JP3930555B2 - 3-keto-acyl CoA reductase and gene encoding the same - Google Patents

Description

  The present invention relates to a bacterium having polyester-producing ability, a polyester polymerizing enzyme gene, a gene expression system containing the gene, a mutant transformed or transduced by the gene expression system, a method for producing a polyester polymerizing enzyme, and a method for producing a polyester About.

  Many microorganisms are known to accumulate poly-3-hydroxyalkanoate (PHA) as an energy storage substance in the body. PHA is attracting attention as a biodegradable plastic (green plastic) because it has thermoplasticity and excellent biodegradability and biocompatibility. The monomer composition of PHA greatly affects its physical properties, and the monomer composition ratio varies depending on the substrate specificity of the polyester polymerizing enzyme and the monomer synthesis pathway of the host. So far, PHA synthase genes have been cloned from about 30 types of microorganisms and classified into three groups based on their primary structure and substrate characteristics (I-III). Types I and III have substrate specificity for short chain length hydroxyacyl CoA having about 3 to 6 carbon atoms, and type II has medium chain length hydroxyacyl CoA having about 6 to 12 carbon atoms. The physical properties of PHA vary greatly depending on the monomer composition, and in order to produce PHA having various physical properties, a polyester polymerizing enzyme having a wide range of substrate properties is required.

  Further, conventional PHA synthesis is a method carried out in a microorganism (in vivo), and synthesis using an enzyme (in vitro synthesis) is hardly carried out industrially. One reason for this is the instability of PHA synthase, and the production of a stable PHA synthase is essential for in vitro synthesis. However, polyester polymerizing enzymes reported so far have relatively low substrate specificity, and polyester polymerizing enzymes having a wide range of substrate properties (Japanese Patent Application Laid-Open Nos. 10-108682 and 10-276781) are also in the middle temperature range (40-50 ° C.). ) Which is stable and has high activity has not been reported.

Japanese Patent Laid-Open No. 10-108682 Japanese Patent Laid-Open No. 10-276781

  Accordingly, an object of the present invention is to provide a bacterium having a polyester-producing ability stably at around an intermediate temperature, a polyester polymerizing enzyme gene isolated from the bacterium, a gene expression system containing the gene, and transformation or transduction by the gene expression system. It is an object of the present invention to provide a method for producing a polyester polymerizing enzyme and a method for producing a polyester, which are stable at around an intermediate temperature and have a wide range of substrate specificities.

  In order to solve such a problem, the present invention synthesizes a polyester stably at an intermediate temperature (40 to 50 ° C.), and from a bacterium having a polyester polymerizing enzyme having a wide substrate specificity, its gene and The open reading frame that accompanies it is cloned, and the gene amplification, transcription, and translational activities are enhanced to intensively study to increase the target enzyme production amount, and the present invention has been completed.

さらに、本発明は、ＤＮＡ断片が、Bacillus sp. INT005 菌株より単離したものである、前記ＤＮＡ断片に関する。
また、本発明は、配列番号１、配列番号３および配列番号５に示される塩基配列を含む、前記ＤＮＡ断片に関する。 That is, the present invention relates to a bacterium having a polyester-producing ability at 40 ° C. or higher.
Moreover, this invention relates to the said bacterium which is a Bacillus genus.
Furthermore, the present invention relates to the bacterium, wherein the bacterium is a Bacillus sp. INT005 strain.
The present invention also relates to a DNA fragment containing a polyester polymerase gene having the following restriction enzyme cleavage map and having a base pair of 3.8 kbp.

Furthermore, the present invention relates to the DNA fragment, wherein the DNA fragment is isolated from Bacillus sp. INT005 strain.
The present invention also relates to the DNA fragment comprising the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 5.

Furthermore, the present invention relates to a polyester synthase I gene encoding the following polypeptide (a) or (b):
(A) Polypeptide having the amino acid sequence shown in SEQ ID NO: 2 (b) Polyester having an activity of polyester polymerase comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a) peptide.
The present invention also relates to a polyester polymerase I gene comprising the following base sequence (a) or (b):
(A) a base sequence represented by SEQ ID NO: 1 (b) a base sequence encoding the same amino acid sequence, although the codon sequence is different from the base sequence of (a) due to the degeneracy of the genetic code.
Furthermore, the present invention relates to a polyester synthase II gene encoding the following polypeptide (a) or (b):
(A) Polypeptide having the amino acid sequence shown in SEQ ID NO: 4 (b) Polyester having a polyester polymerizing enzyme activity comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a) peptide.
The present invention also relates to a polyester polymerizing enzyme II gene comprising the following base sequence (a) or (b):
(A) The base sequence shown in SEQ ID NO: 3 (b) A base sequence encoding the same amino acid sequence, although the codon sequence is different from the base sequence of (a) due to the degeneracy of the genetic code.
Furthermore, the present invention relates to a 3-keto-acyl CoA reductase gene encoding the following polypeptide (a) or (b):
(A) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 6 (b) a 3-keto-acyl CoA reductase comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a) Polypeptide that brings about activity.
The present invention also relates to a 3-keto-acyl CoA reductase gene comprising the following base sequence (a) or (b):
(A) The base sequence shown in SEQ ID NO: 5 (b) A base sequence encoding the same amino acid sequence, although the codon sequence is different from the base sequence of (a) due to the degeneracy of the genetic code.

