JP3515072B2 - Methods and compositions used to identify growth factor mimetics, growth factors and inhibitors - Google Patents

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates to the field of growth factors, inhibitors and their receptors.

BACKGROUND OF THE INVENTION Although related technologies are examined below, none of them is recognized as a technology prior to the scope of the claims below.

By conventional means, namely protein purification and expression screening, the number of growth factors and cytokines identified is limited.

In hematopoiesis, for example, cytokines are required for the development of all mature, highly differentiated blood cells. It is believed that all blood cells are derived from a common pool of pluripotent stem cells that can undergo self-renewal or give rise to progenitor cells. Cytokines control a complex process involving the continuous, synchronous differentiation and proliferation of stem and progenitor cells. Many cytokines are produced locally by bone marrow stromal cells. Others are generated in other areas of the body. Some cytokines have broad specificity, acting on pluripotent stem cells and inducing them into differentiation, self-renewal and proliferation. Others act on specific cell lines late in hematopoiesis. Many cytokines also affect the activity of mature cells and play a role in the immune response to exogenous antigens. Many of the known cytokines and their major role in hematopoiesis are listed in Table 1 (Metcalfe, D. and Nikola, NA 1995. Th.
e Hemopoietic colony-Stimulating Factors in progress. Cambridge University Press, New York,
Colored, RE and Gearing, AJH 1994. The
Under Cytokine Facts Book. Academic Press Incorporated, San Diego, California, Hamburg, AS 1993. Cytokines and CytokineRecep
in tors. Oxford University Press Incorporated, New York).

[0005]

[Table 1]

[Table 2]

In addition to the ligand natural growth factors and cytokines, agonist antibodies have been discovered. Agonist antibodies are antibodies that mimic the natural ligand of the receptor. Agonist antibodies have been identified in hematopoiesis and related growth and differentiation pathways by using conventional monoclonal antibody technology. Agonist antibodies are liver cancer transmembrane kinase (Htk), C
D34 ⁺ was identified against a tyrosine kinase in human bone marrow cells and a human hepatocellular carcinoma cell line (Bennett, BD, Wang, Z., Kwang, WJ, Wang, A., Groupman, JE, Goedel, DV, Skadden , DT, JB
iol. Chem. 269: 14211-14218, 199.
4). Agonist antibodies have also been raised against flt3 / flk2 (Bennett et al., US Pat. No. 563).
5388).

Antibodies that mimic erythropoietin have been identified through screening of monoclonal antibodies raised against the erythropoietin receptor. This antibody promotes the receptor response via dimer formation (Schneider et al., Blood 89: 473, 1997). Other antibodies that mimic ligands have also been identified (Kahan et al., Pr.
oc.Natl.Acad.Sci., USA 75: 4209, 1978).

In some conditions, antibodies that bind to the receptor may mimic the action of the natural ligand. In the case of hyperthyroidism (Graves' disease), abnormal production of antibodies that bind to TSH receptors and activate these receptors occurs (Kosugi, S., Van, T., Corn, LD, Mol. Endocrino
l. 7: 114-130, 1993, Lundgate, M.
E., Vasat, G., Baillieres Clin.Endocrinol.Meta
b. 9: 95-113, 1995).

In contrast to antibodies that promote proliferation or differentiation, inhibitory antibodies have been identified that bind to cell surface receptors and effectively interfere with ligand binding. These antibodies act by competing with the natural molecule for the same binding site or by blocking the natural binding site by binding to sites in close proximity. Antibodies to c-fms receptor (Sudo, T., Nishikawa, S., Ogawa, M., Kataoka, H., Oono, N., Izawa, A., Hayashi, S., Nishikawa,
S., Oncogene 11: 2469-2476, 1995).
And antibodies to the c-kit receptor (Kodama, H., Nose, M., Niida, S., Nishikawa, S., Nishikawa, S., Exp.He.
Matol. 22: 979-984, 1994), and numerous examples are described in the literature for these types of inhibitory antibodies.

Alternatively, some inhibitory antibodies may act by mimicking a naturally occurring inhibitory molecule.
Cytokines having an inhibitory effect on hematopoiesis have been identified (Kesenbury, PJ, 1995. Hemopoietic stem
cells, progenitor cells, and cytokines. Williams H
In Ematology, 5th Edition, Butler, E., Richtmann, M.
A., Coller, BS, Kipps, TJ, McGraw-Hill United States). These inhibitory molecules are
It acts by inhibiting cell division during S phase, regulating surface cytokine receptor expression, or inhibiting the release of cytokines from cells. Transforming growth factor-B (TGF-B) suppresses early stem cells and stimulates further mature cells. Other cytokines with inhibitory effects include the H-subunit ferritin, prostaglandins E1 and E2, inhibin and lactoferrin (Kesenbury 1995). Hematopoietic inhibitors in the chemokine family include macrophage-inflammatory protein-1a, macrophage-inflammatory protein-2a, platelet factor-4, interleukin-8,
There are interferon-inducible proteins-10 and several small peptides (Kesenbury, 1995). The action of inhibitors may require receptor dimerization, or conformational changes in the receptor triggered by binding. 2 inhibitory antibodies
Inhibitory ligands may also be mimicked by promoting merization or changes in receptor conformation.

