999); Pennell et al., Res. Immunol. 149 (6): 599-603 (1998); Eldin et al., J. Biol. Immunol. Methods. 201 (1): 67-75 (1997); and Saccharomyces cerevisiae, Frenken et al., Res. Immunol. 149 (6): 589-99 (1998); Shusta et al., Nature Biotechnol. 16 (8): 773-7 (1998), the disclosures of which are incorporated herein in their entirety.

  The antibodies of the present invention (including antibody fragments and derivatives) can also be produced in insect cells. Li et al., Protein Expr. Purif. 21 (1): 121-8 (2001); Ailor et al., Biotechnol. Bioeng. 58 (2-3): 196-203 (1998); Hsu et al., Biotechnol. Prog. 13 (1): 96-104 (1997); Edelman et al., Immunology 91 (1): 13-9 (1997); and Nesbit et al., J. Biol. Immunol. Methods. 151 (1-2): 201-8 (1992) (the disclosures of which are incorporated herein in their entirety).

  The antibodies and fragments and derivatives thereof of the present invention can also be produced in plant cells. Giddings et al., Nature Biotechnol. 18 (11): 1151-5 (2000); Gavilondo et al., Biotechniques 29 (1): 128-38 (2000); Fischer et al., J Biol. Regul. Homeost. Agents 14 (2): 83-92 (2000); Fischer et al., Biotechnol. Appl. Biochem. 30 (Pt2): 113-6 (1999); Fischer et al., Biol. Chem. 380 (7-8): 825-39 (1999); Russell, Curr. Top. Microbiol. Immunol. 240: 119-38 (1999); and Ma et al., Plant Physiol. 109 (2): 341-6 (1995), the disclosures of which are incorporated herein in their entirety.

  Mammalian cells useful for recombinant expression of the antibodies, antibody fragments and antibody derivatives of the present invention include CHO cells, COS cells, 293 cells and myeloma cells. Verma et al. Immunol. Methods 216 (1-2): 165-81 (1998) reviews and compares bacterial, yeast, insect and mammalian expression systems for antibody expression.

  The antibodies of the present invention are also described in Merk et al. Biochem. (Tokyo). 125 (2): 328-33 (1999) and Ryabova et al., Nature Biotechnol. 15 (1): 79-84 (1997) and can be prepared by cell-free translation, and Pollock et al., J. Biol. Immunol. Methods 231 (1-2): 147-57 (1999), the disclosures of which are prepared in the milk of transgenic animals as further described in their entirety herein by reference. obtain.

  The invention includes one or more GP354 proteins and protein fragments of the invention, antibody fragments that specifically bind to one or more proteins and protein fragments encoded by the isolated gp354 polynucleotides of the invention, or the present Further provided are antibody fragments whose binding can be competitively inhibited by one or more proteins and protein fragments of the invention, or one or more proteins and protein fragments encoded by the isolated polynucleotides of the invention.

Among such antibody fragments, useful fragments are Fab, Fab ′, Fv, F (ab) ′ ₂ , and single chain Fv (scFv) fragments. Other useful fragments are described by Hudson, Curr. Opin. Biotechnol. 9 (4): 395-402 (1998). Accordingly, the present invention relates to one or more GP354 proteins and protein fragments of the present invention, antibody derivatives that specifically bind to one or more proteins and protein fragments encoded by the isolated nucleic acids of the present invention, or the present Antibody derivatives are provided wherein binding can be competitively inhibited by one or more proteins and protein fragments of the invention, or one or more proteins and protein fragments encoded by the isolated polynucleotides of the invention.

  Among such derivatives, useful derivatives are chimeric antibodies, primatized antibodies and humanized antibodies; such derivatives are therefore in humans more than unmodified antibodies from non-human mammalian species. It is less immunogenic and is more suitable for in vivo administration.

  A chimeric antibody is typically an immunoglobulin heavy and / or light chain variable region (CDR and frame) of one (typically mouse) immunoglobulin fused to the constant region of another species (typically human). Including both work residues). See, eg, US Pat. No. 5,807,715; Morrison et al., Proc. Natl. Acad. Sci USA. 81 (21): 6851-5 (1984); Sharon et al., Nature 309 (5966): 364-7 (1984); Takeda et al., Nature 314 (6010): 452-4 (1985) (the disclosure of which is The entirety of which is incorporated herein by reference).

  Primatized and humanized antibodies typically comprise heavy and / or light chain CDRs or human antibody V region frameworks from mouse antibodies transplanted into non-human primates (usually human constant regions). (Riechmann et al., Nature 332 (6162): 323-7 (1988); Co et al., Nature 351 (6326): 501-2 (1991); US Pat. No. 6,054,297; ibid.) 82,337; 5,770,196; 5,766,886; 5,821,123; 5,869,619; 6,180,377 6,013,256; 5,693,761; and 6,180,370 (the disclosures of which are incorporated herein by reference in their entirety). ).

  Other useful antibody derivatives of the invention include heteromeric antibody conjugates and antibody fusions (eg, bi-antibodies (bispecific antibodies), single-chain bi-antibodies and internal antibodies).

  The antibodies (including fragments and derivatives thereof) of the present invention can be usefully labeled. Accordingly, another aspect of the present invention is a label that specifically binds to one or more proteins and protein fragments of the present invention, one or more GP354 proteins and protein fragments encoded by the isolated polynucleotides of the present invention. A labeled antibody whose binding can be competitively inhibited by one or more proteins and protein fragments of the present invention, or one or more proteins and protein fragments encoded by the isolated polynucleotides of the present invention. Is to provide.

  The choice of label depends in part on the desired application. When the antibodies of the invention are used for immunohistochemical staining of tissue samples, the label can be usefully an enzyme that catalyzes the production and local deposition of detectable product. Enzymes, typically conjugated to antibodies, to allow their immunohistochemical visualization are well known and include alkaline phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase (HRP) And urease. The antibodies of the present invention can also be labeled using colloidal gold.

  Numerous representative materials for the production and deposition of visually detectable products, luminescent and fluorescent labels are also well known and need not be described further. See, for example, Thorpe et al., Methods Enzymol. 133: 331-53 (1986); Kricka et al., J. Biol. Immunoassay 17 (1): 67-83 (1996); and Lundqvist et al., J. Biol. Biolumin. Chemilumin. 10 (6) 353-9 (1995) (the disclosures of which are incorporated herein by reference in their entirety). Kits for enhanced chemiluminescence detection (ECL) are commercially available.

  If the antibodies of the invention are used, for example, for flow cytometric detection, scanning laser cytometric detection, or fluorescent immunoassay, they can be usefully labeled with a fluorophore. There are a wide variety of fluorophore labels that can be usefully linked to the antibodies of the present invention. Many are described, for example, in Molecular Probes, Inc. , Eugene, OR, USA.

  For secondary detection using labeled avidin, streptavidin, captavidin or neutravidin, the antibodies of the invention can be usefully labeled with biotin.

When the antibodies of the present invention are used, for example, for Western blot applications, these antibodies are useful with radioisotopes (eg, ³³ P, ³² P, ³⁵ S, ³ H and ¹²⁵ I). Can be labeled. As another example, when the antibody of the present invention is used for radioimmunotherapy, this label is useful for ²²⁸ Th, ²²⁷ Ac, ²²⁵ Ac, ²²³ Ra, ²¹³ Bi, ²¹² Pb, ²¹² Bi, ²¹¹ At, ²⁰³ Pb, ¹⁹⁴ Os, ¹⁸⁸ Re, ¹⁸⁶ Re, ¹⁵³ Sm, ¹⁴⁹ Tb, ¹³¹ I, ¹²⁵ I, ¹¹¹ In, ¹⁰⁵ Rh, ^99m Tc, ⁹⁷ Ru, ⁹⁰ Y, ⁹⁰ Sr, ⁸⁸ Y ⁷² Se, ⁶⁷ Cu or ⁴⁷ Sc. As another example, when the antibodies of the present invention are used for in vivo diagnostic applications, these antibodies can be used as MRI contrast agents (eg, gadolinium diethylenetriaminepentaacetic acid (DTPA), Lauffer et al., Radiology 207 (2)). : 529-38 (1998)) or by radioisotope labeling. As will be appreciated by those skilled in the art, the use of any of the above labels is not limited to the applications mentioned.

  The antibodies of the present invention (including fragments and derivatives thereof) may also be used biologically to target the proteins of the present invention to the ablating action of toxins on cells that display and / or express. It can be conjugated to a harmful moiety (eg, a toxin). In general, antibodies in such immunotoxins are conjugated to Psedomonas exotoxin A, diphtheria toxin, Shiga toxin A, anthrax toxin lethal factor, or ricin. Hall (Ed.), Immunotoxin Methods and Protocols (Methods in Molecular Biology, 166), Humana Press (2000) (ISBN: 0896037754), Frankel et al. (Ed.), Clinical Aps. 1998) (ISBN: 3540640975). These disclosures are incorporated herein by reference in their entirety for review.

  The antibodies of the invention can usefully be bound to a substrate. Accordingly, the present invention provides antibodies that specifically bind to one or more GP354 proteins and protein fragments of the present invention, one or more proteins and protein fragments encoded by the isolated polynucleotides of the present invention. . That is, the binding can be competitively inhibited by one or more proteins and protein fragments of the invention bound to a substrate, or by one or more proteins and protein fragments encoded by an isolated polynucleotide of the invention. . The substrate can be porous or non-porous, planar or non-planar.

  For example, the antibodies of the present invention can be usefully conjugated to a filtration medium (eg, NHS-activated Sepharose or CNBr-activated Sepharose) for immunoaffinity chromatography purposes.

  The antibodies of the invention can also be usefully conjugated to paramagnetic microspheres, typically by biotin-streptavidin interaction, which then expresses the protein of the invention or It can be used for the isolation of cells for presentation. As another example, the antibodies of the invention can be usefully bound to the surface of a microtiter plate for ELISA.

  As mentioned above, the antibodies of the invention can be produced in prokaryotic and eukaryotic cells. Accordingly, the present invention also provides cells that express the antibodies of the invention, including hybridoma cells, B cells, plasma cells, and host cells that have been recombinantly modified to express the antibodies of the invention. .

  The present invention also includes aptamers evolved to specifically bind to one or more GP354 proteins and protein fragments of the present invention, one or more proteins and protein fragments encoded by the isolated polynucleotides of the present invention. I will provide a. That is, the binding can be competitively inhibited by one or more proteins and protein fragments of the present invention, one or more proteins and protein fragments encoded by the isolated polynucleotides of the present invention.

(Pharmaceutical compositions and treatment methods)
GP354 is a novel member of the immunoglobulin (Ig) superfamily that is expressed primarily in the pancreas and in lower amounts in neural tissue (eg, CNS). GP354, and the integral cell surface membrane protein, has five signature Ig domains in its extracellular portion, known in other family members that mediate cell-cell recognition and adhesion reactions. As a member of the Ig superfamily, GP354 appears to be important for mediating cell-cell recognition, binding and adhesion functions in the pancreas, nerves and other potential tissues expressed by GP354.

  As a protein rich in the pancreas, GP354 is an inappropriate cell-cell in the pancreas, particularly during tissue development, and during tissue regeneration and / or tissue healing (eg, after pancreatic injury, trauma or degenerative conditions). It is a suitable therapeutic target for treating abnormal conditions, disorders and / or diseases associated with binding, adhesion and signaling. It is also envisioned that GP354 is useful for inhibiting pancreatic cell death associated with immunity, autoimmunity, and degenerative conditions. It is envisioned that the neuronal form of GP354 is a similarly suitable therapeutic target for tissue regeneration and repair in CNS tissues and to suppress degeneration and cell death.

  Accordingly, the present invention provides pharmaceutical compositions comprising the nucleic acids, proteins and antibodies of the present invention, and mimics, agonists, antagonists or modulators of GP354 activity, which comprises mis-expression of GP354. In order to overcome abnormal expression or activity of GP354-related molecules and other components involved in cell recognition pathways as a pharmaceutical agent for the treatment (ie, remission) of Can be administered. Since GP354 expression is relatively concentrated in the pancreas, it is expected that incorrect expression of GP354 may be associated with pancreatic disorders or diseases and / or congenital defects in pancreatic development of function.

  Pancreatic disorders and diseases for which administration of the composition of the invention may be effective include acute pancreatitis (often but not always abnormal pancreatic exocrine function (eg, serum, ascites and / or pleural fluid amylase levels) Or an abnormal lipase or trypsinogen level). Pancreatic inflammation and necrosis are also associated with acute and chronic pancreatitis, and exocrine dysfunction. Various pancreatic endocrine tumors have been characterized, and autoimmune disorders affecting the pancreas have also been described. For a more detailed description of the diagnosis and treatment of pancreatic disorders and diseases, see Harrison's PRINCIPLES OF INTERNAL MEDICINE, 14th edition (Anthony S. Fauci et al., Ed.), McGraw-Hill Companies, Inc. 1998, Part Eleven, Section 3 (this disclosure is incorporated by reference in its entirety).

  GP354 expression is also detected in neural CNS tissue, albeit at a lower level than that detected in the pancreas. Thus, misexpression of GP354 may be associated with neuronal dysfunction, disorder or disease, or abnormal development of the CNS. Examples of neurological disorders that can be remedied by treatment with the compositions of the present invention include, but are not limited to, Alzheimer's disease, Parkinson's disease, senile dementia, migraine, epilepsy, neuritis, nervous breakdown, neuropathy, and GP354-mediated nerve migration, any other disease associated with neurodegeneration (eg, GP354-mediated autoimmune disease (eg, certain forms of multiple sclerosis)), as well as neuronal tumors (eg, glioma, glioma) Astroblastoma and astrocytoma).

  Some other disorders in which the compositions of the invention may be useful include endocrine and hormonal problems (eg, diabetes), pancreatic diseases, cancer (particularly pancreatic cancer), and the like. The use of GP354 modulators (including GP354 antisense reagents, GP354 ligands and anti-GP354 antibodies) to treat individuals who have such a disease or are at risk of developing such a disease is It is an aspect of the invention.

The compositions of the present invention typically comprise about 0.1-90% by weight (eg, 1-20% or 1-10%) of a therapeutic agent of the present invention in a pharmaceutically acceptable carrier. . Solid formulations of the composition for oral administration are suitable carriers or excipients (eg corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate) , Calcium carbonate, sodium chloride or alginic acid). Disintegrants that may be used include, but are not limited to, microcrystalline cellulose, corn starch, sodium starch glycolate, and alginic acid. Tablet binders that can be used include acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone (Povidone ^™ ), hydroxypropylmethylcellulose, sucrose, starch and ethylcellulose. Lubricants that can be used include magnesium stearate, stearic acid, silicone fluids, talc, waxes, oils and colloidal silica.

  Liquid formulations of compositions for oral administration prepared in water or other aqueous vehicles include various suspensions (eg, methylcellulose, alginate, tragacanth, pectin, kelgin, carrageenan, acacia, Polyvinylpyrrolidone and polyvinyl alcohol). Liquid formulations may also contain solutions, emulsions, syrups, and elixirs containing the active compound, wetting agents, sweetening agents and coloring and flavoring agents together. Various liquid and powder formulations can be prepared by conventional methods for inhalation into the lungs of the mammal to be treated.

  Injectable formulations of the composition include various carriers (eg vegetable oil, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyol (glycerol, propylene glycol, liquid polyethylene glycol, etc.) For intravenous injection, a water-soluble form of this compound can be administered by infusion, thereby injecting a pharmaceutical formulation comprising an antifungal agent and a physiologically acceptable excipient. Acceptable excipients can include, for example, 5% dextrose, 0.9% saline, Ringer's solution or other suitable excipients. Sterile formulations of suitable soluble salt forms) are pharmaceutical excipients (eg, distilled water for injection, 0.9% saline) Or a 5% glucose solution) and can be administered Suitable insoluble forms of the compounds include aqueous bases or pharmaceutically acceptable oil bases (eg, esters of long chain fatty acids ( For example, it can be prepared and administered as a suspension in ethyl oleate))).

  Topical semisolid ointment formulations typically comprise the active ingredient in a concentration such as a pharmaceutical cream base at a concentration of about 1-20%, eg, 5-10%. Various formulations for topical use include drops, tinctures, lotions, creams, solutions and ointments containing the active ingredient and various supports and vehicles. The optimal proportion of therapeutic agent in each pharmaceutical formulation will vary according to the therapeutic effect desired in the formulation itself and the particular pathology and associated treatment regimen.

  Inhalation and transdermal formulations can also be readily prepared.

  Pharmaceutical formulations are a well-established field and are further described below: Gennaro (eds), Remington: The Science and Practice of Pharmacy, 20th edition, Lippincott, Williams & Wilkins (2000) (3302: 0, 72) Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th Edition, Lippincott, Williams & Wilkins Publishers (1999) (ISBN: 0683357727); and Kibib. Pharmaceuticl Association, Third Edition, (2000) (ISBN: 091733096X) (the disclosures of which are incorporated by reference in their entirety herein). Conventional methods known to those skilled in the pharmaceutical arts can be used to administer the pharmaceutical formulation to the patient.

  Typically, the pharmaceutical formulation applies a transdermal patch containing the pharmaceutical formulation to the patient's skin and leaves the patch in contact with the patient's skin (typically per patch). , 1 to 5 hours). Other transdermal routes of administration (eg, by use of topically applied creams, ointments, etc.) can be used by applying conventional techniques. These pharmaceutical formulations can also be made using other conventional routes (eg enteral, subcutaneous, pulmonary, transmucosal, intraperitoneal, intrauterine, using standard techniques). , Sublingual, intrathecal or intramuscular route). Further, the pharmaceutical formulation can be administered via the administration of an injectable storage route, for example by using a one-month, three-month, or six-month cumulative doseable material and method, or a biodegradable material and method. Can be administered to the patient.