Furthermore, the present invention relates to a gene expression cassette comprising one or more genes selected from the group consisting of the polyester synthase I gene, the polyester synthase II gene, and the 3-keto-acyl CoA reductase gene.
The present invention also relates to a gene expression system that simultaneously expresses the polyester polymerase I gene and the polyester polymerase II gene.
Furthermore, the present invention relates to the gene expression system further comprising the 3-keto-acyl CoA reductase gene.
The present invention also relates to a mutant transformed or transduced by the gene expression system.

Furthermore, the present invention relates to the following polypeptide (a) or (b):
(A) Polypeptide having the amino acid sequence shown in SEQ ID NO: 2 (b) Polyester having an activity of polyester polymerase comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a) peptide.
The present invention also relates to the following polypeptide (a) or (b):
(A) Polypeptide having the amino acid sequence shown in SEQ ID NO: 4 (b) Polyester having a polyester polymerizing enzyme activity comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a) peptide.
Furthermore, the present invention relates to the following polypeptide (a) or (b):
(A) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 6 (b) a 3-keto-acyl CoA reductase comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a) Polypeptide that brings about activity.

The present invention also relates to a method for producing a polyester polymerizing enzyme, comprising culturing the bacterium and collecting the polyester polymerizing enzyme from the obtained culture.
Furthermore, the present invention relates to a method for producing a polyester polymerizing enzyme, wherein the mutant is cultured and the polyester polymerizing enzyme is collected from the obtained culture.
The present invention also relates to a method for producing polyester, wherein the bacterium is cultured and the polyester is collected from the obtained culture.
Furthermore, this invention relates to the manufacturing method of polyester characterized by culture | cultivating the said variant and extract | collecting polyester from the obtained culture.
The present invention also relates to a method for producing a polyester, wherein the polyester is polymerized using the polyester polymerizing enzyme obtained by the above method.

According to the present invention, a polyester polymerizing enzyme and a polyester having high thermal stability can be produced stably even at around medium temperature by culturing bacteria having a polyester-producing ability stably even at 40 ° C. or higher.
By obtaining a gene fragment involved in polyester biosynthesis isolated from the bacterium described above, it is possible to produce a polyester polymerase and polyester having high thermal stability by culturing using a mutant containing the gene. it can.
According to the present invention, since a polyester polymerizing enzyme having high thermal stability can be obtained, long-term use that has not been possible in the past in terms of instability in synthesis of polyester in vitro becomes possible. Furthermore, when a bioreactor or the like is constructed, the reaction can be carried out at a high temperature, so that contamination with germs can be prevented and the range of applications for polyester synthesis is expanded.
Furthermore, since 3-keto-acyl CoA reductase, an enzyme involved in polyester biosynthesis, has been obtained, polyester synthesis from fatty acids can be performed efficiently, and the range of substrates is expanded.

  According to the present invention, a polyester polymerizing enzyme-related gene having a wide range of substrate properties and stability, a gene expression cassette containing the gene, a mutant containing the gene expression cassette, a method for producing a polyester polymerizing enzyme, and a method for producing a polyester are provided. Can do. In addition, the polyester and the mutant of the present invention can efficiently produce a polyester polymerization enzyme having stable and wide substrate characteristics, and the polyester can be efficiently synthesized using the enzyme.

Hereinafter, the present invention will be described in detail.
(R) -3-Hydroxybutyryl-CoA ((R) -3HB-CoA) polymerized in the present invention is represented by the following formula (I).

（式中のＲはエチル基、プロピル基、ペンチル基又はヘプチル基をしめす） The compound polymerized in the present invention includes not only (R) -3HB-CoA but also (R) -3-hydroxyacyl-CoA ((R) -3HA-CoA). An example of (R) -3HA-CoA is shown in Formula (II).

(Wherein R represents an ethyl group, a propyl group, a pentyl group or a heptyl group)

  The bacterium producing polyester at 40 ° C. or higher according to the present invention may be any bacterium as long as it can grow stably at 40 ° C. or higher and can accumulate polyester in the microbial cells. Genus, Cyanobacterium genus, Bacillus genus and the like. Among these, from the viewpoint of stable growth and polyester production, those capable of stable growth at 45 ° C. or higher are preferred, and Bacillus sp. INT005 strain (hereinafter referred to as “this strain” or “this strain”, which is a new strain isolated by the present inventors). “INT005” may be abbreviated). This strain was deposited at the National Institute of Advanced Industrial Science and Technology as an accession number FERM P-18327 on May 9, 2001.