SUMMARY OF THE INVENTION The present invention is a novel growth factor mimetic, growth factor receptor, natural growth factor, growth factor receptor involved in differentiation pathways, developmental pathways, cell survival and functional activation or inhibition of cells. Utilize immune system methods to identify antagonists and inhibitors. The pathways include, but are not limited to, hematopoiesis, nervous system development and regeneration and organ / tissue development and regeneration. In a preferred embodiment, the present invention provides granulocytes, mononuclear cells, macrophages, eosinophils, megakaryocytes, mast cells, red blood cells, T-lymphocytes, B-
Growth factors and mimetics that affect proliferation and differentiation of pluripotent stem cells, hematopoietic cells including pluripotent progenitor cells and unipotent cells at various stages within each hematopoietic lineage, including lymphocytes and dendritic cells And identification of inhibitors.

The extensive screening and identification method of the present invention enables selection and screening through a large repertoire of molecules that bind to cell surface molecules, and exerts proliferation, differentiation, development, cell survival, function activation or function suppression effects. Those with have been found. In a preferred embodiment, the method employs a combinatorial library and a phagemid to provide a first generation mimetic molecule (agonist antibody) that acts as an agonist or inhibitor in the proliferation, differentiation, survival or activation of various cell lineages or Inhibitory molecules (inhibitory antibodies) (eg, antibodies that mimic naturally occurring inhibitor or antagonist antibodies) are identified. First generation agonists and inhibitors are therapeutic agents (eg, for agonists: expansion of clinically relevant cell types, ex vivo proliferation and differentiation for gene therapy purposes, eg, for inhibitors: Cancer cells continue to divide, suppressing the growth of normal cells only to increase sensitivity to chemotherapeutic agents, or suppressing the growth or differentiation of cells involved in diseases or disorders, such as the proliferation or differentiation of cell populations involved in allergic reactions), diagnosis It can be used directly as a reagent and in basic and clinical studies (eg antibodies for cell sorting of cells, eg hematopoietic cells and for identifying cells, eg hematopoietic cells). First generation agonists and inhibitors can also be used to clone the receptors, and ultimately the natural factors they mimic. The natural factors obtained from these studies can be used clinically in many medical conditions. For example, those who would benefit from novel hematopoietic growth factors and mimetics include any patient, including HIV-infected patients, who suffer from disease- or treatment-related immunosuppression, including chemotherapy, bone marrow transplantation and myeloproliferative disorders. However, without being limited thereto, medical facilities for this type of therapeutic agent will be increased.

In one aspect of the invention, immunizing an animal with human or murine stem / progenitor cells produces an immune repertoire library of antibodies raised against these cell surface-expressed epitopes. . Since a mixture of primary cells is used, the immunogen represents thousands of cell surface receptors that are involved in various distinct stages of development, differentiation, survival, activation and inactivation for various cell types. Will express potential epitopes of The epitope of interest is a cell surface receptor that is linked to a signaling cascade that leads to enhanced or inhibited proliferation, differentiation, development, survival or activation. For example, in order to produce antibodies that act on cells of hematopoietic origin, bone marrow cells are a choice of injected cells.

The present method of discovering novel growth factors, inhibitors and related molecules can be applied to other differentiation / developmental pathways in addition to hematopoiesis. For example, the animal (rabbit, chicken or other animal) is a murine or human embryonal carcinoma cell, such as a murine P19 cell (McBarney, MW, Rogers, B.
J., Developmental Biology 89: 503-508, 1.
982) or human NTera-2cl.D1 cells (Andrews, PW, Damjanov, I., Simon, D., Banting, GS, Carlin, C., Dracopoly, NC, Foff,
J., Laboratory Investigation 50: 147-16
2, 1984). Although these cells are pluripotent, they do not differentiate well under normal culture conditions. They can be induced to differentiate into nerves and glial cells (generally in the presence of inducers such as retinoic acid) or myocardium and skeletal muscle (eg in the presence of DMSO). Immunization with these cells allows the identification of agonist antibodies, inhibitory antibodies and growth factors involved in differentiation into these and other pathways.

Alternatively, the animal may be immunized with human or mouse multipotent teratocarcinoma cells. In this case, tissues and organs derived from endoderm, such as lung, liver, pancreas, stomach,
Agonist or inhibitory antibodies that promote or suppress esophageal, pharyngeal, intestinal or salivary gland development can be identified.

Immunization with murine pluripotent embryonic stem cells is also possible. Embryonic stem cells (ES cells) are totipotent and are derived from early mammalian cells that can proliferate in vitro. They can differentiate into whole embryonic 3 germ layers and their derivatives (Evans, M., Kaufmann, M., Nature 29).
2: 154, 1981, Martin, G., Proc. Natl. Acad.
Sci. USA, 78: 7634, 1981). Furthermore, the human ES cell line can be used as an immunogen (Thomson, JA, Itkowitz-Erdeau, J., Shapiro, S.
S., Wachnitz, MA, Swiergiel, JJ, Marshall, VS, Jones, JM, Science 282: 114
5-1147, 1998, Bongso, A., CY Phong, SCNg and S. Ratnam, Hum. Reprod. 9: 2.
110, 1994). In this case, agonist or inhibitory antibodies that promote or suppress differentiation into various embryonic structures can be identified.

After immunization, a combinatorial antibody fragment library is constructed from the immunized animals. The present invention also provides
Also included are these combinatorial libraries directed to the surface components of various cells used for immunization. These libraries provide a higher frequency of specific antibodies to the antigen of interest as compared to natural or synthetic libraries. Also, libraries generated from animals that have undergone 1-3 booster immunizations yield high affinity antibody fragments due to affinity maturation.