  Regardless of the route of administration, the therapeutic protein or antibody drug is typically administered at a daily dosage of 0.01 mg to 30 mg (eg, 1 mg / kg to 5 mg / kg) per kg patient body weight. The pharmaceutical formulation can be administered at multiple doses per day to achieve the desired total daily dose, if desired. The effectiveness of the treatment method can be assessed by monitoring the patient for known signs or symptoms of the disorder.

  The pharmaceutical composition of the present invention may be included in a container, package or dispenser, alone or as part of a kit having labels and instructions for administration.

(Transgenic animals and cells)
In another aspect, the present invention provides transgenic cells and transgenic non-human organisms comprising gp354 isoform nucleic acids, and transgenic cells and transgenic non-human organisms targeted for disruption of endogenous orthologs of the human gp354 gene. provide. These cells can be embryonic stem cells or somatic cells. These transgenic non-human organisms can be chimeric, non-chimeric heterozygotes, and non-chimeric homozygotes.

  The host cells of the invention can be used to produce non-human transgenic animals. For example, in some embodiments, the host cell of the invention is a fertilized egg or embryonic stem cell into which a gp354 nucleotide sequence has been introduced. Such host cells can be used to create non-human transgenic animals that have exogenous gp354 sequences introduced into their genome, or to alter or replace the relevant endogenous gp354 sequences in the animals. Can be used.

  As used herein, a “transgenic animal” is a non-human animal, preferably a mammal, more preferably a cow, goat, sheep or rodent, in which one or more animal cells contain a transgene. (Eg, rat, mouse). Other examples of transgenic animals include non-human primates, dogs, chickens, amphibians and the like.

  As used herein, a “transgene” is an exogenous DNA that is integrated into the genome of a cell from which the transgenic animal develops and is retained in the genome of the mature animal, thereby transducing it. Directs the expression of the encoded gene product in one or more cell types or tissues of the transgenic animal.

  As used herein, a “homologous recombinant animal” is an endogenous gp354 gene introduced into an animal cell (eg, an animal embryonic stem cell) prior to the animal's development. A non-human animal, preferably a mammal, more preferably a mouse, which has been altered by homologous recombination with an exogenous DNA molecule.

  The non-human transgenic animals of the present invention are useful for studying the function and / or activity of gp354 and for identifying and / or evaluating modulators of gp354 activity. They are also useful in methods for producing GP354 protein or polypeptide fragments (ie, where the protein is produced in the mammary gland of a non-human mammal).

  The transgenic animal of the present invention introduces a gp354-encoding nucleic acid into the male pronucleus of a fertilized oocyte, eg, by microinjection, retroviral infection, and generates an oocyte in a pseudopregnant female parent animal Can be made. A polynucleotide comprising or having the human gp354 DNA sequence of SEQ ID NO: 1, 3, 5, 6, 7, 9, or 11 can be introduced as a transgene into the genome of a non-human animal. Alternatively, a non-human homologue of the human gp354 gene (eg, mouse gp354 gene) that is isolated by hybridization to an isolated polynucleotide of the invention can be used as a transgene. Sequences of heterologous transcription control sequences, intron sequences, polyadenylation signals, etc. can also be operably linked to the transgene to increase the efficiency of expression of the transgene in the recipient host animal, or else Transgene expression can be regulated (eg, in a developmental or tissue-specific manner).

  Methods for producing transgenic animals, particularly animals such as mice, by embryo manipulation and microinjection have become routine in the art and are described, for example, in: US Pat. No. 4,736 No. 4,866,009; and No. 4,873,191; and Hogan 1986, MANIPULATING THE MOUSE EMBRYO, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N .; Y. . Similar methods are used for the production of other transgenic animals. A transgenic founder animal can be identified based on the presence of a gp354 transgene in the genome and / or expression of gp354 mRNA in a tissue or cell of the animal. The transgenic founder animal can then be used to breed additional animals carrying the transgene. In addition, transgenic animals carrying transgenes encoding gp354 can be further bred with other transgenic animals carrying other transgenes.

  In order to produce a homologous recombination animal, a vector containing at least a part of the gp354 gene is prepared, and at least a part of the gp354 gene is introduced with a deletion, addition or substitution, thereby changing the gp354 gene. (E.g. functionally destroy). The gp354 gene can be a human gene (eg, SEQ ID NO: 1, 5, 9, or 11), but more preferably is a non-human homolog of the human gp354 gene. For example, a mouse homologue of the human gp354 gene of SEQ ID NO: 1, 5, 9, or 11 can be used to construct a homologous recombination vector suitable for altering the endogenous gp354 gene in the mouse genome.

  In some embodiments, the vector is such that upon homologous recombination, the endogenous gp354 gene is functionally disrupted (ie, no longer encodes a functional protein; also referred to as a “knockout” vector). Designed. Alternatively, the vector may have an endogenous gp354 gene that has been mutated or otherwise altered during homologous recombination, but still encodes a functional protein (eg, an upstream regulatory region is altered to Can alter the expression of the endogenous GP354 protein). In the homologous recombination vector, the altered portion of the gp354 gene allows homologous recombination to occur between the exogenous gp354 gene carried by the vector and the endogenous gp354 gene in embryonic stem cells. , The 5 ′ and 3 ′ ends are flanked by additional nucleic acids of the gp354 gene. The additional flanking gp354 nucleic acid is long enough for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5 'and 3' ends) are included in the vector. For example, see Thomas et al. Cell 51: 503 (1987) for an exemplary description of homologous recombination vectors.

  This vector is introduced into an embryonic stem cell line (eg, by electroporation) and cells in which the introduced gp354 gene is homologously recombined with the endogenous gp354 gene are selected (eg, Li et al., Cell 69: 915 (1992)). The selected cells are then injected into an animal (eg, mouse) blastocyst to form an assembled chimera. See, for example, Bradley 1987, TERATOCARCINOMAS AND EMBRYONIC STEM CELLS: A PRACTOCAL APPROACH, edited by Robertson, IRL, Oxford, pages 113-152. The chimeric embryo is then transferred into an appropriate pseudopregnant female parent animal, bringing the embryo close to birth. Offspring with DNA homologously recombined into germ cells can be used to breed animals that contain DNA in which all cells of the animal are homologously recombined by germline transmission of the transgene.

  Methods for constructing homologous recombination vectors and homologous recombination animals are further described below: Bradley Curr. Opin. Biotechnol. 2: 823-829 (1991); PCT International Publication Nos. WO90 / 11354; WO91 / 01140; WO92 / 0968; and WO93 / 04169.

  The clones of non-human transgenic animals described herein can also be generated according to the method described in Wilmut et al. Nature 385: 810-813 (1997). Briefly, cells from a transgenic animal (eg, somatic cells) can be isolated and induced to exit the growth cycle and enter the G0 phase. This quiescent cell can then be fused to an enucleated oocyte from the same species of animal from which the quiescent cell was isolated, eg, by use of an electrical pulse. The reconstructed egg cells are then cultured to develop into morulas or undifferentiated germ cells and then transferred to pseudopregnant female parent animals. The offspring of this female parent animal is a clone of the animal from which the cells (eg, somatic cells) were isolated.

  Controlled expression of transgenes in vivo can be achieved using controllable recombinant systems such as the cre / loxP recombinase system (eg Lakso et al., Proc. Natl. Acad. Sci. USA 89: 6232-6236 (1992). And the FLP recombination system (O'Gorman et al., Science 251: 1351-1355 (1991))). If the cre / loxP recombinase system is used to control transgene expression, an animal containing a transgene encoding both the Cre recombinase and the selected protein is required. Transgenic animals containing both elements of the system are obtained, for example, by mating two transgenic animals, each of which is either a transgene encoding a selected protein or a transgene encoding a recombinase including.

(Antisense reagents and methods)
(A. Antisense)
Many of the isolated polynucleotides of the present invention are antisense polynucleotides that recognize and hybridize to gp354 polynucleotides. Full length and fragment antisense polynucleotides are provided. The fragment antisense molecule of the present invention comprises (i) a molecule that specifically recognizes gp354 RNA and hybridizes specifically to the gp354 RNA (DNA encoding GP354 and DNA encoding other known molecules). As determined by sequence comparison with The identification of sequences unique to the polynucleotide encoding GP354 can be deduced by the use of any publicly available sequence database and / or by the use of commercially available sequence comparison programs. Following identification of the desired sequence, isolation using restriction digests or amplification using any of a variety of polymerase chain reaction techniques well known in the art can be performed. Antisense polynucleotides are particularly concerned with regulating the expression of GP354 by cells that express gp354 mRNA.

  An antisense oligonucleotide or fragment of the nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 6, 7, 9, or 11 from the nucleotide sequence encoding GP354, or complementary or homologous thereto The sequences are useful as diagnostic tools for exploring gene expression in various tissues. For example, tissue can be probed in situ using oligonucleotide probes with groups detectable by conventional autoradiographic techniques to investigate the native expression of this enzyme or the pathological conditions associated therewith. . In certain aspects, an antigen comprising a sequence complementary to at least about 10 nucleotides, about 25 nucleotides, about 50 nucleotides, about 100 nucleotides, about 250 nucleotides, or about 500 nucleotides, or the entire gp354 coding strand or only a portion thereof. A sense nucleic acid molecule is provided. A nucleic acid molecule encoding a fragment, homologue, derivative and analog of the GP354 protein of SEQ ID NO: 2, 4, 8, 10, or 12; complementary to the GP354 nucleic acid sequence of SEQ ID NO: 1, 3, 5, 6, 7, 9 or 11 Further antisense nucleic acids are provided.

  An antisense nucleic acid molecule of the invention can be antisense to a “coding region” or non-coding region of the coding strand of a nucleotide sequence encoding GP354. The term “coding region” refers to a region of a nucleotide sequence that includes codons translated into amino acid residues (eg, the protein coding region of human GP354 corresponds to the coding region shown in SEQ ID NO: 1, 7, or 11). ).

  Antisense oligonucleotides preferably relate to regulatory regions of the nucleotide sequence of SEQ ID NO: 1, 7 or 11 or mRNA corresponding thereto (including but not limited to initiation codons, TATA boxes, enhancer sequences, etc.). The antisense nucleic acid molecule can be complementary to the entire coding region or non-coding region of gp354, but more preferably is an oligonucleotide that is antisense to only a portion of the coding region or non-coding region of gp354 mRNA. . For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of gp354 mRNA. Antisense oligonucleotides can be, for example, about 5 nucleotides long, about 10 nucleotides long, about 15 nucleotides long, about 20 nucleotides long, about 25 nucleotides long, about 30 nucleotides long, about 35 nucleotides long, about 40 nucleotides long, about 45 nucleotides long. It may be nucleotides long or about 50 nucleotides long.

  The antisense nucleic acids of the invention can be constructed using chemical synthesis or enzyme ligation reactions using procedures known in the art. For example, antisense nucleic acids (eg, antisense oligonucleotides) are naturally occurring nucleotides or various modified nucleotides (to increase the biological stability of a molecule or between antisense and sense nucleic acids). Designed to increase the physical stability of the duplex formed into (eg, phosphorothioate derivatives and acridine-substituted nucleotides can be used).

  Alternatively, antisense nucleic acids can be biologically produced using expression vectors in which the nucleic acid is subcloned in the antisense orientation (ie, RNA transcribed from the inserted nucleic acid is further described in the subsections below. In the antisense direction relative to the target nucleic acid of interest).

  An antisense nucleic acid molecule of the invention (preferably an oligonucleotide of 10-20 nucleotides in length) typically hybridizes or binds to cellular mRNA and / or genomic DNA encoding GP354 protein; Thereby, it is administered to a subject or made in situ to inhibit the expression of a protein, for example by inhibiting transcription and / or translation. Suppression of gp354 expression at either the transcriptional or translational level is useful for creating cellular or animal models for diseases / conditions characterized by abnormal gp354 expression.

  Hybridization can be achieved by conventional nucleotide complementarity to form a stable duplex or, for example, in the case of antisense nucleic acid molecules that bind to a DNA duplex, specific interactions in the main groove of the duplex helix. It can be by action. Phosphorothioate and methylphosphonate antisense oligonucleotides are particularly contemplated for therapeutic use according to the present invention. Antisense oligonucleotides can be further modified by adding poly-L-lysine moieties, transferrin moieties, polylysine moieties, or cholesterol moieties to their 5 'ends.

  An example of a route of administration of an antisense nucleic acid molecule of the invention includes direct injection at a tissue site. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, an antisense molecule can be a receptor or antigen expressed on the surface of a selected cell, eg, by linking the antisense nucleic acid molecule to a peptide or antibody that binds to the cell surface receptor or antigen. Can be modified to specifically bind to. Antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. In order to achieve sufficient intracellular concentrations of the antisense molecule, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.

  In yet other embodiments, the antisense nucleic acid molecule of the invention is an a-anomeric nucleic acid molecule. a-anomeric nucleic acid molecules, unlike the normal b-unit, form specific double-stranded hybrids with complementary RNAs that run parallel to each other (Gaultier et al., Nucl. Acids Res 15 : 6625-6641 (1987)). Antisense nucleic acid molecules can also be 2′-O-methyl ribonucleotides (Inoue et al., Nucl. Acids Res 15: 6131-6148 (1987)) or chimeric RNA-DNA analogs (Inoue et al., FEBS Lett 215: 327-330 ( 1987)).

(B. Ribozymes and catalytic nucleic acids)
In yet another series of embodiments, the antisense nucleic acid of the invention is part of a gp354-specific ribozyme (or, as a modification, a “nucleozyme”). Ribozymes are catalytic RNA molecules having ribonuclease activity that can cleave single-stranded nucleic acids (eg, mRNA) that have complementary regions. Thus, ribozymes (eg, hammerheads, hairpins, group I intron ribozymes, etc.) can be used to catalytically cleave gp354 mRNA transcripts, thereby inhibiting translation of gp354 mRNA. A ribozyme having specificity for a gp354-encoding nucleic acid can be designed based on the nucleotide sequence (SEQ ID NO: 1, 3, 5, 6, 7, 9, or 11) of a gp354 polynucleotide disclosed herein. For example, U.S. Pat. Nos. 5,116,742; 5,334,711; 5,652,094; and 6,204,027 (incorporated herein in their entirety). See incorporated by reference).

  For example, a derivative of Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence that is cleaved in GP354-encoding mRNA. See, for example, Cech et al., US Pat. No. 4,987,071; and Cech et al., US Pat. No. 5,116,742. Alternatively, gp354 mRNA can be used to select catalytic RNA with specific ribonuclease activity from a pool of RNA molecules. See, for example, Bartel et al., Science 261: 1411-1418 (1993).

  Expression of the gp354 gene is inhibited by targeting a nucleotide sequence complementary to the regulatory region of gp354 (eg, the gp354 promoter and / or enhancer) to form a triple helix structure that prevents transcription of the gp354 gene in the target cell. obtain. See generally, Helene, Anticancer Drug Des. 6: 569-84 (1991); Helene et al., Ann. N. Y. Acad. Sci. 660: 27-36 (1992); and Maher, Bioassays 14: 807-15 (1992).

(C. Peptide nucleic acid (PNA))
In other preferred oligonucleotide mimetics, particularly useful for in vivo administration, both sugar and internucleoside linkages are replaced with novel groups (eg, peptide nucleic acids (PNA)). See, for example, Hyrup et al., Bioorg. Med. Chem. Lett. 4: 5-23 (1996). In PNA compounds, the phosphodiester backbone of the nucleic acid is replaced with an amide-containing backbone, particularly by repeating N- (2-aminoethyl) glycine units linked by amide bonds. The nucleobase is typically linked directly or indirectly to the aza nitrogen atom of the backbone amide moiety by a methylene carbonyl linkage. The synthesis of PNA oligomers is described in Hyrup et al., Supra; and Perry-O'Keefe et al., Proc. Natl. Acad. Sci. USA 93: 14670-675 (1996), which can be performed using standard solid phase peptide synthesis protocols.

  The gp354 PNA can be used in therapeutic and diagnostic applications. For example, PNA can be used as an antisense or anti-gene agent for sequence-specific regulation of gene expression, for example, by inducing transcriptional or translational arrest or by inhibiting replication. The gp354 PNA is also used as an artificial restriction enzyme when used in combination with other enzymes (eg, S1 nuclease), eg, in PNA-directed PCR clamping, eg in the analysis of single base pair mutations in genes; Or as a probe or primer for DNA sequence and hybridization (Hyrup et al., Supra; and Perry-O'Keefe, supra).

  In other embodiments, gp354 PNAs can be synthesized, for example, by attaching lipophilic or other helper groups to the PNA, to form their PNA-DNA chimeras, or to enhance their stability or cellular uptake. Or it can be modified by the use of other techniques of drug delivery known in the art. For example, a PAN-DNA chimera of gp354 can be created, which can combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes (eg, RNase H and DNA polymerase) to interact with the DNA moiety, while the PNA moiety provides high binding affinity and specificity. PNA-DNA chimeras can be ligated using a linker of appropriate length selected in terms of base stacking, number of linkages between nucleobases, and orientation (Hyrup, supra). The synthesis of PNA-DNA chimeras is described in Hyrup, supra, and Finn et al., Nucl. Acids Res. 24: 3357-63 (1996).