1. Isolation and identification of Bacillus sp. INT005 strain
The INT005 strain was isolated from natural gas field mining soil in Hokkaido by the present inventors.
Its bacteriological properties are as follows.
(1) Morphological properties-37 ° C on normal agar medium
Colony features
1) Outline: Circular
2) Surface bumps: low convex
3) Surface shape: circular
4) Perimeter: curly
5) Gloss: None
6) Color: Cream color-37 ° C on normal agar medium
Morphological properties
1) Cell morphology: Spider
2) Mobility: Yes
3) Spore shape: circular
4) Gram staining: Positive

(2) Physiological properties
1) Growth under anaerobic conditions: positive
2) Catalase: Positive
3) Oxidase: Positive
4) OF test:-
5) Casein hydrolysis: positive
6) Starch hydrolysis: negative
7) Nitrate reduction: negative
8) VP test: negative
9) Indolol production: Negative
10) Hydrogen sulfide production: Negative
11) Use of citric acid: Negative
12) Urease: Negative
13) Growth with 10% NaCl: negative
14) Growth temperature upper limit: 45 ℃
15) Hydrolysis of arginine: negative
16) Tyrosine degradation: Negative
17) Acid generation from carbon sources

1 Glycerol-
2 Erythritol −
3 D-arabinose-
4 L-arabinose-
5 Ribose +
6 D-xylose −
7 L-xylose −
8 Adonitol-
9 β-methyl-D-xylose −
10 Galactose-
11 Glucose +
12 Fructose +
13 Mannose-
14 Maltose +
15 Trehalose +
16 Mannitol-
17 Inositol-
18 Glycerol-
19 Sucrose +
20 Gluconate +

(3) Taxonomic considerations-identification at the genus level This strain (INT005) is 1) a Gram-positive rod, 2) has motility, 3) forms spores, 4) aerobically acid from glucose Features such as generating From these characteristics, it was found that this strain belongs to the genus Bacillus of the Endo-spore-forming Gram-Positive Rods and Cocci group described in the 9th volume of Bergey's Mannual of Dterminative Bacteriology.
-Species level identification
The Bacillus genus currently contains nearly 50 species of bacteria. Analysis of the partial nucleotide sequence of 16SRNA gene and database search revealed that it had the highest homology with Bacillus cereus. However, the results of acid production from salicin, VP test, nitrate reducing ability, and starch hydrolysis were all different from Bacillus cereus, and from these results, this strain was identified as Bacillus sp.
(4) Polyester production ability The PHA production ability at 37 ° C and 45 ° C is as follows.
37 ℃ (++>+>+->-)
Ralstnia eutropha ++
Bacillus megaterium ++
Bacillus sp.INT005 ++
45 ℃
Ralstnia eutropha-
Bacillus megaterium-
Bacillus sp.INT005 +
Bacillus sp. INT005 was capable of producing polyester even at 45 ° C.

  Furthermore, in the present invention, focusing on the ability of Bacillus sp. INT005 strain to produce polyester at 40 ° C. or higher, a polyester polymerization-related gene that is stable at 40 ° C. or higher and has a wide range of substrate specificities is excised. It is also possible to transform or transduce an appropriate host using an appropriate vector to produce a mutant, and to produce a polyester polymerizing enzyme and a polyester using the mutant.

2. Production of Fiber Pair (1) Gene Cloning Gene cloning can be performed by a known method. For example, chromosomal DNA is prepared by Current Protocols in Molecular Biology, the method of units 2 and 4 and the like.
The obtained chromosomal DNA is completely degraded with an appropriate restriction enzyme such as PstI or EcoRI. The obtained DNA fragment is ligated with a phosphatase-treated vector cut with a restriction enzyme (eg, PstI, EcoRI, etc.).

As the vector, a phage or a plasmid capable of autonomously growing in a host microorganism is used. Examples of the phage vector include EMBL3, M13, and λgt11. Examples of the plasmid vector include pBR322, pUC18, and pBluescript II (manufactured by STRATAGENE). Furthermore, various shuttle vectors can be used in addition to vectors capable of autonomous growth in two or more host microorganisms such as Escherichia coli and Bacillus. Such a vector can also be cleaved with the restriction enzyme to obtain a fragment thereof.
A known DNA ligase is used to link the DNA fragment and the vector fragment. Then, the DNA fragment and the vector fragment are annealed and then ligated to produce a recombinant vector.

  Introduction of the recombinant vector into the host microorganism can be performed by a known method. For example, when the host microorganism is Escherichia coli, the calcium chloride method (Current Protocols in Molecular Biology Units 1 and 4, Lederberg, EM et al., J. Bacteriol. 119, 1072 ( 1974)) and electroporation (Current Protocols in Molecular Biology, Vol. 1, 1.8.4, 1994) can be employed. When the host microorganism is phage DNA, the in vitro packaging method (Current Protocols in Molecular Biology, Vol. 1, page 5.7.1, 1994) can be employed. In the present invention, an in vitro packaging kit (Gigapack II; manufactured by STRATAGENE, etc.) may be used.