Alternatively, in a less preferred embodiment, a ready-made antibody library, such as a synthetic antibody phage display library, can be screened. However, since these are not targeted libraries, there may be no agonist or inhibitory antibody of interest. Some synthetic antibody phage display libraries contain a broad assortment of binding specificities. The library was created using random oligonucleotide synthesis (Barbus, CFIII, Vine, JD, Hoextra, DM, Lerner, RA, Proc.Natl.Acad.Sci USA.
89: 4457-4461, 1992, Soderlind,
E., Vergeres, M., Borebeck, CA, Gene 16
0: 269-272, 1995). In addition, a large phage display library of human single chain Fv (scFv) antibody fragments has a synthetic heavy chain C
Constructed by combining with the DR3 region and various light chain sequences (De Kruif, J., Boel, E., Logtenberg, T., J. Mol. Biol. 248: 97-105, 199.
5, Red pine, Y., Cole, MS, Tsuso, JY, Tsurushita,
N., J. Immunol. 151: 4651-4659, 199.
3). Other synthetic libraries have also been reported (Fuchs, P., Dubel, S., Breitling, F., Braunagel, M., Klewinghouse, I., Little, M., C.
ell Biophys., 21: 81-91, 1992, Fugenboom, HR and Winter, G., J. Mol. Biol. 22.
7: 381-388, 1992).

In the present invention, the expression library from the immunized animal is preferably constructed as a Fab fragment library or a single chain variable region library (scFv). The Fab fragment library maintains the natural antigen recognition site and is useful for ensuring maintenance of affinity. Single chain libraries are useful because the entire binding domain is contained in one polypeptide.

The antibody or antibody fragment may be delivered to the target cells for screening purposes in a variety of ways. First, they are bacteriophages, phagemids, prokaryotic cells such as E. col.
i), can be surface-displayed on eukaryotic cells such as mammalian cells or yeast or can be displayed on ribosomes. The surface-displayed antibody is
Contacting the target cell with an independent entity that carries the surface display antibody (a bacteriophage, phagemid, bacterial or mammalian cell) causes binding to the target cell, removal of unbound independent entities, and independence of binding. If there is a body, it will be screened by amplifying them,
Further tested in bioassay. Alternatively, co-culture can be used for screening purposes. Antibody-producing cells, bacteriophage- or phagemid-producing bacterial cells, antibody-producing bacterial cells, antibody-producing eukaryotic cells are grown in the presence of target cells (co-culture). The antibody is either provided on the surface of cells, bacteriophage or phagemids or secreted into the medium. Third, the means of providing the target cells is by utilizing the secreted antibody.

The antibody display is bacteriophage (Foods, WD, Sustain, L., Iverson, S.
A., Kung, AS, Alting-Meads, M., Burton, DR, Benkovic, SJ and Learner, R.
A., Science, 246: 1275-1281, 198.
9, Makaferty, J., Phryphis, AD, Winter, G., Chiswell, DJ, Nature 348: 552-5
54, 1990, Chang, CN, Randolphy, NF and Queen, C., J. Immunol. 147: 3610-36.
14, 1991), phagemid (Barbus III, CF,
Kang, CF, Learner, RA and Benkovic, S.
J., Proc. Natl. Acad. Sci., USA, 88: 7978-79.
82, 1991) and prokaryotic cells, such as E. coli (Fuchs, P., Braidling, F., Berscheus, T., Little, M., Biotechno.
logy 9: 1369-1372, 1991, Francisco, JA et al., Proc. Natl. Acad. Sci., USA, 90: 1044.
4-10448, 1993, Chen, G., Cloud, J.,
Georgiou, G, Iverson, BL, Biotechnol.Pr
12: 572-574, 1996). The antibody was intracellularly expressed and secreted in eukaryotic cells. The antibody was also expressed on the surface of eukaryotic cells (yeast). Mammalian CHO cells and COS cells are
Commonly used for antibody secretion (Toril, JJ, Shirtman, AR, Gangley, S., Curr. Opin. Biotechnol.
6: 553-560, 1995, Fouzer, LA, Swanberg, SL, Lynn, BY, Benedict, M., Kelleher, K., Cumming, DA, Riedel, GE, Biotechno.
logy (NY) 10: 1121-1127, 1992). G
PI anchors are commonly used to anchor various proteins on the cell surface. In eukaryotic cells, antibody fragments can be displayed on the surface of the plasma membrane using GPI anchors. Fusion proteins linked to GPI anchors are widely used for heterologous protein expression on the cell surface (Scaron, BJ, Cad-Fong,
H., Net Reton, MY, Koh Chang, JP, Biotechnolog
y 10: 550-556, 1992). In yeast, antibody expression is intracellular (Carlson, JR and Weissmann, I.
L., Mol. Cell. Biol., 8: 2647-2650, 198.
8, Bow Dish, KS, Tongue, Y., Hicks, JB
And Hilvert, D., J. Biol. Chem. 266: 11.
90-11908, 1991) and the surface (bodder,
ET and Whitlap, KD, Nat. Biotechnol.,
15: 553-557, 1997). A variety of stable vectors and effective promoters and secretion signals are available in yeast when the secretion of the protein of interest is engineered. These are Moa, DT, Davidow, LS, Meth
ods Enzymol. 194: 491-507 (1991). Cell surface expression of heterologous proteins on the yeast surface has recently been reviewed (Georgiu, G., Stasopoulos, C., Dauferty, P.
S., Nayak, AR, Iverson, BL, Curtis, R.III, Nat. Biotechnol. 15: 29-34, 19
97). A cloning fragment downstream of the leading sequence, mating factor alpha, has been used effectively in the secretion of heterologous proteins (Swart, AC,
Swart, P., Rhox, SP, Van der Melwe, KJ, Praetorius, IS, Stain, AJ, Endocr.
Res. 21: 289-295, 1995). In addition, many heterologous proteins are methylated by using the methanol oxidase promoter.
ropic) is produced in the yeast Pichia pastoris at levels greater than gram per liter (Three Krishna, K., Blanckamp, R.
G., Crop, KE, Blankenship, DT, Tsai,
JT, Smith, PL, Wiershke, JD, Subramaniam, A., Birkenberger, LA, Gene 190: 55-
62, 1997). One of ordinary skill in the art can readily achieve surface display and secretion of antibody molecules and fragments based on these and other known techniques.