  For example, DNA strands can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs (eg, 5 ′-(4-methoxytrityl) amino-5′-deoxy- Thymidine phosphoramidite) can be used between PNA and the 5 ′ end of DNA (Mag et al., Nucl. Acids Res. 17: 5973-88 (1989)). PNA monomers are then joined in a sequential manner to create a chimeric molecule having a 5 'PNA segment and a 3' DNA segment (Finn et al., Supra). Alternatively, a chimeric molecule can be synthesized using a 5 'DNA segment and a 3' PNA segment. Petersen et al., Bioorg. Med. Chem. Lett. 5: 1119-11124 (1975).

  In other embodiments, the oligonucleotides are other attachment groups such as peptides (eg to target host cell receptors in vivo) or cell membranes (eg Letsinger et al., Proc. Natl. Acad. Sci. USA). 86: 6553-6556 (1989); Lemaire et al., Proc. Natl. Acad. Sci. USA 84: 648-652 (1987); see PCT Publication No. WO 88/09810) or the blood-brain barrier (eg, PCT Agents that facilitate transport across publication number WO 89/10134) may be included. In addition, oligonucleotides may be hybridization-triggered cleavage agents (see, eg, Krol et al., BioTechniques 6: 958-976 (1988)), or intercalating agents (eg, Zon, Pharm. Res. 5). : 539-549 (1988)). For this purpose, the oligonucleotide can be coupled to another molecule (eg, peptide, hybridization-triggered crosslinker, transport factor, hybridization-triggered cleavage agent, etc.).

  PNA chemistry and applications are described in particular by Ray et al., FASEB J. et al. 14 (9): 1041-60 (2000); Nielsen et al., Pharmacol Toxicol. 86 (1): 3-7 (2000); Larsen et al., Biochim Biophys Acta 1489 (1): 159-66 (1999); Nielsen, Curr. Opin. Struct. Biol. 9 (3): 353-7 (1999), and Nielsen, Curr. Opin. Biotechnol. 10 (1): 71-5 (1999), the disclosures of which are incorporated herein by reference in their entirety.

(Diagnosis method)
(A. Nucleic acid diagnosis)
As described above, the isolated polynucleotide of the present invention is used as a nucleic acid probe, and when such abnormal tissue misexpression is suspected, tissues in which gp354 mRNA is normally expressed (eg, pancreas and CNS). ), And in tissues where it is not normally expressed, the level of gp354 mRNA can be assessed.

  The present invention then relates to the presence of gp354 polynucleotides in a biological sample (eg, a patient-derived cell extract, fluid or tissue sample) by contacting this sample with an isolated polynucleotide of the present invention. A method for detection is provided, wherein the polynucleotide of the invention can be specifically detected by hybridizing to a gp354 polynucleotide sequence.

  Preferably, the method detects contacting the sample with the isolated nucleic acid under highly stringent hybridization conditions, and detecting the hybridization of the isolated polynucleotide to the nucleic acid in the sample. Wherein the occurrence of this hybridization indicates the presence of the gp354 coding sequence in the sample.

  The isolated polynucleotides of the present invention can be used as nucleic acid probes that are directed against specific cell types in these tissues based on the specific expression of gp354 in the pancreas and central nervous system. And specific. Accordingly, the present invention detects the presence of a gp354 polynucleotide in a biological sample (eg, a fluid sample or tissue sample derived from a patient) by contacting the sample with an isolated polynucleotide of the present invention. Thus, providing a method for identifying a cell as a pancreatic cell or a neuronal cell, the polynucleotide of the present invention can be specifically detected by hybridizing to a gp354 polynucleotide sequence.

  The present invention also includes: (i) abnormal modification or mutation of a gene encoding GP354 protein; (ii) misregulation of a gene encoding GP354 protein; and (iii) abnormal post-translational modification of GP354 protein. A diagnostic assay is provided for identifying the presence or absence of a genetic injury or mutation characterized by at least one, wherein the wild type of the gene encodes a protein having GP354 biological activity.

  The present invention further provides a method of identifying a homologue of the human gp354 gene, which comprises subjecting a nucleic acid library to SEQ ID NOs: 1, 3, 5, 6, 7 under intermediate or high stringency hybridization conditions. , 9 or 11, or hybridizing with a nucleic acid probe comprising a portion thereof having at least 17 nucleotides; and determining whether the nucleic acid probe hybridizes with a nucleic acid sequence in the library. If the nucleic acid sequence in the library hybridizes under such selected conditions, it is a homologue of the human gp354 gene.

(B. Antibody diagnosis)
When such an abnormal tissue misexpression is suspected, the antibody of the present invention shows the expression level of GP354 protein in tissues in which GP354 protein is normally expressed (for example, pancreas and CNS) and tissues in which it is not normally expressed. Can be used to evaluate.

  The present invention then determines the presence or activity of GP354 protein in a biological sample (eg, a cell extract, fluid or tissue sample derived from a patient) and the presence of GP354 protein or an indicator of its activity. A method of detecting by contacting with a detectable agent is provided. Preferably, the agent is an antibody specific for at least one epitope of GP354 protein.

  Accordingly, the present invention provides a method for determining whether GP354 protein is present in a sample, the method comprising contacting the sample with an antibody having at least one GP354 epitope; and Detecting specific binding to the antigen, this binding indicating the presence of GP354 protein in the sample.

  The above method also reduces the amount of GP354 polypeptide present in a test cell in a subject in a biological sample derived from the subject test cell (eg, a cell extract, fluid or tissue derived from the subject). Useful for identification as pancreatic or neural cells by comparison with the amount of GP354 polypeptide present in a comparative biological sample from pancreatic or non-neural tissue.

  In some embodiments, the anti-PanCAM antibodies described herein can be used to quantify any treatment intended to restore Langerhans damage and restoration of Langerhans function in early type I diabetes. For example, the antibody is conjugated to a control marker (eg, gadolinium) for MRI and CT applications or a radioactive marker (eg, technetium) for nuclear medicine applications. The associated diagnostic modalities are then used to quantify and record in detail the changes in the size and / or number of the islets of Langerhans. The antibody is labeled in this way, and Langerhans islet cell tumors using such a diagnostic modality can also be localized.

(Method for diagnosing disease)
The gp354 isolated polynucleotides, proteins and GP354 specific antibodies of the present invention are useful in methods for diagnosing various disorders and disease states associated with abnormal gp354 expression.

  The invention then provides a method for diagnosing a disease state in a subject, the method comprising determining the amount or activity of GP354 protein in a tissue sample from the subject, the amount of GP354 polypeptide in a control sample. Or a comparison with activity (equivalent to that from a healthy subject), wherein the significant difference in the amount or activity of GP354 polypeptide in a tissue sample relative to the amount or activity of GP354 polypeptide in a control sample is , Indicating that the subject has a disease state.

  In preferred embodiments, the amount or activity of GP354 protein in a tissue sample is assessed by a competitive binding assay using a GP354 polypeptide or fragment of the invention or by an immunoassay using a GP354-specific antibody of the invention. Is done. Preferably, the method is used to diagnose a disease state associated with the pancreas or nervous system.

  Also provided is a method for diagnosing a disease state in a subject by monitoring relative gp354 mRNA levels in different tissues. Preferably, the method comprises the step of comparing the amount of gp354 mRNA in a test tissue sample from the subject with the amount of gp354 mRNA in a control sample, wherein the test sample is relative to the amount in the control sample. A significant difference in the amount of mRNA in it indicates that the subject has a disease state.

  In preferred embodiments, the amount of gp354 mRNA in a tissue sample is assessed by hybridization using an isolated gp354 polynucleotide or nucleic acid fragment of the invention. Preferably, the method is used to diagnose a disease state associated with the pancreas or nervous system.

(Computer-readable means)
A further aspect of the invention is a computer readable means for storing the gp354 nucleic acid and amino acid sequences of the invention. In preferred embodiments, the present invention provides a computer readable means for storing SEQ ID NOs as described herein as a complete set of sequences or in any combination. The computer readable record is accessed for reading and display and connection with a computer system for application of the program, where the computer system positions the data relative to a query for data that meets certain criteria. Sequence comparison, alignment or ordering of sequences that meet a set of criteria, and the like.

  The nucleic acid and amino acid sequences of the present invention are particularly useful as components in search analysis, useful databases, and sequence analysis algorithms. As used in these embodiments, the terms “nucleic acid sequence of the invention” and “amino acid sequence of the invention” can be reduced or stored in a computer-readable form, or can be converted or stored. , Means any detectable chemical or physical characteristic of a polynucleotide or polypeptide of the invention. These include, but are not limited to, chromatographic scan data or peak data, photographic data or scan data derived therefrom, and mass spectrometry data.

  The present invention provides a computer readable medium storing the sequences of the present invention. The computer readable medium may comprise one or more of the following: a nucleic acid sequence comprising the sequence of the nucleic acid sequence of the invention; an amino acid sequence comprising the amino acid sequence of the invention; at least one of the sequences being a sequence of the nucleic acid sequence of the invention A set of nucleic acid sequences; at least one of the sequences comprises a sequence of amino acid sequences of the invention; a set of amino acid sequences; a data set representing a nucleic acid sequence comprising a sequence of one or more nucleic acid sequences of the invention A data set representing a nucleic acid sequence encoding an amino sequence comprising the sequence of the amino sequence of the present invention; a set of nucleic acid sequences, wherein at least one sequence comprises the sequence of the nucleic acid sequence of the present invention; A set of amino acid sequences comprising the sequence of the amino acid sequence of the invention; a data set representing a nucleic acid sequence comprising the sequence of the nucleic acid sequence of the invention; an amino of the invention Data set representing a nucleic acid sequence encoding an amino acid sequence comprising the sequence of SEQ. A computer-readable medium is any compositional object used to store information or data, including commercially available floppy disks, tapes, hard drives, compact disks, and video disks. possible.

  Accordingly, the present invention provides a diagnostic assay for identifying homologues of the human gp354 gene, which comprises a nucleic acid database comprising a query sequence consisting of SEQ ID NOs: 1, 3, 5, 6, 7, 9, or 11. Or screening with a portion thereof having 300 or more nucleotides, wherein it is at least 65% identical to SEQ ID NO: 1, 3, 5, 6, 7, 9, or 11, or a portion thereof If a nucleic acid sequence in the database that is less than 100% identical is present, it is a homologue of the human gp354 gene.

  Also provided by the present invention is a method for the analysis of characteristic sequences, particularly the gene sequences of the present invention. Preferred methods of sequence analysis include, for example, sequence homology analysis (eg, identity analysis and similarity analysis), RNA structure analysis, sequence assembly, cadistic analysis, sequence motif analysis, open reading frame determination, nucleobase Examples include calling and sequencing chromatogram peak analysis methods.

  Computer-based methods are provided to perform nucleic acid homology identification. The method provides a nucleic acid sequence comprising a nucleic acid sequence of the invention in a computer readable medium; and compares the nucleic acid sequence to at least one nucleic acid sequence or amino acid sequence to identify homology. The process of carrying out is included.

  A computer-based method is also provided for performing amino acid homology identification, the method providing an amino acid sequence comprising a sequence of a polypeptide of the invention in a computer readable medium; and Comparing this amino acid sequence with at least one nucleic acid sequence or amino acid sequence to identify homology.

  A computer-based method is further provided for a single nucleic acid sequence for the construction of overlapping nucleic acid sequences, the method reading a first nucleic acid sequence comprising a sequence of the nucleic acid of the invention with a computer. Providing in a possible medium; and screening at least one overlapping region between the first nucleic acid sequence and the second nucleic acid sequence.

  The following examples are meant to illustrate the methods and materials of the present invention. Appropriate changes and additions to the described conditions and parameters are routinely made in the field of molecular biology, which will be apparent to those skilled in the art and are within the spirit and scope of the invention.

  For the experiments described below, all RT-PCR and fragments were gel purified prior to cloning. This fragment was separated by agarose gel electrophoresis by standard methods. The DNA fragment was excised from the agarose gel and purified from the gel using QIAEX resin according to the manufacturer's instructions (Qiagen, Valencia, CA). The gel purified fragment was cloned into a plasmid vector and then used to competent TOP10 E. coli. E. coli host cells were transformed. The plasmid produced by this host cell was isolated by standard alkaline lysis miniprep procedures (Qiagen, Valencia, CA). Sequencing was performed by the standard dideoxy termination method (Applied Biosystems, Foster City, CA).

(Example 1. In silico gene prediction and sequence analysis)
Using the gene prediction software program GENESCAN (Burge et al., J. Mol. Biol. 268: 78-94 (1997)) and GENEMARKHMM (Lukashin et al., Nucl. Acids Res. 26: 1107-1115 (1998)), GenBank A novel gene was identified in the high-throughput genomic sequence deposited at. To do so, the entire Genbank data was downloaded to a local server and the individual sequence contigs were separated according to the annotation provided with the sequence input. The parameters used in this analysis were the default parameters included with the program (Burge et al., Supra; and Lukashin et al., Supra).

  Gene candidates with at least two identical exons predicted from GENSCAN and GENEMARKHMM were further analyzed. Specifically, these gene sequences were translated into protein sequences, which were then used as query sequences in a Blast analysis of a non-overlapping protein sequence database incorporating Genpept, Swissprot and PIR. These protein sequences were also analyzed for signal peptides using SIGNALP (Nielsen et al., Int J. Neural Syst 8: 581-99 (1997)). Candidate genes encoding proteins with similarity to signal peptides and Ig superfamily proteins were subjected to experimental visualization and cloning.

  The BLAST ("Basic Local Alignment Search Tool") algorithm is suitable for determining sequence similarity (Altschul et al., J. Mol. Biol., 215, 403-410 (1990)). Software for performing BLAST analyzes is publicly available through the website's the National Center for Biotechnology Information. The algorithm includes first identifying a high scoring sequence pair (HSP) by identifying short W-length words in the query sequence, which includes: When aligned with words of the same length, either match some positive value threshold score T or satisfy this score T. T is referred to as the score threshold for adjacent words (Altschul et al., Supra). These initial neighborhood word hits act as seeds for initiating searches to find HSPs containing them. Word hits are extended in both directions along each sequence as long as the cumulative alignment score can be increased. The expansion of word hits in each direction is stopped when: (1) if this cumulative alignment score falls from the maximum achieved value to the quantity X; (2) this cumulative score is Due to the accumulation of alignments of residues giving a negative score of 1 or more, or less than 0; or (3) reaching the end of any sequence. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of this alignment. This BLAST program has 11 word lengths (W), 50 BLOSUM62 score matrix (see Henikoff et al., Proc. Natl. Acad. Sci. USA, 89, 10915-10919 (1992)) alignment (B), Ten expected values (E), M = 5, N = 4, and comparison of both strands are used as defaults.

  BLAST (Karlin et al., Proc. Natl. Acad. Sci. USA, 90, 5873-5787 (1993)) and GAPPED BLAST perform statistical analysis of the similarity between two sequences. One similarity measure provided by the BLAST algorithm is the minimum total probability (P (N)), which is the probability that a match between two nucleotide sequences or between two amino acid sequences will occur by chance. Provide indicators of For example, the minimum total probability of a test nucleic acid compared to a gp354 nucleic acid is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001. The nucleic acid is considered to be similar to the gp354 gene or cDNA.

  The gp345 gene (ORF) was identified in BAC contig 38 of GenBank accession number AC022315 (deposited on February 10, 2000). The GENSCAN prediction for this gene was in the reverse direction and included the following 14 exons shown in Table 3.

公共利用可能なＥＳＴのデータベースに対するｇｐ３５４遺伝子のＢＬＡＳＴ分析は、予測された遺伝子と一致するＥＳＴを示さなかった。

BLAST analysis of the gp354 gene against a publicly available EST database did not show an EST consistent with the predicted gene.

(Example 2: Amplification of gp354)
The sequence of gp354 cDNA is obtained by performing rapid amplification (RACE) of cDNA ends using the MARATHON-READY RACE kit (Clontech, Palo Alto, Calif.). MARATHON-READY cDNA is a double-stranded cDNA synthesized from human tissue mRNA and is linked to a standard set of adapters (Clontech). All RACE reactions use the adapter primer AP-1, 5′-CCATCCTAATACGACTCACTATAGGGC-3 ′ (SEQ ID NO: 15) provided with this kit. The 3′RACE for gp354 is the forward primer GX1-218, 5′-ACTGGGGGCTAGTTCAGGTGACTAA-3 ′ (SEQ ID NO: 16), or the complement of the reverse primer GX1-219, 5′-CCAAACAGCACATCCGCGCAGTAC-3 ′ (SEQ ID NO: 17 ) May be used with AP-1. 5'RACE for gp354 may use AP-1 with reverse primer GX1-219, or the complement of forward primer GX1-218. ADVANTAGE 2 DNA polymerase (Clontech) can be used for the amplification reaction. The MARATHON-READY kit was used according to the manufacturer's instructions, except that "touchdown" PCR (Don et al., Nuc. Acids Res. 19: 4008 (1991)) conditions were used for thermal cycling. Can do. Thermal cycling conditions are as follows: 94 ° C for 1 minute; 94 ° C for 15 seconds, 72 ° C for 15 seconds, 68 ° C for 15 seconds; 94 ° C for 15 seconds, 71 ° C for 15 seconds, 1 cycle of 68 ° C for 15 seconds; 94 ° C for 15 seconds, 70 ° C for 15 seconds, 68 ° C for 15 seconds; 94 ° C for 15 seconds, 69 ° C for 15 seconds, and 68 ° C for 15 seconds Cycle; 35 cycles of 94 ° C. for 15 seconds, 68 ° C. for 30 seconds; and 68 ° C. for 10 minutes.