Next, a probe for obtaining a DNA fragment containing the polyester polymerizing enzyme I and II genes of the present invention and the 3-keto-acyl CoA reductase gene is prepared.
Several amino acid sequences of polyester polymerizing enzymes are already known (Gabriel J. McCool and Maura C. Cannon, J. Bacteriol., 181,585 (1999); Liebergesell, M. and Steinbuchel, Eur. J. Biochem., 209, 135 (1992); Kaneko, T., et al., DNA Res., 3, 109 (1996); Liebergesell, M. and Steinbuchel, Appl. Microbiol. Biotechnol., 38, 493 ( 1993) and others). Therefore, a well-conserved region is selected from these amino acid sequences, and an oligonucleotide is designed by estimating a base sequence encoding it. These oligonucleotides include, but are not limited to, Primer1: GCAGTGAAAAAAGTAATGCGAACTGCAAGA, Primer2: CCGCTGTTCCACCGTAAACAATCGCATATG.

  Next, this synthetic oligonucleotide is labeled with an appropriate reagent, and the PCR method using the above-mentioned Primer 1 and 2 from the chromosomal DNA library (the library is divided into several groups, and plasmids are separated from each group. PCR was performed using this plasmid as a template, and the group subjected to fragment amplification was further subdivided and finally E. coli containing the target gene was isolated.

By recovering the plasmid from the screened E. coli by the alkaline method (Currnt Protocols in Molecular Biology, Vol. 1, 1.6.1, 1994), a DNA fragment containing the polyester polymerase gene can be obtained.
The base sequence of the DNA fragment can be determined by a known method such as the Sanger method (Molecular Cloning, Vol. 2, 13.3, 1989), etc., and an automatic base sequence analyzer such as various synthetic DNAs as primers. , Using a Dynamic ET Terminal Cycle Sequencing Kit (Amersham Pharmacia) and a DNA sequencer (Perkin Elmer Applied Biosystems) (ABI).

  After the base sequence is determined by the above method, the gene of the present invention is obtained by chemical synthesis, by PCR using chromosomal DNA as a template, or by hybridizing with a DNA fragment having the base sequence as a probe. Can be obtained.

Analysis of the entire base sequence of the 3.8 kbp DNA fragment containing the polyester polymerase gene derived from the Bacillus sp. INT 005 strain revealed a plurality of open reading frames (ORF). The three ORFs confirmed this time are referred to as ORFs 1 to 3 in the forward direction from the promoter. ORF2 is composed of 744 bases and has a homology of about 72.5% at the amino acid sequence level with a gene encoding 3-keto-acyl CoA reductase derived from Bacillus megaterium (J. Bacteliol., 181, 585-592 (1999)). FASTA program) was confirmed. ORF3 is composed of 1086 bases and has about 71.5% homology (FASTA program) at the amino acid sequence level with the gene encoding polyester polymerase from Bacillus megaterium (J. Bacteliol., 181, 585-592 (1999)). It was confirmed to have. 3-Keto-acyl-CoA reductase is an enzyme involved in polyester biosynthesis, can efficiently synthesize polyester from fatty acids, and can obtain a wide range of substrate characteristics in polyester polymerization. In addition, ORF1 located upstream of ORF2 and ORF3 is considered to be a gene involved in polyester production. When it is expressed simultaneously with ORF3, polyester polymerase activity is obtained, and simultaneous expression of ORF1 and ORF3 is essential. It was confirmed that there was.
Therefore, ORF3 was designated as the polyester synthase I gene, ORF1 as the polyester synthase II gene, and ORF2 as the 3-keto-acyl CoA reductase gene.

The entire base sequence of the polyester polymerase I gene of the present invention is shown in SEQ ID NO: 1, the amino acid sequence of the polypeptide translated by this base sequence is shown in SEQ ID NO: 2, and the entire base sequence of the polyester polymerase II gene is shown in SEQ ID NO: 3. Next, the amino acid sequence of the polypeptide translated by this base sequence is SEQ ID NO: 4, the entire base sequence of the 3-keto-acyl CoA reductase gene is SEQ ID NO: 5, and then the polypeptide translated by this base sequence The amino acid sequence is set forth in SEQ ID NO: 6.
In addition, in the amino acid sequences shown in SEQ ID NOs: 2, 4 and 6, one or more amino acids are deleted, substituted or added, and a polyester polymerizing enzyme activity and a 3-keto-acyl CoA reductase activity are produced. All genes encoding peptides are included in the present invention.