Those skilled in the art will appreciate that other means of providing the antibody or antibody fragment to target cells that are not surface-displayed or secreted are also possible and suitable for use in the present invention. Should be. These methods include prokaryotic ribosome display (Haines, J. and Plaxant, A., Proc. Natl. Acad. Sci.
USA, 94: 4937-4942, 1997) and eukaryotic ribosome display (translocus.
Therapeutics, Cambridge, UK), but not limited to.

[0023] Preferably, the library is constructed in a phagemid vector which allows rapid screening. Phagemid requires superinfection with helper phage. Superinfection provides the remaining phage components required to package the plasmid into phagemid particles. Each phagemid contains approximately one or more antibody binding sites per phagemid particle, displayed on the surface as a coat protein fusion. The remaining coat proteins are wild-type due to the helper phage's contribution, which allows effective reinfection of E. coli with the phagemid for amplification. The functional domain of the gene III coat protein is preferred as a fusion partner for display of antibody fragments. However, it is also possible to utilize phage full-length or functional domain coat proteins, such as gene VIII, which allow phage surface display (Kang, A. et al.
S., Barbus III, CF, Janda, KD, Benkovic, SJ and Learner, RA, Proc. Natl. Acad. Sci.
USA, 88: 4363-4366, 1991).

The initial screening of surface-display antibody molecules or fragments is preferably carried out by sieving (De Kruif, J., Tarstappen, L., Boel, E., Logtenberg, T., Proc. Natl. Acad. Sci. .
USA 92: 3938-3942, 1995). Since sieving the monomeric antigen binding sites has the advantage of selecting clones based on affinity and specificity,
The population is skewed to separate high affinity binders. Typically, several rounds of selection and amplification are performed to enrich the binding molecule. The sieving is carried out using target cells expressing antibody directed cell surface receptors or closely related receptors. Alternatively,
Cells can be separated by fluorescence activated cell selector (FACS) sorting or magnetic sorting. Phage that adhere to a specific population of cells can be propagated by elution and infection of bacterial cells.

An alternative to the initial screen detects the binding of phage-displayed antibody molecules or fragments to target cells expressing cell surface receptors or closely related receptors to which the antibody is directed, As a result, the bound phages are internalized by receptor endocytosis. These phages can be identified, for example, by eluting surface-bound phages, lysing the cells, and then electrophoresing to recover the internalized phage DNA.

Another possible method of identifying a specific binding antibody is:
Radiolabeled cell lysates or membrane products are used, which are electrophoresed on one or two-dimensional gels and transferred to an immobilized solid support membrane. Hybridize the phage,
Elute from the specific spot of interest. Spots can be selected based on pattern comparisons of membrane proteins exhibited by target cells with cell surface molecules of interest and unrelated cells that naturally lack them.

Then, surface-displayed antibodies (remaining on the surface of the target cells or internalized) that specifically bind to the target cells are proliferated by using various bioassays or receptor assay methods. Various target cells and cell lines are screened for their ability to promote or suppress differentiation, cell survival or activation. Dimerization is often a prerequisite for activation of many receptors, including hematopoietic receptors (The Hematopoietic Colony-Stimulating Factors, D.
M. Metcalfe, NA Nicola (1995) Cambridge
(University Press, New York). That is, following sieving, antibody fragments identified as binding cell surface molecules on target cells are tested as dimers in bioassays or receptor assays.
The inhibitory antibodies that act as antagonists may not necessarily be dimers, especially if they only block the receptor from binding the agonist, but the inhibitory antibody may be a natural inhibitory molecule. When mimicking, it may be required to be a dimer to be functional.

The present invention offers several advantages over other methods of identifying growth-related molecules. Previous methods of isolating growth factors have utilized purification of active factors from conditioned media by segregating biochemical characteristics. These methods required that the factor be present in significant amounts. Another method uses cell lines similar to bioassays and uses direct expression screening of cDNA pools. In this case, transcription level is a factor in effective factor identification, as is the case for proper folding of the polypeptide chains in the expression screen. Also, it is becoming increasingly clear that many of the regulatory factors were designed to work most effectively when they work together, with factors that simply act to affect proliferation and / or differentiation. These methods are limited in that they can only be identified.