(Example 3: Confirmation of GP354 expression by RT-PCR)
Inter-exon-PCR was used to confirm that this predicted gp354 gene was actually expressed and to initiate the cloning process to determine the true gene structure (rather than the predicted gene structure) . The template for PCR uses single-stranded cDNA (generated from mRNA isolated from multiple human tissues by reverse transcription PCR (“RT-PCR”)) contained in a multi-tissue cDNA panel. And performed according to the manufacturer's instructions (Clontech). These tissues were brain, heart, kidney, liver, lung, pancreas, pituitary, skeletal muscle, colon, ovary, peripheral blood leukocytes, prostate, small intestine, spleen, testis, and thymus.

  Primers for inter-exon PCR should be separated so that all PCR experiments have an integrated control to distinguish the spliced message from unspliced messages or genomic contaminants in the cDNA panel. Selected from exons. A pair of such primers were GX1-220 and GX1-221 (Example 13, supra). Another pair used was GX1-218 and GX1-219 (supra). PCR was performed according to the instructions included with the multi-tissue cDNA panel (Clontech). Typical thermal cycler conditions for PCR were as follows: 94 ° C for 1 minute, followed by 35 cycles of 94 ° C for 20 seconds, 68 ° C for 2 minutes, followed by 5 at 68 ° C. Minutes (after the last cycle). PCR products were separated on a 1.0% agarose gel and visualized by ethidium bromide staining.

  These results indicated that an approximately 785 bp fragment was present in the pancreas and not in other tissues. The same observations were obtained with GX1-218 and GX1-219. This fragment was isolated and cloned into the PCR2.1 plasmid vector (Invitrogen, Carlsbad, CA). The resulting plasmid construct CS0026 was transformed into TOP10 E. coli. grown in E. coli host cells. Plasmids were purified by standard alkaline lysis miniprep procedures (Qiagen, Valencia, CA). Sequencing was completed by standard dideoxy termination methods (Applied Biosystems, Foster City, CA). The sequence of the PCR fragment (SEQ ID NO: 3) was compared with the sequence of the putative gp354 gene to confirm the accuracy of this gene prediction.

(Example 4: Identification of full-length gp354 cDNA by RACE)
Since the gene prediction programs GENESCAN and GENEMARK have a predictable error rate (Burge et al., Supra; Lukashin et al., Supra), the PCR fragment described in Example 3 can be transformed into the gp354 cDNA sequence via the RACE reaction. Use as a seed sequence to get the rest. For this 3′RACE reaction, the primer is the complement of GX1-218 or GX1-219, and the template is cDNA from human pancreatic tissue (see Example 3). For the 5'RACE, the primer is the complement of GX1-219 or GX1-218, and the template is also cDNA from human pancreatic tissue. The 5 ′ RACE and 3 ′ RACE fragments thus obtained were gel purified, cloned and sequenced. To construct the full-length gp354 cDNA sequence, the initial PCR product, 5 'RACE product and 3' RACE product were combined into a single continuous sequence using the ASSEMBLE program (Genetics Computer Group, Madison, Wisconsin) in the GCG computer package. Build in.

(Example 5: Confirmation of GP354 expression by Northern blot analysis)
To confirm GP354 expression, Northern blot analysis was performed on each lane of a blot containing 2 μg poly A RNA (Clontech catalog number 7760-1). The tissues shown in this blot included heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. The probe for this Northern blot was the PCR fragment (SEQ ID NO: 3) described in Example 3. 50 ng of the probe was labeled by the Feinberg and Vogelstein random priming method (Anal. Biochem. 132: 6-13 (1983)). Hybridization was performed in EXPRESSHYB solution (Clontech catalog number 8015-1) at 68 ° C. for 1 hour. Prior to autoradiography, Northern blots were washed with 2 × SSC / 0.05% SDS at room temperature followed by two washes with 0.1 × SSC / 0.1% SDS at 50 ° C.

  Approximately 3.2 kb of RNA hybridization was observed in the pancreas but not in any of the other tissues tested.

(Example 6: PCR screening of genomic library and subcloning of GP354 coding region)
Subcloning of the gp354 genomic locus can be accomplished by PCR, either from a genomic library or directly from genomic DNA. For example, 2 μl of human genomic library (approximately 10 ⁸ PFU / ml) (Clontech) is added to 6 ml of K802 cells (overnight culture) (Clontech) and then as 24 ml aliquots of each 24 microtubes. Distributed. The microtube is incubated for 15 minutes at 37 ° C. 7 ml of agarose (0.8%) is added to each tube, mixed, then poured onto LB agar + 10 mM MgSO ₄ plates and incubated at 37 ° C. overnight. 5 ml of SM phage buffer (0.1 M NaCl, 8.1 mM MgSO ₄ .7H ₂ O, 50 mM Tris.Cl, pH 7.5, 0.01% gelatin) is added to each plate (5 ml) and top Agarose is removed using a microscope slide and placed in a 50 ml centrifuge tube. A drop of chloroform is added and the tube is placed on a 37 ° C. shaker for 15 minutes, then centrifuged for 20 minutes at 4000 rpm (Sorvall RT6000 tabletop centrifuge) and the supernatant is stocked Stored at 4 ° C. as a solution.

PCR was then performed in 20 ml containing: 8.8 ml H ₂ O, 4 ml 5 × RAPID-LOAD BUFFER (Origine), 2 ml 10 × PCR BUFFER II (Perkin Elmer), 2 ml 25 mM MgCl ₂ , 0.8 ml of 10 mM dNTP, 0.12 ml primer (1 mg / ml) containing at least part of the sequence at the 5 ′ end of the gp354 polynucleotide of SEQ ID NO: 1, 3 of gp354 polynucleotide of SEQ ID NO: 1 '0.12 ml primer (1 mg / ml), 0.2 ml AMPLITAQ GOLD polymerase (Perkin Elmer) and 2 ml phage from each of 24 tubes containing at least part of the sequence that is complementary to the ends solution. The PCR reaction includes: one cycle of 80 ° C. for 20 minutes, 95 ° C. for 10 minutes; then 95 ° C. for 30 seconds, 72 ° C. for 4 minutes (decrease by 1 ° C. per cycle), at 68 ° C. 22 cycles of 2 minutes, followed by 30 cycles of 95 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 60 seconds. The reaction is loaded onto a 2% agarose gel.

From the tube giving the correct size PCR product, 5 μl is used to set up 5 1:10 dilutions, which are placed on LB agar + 10 mM MgSO ₄ plates and incubated overnight. did. A BA85 nitrocellulose filter (Schleicher & Schuell) is placed on top of each plate for 1 hour. The filter is removed, placed in a Petri dish with the phage side up, and covered with 4 ml SM buffer for 15 minutes to elute the phage. 1 ml of SM buffer is removed from each plate and used to set up the PCR reaction as described above. Subdivide the most diluted plate to obtain the PCR product, place the filter, and repeat the PCR reaction. Continue serial dilution and subdivision of the plate until a single plaque giving a positive PCR band is isolated. Once a single plaque is isolated, 10 ml of phage supernatant is added to 100 ml SM and 200 ml K802 cells per plate, setting up a total of 8 plates. The plate is incubated overnight at 37 ° C. 8 ml of SM is added to each plate and the top agarose is scraped off with a microscope slide and collected in a centrifuge tube.

  Three drops of chloroform are added to the centrifuge tube. The tube is then vortexed, incubated for 15 minutes at 37 ° C., and centrifuged for 20 minutes at 4000 rpm (Sorvall RT6000 tabletop centrifuge) to recover the phage. The recovered phage is used to isolate genomic phage DNA using QIAGEN LAMBDA MIDI KIT. The sequence for the primer can be derived from the sequences set forth herein.

To subclone the coding region of the gp354 gene, PCR is performed in a 50 μl reaction containing: 33 μl H ₂ O, 5 μl 10 × TT buffer (140 mM ammonium sulfate, 0.1% gelatin) , 0.6 M Tris-Tricine pH 8.4), 5 μl 15 mM MgSO ₄ , 2 μl 10 mM dNTPs, 4 μl genomic phage DNA (0.1 μg / ml), 5 ′ most of the gp354 polynucleotide of SEQ ID NO: 1 0.3 μl of a primer (1 μl / ml) containing at least a portion of the coding sequence of SEQ ID NO: 1, comprising a sequence that is complementary to at least a portion of the most 3 ′ coding sequence of the gp354 polynucleotide of SEQ ID NO: 1 3 μl primer (1 μg / ml), 0.4 μl HIGH FIDELITY Taq Polymerase (Boehringer Mannheim). The PCR reaction was started with one cycle of 2 minutes at 94 ° C, followed by 15 cycles of 94 ° C for 30 seconds, 55 ° C for 60 seconds, and 68 ° C for 2 minutes.

The PCR product is loaded onto a 2% agarose gel. A DNA band of the expected size was excised from the gel, placed on a GENELUTE AGAROSE spin column (Supelco) and centrifuged at maximum speed for 10 minutes. The eluted DNA was ethanol precipitated and resuspended in 12 μl H ₂ O for ligation. These PCR primer sequences can be derived from the sequences provided herein.

  This ligation reaction uses a solution from the TOPO TA cloning kit (Invitrogen). The reaction proceeds in a solution containing 4 μl PCR product and 1 μl pCRII-TOPO vector for 5 minutes at room temperature. The reaction is terminated by the addition of 1 μl of 6 × TOPO cloning stop solution. The ligation product is then placed on ice. 2 μl ligation reaction is used to transform ONE-SHOT TOP10 cells (Invitrogen). Briefly, the ligation reaction is mixed with the cells and placed on ice for 30 minutes. The cells are then heat shocked at 42 ° C. for 30 seconds and placed on ice for 2 minutes. Next, 250 μl of SOC is added to the cells, which is incubated for 1 hour at 37 ° C. with shaking and then plated on ampicillin plates.

  A single colony from this plate is used to inoculate a 5 ml culture of LB medium. Plasmid DNA is purified from this culture using a CONCERTRAP RAPID PLASMID MINIPREP SYSTEM (GibcoBRL) and then the insert of the plasmid DNA is sequenced.

This gp354 genomic phage DNA is determined using ABI PRISM 310 Genetic Analyzer (PE Applied Biosystems) (which uses advanced capillary electrophoresis technology and ABI PRISM BIGDYE Terminator Cycle Sequencing Ready Reit). The cycle-sequencing reaction system may include 14 ml H ₂ O, 16 ml BIGDYE Terminator mixture, 7 ml genomic phage DNA (0.1 mg / ml) and 3 ml primer (25 ng / ml). The reaction is performed on a Perkin-Elmer 9600 thermal cycler by: 95 ° C. for 5 minutes, followed by 99 cycles of 95 ° C. for 30 seconds, 55 ° C. for 20 seconds and 60 ° C. for 4 minutes. The product is purified using a CENTRIFLEX gel filtration cartridge, dried under reduced pressure, and then dissolved in 16 μl of Template Suppression Reagent (PE Applied Biosystems). These samples are heated at 95 ° C. for 5 minutes and then placed in a 310 Genetic Analyzer.

DNA subcloned into pCRII is sequenced using ABI PRISM 310 Genetic Analyzer (supra). Each cycle-sequencing reaction system contains 6 ml H ₂ O, 8 ml BIGDYE Terminator mixture, 5 ml miniprep DNA (0.1 mg / ml), and 1 ml primer (25 ng / ml) and Perkin- Perform on an Elmer 9600 thermal cycler with 25 cycles of 96 ° C. for 10 seconds, 50 ° C. for 10 seconds, and 60 ° C. for 4 minutes. The product is purified using a CENTRIFLEX gel filtration cartridge, dried under reduced pressure, and then dissolved in 16 μl of Template Suppression Reagent. These samples are heated at 95 ° C. for 5 minutes and then placed in a 310 Genetic Analyzer.

Example 7: Hybridization analysis to demonstrate the expression of GP354 in the brain
Expression of gp354 in mammals (eg, rats) can be studied by in situ hybridization histochemistry. To study gp354 expression in the pancreas, coronal and sagittal rat pancreatic cryosections (20 μm thick) are prepared, for example, using a Reichert-Jung cryostat. Individual sections are thaw mounted on silane-treated slides without nuclease (CEL Associates, Inc., Houston, TX) and stored at -80 ° C. Sections were first treated after fixation in 4% cold paraformaldehyde, rinsed in cold phosphate buffered saline (PBS), acetylated using acetic anhydride in triethanolamine buffer, It is then dehydrated by a series of alcohol washes with 70%, 95% and 100% alcohol at room temperature. Subsequently, the sections are defatted in chloroform and subsequently rehydrated by sequential exposure to 100% and 95% alcohol at room temperature. Microscope slides containing the treated frozen sections are air-dried prior to hybridization. Other tissues can be assayed in a similar manner.

  A gp354-specific probe can be generated using PCR and sequence information from SEQ ID NO: 1 or SEQ ID NO: 3. After PCR amplification, this fragment is digested with restriction enzymes and cloned into pBluescript II cut with the same enzymes. For the generation of a probe specific for the sense strand of gp354, the cloned gp354 fragment cloned into pBluescript II can be linearized with the appropriate restriction enzymes, including the T7 promoter the vector has and the commercially available T7 RNA. A polymerase is used to provide a substrate for the labeled run-off transcript (ie, cRNA riboprobe). A probe specific for the antisense strand of gp354 is also linearized for production of labeled run-off cRNA transcripts using the T3 promoter and cognate polymerase, cleaving the recombinant plasmid with appropriate restriction enzymes. By generating the substrate, it can be easily prepared using the gp354 clone in pBluescript II.

Riboprobes are labeled with [ ³⁵ S] -UTP and have a specific activity of about 0.40 × 10 ⁶ cpm / pmol for antisense riboprobe and about 0.65 × 10 ⁶ cpm for sense strand riboprobe. Can produce a specific activity of / pmol. Subsequently, each riboprobe can be denatured and hybridized with 50% formamide, 10% dextran, 0.3 M NaCl, 10 mM Tris (pH 8.0), 1 mM EDTA, 1 × Denhardt's solution, and 10 mM dithiothreol. Can be added to buffer (2 pmol / ml).

  Microscopic slides containing serial pancreatic frozen sections can be independently exposed to 45 μl of hybridization solution per slide, and a silane treated coverslip is placed on the sections exposed to the hybridization solution. obtain. Incubate sections at 52 ° C. overnight (eg, 15-18 hours) to allow hybridization. An equivalent series of frozen sections is then exposed to a sense or antisense gp354-specific cRNA riboprobe.

  After the hybridization period, the coverslips were wiped from the slides in 1 × SSC, and the slides were subsequently washed for 45 minutes at 37 ° C. with 10 mM Tris HCl (pH 7.4), 0.5 M EDTA and 0.5 M Treat RNase A by exposure to 20 μg / ml RNase A in a buffer containing NaCl. The frozen sections are then subjected to three high stringency washes at 52 ° C. in 0.1 × SSC for 20 minutes each. After a series of washes, the frozen sections were dehydrated by sequential exposure to 70%, 95% and 100% ammonium acetate in alcohol, followed by air drying and exposure to KODAK BIOMAX MR-1 film. . After 13 days of exposure, the film is developed and any significant hybridization signal is detected.

  Based on these results, slides containing hybridized tissue are coated with KODAK NTB-2 nuclear track emulsion and stored in the dark for 32 days, as shown by the autoradiogram of the film. The slide is then developed and counterstained with hematoxylin. Sections coated with the emulsion are analyzed under a microscope to determine the specificity of the label. This signal is determined to be specific if autoradiographic grains (generated by hybridization of the antisense probe) are clearly associated with the cell body stained with cresyl violet. Autoradiographic grains found between cell bodies indicate non-specific binding of the probe.

  The expression of GP354 in the pancreas and brain (below) provides an indication that a modulator of GP354 activity has utility for treating certain neurological disorders by inhibiting or increasing GP354 activity in the nervous system. .

(Example 8: Northern blot analysis of gp354-RNA)
Northern blot hybridization can be performed to test for expression of gp354 mRNA. A clone containing at least part of the sequence of SEQ ID NO: 1, SEQ ID NO: 3 or their complement may be used as a probe. Vector specific primers are used for PCR to generate hybridization probe fragments for ³² P labeling. PCR is performed as follows:
(1) Mix the following reagents:
1 μl gp354-containing plasmid 2 μl Forward primer 2 μl Reverse primer 10 μl 10 × PCR buffer provided by the manufacturer of Taq polymerase (eg Amersham Pharmacia Biotech) 1 μl 10 mM dNTP (eg Boehringer Mannheim 64 catalog number 196)
0.5 μl Taq polymerase (eg Amersham Pharmacia Biotech catalog number 27-0799-62)
83.5 μl water.

(2) Perform PCR on the thermocycler using the following program:
94 ° C for 5 minutes; 94 ° C for 1 minute, 55 ° C for 1 minute and 72 ° C for 1 minute for 30 cycles; then 72 ° C for 10 minutes.

The PCR product can be purified using the QIAQUICK PCR Purification Kit (Qiagen catalog number 28104). This purified PCR fragment was purified by random priming using “Ready-to-go DNA Labeling Beads” (Amersham pharmacia Biotech catalog number 27-9240-01), ³² P-dCTP (Amersham Pharmacia Biotech catalog number AA0005 / 250). Label with. Hybridization is performed on human multiple tissue Northern blots from Clontech according to the manufacturer's protocol. A band of approximately 1.35 kb is visualized after overnight exposure on a Molecular Dynamics PHOSPHORIMAGER screen (Cat. No. MD146-814).