In order to obtain a gene encoding a polyester polymerizing enzyme in which one or more amino acids are deleted, substituted or added in the amino acid sequences shown in SEQ ID NOs: 2, 4 and 6, and bring about a polyester polymerizing enzyme activity Can be any method, for example, site-directed mutagenesis, a well-known technique for generating point mutations or deletion mutations in a gene; then selectively cleaving the gene and then removing or adding selected nucleotides. A method of ligating genes; an oligonucleotide mutagenesis method.
Further, the polyester synthase I gene, the polyester synthase II gene and the 3-keto-acyl CoA reductase gene of the present invention are not limited to those containing the base sequences shown in SEQ ID NOs: 1, 3 and 5, and these bases The sequence may be a base sequence in which a codon for an amino acid is replaced with another equivalent codon due to degeneracy of the genetic code. For example, in the case of a serine residue, it is encoded by 6 codons of codons TCA, TCG, TCT, TCC, AGT, or AGC. Since these are equivalent for the purpose, these codons may be replaced with other codons. Similarly, other respective amino acid residues may be replaced with other equivalent codons, and any other amino acid residue encoding the same amino acid sequence is included in the base sequence of the present invention.

(2) Production of mutant The gene expression cassette of the present invention comprises a promoter, a gene having polyester polymerizing enzyme activity and 3-keto-acyl CoA reductase activity, such as the above-mentioned polyester polymerizing enzyme I gene, polyester polymerizing enzyme II gene and It contains one or more DNAs selected from a 3-keto-acyl CoA reductase gene and contains a terminator corresponding to the promoter, and these are linked from the 5 ′ end direction to the 3 ′ end direction. . The mutant of the present invention can be obtained by introducing this gene expression cassette into a host by the gene expression system of the present invention incorporating one or more recombinant vectors. Furthermore, expression can be regulated in the mutant.

In the gene expression system of the present invention, when it is desired to efficiently produce polyester polymerizing enzyme and polyester, it is preferable that the polyester polymerizing enzyme I gene and the polyester polymerizing enzyme II gene can be expressed simultaneously. The polyester synthase II gene need not necessarily be present upstream of the polyester synthase I gene, and may be a single recombinant vector that allows the gene to be present on the same DNA fragment, or Two or more recombinant vectors present on different DNA fragments can be used separately and introduced into the same host.
Furthermore, when it is desired to produce a polyester polymerizing enzyme having a wide range of substrate specificities, a gene having 3-keto-acyl CoA reductase activity can be included in the above gene expression system.

  The mutant of the present invention can be obtained by transforming and transducing a recombinant vector by the gene expression system of the present invention into a host. The host is not particularly limited as long as it can express the target gene. And yeast cells such as COS cells and CHO cells.

  When Escherichia coli or the like is used as a host, it is preferable that the recombinant DNA of the present invention is capable of autonomous replication in the host and at the same time includes a promoter, the DNA of the present invention, and a transcription termination sequence. Examples of expression vectors include pLA2917 (ATCC 37355) having an RK2 origin of replication and pJRD215 (ATCC 37533) having an RSF1010 replication origin that are replicated and maintained in a wide range of hosts.

  Any promoter that can be expressed in the host may be used. For example, promoters derived from Escherichia coli or phages such as tac promoter, trc promoter, lac promoter, PL promoter, PR promoter, T7 promoter and the like can be used. As a method for introducing recombinant DNA into bacteria, for example, a method using calcium ions (Current Protocols in Molecular Biology, Vol. 1, 1.8.1, 1994) and an electroporation method (Current Protocols in Molecular Biology, 1 Volume, page 1.8.4, 1994).

  When yeast is used as a host, examples of expression vectors include YEp13 and YCp50. Examples of the promoter include gal 1 promoter and gal 10 promoter. Examples of methods for introducing recombinant DNA into yeast include electroporation (Methods Enzymol., 194, 182-287 (1990)) and spheroplast method (Proc. Natl. Acad. Sci. USA, 84, 1929- 1933 (1978)), lithium acetate method (J. Bacteriol., 153, 163-168 (1983)) and the like.

  When animal cells are used as hosts, for example, pcDNAI, pcDNAI / Amp (Invitrogen) and the like are used as expression vectors. Examples of methods for introducing recombinant DNA into animal cells include the electroporation method and the calcium phosphate method.

3. Polyester Polymerase and Production of Polyester The polyester polymerase of the present invention cultivates the bacterium or mutant of the present invention, and produces and accumulates the polyester polymerase of the present invention in the culture (cultured cells or culture supernatant), It is carried out by collecting polyester polymerizing enzyme from the culture. The method for culturing the bacterium and the mutant of the present invention is performed according to a usual method.
Furthermore, the polyester is produced by culturing the bacterium or mutant of the present invention, producing and accumulating the polyester of the present invention in the culture or cultured cells, and collecting the polyester from the cultured cells or culture. Is called. The method for culturing the bacterium and the mutant of the present invention is performed according to a usual method.