In contrast, the present invention finds those that have a proliferative or differentiative effect by direct selection for binding molecules and then screening across the entire repertoire of binding molecules. A large immune repertoire as a combinatorial library allows for random association of heavy and light chain binding regions, further increasing candidate agonists and inhibitors. The claimed method is also a limitation of traditional monoclonal antibody technology (B to myeloma cells per immunized animal).
(Limited by the number of cell fusions), allowing screening across a large immune repertoire. Moreover, both local regulatory and fluid regulatory molecules through cell-cell contact are known to be involved in proliferation, development, differentiation, cell survival, functional activation and suppression, so these screening methods ,
It is not limited to the type of modulator or its origin or site of generation. Furthermore, this screening method does not assume any biochemical function, sufficient sequence similarity with known genes, or origin sites. The claimed identification and screening methods present several practical advantages over conventional screening methods, including speed, cost-effectiveness and simplicity. The current method also provides a simultaneous multi-sample analysis method, making more Ab fragments available for screening.

The present invention also includes a method for screening an antibody (agonist or inhibitory) by co-culturing cells expressing the antibody in the presence of cells expressing the receptor to which the antibody binds (target cells).

Once agonist or inhibitory antibodies have been identified, they can be synthesized using standard recombinant techniques known to those of skill in the art. These antibodies and methods for producing them are also included in the claimed invention.
Furthermore, the present invention includes a method of identifying a receptor that binds to an antibody and identifying a natural growth factor or inhibitor that can be mimicked by the antibody by using the above antibody.

Furthermore, the present invention relates to the use of agonist antibodies for treating patients deficient in a particular cell type or its precursors by stimulating the proliferation or differentiation of that cell type and to inhibit the particular cell type. Uses of inhibitory antibodies,
And the use of antibodies to identify specific cell types.

Also included in the present invention is the use of agonist and inhibitor antibodies to identify and isolate specific populations of cells.

In a first aspect, the present invention is a method for identifying an agonist or inhibitory antibody against a receptor involved in cell proliferation, differentiation, survival or activation, which comprises a surface molecule containing the receptor. / Immunizing an animal with progenitor cells to produce a plurality of immune cells expressing one or more antibodies to a surface molecule and generating a library from the plurality of immune cells containing nucleic acid sequences encoding the antibodies. Generate, clone nucleic acid sequences from the library into a surface display vector such that the antibody is surface displayed, and screen the surface display antibody with target cells to identify agonist or inhibitory antibodies to the receptor. A method including steps is featured.

"Receptor involved in cell proliferation, differentiation, survival or activation" refers to a signal transduction cascade that leads to enhancement or inhibition of proliferation, differentiation, development, survival or activation of cells displaying the receptor. Includes linked receptors. Proliferation depends on the rate of protein synthesis, chromosome replication,
Active division and progression through various stages of the cell cycle detected by changes in cell size or cell number. Differentiation occurs as a result of exposure to exogenous factors,
Changes in cell morphology, behavior or function leading to the production of different types of cells with special functions, or cell maturation,
Includes changes in gene expression that reduce pluripotency. Activation is
It is a process in which cells leave G ₀ and enter G ₁ , but do not synthesize or divide until they receive a second signal. Activation involves the expression of a specific set of activating genes and activating antigens. For example, activation antigens for B cells include CD23, surface IgM and CD40. Survival means that the cells have not undergone apoptosis or programmed (planned) cell death or necrosis. Although the present invention includes antibodies directed to as yet undiscovered receptors,
The identification of the receptor is not always necessary because the average technician in the art can detect the binding of the antibody and the receptor by the resulting behavior of the cell, such as proliferation, differentiation, activation or survival. is not.

In a preferred embodiment, the stem / progenitor cells are
Unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, murine AG
Cells derived from M region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES)
Cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells that have undergone RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FDCP-mixed murine hematopoietic stem cell lines, B6SUTA murine hematopoietic cells Selected from the group consisting of stem cell lines, P19 teratoma cells, and NTera-2 multipotent embryonal carcinoma cells, wherein the antibody is sc
Fv or Fab fragment, the surface display vector is a phagemid, and the library is a combinatorial library.

In another aspect, the present invention provides a method for identifying agonistic antibodies to growth factor receptors, which comprises immunizing an animal with stem / progenitor cells bearing surface molecules containing the growth factor receptor. Generate a plurality of immune cells that express one or more antibodies to the molecule,
Generate a library from multiple immune cells containing nucleic acid sequences encoding the antibody, surface-display the antibody by cloning the nucleic acid sequence from the library into a surface display vector, and surface display using target cells. A method comprising the step of identifying agonistic antibodies to growth factor receptors by screening the antibodies.

"Agonist antibody" refers to whole antibodies or binding to cell surface receptors linked to a signal transduction cascade leading to proliferation, differentiation, activation, survival or viability conservation of cells displaying cell surface receptors. Its fragments, eg Fab fragments and scFv
Include fragments.

"Growth factor receptor" is a substance that binds to growth factors or other ligands and is associated with the plasma membrane (ie, cell surface).
It includes molecules that participate in signal transduction cascades that lead to proliferation, differentiation, survival or activation of cells with the growth factor receptors presented above.

“Immunizing an animal” means injecting cells, eg stem / progenitor cells, into one or more animals by any route of administration, eg intraperitoneal, intravenous, subcutaneous or intramuscular. By means that an animal elicits an immune response against molecules on the cell surface. The primary immunization can be performed in the presence of adjuvant. Often the first immunization is followed by boosting with the same antigen, resulting in a larger response,
The affinity of the produced antibody is enhanced. Typically 1
~ 3 booster immunizations are given at 2-8 week intervals, usually at 3-4 week intervals. Typically, more than a single animal is immunized.