Example 9: Recombinant expression of GP354 in eukaryotic host cells
(A. Expression of gp354 in mammalian cells)
In order to produce GP354 protein, a GP354-encoding polynucleotide is expressed using recombinant techniques. For example, the GP354 coding sequence described in Example 1 is subcloned into the commercially available expression vector pzeoSV2 (Invitrogen). The resulting expression construct is transfected into Chinese hamster ovary (CHO) cells using the transfection reagent FUGENE6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert. Other eukaryotic cell lines (including human embryonic kidney (HEK 293) and COS cells) are equally suitable.

  Cells stably expressing GP354 are selected by growth in the presence of 100 μg / ml zeocin (Stratagene, LaJolla, Calif.). If desired, GP354 can be purified from the cells using standard chromatographic techniques. To facilitate purification, an antiserum is raised against one or more synthetic peptide sequences corresponding to a portion of the GP354 amino acid sequence and this antiserum is used to affinity purify GP354. The GP354 protein can also be expressed in-frame with a tag sequence (eg, polyhistidine, hemagglutinin or FLAG) to facilitate purification. Further, it is understood that many uses of GP354 polypeptides (eg, the assays described below) do not require purification of GP354 from host cells.

(B. Expression of GP354 in 293 cells)
For expression of GP354 in mammalian cells 293 (transformed human or primate embryonic kidney cells), a plasmid with the relevant gp354 coding sequence is prepared using the vector pSecTag2A (Invitrogen). Vector pSecTag2A is a mouse IgK chain leader sequence for secretion, a c-myc epitope for detecting recombinant protein using anti-myc antibody, a C-terminal polyhistidine for purification using nickel chelate chromatography, and a stable A zeocin resistance gene for selection of the appropriate transfectants. The forward primer for amplification of the gp354 cDNA was determined by conventional procedures, and the forward primer preferably matches the 5 ′ extension of the nucleotide to introduce the HindIII cloning site and the gp354 sequence. Nucleotides. A reverse primer is also determined by conventional procedures, and this reverse primer is preferably at the 5 'extension of the nucleotide to introduce an XhoI restriction site for cloning and the reverse complement of the gp354 sequence. Contains the corresponding nucleotide. PCR conditions are 55 degreeC as annealing temperature. The PCR product is gel purified and cloned into the HindIII-XhoI site of the vector. The DNA is purified using a QIAGEN chromatography column and transfected into 293 cells using DOTAP transfection medium (Boehringer Mannheim). Transiently transfected cells are tested for expression using Western blots probed with anti-His and anti-GP354 peptide antibodies 24 hours after transfection.

  Permanently transfected cells are selected and expanded with Zeocin. Production of recombinant protein is detected from both cells and media using Western blots probed with anti-His peptide antibody, anti-Myc peptide antibody or anti-GP354 peptide antibody.

(C. Expression of GP354 in COS cells)
For expression of GP354 in COS7 cells, for example, a polynucleotide having the sequence of SEQ ID NO: 1 can be cloned into the vector p3-CI. This vector is a pUC18-derived plasmid containing an HCMV (human cytomegalovirus) promoter intron located upstream from the bGH (bovine growth hormone) polyadenylation sequence and a multiple cloning site. In addition, this plasmid contains a dhrf (dihydrofolate reductase) gene that provides selection in the presence of the drug methotrexate (MTX) for selection of stable transformants.

  A forward primer is determined by conventional procedures, and the forward primer is preferably a 5 ′ extension site that introduces an XbaI restriction site for cloning, followed by a nucleotide corresponding to the nucleotide sequence of SEQ ID NO: 1. including. A reverse primer is also determined by conventional procedures, and this reverse primer is preferably a 5 ′ extension of the nucleotide introducing the SalI cloning site, followed by the reverse complement of the nucleotide sequence of SEQ ID NO: 1. Contains the corresponding nucleotide.

  This PCR consists of an initial denaturation step at 95 ° C. for 5 min; 30 cycles of denaturation at 95 ° C. for 30 sec, annealing at 58 ° C. for 30 sec and extension at 72 ° C. for 30 sec; followed by 5 min at 72 ° C. Consists of elongation. The PCR product is gel purified and ligated into the XbaI and SalI sites of vector p3-CI. Using this construct, competent E. coli. E. coli cells are transformed. Then, using a QIAGEN chromatography column, E.I. Plasmid DNA is purified from the E. coli culture and transfected into COS7 cells using LIPOFECTAMINE reagent from BRL according to the manufacturer's specifications. The media and cells are tested for recombinant protein expression 48 and 72 hours after transfection.

  GP354 expressed from COS cell culture can be purified by first concentrating the cell growth medium to about 10 mg protein / ml. This purification can be achieved, for example, by chromatography.

  Purified GP354 is concentrated to 0.5 mg / ml with an AMICON concentrator equipped with a YM-10 membrane and stored at −80 ° C.

(D. Expression of GP354 in insect cells)
For expression of GP354 in a baculovirus system, a polynucleotide having the sequence of SEQ ID NO: 1 is amplified by PCR. A forward primer is determined by conventional procedures, and the forward primer preferably comprises a 5 ′ extension that adds an NdeI cloning site followed by a nucleotide corresponding to the nucleotide sequence of SEQ ID NO: 1. The reverse primer is also determined by conventional procedures, and this reverse primer preferably corresponds to the 5 ′ extension that introduces the KpnI cloning site, followed by the reverse complement of the nucleotide sequence of SEQ ID NO: 1. Contains nucleotides.

  PCR products are gel purified, digested with NdeI and KpnI, and cloned into the corresponding sites of the expression vector pAcHTL-A (Pharmingen, San Diego, Calif.). This pAcHTL vector contains the strong polyhedron promoter of Autographa californica nuclear polyhedrosis virus (AcMNPV) and a 6 × His tag upstream from the multiple cloning site. A nucleic acid sequence encoding a protein kinase site for phosphorylation and a thrombin site for excision of the recombinant protein precedes the multiple cloning site.

  Of course, many other baculovirus vectors (eg, pAc373, pVL941 and pAcIM1) can be used in place of pAcHTL-A. Other vectors suitable for expression of the GP354 polypeptide may also be used, provided that the vector construct contains properly positioned signals (eg, in-frame AUG and signal peptides for transcription, translation and transport). ) As necessary. Such vectors are described, for example, in Luckow et al., Virology 170: 31-39 (1989).

This virus can be used in standard baculovirus expression methods (eg, Summers et al., A MANUAL OF METHODS FOR BACULOIRUS VECTORS AND INSECT CELL CURRENT PROCEEDURES, Texas Agricultural Exp. 15). Grow and isolate. In a preferred embodiment, pAcHLT-A containing the gp354 gene is introduced into baculovirus using the BACULOGOLD transfection kit (Pharmingen). Individual viral isolates are analyzed for protein production by radiolabeling infected cells with ³⁵ S-methionine 24 hours after infection. Infected cells are harvested 48 hours after infection and the labeled protein is visualized by SDS-PAGE. Viruses that exhibit high expression levels can be isolated and used for scaled up expression.

  For expression of GP354 polypeptide in Sf9 cells, a polynucleotide having the sequence of SEQ ID NO: 1 can be amplified by PCR using the methods described above for baculovirus expression. The gp354 cDNA is cloned into the vector pAcHLT-A (Pharmingen) for expression in Sf9 insect cells. After removing the internal NdeI site (using the same primers described above for expression in baculovirus), the insert is cloned into the NdeI and KpnI sites. DNA is purified using a QIAGEN chromatography column and expressed in Sf9 cells. Preliminary Western blot experiments from unpurified plaques are tested for the presence of a putative size recombinant protein using GP354 specific antibodies. This result is confirmed after further purification and optimization of expression in HiG5 cells.

(Example 10: Interaction capture / two-hybrid system)
An interaction capture / two-hybrid library screening method can be used to assay for GP354 interacting proteins. This assay was first described in Fields et al., Nature 340: 245 (1989). The protocol is described in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, NY (1999) and Ausubel. F. M.M. SHORT PROTOCOLS IN MOLECULAR BIOLOGY, 4th edition, Greene and Wiley-interscience, NY (1992). The kit is commercially available from, for example, Clontech (MATCHMAKER Two-Hybrid System 3).

  A fusion of the nucleic acid sequence encoding all or part of GP354 and the DNA binding domain (DNA-BD) of the yeast transcription factor GAL4 is constructed using an appropriate vector (ie, pGBKT7). Similarly, a GAL4 active domain (AD) fusion library is constructed in a second plasmid (ie, pGADT7) derived from the cDNA of a potential GP354 binding protein. See, for example, Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition, Cold Spring Harbor Press, Cold Spring Harbor, NY (1989) for the protocol for preparing the cDNA library.

  The DNA-BD / GP354 fusion construct is confirmed by sequencing and tested for autonomous reporter gene activation and cytotoxicity, both of which interfere with successful two-hybrid analysis. Similar controls are performed with the AD / library fusion construct to demonstrate loss of expression and transcriptional activity in the host cell. According to standard procedures (Ausubel et al., Supra), yeast cells are transformed with both GP354 plasmid and library fusion plasmid (approximately 105 transformants / mg DNA). In vivo binding of DNA-BD / GP354 and AD / library proteins results in transcription of certain yeast plasmid reporter genes (ie, lacZ, HIS3, ADE2, LEU2). Yeast cells are plated on nutrient-deficient medium and screened for reporter gene expression. Colonies are assayed in duplicate for β-galactosidase activity in growth in medium supplemented with Xgal (5-bromo-4-chloro-3-indolyl-bD-galactoside) (filter assay for β-galactosidase activity) Are described in Breeden et al., Cold Spring Harb. Symp. Quant. Biol., 50: 643 (1985)). Positive AD-library plasmids are rescued from the transformants and reintroduced into the original yeast strain and other strains containing an irrelevant DNA-BD fusion protein to obtain specific GP354 / library protein reciprocity. Check the action. The inserted DNA is sequenced to demonstrate the presence of an open reading frame fused to GAL4 AD and to determine the identity of the GP354 binding protein.

Example 11: Antibody to GP354 polypeptide
Standard techniques are used to generate polyclonal or monoclonal antibodies against GP354 and to generate these useful antigen-binding fragments or variants thereof (including “humanized” variants). Such protocols can be found, for example, in Sambrook et al. (Supra) and in Harlow et al. (Supra). In some embodiments, recombinant GP354 polypeptides (or cells or cell membranes containing such polypeptides) are used as antigens to generate antibodies. In other embodiments, one or more peptides having an amino acid sequence corresponding to an immunogenic portion of GP354 (eg, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20 or more amino acids) are used as antigens. Peptides corresponding to the extracellular portion of GP354 are preferred, particularly hydrophilic extracellular portions. The antigen can be mixed with an adjuvant or linked to a hapten to increase antibody production.

(A. Polyclonal antibody or monoclonal antibody)
In one exemplary protocol, recombinant GP354 or synthetic fragments thereof are used to immunize mice to generate monoclonal antibodies, or for polyclonal antibodies, immunize larger mammals (eg, rabbits). . To increase antigenicity, the peptide can be conjugated to keyhole limpet hemocyanin, eg, commercially available from Pierce. For the first injection, the antigen is emulsified with Freund's complete adjuvant and injected subcutaneously. At 2-3 week intervals, additional aliquots of GP354 antigen are emulsified with Freund's incomplete adjuvant and injected subcutaneously. Prior to the last boost injection, serum samples are taken from the immunized mice and assayed by Western blot to confirm the presence of antibodies immunoreactive with GP354. Sera from this immunized animal can be used as a polyclonal antiserum or can be used to isolate polyclonal antibodies that recognize GP354.

  Alternatively, mice are sacrificed and their spleens removed for production of monoclonal antibodies. To produce monoclonal antibodies, the spleen is placed in 10 ml serum free RPMI 1640 and 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units / ml penicillin, and 100 μg / ml streptomycin (RPMI) (Gibco , Canada), a single cell suspension is formed by grinding the spleen in serum-free RPMI 1640 supplemented with Canada. The cell suspension is filtered and washed by centrifugation and resuspended in serum free RPMI. Thymocytes harvested from 3 native Balb / c mice are prepared in a similar manner and used as a feeder cell layer. NS-1 myeloma cells kept in log phase for 3 days prior to fusion in RPMI containing 10% fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) were similarly centrifuged, Then wash.

To generate hybridoma fusions, spleen cells from immunized mice are combined with NS-1 cells and centrifuged and the supernatant is aspirated. The cell pellet is removed by tapping the tube, and 2 ml of 37 ° C. PEG 1500 (50% in 75 mM HEPES, pH 8.0) is added to the pellet and stirred, followed by addition of serum-free RPMI To do. The cells were then centrifuged and 15% FBS, 100 μM sodium hypoxanthine, 0.4 μM aminopterin, 16 μM thymidine (HAT) (Gibco), 25 units / ml IL-6 (Boehringer-Mannheim) and 1.5 × Resuspend in RPMI containing 10 ⁶ thymocytes / ml and place in 10 flat bottom 96 well tissue culture plates.

  Two, four and six days after fusion, 100 μl of medium is removed from the wells of these tissue culture plates and replaced with fresh medium. On day 8, fusions are screened by ELISA and tested for the presence of mouse IgG that binds to GP354. Cells in selected wells are further cloned by dilution until a monoclonal culture producing anti-GP354 antibody is obtained.

(B. Humanization of anti-GP354 monoclonal antibody)
The expression pattern of GP354 reported herein, and the potential of GP354 as a target for therapeutic intervention, suggests a therapeutic indicator for GP354 inhibitors (antagonists). GP354 neutralizing antibodies comprise one class of therapeutic agents useful as GP354 antagonists. The following is a protocol for improving the usefulness of anti-GP354 monoclonal antibodies as therapeutic agents in humans by “humanizing” anti-GP354 monoclonal antibodies. Humanized antibodies have improved serum half-life and are less immunogenic in humans. The principle of antibody humanization is described in the literature. For example, to minimize potential binding to complement, it is preferred that the humanized antibody be of the IgG ₄ subtype.

  One level of humanization can be achieved by creating a chimeric antibody comprising the variable domain of the non-human antibody of interest and the constant domain of a human antibody. For example, Morrison et al., Adv. Immunol. 44: 65-92 (1989). The variable domain of the anti-GP354 antibody can be cloned from the genomic DNA of an appropriate B cell hybridoma or from cDNA derived from this hybridoma. V region gene fragments are linked to exons encoding human antibody constant domains. The resulting construct is expressed in a suitable mammalian host cell (eg, myeloma cells or CHO cells).

  In order to achieve higher levels of humanization, only the portion of the variable region gene fragment encoding the antigen binding complementarity determining region (CDR) of the non-human monoclonal antibody is cloned into the human antibody sequence. For example, Jones et al., Nature 321: 522-525 (1986); Riechmann et al., Nature 332: 323-327 (1988); Verhoeyen et al., Science 239: 1534-36 (1988); and Tempest et al., Bio / Technology 9: 266-71 (1991). If necessary, the β-sheet framework of the human antibody surrounding the CDR3 region is also modified (ie, “backmutation” to more closely reflect the three-dimensional structure of the antigen-binding site of the original monoclonal antibody. )). Kettleborough, et al., Protein Engine. 4: 773-783 (1991); and Foote et al., J. Biol. Mol. Biol. 224: 487-499 (1992).

  In an alternative approach, the surface of the non-human monoclonal antibody of interest modifies selected surface residues of the non-human antibody, for example by site-directed mutagenesis, while the internal residues and contact residues of the non-human antibody are changed. It is humanized by maintaining all of the groups. Padlan, Mol. Immunol. , 28 (4/5): 489-98 (1991).

  The approach described above is utilized using anti-GP354 monoclonal antibodies and hybridomas producing these antibodies. Humanized anti-GP354 antibodies are useful as therapeutic agents for treating or alleviating conditions where GP354 expression or ligand-mediated GP354 signaling is not desired.

(C. human GP354 neutralizing antibody derived from phage display)
Anti-GP354 antibodies are also described in Aujame et al., Hum. Antibodies 8 (4): 155-168 (1997); Hoogenboom (supra); and Rader et al., Curr. Opin. Biotechnol. 8: 503-508 (1997). For example, antibody variable regions in the form of Fab fragments or linked short Fv fragments are fused to the amino terminus of filamentous phage minor coat protein pIII. Expression of the fusion protein and incorporation of the fusion protein into the mature phage coat results in a phage particle that displays the antibody on its surface and contains the genetic material encoding the antibody. Phage libraries containing such constructs are expressed in bacteria and the library is screened for GP354-specific phage antibodies using labeled GP354 or immobilized GP354 as an antigen probe.

(D. Human GP354-specific antibody derived from a transgenic mouse)
Human GP354-specific antibodies are essentially as described by Brueggemann et al., Immunol. Today 17 (8): 391-97 (1996) and Bruggemann et al., Curr. Opin. Biotechnol. 8: 455-58 (1997). Transgenic mice carrying human V gene segments in a germline configuration and expressing these transgenes in their lymphoid tissue are immunized with the GP354 composition using conventional immunization protocols. Using this immunized mouse-derived B cell, hybridomas are generated and screened using conventional protocols to identify hybridomas that secrete anti-GP354 human antibodies (eg, as described above). .