As a medium for culturing bacteria and mutants, a complete medium or a synthetic medium, for example, LB medium, M9 medium or the like can be mentioned. Further, the polyester polymerizing enzyme and the polyester are accumulated in the cells and collected by aerobically culturing for 4 to 24 hours at a pH of 7 to 9 and a culture temperature of 30 to 37 ° C.
In addition, when Bacillus sp. INT005 strain is used, it can be cultured in the range of 30 to 45 ° C.
The carbon source of the present invention is necessary for the growth of microorganisms and serves as a raw material for polyester synthesis. Examples thereof include carbohydrates such as glucose, fructose, sucrose, and maltose.
In addition, by using a 3-keto-acyl CoA reductase gene, a fatty acid can also be used as a raw material for polyester synthesis. Examples of fatty acids include butyric acid, hydroxybutyric acid, valeric acid, hexanoic acid, octanoic acid, decanoic acid, and the like.

Examples of the nitrogen source include ammonia, ammonium salts such as ammonium chloride, ammonium sulfate, and ammonium phosphate, as well as peptone, meat extract, yeast extract, corn steep liquor, and the like.
Examples of the inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, magnesium chloride, ferric chloride, manganese sulfate and the like.

  The culture is usually performed at 25 to 37 ° C. for 2 hours or more after induction of expression under aerobic conditions such as shaking culture. During the culture, antibiotics such as kanamycin, ampicillin, and tetracycline may be added to the medium.

  When culturing a microorganism transformed with an expression vector using an inducible promoter, an inducer can be added to the medium. For example, isopropyl-β-D-thiogalactopyranoside (IPTG), indoleacrylic acid (IAA), etc. can be added to the medium.

As a medium for culturing a transformant obtained using animal cells as a host, for example, RPMI-1640, DMEM medium, or a medium obtained by adding fetal bovine serum to these mediums is used. The culture is usually performed at 30 to 37 ° C. for 1 to 7 days in the presence of 5% CO ₂ . During culture, antibiotics such as kanamycin and penicillin may be added to the medium.

Purification of the polyester polymerizing enzyme can be obtained from the culture using a collecting means after the culture is completed. For example, the cells are disrupted by an ultrasonic disruption process or the like by a conventional method, or the enzymes are extracted by lysing the cells using a lytic enzyme such as lysozyme. Then, the resulting crude enzyme is purified using various types of chromatography such as ion exchange chromatography and gel filtration.
Purification of the polyester obtained from the cells and mutants can be performed, for example, as follows. Bacteria and mutants are collected from the culture by centrifugation, washed with distilled water, and dried. Thereafter, the dried microbial cells and mutants are suspended in chloroform, and the polyester is extracted by heating. The residue is removed by filtration. Methanol is added to the chloroform solution to precipitate the polyester. The supernatant is removed by filtration or centrifugation, and then dried to obtain purified polyester.
Moreover, if (R) -3HB-CoA is added using the polyester polymerization enzyme obtained by the above-mentioned method, a polyester (poly-3-hydroxybutyrate (P3HB)) can be obtained by an enzymatic reaction.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the technical scope of the present invention is not limited to these examples.
[Example 1]
(1) Preparation of chromosomal DNA of Bacillus sp. INT 005 strain
Bacillus sp. INT 005 strain was cultured overnight at 37 ° C. in a liquid medium (using distilled water, pH 7.4) consisting of 2 ml of sterilized LB culture solution [LB Broth Base (GIBCO BRL)]. The total amount of the culture solution was put into 100 ml of LB culture solution, and cultured with shaking at 37 ° C. until the turbidity of the culture solution (absorbance at 600 nm) reached 0.7. After completion of the culture, the cells are separated from the culture by centrifugation at 7000 rpm for 10 minutes, and the cells are described in Current Protocols in Molecular Biology units 2.4. According to the method, chromosomal DNA was obtained.

Next, 0.05 mg of this chromosomal DNA was mixed with 50 units of restriction enzyme PstI (Takara Shuzo) and mixed with 50 mM Tris-HCl buffer (containing 100 mM NaCl, 10 mM MgSO ₄ , 1 mM dithiothreitol) (pH 7.5) at 37 ° C. The reaction was performed for 8 hours to complete digestion of the DNA. After completion of the reaction, the reaction solution was subjected to 0.7% agarose electrophoresis, and a DNA band around 8 kbp was excised. DNA contained in the gel was extracted and purified using QIAEX II Gel Extraction Kit (manufactured by Qiagen) to obtain 1 μg of chromosomal DNA fragment.

(2) Preparation of chromosomal DNA library of Bacillus sp. INT 005 strain using plasmid vector pUC19 and search for DNA fragment containing polyester polymerase gene 1 μg of plasmid vector pUC19 and 1 unit of restriction enzyme PstI (Takara Shuzo) The mixture was mixed with a hydrochloric acid buffer (containing 100 mM NaCl, 10 mM MgSO ₄ and 1 mM dithiothreitol) (pH 7.5), reacted at 37 ° C. for 3 hours for digestion, and further subjected to phosphatase treatment. After the reaction, phenol extraction treatment and ethanol precipitation treatment were performed by a conventional method to obtain a plasmid vector pUC19 digested with PstI.