By "stem / progenitor cell" is meant a cell that is multipotent and a cell that is pluripotent and also the proliferation, differentiation,
It includes terminal stage or terminally differentiated cells derived from multipotent or pluripotent cells that have cell surface receptors involved in activation or survival. Pluripotent cells (stem cells) can differentiate into all cell lineages. For example, human embryonic stem (ES) cells can differentiate into all three germ layers of the embryo and their derivatives. The most immature hematopoietic stem cells can form mature hematopoietic cells of all lineages and reconstitute the hematopoietic tissue of animals. Pluripotent cells (progenitor cells) are limited to differentiation into a limited number of lineages (typically 2 or 3).
Hematopoietic stem / progenitor cells are present in bone marrow and circulating blood.
Stem / progenitor cells include unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, murine AGM region Cells derived from, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells,
Human embryonic stem (ES) cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells undergoing RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FDCP-mixed murine hematopoiesis Stem cell line, B6SU
There are, but are not limited to, TA murine hematopoietic stem cell lines, P19 teratocarcinoma cells and NTera-2 pluripotent embryonal carcinoma cells. Cells for immunization can be obtained from any of these sources.

"Surface molecule" includes plasma membrane (cell membrane) protein molecules, at least some of which are on the extracellular surface of the plasma membrane (cell membrane).

By "plurality of immune cells expressing one or more antibodies" is meant a population of antibody-producing cells from blood or lymphoid organs such as bone marrow, spleen and lymph nodes from an immunized animal. .

By "library" is meant a collection of nucleic acid molecules representative of the immune repertoire of an organism, which in the present invention encode antibodies and fragments directed against relevant stem / progenitor cell growth factor receptors. The molecule is included.
The library is typically provided as a nucleic acid molecule cloned in a vector, eg, a surface display vector.

"Surface display vector" means at least a functional domain of a surface display protein,
That is, it means a nucleic acid vector that carries a cloning sequence for inserting a leader sequence that directs transport from cells and an antibody sequence, and as a result, an antibody fusion gene is obtained.
The surface display vector enables the production of a fusion protein in the host cell which is composed of the surface display protein or a functional domain thereof and the antibody or fragment thereof such that the antibody or fragment is surface displayed. That is, the antibody or fragment is provided on the surface as a functional binding polypeptide linked to a domain of the surface display protein. The surface display is a bacteriophage,
It can be performed on the surface of phagemids, bacterial cells or mammalian cells. An example of a surface display vector is pCOM.
B3, SurfZAP, pCANTAB5E and pEXmi
de3, but not limited to these. One of ordinary skill in the art would be familiar with these and other surface display vectors and can readily construct other similar vectors. Surface-displayed antibodies can bind to antigens provided from the extracellular side of the plasma (cell) membrane in which they are located.

By "screening" is meant using a method of identifying antibodies that are agonistic or inhibitory antibodies. In the case of agonistic antibodies, the screening will identify antibodies that bind to the receptor of the target cell and thus induce or activate a receptor that participates in a signaling cascade leading to proliferation, differentiation, survival or activation of that cell. To do. Screening involves measuring the ability of an antibody to bind to a receptor on a target cell (including both antibody that remains on the cell surface after binding and that is internalized after binding) and / or binding of the antibody to the receptor. Only assays that measure the cellular response associated with can be included. These include bioassays to detect differentiation, proliferation, cell survival or activation (eg alterations in transcription of downstream effector genes) and chemical processes such as biochemical assays to detect phosphorylation. For inhibitory antibodies,
The screening involves the identification of antibodies that bind to the receptor of the cell, where binding of the antibody to the receptor inhibits growth, proliferation, differentiation, activation or survival of the cell. Screening involves measuring the ability of an antibody to bind to a receptor on a cell (including both antibody that remains on the cell surface after binding and that is internalized after binding) and / or binding of the antibody to the receptor. Only assays that measure concomitant cellular responses can be included. These include bioassays to detect differentiation, proliferation, cell survival or activation (eg alterations in transcription of downstream effector genes) and chemical processes such as biochemical assays to detect phosphorylation.

"Target cell" includes cells which display a receptor to which an agonist or inhibitory antibody binds. Growth factor receptors on target cells are those that are the same or highly related to those present on stem / progenitor cells. In the case of hematopoietic cells, these can include, but are not limited to, primary hematopoietic cells, some factor-dependent murine cell lines and human leukemia cell lines. The target cell may be the same primary cell type, population of cell types, or cell line or another cell type or cell line used as the immunogen. Target cells are selected based on the immunogen used. For example, extensive immunization with human primary bone marrow aspirate that has been depleted of erythrocytes and platelets by treatment with erythrocyte lysing reagents and centrifugation naturally yields antibodies with specificity for diverse cell surface receptors. .. The target cells in this case may comprise the same immunogen, in which the various antibodies are separated, or the target cells may comprise a sorted population of cells, eg CD34 ⁺ cells, so that antibodies directed against specific cell lines are To be identified. Another target option with a wide range of immunogens is to use the murine hematopoietic cell line FDCP-mix. In this case, a more homogenous population of cells capable of in vitro growth has its advantages, but the agonist antibody identified with the murine target must be further characterized for its ability to promote effects on human cells. I have to. Alternatively, an immunogen consisting of a sorted population of cells, eg CD34 ⁺ cells, can be used to target CD3
4 ⁺ cells, or FDCP-mixed cell lines can be used. Thus, proper selection of immunogen and target cells is key to identifying relevant antibodies. One of ordinary skill in the art should be able to readily determine the appropriate target cells based on the desired antibody properties, ie directed to receptors that are only involved in precursor cell growth. Antibodies require that target cells be early lineage cells.