Example 12: Assay to identify modulators of GP354 activity
Several non-limiting assays for identifying modulators (agonists and antagonists) of GP354 activity are described below. Among the modulators that can be identified by these assays are: natural ligands for receptors; synthetic analogs and derivatives of natural ligands; antibodies and / or antibody-like compounds from natural antibodies or antibody-like combinatorial libraries; and / or live Synthetic compounds identified by rally high-throughput screening.

  Any modulator that binds GP354 is useful for identifying GP354 in a tissue sample (eg, for diagnostic or therapeutic purposes). Agonist and antagonist modulators are useful for up-regulating and down-regulating GP354 activity, respectively, for treating GP354-mediated diseases. These assays can be performed using a single putative modulator and / or using a known agonist (or vice versa) in combination with a candidate antagonist.

(A. cAMP assay)
In one type of assay, cyclic adenosine monophosphate (cAMP) levels are measured in gp354-transfected cells exposed to candidate modulator compounds. Protocols for cAMP assays are described in the literature. See, for example, Sutherland et al., Circulation 37: 279 (1968); Flandsen et al., Life Sci. 18: 529-541 (1976); Dooley et al., J. MoI. of Pharmacol. Exp. Therap. 283 (2): 735-41 (1997); and George et al., J. Biol. Biomol. Screening 2 (4): 235-40 (1997). An exemplary protocol for such an assay using the NEN Life Science Products Adenylyl cyclase activated FLASHPLATE assay is described below.

Briefly, the GP354 coding sequence is subcloned into an expression vector such as pzeoSV2 (Invitrogen). CHO cells are transiently transfected with the resulting expression construct using known methods (eg, transfection protocol provided by Boehringer-Mannheim when supplying FUGENE6 transfection reagent). Transfected CHO cells are seeded from a FLASHPLATE assay kit into a 96-well microplate, which is coated with a solid scintillation agent conjugated with an antiserum to cAMP. As a control, some wells are seeded with untransfected CHO cells. The other wells in the plate are given various amounts of cAMP standard solution for use in generating a standard curve. One or more test compounds are added to the cells in each well and medium or buffer without compound is used as a control. After treatment, cAMP is allowed to accumulate in the cells for exactly 15 minutes at room temperature. The assay is terminated by the addition of lysis buffer containing [ ¹²⁵ I] -cAMP and the plates are counted using a Packard TOPCOUNT 96 well microplate scintillation counter. Unlabeled cAMP from lysed cells or standards and a fixed amount of [ ¹²⁵ I] -cAMP compete for the antibody bound to the plate. A standard curve is constructed and cAMP values for the unknown are obtained by interpolation. Changes in cellular intracellular cAMP levels in response to exposure to a test compound are indicative of modulation of GP354 activity. Regulators that act as agonists of receptors that bind to the Gs subtype of the G protein stimulate cAMP production leading to a modest (eg, 3-10 fold) increase in cAMP levels. Receptor agonists that bind to the Gi / o subtype of the G protein inhibit forskolin-stimulated cAMP production, leading to a modest decrease in cAMP levels (eg, 50-100%). Modulators that act as inverse agonists reverse these effects at receptors that are either constitutively active or activated by known agonists.

(B. Aequorin assay)
In another assay, cells (eg, CHO cells) are transiently co-transfected with a gp354 expression construct and a construct encoding the photoprotein apoaquorin. In the presence of the cofactor coelenterazine, apoaquorin produces measurable luminescence that is proportional to the amount of free calcium in the cytoplasm. See generally, Cobold et al., “Aequorin measurements of cytoplasmic free calcium”: McCormac J. et al. G. And Cobold P.M. H. Hen, CELLULAR CALCIUM: A PRACTICAL APPROACH. Oxford: IRL Press (1991); Stables et al., Anal. Biochem. 252: 115-26 (1997); and Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, 6th edition, Eugene OR (1996).

  In one exemplary assay, the gp354 coding sequence is subcloned into pzeoSV2 (Invitrogen). Using a transfection protocol provided with the resulting expression construct and the construct encoding the photoprotein apoaquorin (Molecular Probes), transfection reagent FUGENE6 (Boehringer-Mannheim) and product insert, To be transfected simultaneously.

These cells are cultured for 24 hours at 37 ° C. in MEM (Gibco / BRL, Gaithersburg, MD) supplemented with 10% fetal calf serum, 2 mM glutamine, 10 U / ml penicillin and 10 μg / ml streptomycin. The culture medium is then replaced with serum-free MEM containing 5 μM coelenterazine (Molecular Probes). Incubation is continued for an additional 2 hours at 37 ° C. Subsequently, these cells are detached from the plate using VERSEN (Gibco / BRL), washed and resuspended at 2 × 10 ⁵ cells / ml in serum free MEM.

  Dilutions of candidate GP354 modulator compounds are prepared in serum-free MEM and dispensed at 50 μL / well into wells of an opaque 96-well assay plate. The plate is then placed in an MLX microtiter plate luminometer (Dynex Technologies, Inc., Chantilly, VA). The device is programmed to dispense 50 μl of cell suspension into each well, one well at a time, and immediately read the luminescence for 15 seconds. A dose-response curve for the candidate modulator is constructed using the area under the curve for each light signal peak. Data is analyzed using SLIDEWRITE using the formula for single site ligands and EC50 values are obtained. The change in luminescence caused by these compounds is taken as an indicator of regulatory activity. In receptors that bind to the Gq subtype of the G protein, modulators that act as agonists give a 100-fold increase in luminescence. Modulators that act as inverse agonists reverse this effect at receptors that are either constitutively active or activated by known agonists.

(C. Luciferase Reporter Gene Assay)
Photoprotein luciferase provides another useful tool for identifying GP354 modulators. A reporter construct comprising a gene for a luciferase protein downstream of a gp354 expression construct and a transcription factor binding site (eg, cAMP response element (CRE), AP-1, or NF-κB) So, temporarily transfect simultaneously. The expression level of luciferase reflects the activation state of the signaling event. See, in general, George et al. Biomol. Screening 2 (4): 235-240 (1997); and Stratowa et al., Curr. Opin. Biotechnol. 6: 574-581 (1995). Luciferase activity can be measured quantitatively using, for example, luciferase assay reagents available from Promega (Madison, Wis.).

In one exemplary assay, CHO cells are plated in 24-well culture plates at a density of 10 ⁵ cells / well one day prior to transfection and 10% fetal calf serum, 2 mM glutamine, 10 U / ml penicillin and Incubate at 37 ° C. in MEM (Gibco / BRL) supplemented with 10 μg / ml streptomycin. Cells are transiently co-transfected with a gp354 expression construct and a reporter construct containing a luciferase gene. Reporter plasmid constructs CRE-luciferase, AP-1-luciferase and NF-κB-luciferase can be purchased from Stratagene (LaJolla, Calif.). Transfections are performed using FUGENE 6 transfection reagent (Boehringer-Mannheim) according to the supplier's instructions. Cells transfected with the reporter construct alone are used as a control.

  Twenty-four hours after transfection, the cells are washed once with PBS preheated to 37 ° C. Serum-free MEM is then added to these cells, either alone (control) or with one or more candidate modulators. The cells are then incubated for 5 hours at 37 ° C. The cells are then washed once with ice-cold PBS and lysed by adding 100 μl of lysis buffer to each well of the luciferase assay kit supplied by Promega. After 15 minutes incubation at room temperature, 15 μl lysate was mixed with 50 μl substrate solution (Promega) in an opaque white 96-well plate and luminescence was measured using a Wallace model 1450 MICROBETA scintillation and luminescence counter (Wallace Instruments, Gaithersburg, MD) and read immediately.

  The difference in luminescence in the presence versus absence of a candidate modulator compound is an indicator of regulatory activity. Receptors that are either constitutively active or activated by an agonist typically provide a 3 to 20 fold stimulation of luminescence compared to cells transfected with the reporter gene alone. . Modulators acting as inverse agonists reverse this effect.

(D. Measurement of intracellular calcium using FLIPR)
Changes in intracellular calcium levels are another recognized indicator of receptor activity, and such assays can be used to screen for modulators of GP354 activity. For example, CHO cells stably transfected with a gp354 expression vector were prepared at a density of 4 × 10 ⁴ cells / well, using a Packard black wall 96 well plate (specially differentiated fluorescent signals emanating from various wells on this plate). Plate). These cells contain 36 mg / L pyruvate and 1 g / L glucose and contain 1% fetal calf serum and four calcium indicator dyes (FLUO-3 AM, FLUO-4 AM, CALCIUM GREEN-1 AM, or OREGON GREEN 488 BAPTA-1 AM) is incubated for 60 minutes at 37 ° C. in modified Dulbecco's PBS (D-PBS) added at a concentration of 4 μM each. Plates are washed once with modified D-PBS without 1% fetal bovine serum and incubated at 37 ° C. for 10 minutes to remove residual dye from the cell membrane. In addition, a series of washes with modified D-PBS without 1% fetal calf serum is performed immediately followed by activation of the calcium response.

  The calcium response is initiated by adding one or more candidate receptor agonist compounds (calcium ionophore A23187 (10 μM; positive control), or ATP (4 μM; positive control)). Fluorescence is measured by a Molecular Device FLIPR equipped with an argon laser (excitation at 488 nm). See, for example, Kuntzweiler et al., Drug Dev. Res. 44 (1): 14-20 (1998). The F-stop for the detector camera is set to 2.5 and the exposure length is 0.4 milliseconds. The baseline fluorescence of the cells is measured for 20 seconds, after which the candidate agonist, ATP or A23187 is added. The level of reference fluorescence is subtracted from the response signal. Measure for about 200 seconds while reading the calcium signal every 2 seconds. Calcium ionophore A23187 and ATP typically increase the calcium signal about 200% above baseline levels. In general, activated GP354 increases the calcium signal at least about 10-15% above the baseline signal.

(E. Mitosis induction assay)
In a mitogenesis assay, the ability of candidate modulators to induce or inhibit gp354-mediated cell division is determined. For example, Lajness et al., J. MoI. Pharmacol. Exp. Therap. 267 (3): 1573-1581 (1993). For example, CHO cells stably expressing GP354 are seeded in 96-well plates at a density of 5000 cells / well and grown for 48 hours at 37 ° C. in MEM containing 10% fetal calf serum, at which point Rinse these cells twice with serum-free MEM. After rinsing, 80 μl fresh MEM, or MEM containing a known mitogen, is added along with 20 μl MEM containing various concentrations of one or more test compounds diluted in serum-free medium. As controls, several wells on each plate contain serum-free medium alone and some contain medium containing 10% fetal calf serum. Non-transfected cells or cells transfected with the vector alone can also serve as controls.

After 16-18 hours of culture, 1 [mu] Ci [< ³ > H] -thymidine (2 Ci / mmol) is added to these wells and the cells are incubated at 37 [deg.] C for an additional 2 hours. These cells are trypsinized and collected on a filter mat using a cell harvester (Tomtec); the filters are then counted in a Betaplate counter. [ ³ H] -thymidine incorporation into serum-free test wells is compared to results achieved in serum-stimulated cells (positive control). The use of multiple concentrations of test compound allows the creation and analysis of dose response curves using the non-linear, least squares fit equation A = B × [C / (D + C)] + G. In this formula, A is the percent of serum stimulation; B is the maximum effect minus the baseline; C is the EC50; D is the concentration of the compound; and G is It is the greatest effect. The parameters B, C and G are determined by simple optimization.

Agonists that bind to the receptor are expected to increase [ ³ H] -thymidine incorporation into cells and show up to 80% response to serum. Antagonists that bind to the receptor inhibit stimulation seen with known agonists by up to 100%.

(F. [ ³⁵ S] GTPgS binding assay)
It is possible to assess whether GP354 signals through a G protein-mediated pathway. G protein-coupled receptors signal through intracellular G proteins, whose activity includes the binding of GTP and hydrolysis to give bound GDP. Thus, the measurement of the binding of [ ³⁵ S] GTPgS, a non-hydrolyzable GTP analog, in the presence and absence of candidate modulators provides another assay for modulator activity. See, for example, Kowal et al., Neuropharmacology 37: 179-187 (1998).

In one exemplary assay, cells stably transfected with the gp354 expression vector were grown to subconfluence in 10 cm tissue culture dishes and 5 ml ice-cold phosphate buffer without Ca ²⁺ / Mg ²⁺ . Rinse once with saline and scraped into 5 ml of the same buffer. Cells are pelleted by centrifugation (500 × g, 5 min), resuspended in TEE buffer (25 mM Tris (pH 7.5), 5 mM EDTA, 5 mM EGTA) and frozen in liquid nitrogen. After thawing, the cells are homogenized using a Dounce homogenizer (1 ml TEE per plate of cells) and centrifuged at 1,000 × g for 5 minutes to remove nuclei and unbroken cells.

  The homogenate supernatant was centrifuged at 20,000 × g for 20 minutes to isolate the membrane fraction, and the membrane pellet was washed once with TEE and binding buffer (20 mM HEPES, pH 7.5). , 150 mM NaCl, 10 mM MgCl2, 1 mM EDTA). The resuspended membrane can be frozen in liquid nitrogen and stored at -70 ° C until use.

Aliquots of cell membranes prepared as described above and stored at −70 ° C. are thawed, homogenized, and contain 20 mM HEPES, 10 mM MgCl 2, 1 mM EDTA, 120 mM NaCl, 10 μM GDP, and 0.2 mM ascorbic acid. Dilute in buffer at a concentration of 10-50 μg / ml. In a final volume of 90 μl, the homogenate is incubated with various concentrations of candidate modulator compounds or 100 μM GTP for 30 minutes at 30 ° C. and then placed on ice. To each sample, 10 μl guanosine 5′-O- (3 [ ³⁵ S] thio) triphosphate (NEN, 1200 Ci / mmol; [ ³⁵ S] -GTPgS) was added to a final concentration of 100-200 pM. Samples are incubated for an additional 30 minutes at 30 ° C., 1 ml of 10 mM HEPES (pH 7.4), 10 mM MgCl 2 (4 ° C.) is added and the reaction is stopped by filtration.

Samples are filtered through Whatman GF / B filters and the filters are washed with 20 ml ice cold 10 mM HEPES (pH 7.4), 10 mM MgCl ₂ . Filters are counted by liquid scintillation spectroscopy. Non-specific binding of [ ³⁵ S] -GTPgS is measured in the presence of 100 μM GTP and subtracted from the total. A compound that modulates the amount of [ ³⁵ S] -GTPgS binding in the cells is selected and compared to untransfected control cells. Receptor activation by agonists gives up to a 5-fold increase in [ ³⁵ S] -GTPgS binding. This response is blocked by antagonists.

(G. MAP kinase activity assay)
Assessment of MAP kinase activity in cells expressing GP354 provides another assay for identifying modulators of GP354 activity. See, for example, Lajness et al., Supra, and Boulton et al., Cell 65: 663-675 (1991). In one embodiment, CHO cells stably transfected with gp354 are seeded at a density of 7 × 10 ⁴ cells / well in 6-well plates 48 hours prior to the assay. During the 48 hours, the cells are cultured at 37 ° C. in MEM medium supplemented with 10% fetal calf serum, 2 mM glutamine, 10 U / ml penicillin and 10 μg / ml streptomycin. These cells are serum starved for 1-2 hours, after which a stimulatory factor is added.

For the assay, these cells were treated with medium alone or with medium containing either a candidate agonist or 200 nM Phorbol ester-myristoyl acetate (ie PMA, positive control) and the cells were treated at 37 ° C. Incubate at various times. To stop the reaction, the plates are placed on ice, the medium is aspirated, and the cells are rinsed with 1 ml ice-cold PBS containing 1 mM EDTA. Thereafter, 200 μl of cell lysis buffer (12.5 mM MOPS (pH 7.3), 12.5 mM glycerophosphate, 7.5 mM MgCl ₂ , 0.5 mM EGTA, 0.5 mM sodium vanadate, 1 mM benzamidine, 1 mM dithiothreitol 10 μg / ml leupeptin, 10 μg / ml aprotinin, 2 μg / ml pepstatin A, and 1 μM okadaic acid) are added to these cells. The cells are scraped from the plate and homogenized by passing 10 times through a 23 3 / 4G needle and the cytosolic fraction is prepared by centrifugation at 20,000 × g for 15 minutes.

An aliquot of cytosol (5-10 μl containing 1-5 μg protein) was added to 1 mM MAPK substrate peptide (APRTPGGRR (SEQ ID NO: 18), Upstate Biotechnology, Inc., NY) and 50 μM [g- ³² P] ATP (NEN, 3000 Ci / mmol) and diluted to a final specific activity of about 2000 cpm / pmol to a total volume of 25 μl. These samples are incubated at 30 ° C. for 5 minutes and the reaction is stopped by spotting 20 μl onto 2 cm ² square Whatman P81 phosphocellulose paper. These square filters are washed with 4 changes of 1% H ₃ PO ₄ and these squares are subjected to liquid scintillation spectroscopy to quantify the bound label. Equivalent cytosolic extracts are incubated without MAPK substrate peptide and bound label from these samples is subtracted from matching samples with substrate peptide. The cytoplasmic extract from each well is used as a separation point. Protein concentration is determined by a dye-binding protein assay (Bio-Rad Laboratories). Agonist activation of this receptor is expected to result in up to a 5-fold increase in MAPK enzyme activity. This increase is blocked by antagonists.