  Next, 100 ng of the DNA fragment of plasmid vector pUC19 digested with PstI and 200 ng of the chromosomal DNA fragment completely digested with PstI obtained in the above item (1) were mixed, and a DNA ligation kit (Takara Shuzo) was used. DNA was ligated according to a conventional method. The recombinant plasmid DNA-containing solution thus obtained was introduced into Escherichia coli JM109 by the calcium chloride method according to the method described in Current Protocols in Molecular Biology Units 1 and 4. . The transformant was applied to LB medium and left to stand at 37 ° C. for 24 hours. The resulting 2000 colonies were divided into 20 groups of 100 clones. Plasmid DNA was extracted from each group by the method of Current Protocols in Molecular Biology Units 1 and 6. Polyester polymerase enzyme gene-specific oligo DNA was used, and the gene was partially amplified by Taq DNA polymerase (Sigma). The group in which fragment amplification occurred was further divided to obtain one transformant strain in which fragment amplification finally occurred.

(3) Analysis of the base sequence of the polyester polymerase gene and search for the polyester polymerase gene The transformant obtained in the above item (2) is cultured, and the plasmid is clarified by Current Protocols in Molecular Biology (Current Protocols As a result of preparation by the method described in Unit 1.6, a plasmid having an inserted DNA portion of about 8.0 kilobases was obtained. This plasmid was named pNA. Digestion of plasmid pNA with various restriction enzymes produced a restriction enzyme map of the obtained inserted DNA portion. Based on the results of the analysis, pNA was digested with the restriction enzyme DraI, and the resulting DNA fragment of about 3.8 kilobases was subcloned into the plasmid vector pUC19 digested with SmaI and treated with phosphatase (pNAD38, Independent Administrative Institution Deposited with the Technical Research Institute on May 9, 2001 as deposit number FERM P-18326). Using the plasmid obtained by subcloning as a template, the base sequence of each DNA fragment was determined. The base sequence is determined using various synthetic DNAs as primers, using the Dynamic ET Terminal Cycle Sequencing Kit (Amersham Pharmacia) and the DNA sequencer (Perkin Elmer Applied Biosystems) (ABI). , Conducted according to conventional methods.
The nucleotide sequence of the subcloned inserted DNA portion was determined by the dideoxy method using various synthetic DNAs as primers.

  Analysis of the entire base sequence of a 3.8 kb DNA fragment containing the polyester polymerase gene derived from Bacillus sp. INT 005 strain revealed three open reading frames. One of them, an open reading frame (ORF3) composed of 1086 bases, is a gene encoding a polyester polymerizing enzyme derived from Bacillus megaterium (J. Bacteliol., 181, 585-592 (1999)) and amino acid sequence level. And an open reading frame (ORF2) composed of 744 bases is a gene encoding 3-keto-acyl CoA reductase from Bacillus megaterium (J. Bacteliol., 181, 585-592 (1999)) and about 72.5% homology (FASTA program) at the amino acid sequence level.

  The base sequence of ORF3 derived from the obtained Bacillus sp. INT 005 strain is SEQ ID NO: 1, the primary amino acid sequence of the polypeptide translated from the base sequence is SEQ ID NO: 2, the base sequence of ORF 2 is SEQ ID NO: 5, The primary amino acid sequence of the polypeptide translated from the base sequence is shown in SEQ ID NO: 6, the base sequence of ORF1 is shown in SEQ ID NO: 3, and the primary amino acid sequence of the polypeptide translated from the base sequence is shown in SEQ ID NO: 4, respectively. . Based on the obtained base sequence, a restriction enzyme map of a 3.8 kbp DNA fragment derived from Bacillus sp. INT 005 strain cloned into pNAD38 was prepared. This restriction enzyme map is as follows.

On this restriction map, ORF3 is present in the direction from left to right between about 1.6 and 2.7 kbp.
Escherichia coli JM109 was transformed with the plasmid pNAD38, and transformants were obtained using ampicillin resistance as an indicator. pNAD38 has ORF1-3 in the forward direction with the lac promoter on the vector, and can induce the expression of ORF1-3 by adding isopropyl β-D thiogalactopyranoside (IPTG) to the culture medium it can. Escherichia coli JM109 (pNAD38) obtained by transformation was cultured with shaking (37 ° C.) in 5 ml of LB culture solution until the absorbance at 600 nm of the culture solution reached 0.6 (initial logarithmic growth phase). At this point, IPTG was added to the culture solution to a final concentration of 0.2 mM, and shaking culture was continued for another 3 hours. After incubation, the cells are collected by centrifugation, washed with 1 ml of 25 mM Tris-HCl buffer (pH 7.5), suspended in 25 mM Tris-HCl buffer (pH 7.5) containing 5% glycerol, and subjected to ultrasound. The cells were crushed by crushing. The cell disruption solution was centrifuged, and the supernatant was used as a crude extract containing a polyester polymerizing enzyme. This crude extract was added to a 1/10 volume of 25 mM Tris-HCl buffer (pH 7.5) containing 1 mM (R) -3HB-CoA to obtain a polyester polymerization enzyme activity measurement reaction solution. This reaction solution was kept at 30 ° C., sampled at regular intervals, and the reaction was stopped by adding twice the amount of 5% TCA to the sample, followed by centrifugation to precipitate the denatured protein. To the supernatant after centrifugation, 500 mM phosphate buffer and DTNB (color developing solution) were added and incubated at 30 ° C. for 10 minutes. The amount of reaction was quantified from the change in absorbance using the fact that CoA and DTNB liberated with the polymerization reaction of polyester react to exhibit absorption at 412 nm. The results of the polyester polymerization activity test are shown in FIG. The absorbance hardly changed in the reaction solution to which the E. coli extract containing only vector DNA (pUC19) was added, whereas the absorbance increased with time in the reaction solution to which the E. coli extract containing pNAD38 was added.