[0048] In a preferred embodiment, the present invention provides a method for identifying an agonist antibody to a growth factor receptor, the method comprising:
Immunizing an animal with stem / progenitor cells having a surface molecule containing a growth factor receptor generates multiple immune cells that express one or more antibodies to the surface molecule and encodes the antibody By creating a library from multiple cells containing the nucleic acid sequence and cloning the nucleic acid sequence from the library into a viral display vector, the antibody is displayed on the viral surface and targeted cells are used to display the viral surface. The method is characterized by the step of identifying agonistic antibodies to growth factor receptors by screening the displayed antibodies.

The "viral display vector" includes a vector capable of displaying an antibody or a fragment thereof on the surface of a virus. Preferably, the viral vector is a bacteriophage (eg f1, M
13, fd, λ, T3, T4, T7) or phagemid vector. Bacteriophages are viruses that are capable of infecting bacterial cells, replicating, packaging their genome, and infecting other cells upon release from the cell to continue this cycle. Phagemids are viruses lacking the essential genes required for the above life cycle and they are provided by another helper phage. One of ordinary skill in the art would be familiar with virus, bacteriophage and phagemid vectors suitable for the claimed uses of the invention. Examples of viral display vectors include pRL4 (Proriphalon, LLC, San Diego, Calif.), PCOMB3 (Burton, D. et al.
R. and Barbus, CFIII, Advances in Immunology
57: 191-280, 1994), SurfZAP vector (Stratagene, La Jolla, CA), pCANTAB5E (Pharmacia, Piscataway, NJ), pEXmide3 (Soda Lind, E., Lagarkvist, AC, Duenas,
M., Malmborg, AC, Ayala, M., Danielson,
L., Borebec, CA, Biotechnology 11: 503-.
507, 1993).

In a further preferred embodiment, the viral vector is selected from the group consisting of bacteriophage and phagemid vectors.

In another preferred embodiment, the present invention is a method for identifying agonistic antibodies to growth factor receptors, which comprises the step of immunizing an animal with stem / progenitor cells bearing surface molecules containing growth factor receptors. Generating a plurality of immune cells expressing one or more antibodies to the molecule, creating a library from a plurality of immune cells, comprising a nucleic acid sequence encoding a scFv fragment of the antibody, and a nucleic acid sequence from the library Of the scFv fragment onto the phagemid surface by cloning the lignin into a phagemid vector and screening the scFv fragment displayed on the phagemid surface with target cells to identify agonistic antibodies to growth factor receptors. Characterize the method.

"ScFv fragment" includes single chain antibody fragments in which the complete antigen binding domain is contained within a single polypeptide.

In another preferred embodiment, the present invention provides a method of identifying agonistic antibodies to growth factor receptors, which comprises immunizing an animal with stem / progenitor cells having a surface molecule containing the growth factor receptor, 1 for surface molecules
Generating Multiple Immune Cells Expressing One or More Antibodies, Creating a Library from Multiple Immune Cells Containing Nucleic Acid Sequences Encoding a ScFv Fragment of the Antibody, and Surface Displaying Nucleic Acid Sequences from the Libraries A method comprising surface-displaying scFv fragments by cloning into a vector and identifying agonistic antibodies to growth factor receptors by screening the surface-displayed scFv fragments with target cells.

In a further preferred embodiment, the surface display vector is a bacteriophage vector capable of expressing antibodies on the surface of bacteriophage.

In another preferred embodiment, the present invention provides a method for identifying agonistic antibodies to growth factor receptors, which comprises immunizing an animal with stem / progenitor cells having a surface molecule containing the growth factor receptor, 1 for surface molecules
Generating a plurality of immune cells expressing one or more antibodies, creating a library from a plurality of immune cells containing a nucleic acid sequence encoding a scFv fragment of the antibody, and transferring the nucleic acid sequences from the library to a phagemid vector By cloning the scFv fragments onto the phagemid surface, screening the phagemid-displayed scFv fragments for binding to target cell cell surface molecules, and screening for scFv fragments that bind to cell surface molecules in functional assays. Thereby identifying an agonist antibody for the growth factor receptor.

"Sieving" refers to the cell surface containing the antigens of interest, ie, the receptors to which the antibody or antibody fragment is directed, displayed on the target cells in order to enrich the antibody for specifically binding to the target cells. Means exposing a surface display library (bacteriophage, phagemid or cells) to a molecule. For example, target cells can be immobilized, eg, on a plastic surface, or immobilized or captured by centrifugation. After the specific antibody or fragment displayed on bacteriophage, phagemid or whole cells binds to the target cells, the rest of the surface display library is removed by washing. After binding and washing, bacteriophage, phagemids, cells exhibiting specific antibody binding are eluted (eg, by low pH). The sieving process is typically repeated for several rounds. When using bacteriophage or phagemid, the phagemid or bacteriophage eluted after each round can be amplified in host cells. Alternatively, fluorescence activated cell selection (FACS) or magnetic cell sorting can be used for high throughput screening to identify relevant bound antibodies. The FACS selection method for surface display molecules is as follows: Georgiou, G., Staspoulos, C., Dauferty, PS, Nayak, AR,
Iverson, BL and Curtis, R.III, Nature
Biotechnology 15: 29-34 (1996). These methods can be readily applied by one of ordinary skill in the art to screen surface display antibody fragments. Screening for scSv fragments is because one cloning strategy is used.
It may be carried out as a dimer, but in some cases as a monomer. Alternatively, the bacteriophage or phagemid that recognizes the receptor may also remove the bacteriophage or phagemid that remains bound to the cell surface and then lyse the cells to recover the internalized bacteriophage or phagemid. Can be identified using an internalization method. In another method, membrane proteins are separated from target cells and antibodies are bound to specific fractions of these membrane proteins.