(H. [ ³ H] arachidonic acid release)
Activation of GP354 can also enhance the release of arachidonic acid in cells, which also provides another useful assay for modulators of GP354 activity. For example, Kanterman et al., Mol. Pharmacol. 39: 364-369 (1991). For example, CHO cells stably transfected with a GP354 expression vector are plated in 24 wells at a density of 1.5 × 10 ⁴ cells / well and 10% fetal calf serum, 2 mM glutamine, 10 U / ml penicillin and Grow for 48 hours at 37 ° C. in MEM medium supplemented with 10 μg / ml streptomycin before use. Cells in each well were treated with 0.5 μCi / ml [ ³ H] arachidonic acid (Amersham Corp., 210 Ci / in 1 ml MEM supplemented with 10 mM HEPES, pH 7.5, and 0.5% fatty acid free fetal bovine serum albumin. mmol) for 2 hours at 37 ° C. The cells are then washed twice with 1 ml of the same buffer. Candidate compounds are added to 1 ml of the same buffer, either alone or with 10 μM ATP, and the cells are incubated at 37 ° C. for 30 minutes. Buffer alone and mock-transfected cells are used as controls. Samples (0.5 ml) from each well are counted by liquid scintillation spectroscopy. An agonist that activates the receptor induces an enhanced ATP-stimulated release of [ ³ H] arachidonic acid. This enhancement is blocked by antagonists.

(I. Extracellular acidification rate)
In yet another assay, the effect of a candidate modulator of GP354 activity is assayed by monitoring the extracellular change in pH induced by the test compound. For example, Dunlop et al. Pharmacol. Toxicol. Meth. 40 (1): 47-55 (1998). In one embodiment, CHO cells transfected with a GP354 expression vector were transferred to 12 mm capsule cups (Molecular Devices Corp.) at 4 × 10 ⁵ cells / cup, 10% fetal bovine serum, 2 mM L-glutamine, 10 U / Seed in MEM medium supplemented with ml penicillin and 10 μg / ml streptomycin. The cells are incubated in this medium for 24 hours at 37 ° C. in 5% CO ₂ .

  The extracellular acidification rate is measured using a CYTOSENSOR MICROPHYSIOMETER (Molecular Devices Corp.). The capsule cup was attached to the sensor chamber of MICROPHYSIOMETER and the chamber was run with running buffer (4 mM L-glutamine, 10 units / ml penicillin, 10 μg / ml streptomycin, 26 mM NaCl, bicarbonate free MEM), Perfuse at a flow rate of 100 μl / min. Candidate agonists or other agents are diluted in running buffer and perfused through a second flow path. During each 60 second pump cycle, the pump is turned on for 38 seconds and turned off for the remaining 22 seconds. The pH of the running buffer in the sensor chamber is recorded from 43 to 58 seconds during the cycle, and the pump is restarted at 60 seconds to start the next cycle. The acidification rate of the running buffer during the recording time is calculated by the Cytosoft program. The change in the rate of acidification is obtained by subtracting the basal value (the average of the four rate measurements immediately before the addition of the modifier candidate) from the highest rate measurement obtained after the addition of the modifier candidate. Calculated. This selected instrument detects 61 mV / pH unit. Modifiers that act as agonists of the receptor result in an increase in the rate of extracellular acidification compared to the rate in the absence of agonist. This response is blocked by modifiers that act as receptor antagonists.

Example 13: Cloning of other gp354 genes or fragments
To obtain other gp354 genes or fragments, PCR was performed essentially as described in Example 3 (supra). Oligonucleotides GX1-220 and GX1-221 were used for inter-exon PCR testing of the first gp354 gene model. GX1-386 and GX1-387 were used to amplify the entire range of predicted gene parts. The mouse PanCAM ortholog was amplified and cloned using GX1-218 and GX1-221. Full length PanCAM cDNA was amplified from the pancreatic cDNA pool using GX3-238 and GX3-232. Their sequences are as follows:
GX1-218: ACTGGGGGCTAGTTCAGGTGACTAA (SEQ ID NO: 16)
GX1-220: GCCAGCATGACCTCCACATTAG (SEQ ID NO: 19)
GX1-221: CAGCTCCAGCTCTGCACACATAGTC (SEQ ID NO: 20)
GX1-386: ATGCGGGTCCCCCCCCTCCTCGTCCT (SEQ ID NO: 21)
GX1-387: CTTGGTTCCCAGAGTCCCCTTCCCTCC (SEQ ID NO: 22)
GX3-232: GGAGGAGTAAGGTCGCCCAACTTGTC (SEQ ID NO: 23)
GX3-238: ACCTTGGGGGACGAATGCTC (SEQ ID NO: 24)
This PCR product was isolated and cloned as described in Example 3 (supra).

  The cloned GX1-220 / GX1-221 PCR product was labeled by random hexamer extension using the protocol provided in the random hexamer kit (Invitrogen, Carlsbad, Calif.). This labeled fragment was used as a probe in Northern and multi-tissue expression (MTE) blots. Hybridization was performed according to the protocol provided for multi-tissue expression blots (Clontech).

  Northern blots show diffuse signals detected only in the pancreas, with sizes ranging from 2.2 to 3.5 Kb. Hybridization performed with an array of 76 human normal tissues showed a positive spot at the location of the pancreatic RNA sample. These data confirmed that the gp354 gene is predominantly expressed in the pancreas.

(Example 14: Cloning of full-length human gp354 gene)
The predicted full length 1,779 (including stop codon) base pairs from the gene portion were extracted from the human pancreatic cDNA pool with primers GX1-386 and GX1-387, which contain the entire length of the predicted open reading frame (FIG. 7). Was amplified by PCR. In order to amplify the full-length cDNA, the inventors have included a pair of oligonucleotides (GX1-238 and GX1-232, previous) within the putative 5 ′ and 3 ′ untranslated region sequences and within the AL136654 sequence. E) were designed and used for PCR of human pancreatic cDNA pools. Two different cDNA clones were obtained. Both were smaller than AL136654 and within the size range determined by Northern blot. They are followed by an open reading frame, similar to the open reading frame obtained from the original gene prediction, and encode a protein with a 4Ig domain or a 5Ig domain (FIG. 9A).

  This gene encodes a protein with multiple C2-type Ig domains that is predominantly expressed in the pancreas and characterizes cell adhesion molecules (Williams et al., Annu. Rev. Immunol. 6: 381-405 (1988)). Thus, the inventors have also named this gene PanCAM (pancreatic cell adhesion molecule).

  The longest PanCAM potential ORF-encoded protein is composed of 708 amino acid residues and contains a signal peptide, 5 Ig domains (3 of these are C2 types), a transmembrane domain, and a 174 amino acid cell Includes internal domains. It is longer than the protein encoded by our original gene prediction for both the amino and carboxy termini.

  A BLASTP search of the public database identified several proteins with significant similarity to PanCAM. The three most similar proteins that have been characterized are the human and mouse NEPH1, nephrin, Drosophila irregular cross-C rugest (“Irre”) proteins (see, eg, FIG. 2) . In all these cases, the homology is concentrated in the extracellular part of the protein and there is no significant homology in the intracellular part.

  Human NEPH1 (NP — 060710) and mouse NEPH1 protein (NP — 570937) are potential cell adhesion molecules that play an important role in kidney development (Donoviel et al., Mol. Cell. Biol. 21 (14): 4829-36 (2001). )). Like PanCAM, NEPH1 has 5 Ig domains, and its human protein is 44% identical to PanCAM in the extracellular domain, while its mouse protein is identical to PanCAM in the extracellular domain. There is 47% identity.

  Human nephrin (NPHS1, NP — 004637) is the second most similar BLASTP score, sharing 33% identity in the extracellular domain of GP354. This protein contains eight Ig domains and is localized in the glomerular slit diaphragm. Nephrin plays a role in cell adhesion and is involved in the development of the glomeruli of the kidney (Rutosalainen et al., Proc. Natl. Acad. Sci. USA 96: 7962-7967 (1999); Kestila et al. Mol. Cell 1 (4): 575-82 (1998)). Mutations in the nephrin gene cause congenital nephritis in humans (Kestila et al., Supra).

  Drosophila irregular crossover C Lafest precursor (irre, NP — 525058) is another homologous protein. Irre is a compound eye (Ramos et al., Genes Dev. 7. (12B): 2533-47 (1993); Schneider et al., Neuron 15 (2): 259-71 (1995)), and tactile sensation (Reddy et al., Dev. Genes). Evol.209 (10): 581-91 (1999)) is a cell adhesion protein required for development. This protein contains 5 C2 type Ig domains and shares 31% homology with PanCAM. Mutations at the Irre allele in Drosophila affect the development of fly sensory organs and are apparently due to at least some abnormal apoptotic activity (Ramos et al., Supra).

  NEPH1, nephrin and Irre are involved in developmental patterning and cell-cell communication. The similarity between GP354 and these proteins indicates that GP354 also triggers similar developmental pathways and signaling pathways involved in organ and tissue development and / or maintenance, particularly in the pancreas and nervous system— It suggests that it plays a role in cell interaction.

Example 15: Alternative Splicing of PanCAM
Sequence comparison of the sequences of the two pancreatic cDNA clones and the two published EST sequences (AL136654 and BC007312) showed that there are at least four alternative splicing products of PanCAM (FIG. 9B). AL136654 (identified in the fetal brain cDNA library) includes all predicted exons and probably represents the longest full-length cDNA. BC007312 (EST clone from retinoblastoma cDNA) is the shortest PanCAM transcript identified to date. BC007312 is generated by using potential splicing sites in exon 2 and exon 11 (FIG. 9B), where the encoded protein lacks all of the Ig domain and contains a putative intracellular domain and Has a fused signal peptide.

  Pancreatic cDNA clones differ from each other in the extracellular domain, but have the same transmembrane and intracellular domains. A shorter cDNA clone from pancreas (PanCAM-2) encodes a protein that is a deleted portion of Ig domain 1 due to splicing outside exon 2 (FIG. 9B). The intracellular domains of these two pancreatic cDNA clones are shorter than other putative protein sequences due to splicing outside the last exon portion (Figure 9A).

(Example 16: Cloning of a partial cDNA of mouse PanCAM)
To detect and clone the mouse orthologue of PanCAM, multiple inter-exon oligonucleotide pairs were designed based on human gene sequences and tested by PCR on cDNA pools from multiple mouse tissues. One oligonucleotide pair produced a weak band from the mouse brain cDNA pool. This PCR product was cloned and sequenced. The mouse cDNA clone (SEQ ID NO: 32) is 934 nucleotides long and the encoded protein is 85% identical to the human control (FIGS. 10A-B).

(Example 17: PanCAM is β-cell specific in the pancreas)
To further characterize the PanCAM protein, a soluble form of the extracellular domain was used in screening for phage antibodies. Four Fab fragments were screened against the extracellular portion of this protein from a phage antibody library (Knappik et al., J. Mol. Biol. 296 (l): 57-86 (2000). All these Fabs were Recognized recombinant proteins in Western blots, three of which recognized PanCAM on paraffin-fixed tissue slides.

  Immunohistochemistry (with IHC staining) was performed on slides including human heart tissue, brain tissue, kidney tissue, liver tissue, lung tissue, pancreatic tissue, spleen and muscle tissue, and pancreatic tissue from monkeys (Cynomolqous) and mice. Performed above. Of the human tissues tested, only the pancreas showed staining. This result clearly showed that this gene is specifically expressed in human, monkey and mouse pancreatic islets of Langerhans.

In addition to pancreatic staining, the mouse anterior pituitary was also positive for IHC but weaker and scattered staining. This pituitary staining showed the presence of EST clones in the brain library and the ability to clone orthologs derived from mouse brain cDNA.
To identify PanCAM expression patterns at the cellular level, we performed RT-PCR on RNA from multiple cell lines. (293E, Cos7, mouse pancreatic endothelial cells (CRL2279) (Arbiser et al., Proc. Natl. Acad. Sci. USA 94 (3): 861-6 (1997)), alpha cells (CRL2350) (Powers et al., Diabetes 39 ( 4): 406-14 (1990)), β cells from obese / obese mice (CRL2364) (derived from a mouse strain with carboxypeptidase E mutation and incomplete proinsulin processing and insulin secretion); Nuggert et al., Nat Genet 10 (2): 135-42 (1995); Varlamov et al., Endocrinology 138 (11): 4883-92 (1997)), and wild type mouse-derived β cells (CRL, 2055) (Hamaguchi et al., Diabet). s 40 (7): 842-9 (1991)). This result confirmed that the expression of PanCAM was β-cell specific.

  In particular, obese / obese mouse-derived β cells gave two RT-PCR products. Each RT-PCR band was much weaker than a single band amplified from wild type β cells. The sequences of the two RT-PCR products from the mutant cell line are such that the larger molecular weight band is the same as the wild type control band, while the smaller molecular weight band is an alternative splicing product. Was confirmed. A potential splicing site was used to produce a shorter transcript, resulting in the 3 'half of this exon and four downstream exons. As a result, Ig domain 2 and Ig domain 3 are deleted within the open reading frame, while the downstream reading frame remains intact.

Example 18: Reduction of PanCAM-positive cells while developing diabetes in NOD mice
To test whether PanCAM plays a role in the development of type I diabetes, as a first step, pancreas from 4, 8 and 12 week old NOD mice and retired breeders (Animals fully developing diabetes) were tested by IHC. At 4 weeks of age, the staining pattern was the same as wild-type mice, and the majority of cells were positive for PanCAM in the pancreatic islets of Langerhans. At 8 weeks of age, when the mouse pancreas began to develop, T cell invasion of the islets of Langerhans was seen and the number of PanCAM-positive cells began to decrease. At 12 weeks of age, there were more T cells and fewer PanCAM-positive cells in the pancreatic islets of Langerhans. In retired breeders, most of the PanCAM-positive cells were lost and T cells were observed where they were formerly Islets of Langerhans. This result indicated that the overall expression of PanCAM is related to the development of diabetes in NOD mice.

(Example 19: Isolation of β cells using anti-PanCAM antibody)
Monoclonal or polyclonal antibodies specific for the extracellular portion of PanCAM (eg, human PanCAM) were immobilized on a solid or semi-solid substrate and then contacted with dispersed pancreatic cells. Non-β cells were removed by washing the substrate with the appropriate buffer. The bound β cells are then recovered. Alternatively, β cells can be isolated by flow cytometry using an anti-PanCAM antibody. The purified β cells are then encapsulated in a macroporous gelatin microcarrier (eg, CultiSphere-S) and transplanted into a patient suffering from or at risk of having diabetes (eg, Guerra et al. Biotechnol.Bioeng.75 (6): 741-4 (2001)).

  Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Exemplary methods and exemplary materials are described below, but methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All publications and other references mentioned herein are hereby incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. The materials, methods, and examples are illustrative only and not intended to be limiting. Throughout the specification and claims, the word “comprising”, or variations thereof (eg, “comprises” or “comprising”), means inclusion of a specified complete group or group of complete groups. However, it is understood that the exclusion of any other whole or whole group is not meant. All ACTT deposits described herein were made in accordance with the provisions of the Budapest Convention. All restrictions on the validity of the ACTT deposit publication will be irrevocably removed upon approval of the patent under this application.

出願人：バイオジェン，インコーポレイテッドら。
提出：本明細書と同時
表題：ＰａｎＣＡＭ核酸およびポリペプチド
代理人参照番号：Ａ０９７ ＰＣＴ２
本明細書において言及される寄託された生物学的材料に関する専門的解決についての表示
寄託された生物学的材料に関する表示は、全て、本明細書中に含まれる。以下のさらなる表示は、明細書の一部であることを必要とせず、「別の表示」として扱われるべきである。これらは、専門的な解決のためだけに関連する。

Applicant: Biogen, Inc. et al.
Submission: Concurrent with this specification Title: PanCAM nucleic acid and polypeptide agent Reference number: A097 PCT2
Indications for professional solutions relating to the deposited biological material referred to herein All indications relating to the deposited biological material are included herein. The following further displays do not need to be part of the specification and should be treated as “another display”. These are relevant only for professional solutions.

Further indications made below relate to the deposited biological material referred to as FL86-3 on page 6, lines 1-10 of the specification.

Deposit is the deposit number Was done on 11 June 2002 at :
American Type Culture Collection (ATCC)
United States Virginia 20110-2209, Manassas University Boulevard 10801
Further indications are:
About CA (Canada) designation:
With respect to the Canadian designation, samples of biological material deposited will be subject to the grant of a Canadian patent, or the application may be rejected, as provided in Rules 107 and 108 of the Patent Rules under Canadian Patent Law. Or until the date of being abandoned and unable to recover or withdrawn, it is made available only by the provision of a sample to an independent expert appointed by the Director (Rule 104 (4)).

Regarding EP (European Patent) designation:
With respect to the designation of EPO, a sample of the deposited biological material will be published under the EPC until publication of a reference to grant of a European patent, as provided in Rule 28 (3) of the Implementation Regulations, or Rejected or withdrawn or, if deemed to be withdrawn, made available only by the provision of a sample to the expert nominated by the requester up to 20 years from the date of filing (Rule 28 (4) EPC) .

About FI (Finland) designation:
With regard to the designation of Finland, until the publication of a reference to grant by the Patent and Control Board (National Board of Patents and Regulations) or when it is ultimately determined that the application will not result in the grant of a patent by the Patent and Control Board From the date of filing to 20 years, the supply of samples to the deposited biological material will be made available only to experts in the field.

About GB (UK) designation:
For UK designations, the applicant here acknowledges that the supply of samples of deposited biological material will be made available only to experts in the field.