  Next, in order to confirm the activity of the polypeptide encoded by ORF, ORF1 and ORF1-2 were incorporated into vector DNA [pSTV28 (Takara Shuzo)] and ORF3 was incorporated into vector DNA [pQE30 (Qiagen)]. This plasmid was introduced into Escherichia coli JM109, and the following 6 strains were prepared (JM109 (pSTV28, pQE30), JM109 (pSTV-ORF1, pQE30), JM109 (pSTV-ORF1, 2, pQE30), JM109 (pSTV28, pQE) -ORF3), JM109 (pSTV-ORF1, pQE-ORF3), JM109 (pSTV-ORF1, 2, pQE-ORF3)). Similarly, a crude enzyme solution was prepared, and the polyester polymerization enzyme activity was measured (FIG. 2). From these results, it was confirmed that the expression of ORF1 and 3 is essential for polyester polymerase activity.

  A crude enzyme solution was similarly prepared using JM109 (pSTV28), JM109 (pSTV-ORF1), and JM109 (pSTV-ORF1 · 2). The crude extract was added to a 125 mM Tris-HCl buffer (pH 8.0) containing 0.125 mM, NADPH, and 0.025 mM acetoacetyl in an amount of 1/80 to obtain a 3-keto-acyl CoA reductase activity measurement reaction solution. This reaction solution was kept at 30 ° C., and the change in absorbance at 340 nm (NADPH absorption) was measured (FIG. 3). As a result, it was found that ORF2 encodes 3-keto-acyl CoA reductase.

  A crude enzyme solution was prepared in the same manner using JM109 (pSTV-ORF1, pQE-ORF3). This crude extract was added to a 1/10 volume of 25 mM Tris-HCl buffer (pH 7.5) containing 1 mM (R) -3HB-CoA to obtain a polyester polymerization enzyme activity measurement reaction solution. This reaction solution was kept warm at 25, 30, 37, 40, 42, 45, and 50 ° C. and sampled at regular intervals. As a result, it was found that the compound had the highest activity at a relatively high temperature of 45 ° C. (FIG. 4).

The time-dependent change of the polymerization reaction of (R) -3HB-CoA by the Escherichia coli crude extract expressing ORF1, 2, 3 using pNAD38 (CoA released by the progress of the reaction is quantified by DTNB reagent) is shown. The time-dependent change of the polymerization reaction of (R) -3HB-CoA by E. coli crude extracts expressing ORF1, 2 and 3 in various combinations (quantification of CoA released by the progress of the reaction by DTNB reagent) is shown. The time course of the 3-keto-acyl CoA reduction reaction by the Escherichia coli crude extract expressing ORF1 and ORF1 · 2 is shown (NADPH amount decreased as the reaction proceeds is determined by absorbance change at 340 nm). The optimum temperature for the polymerization reaction of (R) -3HB-CoA by the E. coli crude extract expressing ORF1 · 3 is shown (expressed as relative activity with 30 ° C activity as 100).

Claims (4)

A 3-keto-acyl CoA gene having the following restriction enzyme cleavage map derived from Bacillus sp. INT005 (FERM P-18327) and having a base pair of 3.8 kbp and comprising the base sequence shown in SEQ ID NO: 5 DNA fragment containing.

3-keto-acyl CoA reductase gene encoding the following polypeptide (a) or (b):
(A) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 6 (b) a 3-keto-acyl CoA reductase comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a) Polypeptide that brings about activity. 3-keto-acyl CoA reductase gene comprising the following base sequence (a) or (b):
(A) The base sequence shown in SEQ ID NO: 5 (b) A base sequence encoding the same amino acid sequence, although the codon sequence is different from the base sequence of (a) due to the degeneracy of the genetic code. The following (a) or (b) polypeptide:
(A) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 6 (b) a 3-keto-acyl CoA reductase comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence (a) A polypeptide that provides activity.

Images