About IS (Iceland) designation:
For designation of Iceland, the patent shall be deposited until the final decision by the Icelandic Patent Office if the patent is granted by the Icelandic Patent Office or if it is ultimately decided that the application does not result in the grant of the patent. The supply of samples of biological material can only be provided by experts in the field.

About SE (Sweden) designation:
For the Swedish designation, until the application is published (by the Swedish Patent Office) or is finalized by the Swedish Patent Office without publication, a sample of the deposited biological material will not be provided. Only for specialists in the field.

Regarding SG (Singapore) designation:
Applicant acknowledges that the culture samples identified above are only available to professionals in accordance with paragraph 3 of the fourth schedule to 37 CFR 1995.

出願人：バイオジェン，インコーポレイテッドら。
提出：本明細書と同時
表題：ＰａｎＣＡＭ核酸およびポリペプチド
代理人参照番号：Ａ０９７ ＰＣＴ２
本明細書において言及される寄託された生物学的材料に関する専門的解決についての表示
寄託された生物学的材料に関する表示は、全て、本明細書中に含まれる。以下のさらなる表示は、明細書の一部であることを必要とせず、「別の表示」として扱われるべきである。これらは、専門的な解決のためだけに関連する。

Applicant: Biogen, Inc. et al.
Submission: Concurrent with this specification Title: PanCAM nucleic acid and polypeptide agent Reference number: A097 PCT2
Indications for professional solutions relating to the deposited biological material referred to herein All indications relating to the deposited biological material are included herein. The following further displays do not need to be part of the specification and should be treated as “another display”. These are relevant only for professional solutions.

Further indications made below relate to the deposited biological material referred to as CS0026 at page 10, line 25-27 and page 101, line 10-11 of the specification .

Deposit is the deposit number Was done on 11 June 2002 at :
American Type Culture Collection (ATCC)
United States Virginia 20110-2209, Manassas University Boulevard 10801
Further indications are:
About CA (Canada) designation:
With respect to the Canadian designation, samples of biological material deposited will be subject to the grant of a Canadian patent, or the application may be rejected, as provided in Rules 107 and 108 of the Patent Rules under Canadian Patent Law. Or until the date of being abandoned and unable to recover or withdrawn, it is made available only by the provision of a sample to an independent expert appointed by the Director (Rule 104 (4)).

Regarding EP (European Patent) designation:
With respect to the designation of EPO, a sample of the deposited biological material will be published under the EPC until publication of a reference to grant of a European patent, as provided in Rule 28 (3) of the Implementation Regulations, or Rejected or withdrawn or, if deemed to be withdrawn, made available only by the provision of a sample to the expert nominated by the requester up to 20 years from the date of filing (Rule 28 (4) EPC) .

About FI (Finland) designation:
With regard to the designation of Finland, until the publication of a reference to grant by the Patent and Control Board (National Board of Patents and Regulations) or when it is ultimately determined that the application will not result in the grant of a patent by the Patent and Control Board From the date of filing to 20 years, the supply of samples to the deposited biological material will be made available only to experts in the field.

About GB (UK) designation:
For UK designations, the applicant here acknowledges that the supply of samples of deposited biological material will be made available only to experts in the field.

About IS (Iceland) designation:
For designation of Iceland, the patent shall be deposited until the final decision by the Icelandic Patent Office if the patent is granted by the Icelandic Patent Office or if it is ultimately decided that the application does not result in the grant of the patent. The supply of samples of biological material can only be provided by experts in the field.

About SE (Sweden) designation:
For the Swedish designation, until the application is published (by the Swedish Patent Office) or is finalized by the Swedish Patent Office without publication, a sample of the deposited biological material will not be provided. Only for specialists in the field.

Regarding SG (Singapore) designation:
Applicant acknowledges that the culture samples identified above are only available to professionals in accordance with paragraph 3 of the fourth schedule to 37 CFR 1995.

出願人：バイオジェン，インコーポレイテッドら。
提出：本明細書と同時
表題：ＰａｎＣＡＭ核酸およびポリペプチド
代理人参照番号：Ａ０９７ ＰＣＴ２
本明細書において言及される寄託された生物学的材料に関する専門的解決についての表示
寄託された生物学的材料に関する表示は、全て、本明細書中に含まれる。以下のさらなる表示は、明細書の一部であることを必要とせず、「別の表示」として扱われるべきである。これらは、専門的な解決のためだけに関連する。

Applicant: Biogen, Inc. et al.
Submission: Concurrent with this specification Title: PanCAM nucleic acid and polypeptide agent Reference number: A097 PCT2
Indications for professional solutions relating to the deposited biological material referred to herein All indications relating to the deposited biological material are included herein. The following further displays do not need to be part of the specification and should be treated as “another display”. These are relevant only for professional solutions.

Further indications made below relate to the deposited biological material referred to as CS0067-1 on page 11, lines 1-7; and page 11, lines 10-11 of the specification .

The deposit was made on 11 June 2002 under deposit number PTA-4451 :
American Type Culture Collection (ATCC)
United States Virginia 20110-2209, Manassas University Boulevard 10801
Further indications are:
About CA (Canada) designation:
With respect to the Canadian designation, samples of biological material deposited will be subject to the grant of a Canadian patent, or the application may be rejected, as provided in Rules 107 and 108 of the Patent Rules under Canadian Patent Law. Or until the date of being abandoned and unable to recover or withdrawn, it is made available only by the provision of a sample to an independent expert appointed by the Director (Rule 104 (4)).

Regarding EP (European Patent) designation:
With respect to the designation of EPO, a sample of the deposited biological material will be published under the EPC until publication of a reference to grant of a European patent, as provided in Rule 28 (3) of the Implementation Regulations, or Rejected or withdrawn or, if deemed to be withdrawn, made available only by the provision of a sample to the expert nominated by the requester up to 20 years from the date of filing (Rule 28 (4) EPC) .

About FI (Finland) designation:
With regard to the designation of Finland, until the publication of a reference to grant by the Patent and Control Board (National Board of Patents and Regulations) or when it is ultimately determined that the application will not result in the grant of a patent by the Patent and Control Board From the date of filing to 20 years, the supply of samples to the deposited biological material will be made available only to experts in the field.

About GB (UK) designation:
For UK designations, the applicant here acknowledges that a sample supply of deposited biological material will be made available only to experts in the field.

About IS (Iceland) designation:
For designation of Iceland, the patent shall be deposited until the final decision by the Icelandic Patent Office if the patent is granted by the Icelandic Patent Office or if it is ultimately decided that the application does not result in the grant of the patent. The supply of samples of biological material can only be provided by experts in the field.

About SE (Sweden) designation:
For the Swedish designation, until the application is published (by the Swedish Patent Office) or is finalized by the Swedish Patent Office without publication, a sample of the deposited biological material will not be provided. Only for specialists in the field.

Regarding SG (Singapore) designation:
Applicant acknowledges that the culture samples identified above are only available to professionals in accordance with paragraph 3 of the fourth schedule to 37 CFR 1995.

出願人：バイオジェン，インコーポレイテッドら。
提出：本明細書と同時
表題：ＰａｎＣＡＭ核酸およびポリペプチド
代理人参照番号：Ａ０９７ ＰＣＴ２
本明細書において言及される寄託された生物学的材料に関する専門的解決についての表示
寄託された生物学的材料に関する表示は、全て、本明細書中に含まれる。以下のさらなる表示は、明細書の一部であることを必要とせず、「別の表示」として扱われるべきである。これらは、専門的な解決のためだけに関連する。

Applicant: Biogen, Inc. et al.
Submission: Concurrent with this specification Title: PanCAM nucleic acid and polypeptide agent Reference number: A097 PCT2
Indications for professional solutions relating to the deposited biological material referred to herein All indications relating to the deposited biological material are included herein. The following further displays do not need to be part of the specification and should be treated as “another display”. These are relevant only for professional solutions.

Further indications made below relate to the deposited biological material referred to as CS0067-3 on page 11, line 1-7 of the specification.

The deposit was made on 11 June 2002 under the deposit number PTA-4442 :
American Type Culture Collection (ATCC)
United States Virginia 20110-2209, Manassas University Boulevard 10801
Further indications are:
About CA (Canada) designation:
With respect to the Canadian designation, samples of biological material deposited will be subject to the grant of a Canadian patent, or the application may be rejected, as provided in Rules 107 and 108 of the Patent Rules under Canadian Patent Law. Or until the date of being abandoned and unable to recover or withdrawn, it is made available only by the provision of a sample to an independent expert appointed by the Director (Rule 104 (4)).

Regarding EP (European Patent) designation:
With respect to the designation of EPO, a sample of the deposited biological material will be published under the EPC until publication of a reference to grant of a European patent, as provided in Rule 28 (3) of the Implementation Regulations, or Rejected or withdrawn or, if deemed to be withdrawn, made available only by the provision of a sample to the expert nominated by the requester up to 20 years from the date of filing (Rule 28 (4) EPC) .

About FI (Finland) designation:
With regard to the designation of Finland, until the publication of a reference to grant by the Patent and Control Board (National Board of Patents and Regulations) or when it is ultimately determined that the application will not result in the grant of a patent by the Patent and Control Board From the date of filing to 20 years, the supply of samples to the deposited biological material will be made available only to experts in the field.

About GB (UK) designation:
For UK designations, the applicant here acknowledges that a sample supply of deposited biological material will be made available only to experts in the field.

About IS (Iceland) designation:
For designation of Iceland, the patent shall be deposited until the final decision by the Icelandic Patent Office if the patent is granted by the Icelandic Patent Office or if it is ultimately decided that the application does not result in the grant of the patent. The supply of samples of biological material can only be provided by experts in the field.

About SE (Sweden) designation:
For the Swedish designation, until the application is published (by the Swedish Patent Office) or is finalized by the Swedish Patent Office without publication, a sample of the deposited biological material will not be provided. Only for specialists in the field.

Regarding SG (Singapore) designation:
Applicant acknowledges that the culture samples identified above are only available to professionals in accordance with paragraph 3 of the fourth schedule to 37 CFR 1995.

FIG. 1 is the coding amino acid sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO: 2) of human GP354 (PanCAM) polypeptide. Extracellular immunoglobulin (Ig) domains and transmembrane domains are underlined. Continuation of FIG. 1-1. Continuation of FIG. 1-2. FIG. 2 shows the human GP354 amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), the Drosophila Irregular Chiasma (ICCR) protein sequence (SEQ ID NO: 13) and the human nephrin protein sequence (SEQ ID NO: 14). Alignment. A dash is an optional gap in the sequence. Asterisks indicate amino acids that are identical in the three sequences. Continuation of FIG. 2-1. Continuation of FIG. 2-2. FIG. 3 is the sequence of the RT-PCR fragment obtained using primers GX1-218 (SEQ ID NO: 16) and GX1-219 (SEQ ID NO: 17). This fragment (SEQ ID NO: 3) is an insert of plasmid CS0026, which was deposited with the ATCC on June 11, 2002. FIG. 4 is the human genome gp354 sequence (SEQ ID NO: 5). Exons are underlined. Continuation of FIG. 4-1. Continuation of FIG. 4-2. Continuation of FIG. 4-3. Continuation of FIG. 4-4. Continuation of FIG. 4-5. Continuation of FIG. Continuation of FIG. Continuation of FIG. 4-8. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. FIG. 5 is the cDNA sequence of human PanCAM (SEQ ID NO: 7) and the derived amino acid sequence (SEQ ID NO: 8). SEQ ID NO: 7 is the coding sequence for SEQ ID NO: 12 as well as PanCAM-1 (insert of plasmid CS0067-1 deposited at ATCC on June 11, 2002 (SEQ ID NO: 25)) and PanCAM-2 (2002 June 6). It is made based on the coding sequence for the insert of plasmid CS0067-3 (SEQ ID NO: 27)) deposited with the ATCC on the 11th of January. SEQ ID NO: 7 contains a 5 'untranslated region and a 3' untranslated region. Continuation of FIG. 5-1. Continuation of FIG. Continuation of FIG. Continuation of FIG. 5-4. FIG. 6 is the nucleotide sequence (SEQ ID NO: 11) and deduced amino acid sequence (SEQ ID NO: 12) of pancreatic gp354 cDNA. Continuation of FIG. 6-1. Continuation of FIG. FIG. 7 is the nucleotide sequence (SEQ ID NO: 25; insert of plasmid CS0067-1) of a representative GP354 cDNA clone. This deduced amino acid sequence (SEQ ID NO: 26; referred to as PanCAM-1) is shown below the corresponding nucleotide sequence. The signal peptide is double underlined, the transmembrane domain is boxed, and the five Ig domains are underlined. The sequences corresponding to the oligonucleotides used for the amplification of the gene of origin prediction from the beginning are highlighted with a bold line, these sandwiching SEQ ID NO: 11. Continuation of FIG. FIG. 8 is the nucleotide sequence (SEQ ID NO: 27) and deduced amino acid sequence (SEQ ID NO: 28) of PanCAM-2. Continuation of FIG. FIG. 9A shows the proteins encoded by alternative splice transcripts of PanCAM: PanCAM-1 (SEQ ID NO: 26), PanCAM-2 (SEQ ID NO: 28), PanCAM (SEQ ID NO: 8), and bc007312 (SEQ ID NO: 29). Alignment. Conserved Ig domains are underlined. Continuation of FIG. 9A-1. FIG. 9B is a diagram of the PanCAM locus and alternatively spliced mRNA. Exons are numbered 1-15, enclosed in squares, and exons with potential splicing sites are marked with an asterisk. The shaded region in the PanCAM locus represents a potential intron, which is part of the exon spliced in the PanCAM-1 and PanCAM-2 transcripts. FIG. 10A is the nucleotide sequence (SEQ ID NO: 32) and deduced amino acid sequence (SEQ ID NO: 31) of a partial mouse PanCAM cDNA clone. FIG. 10B is an alignment of the partial protein sequence of human PanCAM (SEQ ID NO: 30) and the partial protein sequence of mouse PanCAM (SEQ ID NO: 31). The immunoglobulin domain is underlined. The mouse sequence is on the bottom.

Claims (20)

a) a polynucleotide encoding SEQ ID NO: 26;
b) a polynucleotide encoding SEQ ID NO: 28; and
c) a polynucleotide having the entire cDNA sequence contained in ATCC Deposit Number PTA-4451 or PTA-4442;
A polynucleotide comprising a nucleotide sequence selected from the group consisting of: 2. The polynucleotide of claim 1, further comprising a transcriptional regulatory sequence operably linked to the nucleotide sequence. A vector comprising the polynucleotide according to claim 1 or 2. The vector according to claim 3, which is a plasmid or a viral vector. 5. The viral vector of claim 4, wherein the viral vector is selected from the group consisting of baculovirus, adenovirus, parvovirus, herpes virus, pox virus, adeno-associated virus, Semliki forest virus, vaccinia virus, lentivirus and retrovirus. vector. A host cell comprising the polynucleotide according to claim 1 or 2 or comprising the vector according to any one of claims 3-5. 7. A host cell according to claim 6, selected from the group consisting of bacterial cells, insect cells, yeast cells, plant cells and mammalian cells. The host cell according to claim 7, which is a human cell. A method for producing a polypeptide encoded by the polynucleotide of claim 1 or 2, comprising:
  Culturing the host cell of any one of claims 6-8 in a medium under conditions in which the nucleotide sequence is expressed, and
  Recovering the polypeptide from the cells or from the culture medium;
Including the method. A polypeptide encoded by the polynucleotide of claim 1 or 2. A method for identifying a compound that binds to the polypeptide of claim 10, comprising:
  Contacting the polypeptide with a test compound; and
  Detecting a complex formed by the polypeptide and the test compound;
Including
  The presence of the complex indicates that the test compound binds to the polypeptide;
Method. An in vitro method for isolating beta cells from a dispersed pancreatic cell population comprising:
  Providing a specific antibody against the PanCAM protein consisting of SEQ ID NO: 2, 8, 12, 26, or 28;
  Contacting the dispersed pancreatic cell population with the antibody under conditions that allow β-cells in the population to bind to the antibody; and
  Separating cells not bound to the antibody from beta cells bound to the antibody, thereby isolating the beta cells;
Including the method. 13. The method of claim 12, wherein the dispersed pancreatic cell population is a bovine pancreatic cell population or a porcine pancreatic cell population. The polynucleotide according to any one of claims 1 to 8, comprising:
  The polynucleotide further comprises a second nucleotide sequence encoding a heterologous amino acid sequence such that the heterologous amino acid sequence and the polypeptide encoded by the polynucleotide form a fusion protein.
Polynucleotide. A composition for targeting a diagnostic or therapeutic agent to the pancreatic β islet,
  An antibody that specifically recognizes a polypeptide consisting of SEQ ID NO: 2, 8, 12, 26, or 28
A composition comprising: 16. A composition according to claim 15 for the diagnosis or treatment of diabetes or islet cell tumors. 14. The method according to claim 12 or 13, wherein the antibody is a humanized antibody, a chimeric antibody, or a fully human antibody. The method of claim 9, comprising:
  The polynucleotide further comprises a second nucleotide sequence encoding a heterologous amino acid sequence such that the heterologous amino acid sequence and the polypeptide encoded by the polynucleotide form a fusion protein.
Method. An antibody that specifically recognizes a polypeptide consisting of SEQ ID NO: 2, 8, 12, 26, or 28. The antibody according to claim 15 or 16, which is a humanized antibody, a chimeric antibody, or a fully human antibody.

Images