"Binding to a cell surface molecule" means an antigenic determinant of a receptor that induces antibody production or a closely related antigenic determinant, such as a receptor belonging to the same or related class or another class. And the binding of the antigen binding domain of an antibody fragment to an antigenic determinant on a receptor associated with

"Screening in a functional assay" means the action of an antibody on a target cell (ie, the growth factor receptor displayed on the target cell that affects proliferation, differentiation, development, survival or activation). It refers to the testing of surface-expressed antibodies (agonists or inhibitors) in individual or pool to determine antibody binding). Only antibody fragments determined to bind to target cells by sieving are subsequently screened in a functional assay. ScFv2 is screened for in a functional assay for agonist antibody fragments
It is a quantity. Screening for scFv dimer molecules
It can be performed as a surface display molecule, a soluble scFv molecule or a secretory molecule. In functional assays for inhibitory antibody fragments, antibody fragments are independently screened as monomers and dimers and surface display or soluble molecules. If the scFv fragment binds to the growth factor receptor and acts as an antagonist that blocks its activation, it can act as a monomer. However, if the scFv fragment acts as a mimetic of a naturally occurring inhibitory molecule, it needs to be a dimer, as is the case for agonist antibodies. Screening in functional assays includes bioassays (eg, colony formation assay, ³ H thymidine incorporation or B
Either measuring DNA synthesis by rdU incorporation, assaying for alterations in gene transcription, or measuring cellular enzymes that can be used to screen for effects on proliferation) or biochemical assays (eg receptor phosphorylation). One of ordinary skill in the art should be familiar with bioassays and biochemical assays suitable for detecting cell proliferation, differentiation, survival and activation.

In another preferred embodiment, the present invention is a method of identifying agonistic antibodies to growth factor receptors, which comprises immunizing an animal with stem / progenitor cells having a surface molecule containing the growth factor receptor, 1 for surface molecules
Producing a plurality of immune cells expressing one or more antibodies, making a library from the plurality of immune cells, comprising a nucleic acid sequence encoding a Fab fragment of the antibody,
Fab fragments were displayed on the phagemid surface by cloning the nucleic acid sequences from the library into a phagemid vector, and the Fabmid-displayed Fab fragments were screened for binding to target cell cell surface molecules, A method comprising the step of dimerizing the binding Fab fragments and screening the dimerized Fab fragments to identify those that are agonist antibodies for the growth factor receptor.

By "Fab fragment" is meant a fragment of an antibody in which the heavy and light chain variable regions are contained in separate polypeptides. The polypeptide is
Covalently linked to each other by at least one disulfide bond. The constant regions present may be naturally occurring or derived from different species, also known as hybrid or chimeric Fabs.

Fab fragments are generally monomeric, but sieving is performed using target cells as described above.

"Dimerization" means inducing the association of two antibody binding domains contained in an antibody fragment so that binding to multiple growth factor receptors can occur. One way in which dimerization can be achieved is to use individual antibody fragments in the dimerization domain, eg jun.
(Costelny, SA, Cole, MS and Tsuso, JY,
J. Immunol. 148: 1547-1553, 1992, Dekruyif, J. and Rogtenberg, T., J. Biol. Chem.
271: 7630-7634, 1996) and the two protein fragments can stably associate through the interaction of these domains.

"Screening in functional assay" means
It is performed with target cells as described above for scFv fragments. Monomer Fa binding to target cells
The b molecule is dimerized and screened as a dimer. These can be surface displayed, but are preferably screened for soluble molecules.

In another preferred embodiment, the present invention provides a method for identifying agonistic antibodies to growth factor receptors, which comprises immunizing an animal with stem / progenitor cells having a surface molecule containing the growth factor receptor, 1 for surface molecules
Producing a plurality of immune cells expressing one or more antibodies, making a library from the plurality of immune cells, comprising a nucleic acid sequence encoding a Fab fragment of the antibody,
Fab fragments are surface displayed by cloning the nucleic acid sequences from the library into a surface display vector, the surface displayed Fab fragments are screened for binding to cell surface molecules of the target cell, and the Fab fragments are bound to cell surface molecules. And dimerizing Fab fragments and screening the dimerized Fab fragments in a functional assay to identify those that are agonistic antibodies to growth factor receptors.

In a further preferred embodiment, the surface display vector is a bacteriophage vector,
The antibody may be expressed on the surface of the bacteriophage.

In another preferred embodiment of the agonist antibody identification method, the animal is a rabbit or chicken. stem/
Progenitor cells are derived from unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, and murine AGM regions. Cells, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine multipotent embryonic cells, human embryonic stem (ES) cell lines, cells of neural origin, organs or Cells involved in tissue regeneration, human bone marrow cells subjected to RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells,
FDCP-mixed murine hematopoietic stem cell line, B6SUTA
Murine hematopoietic stem cell line, P19 teratocarcinoma cells, and N
It is selected from the group consisting of Tera-2 pluripotent embryonal carcinoma cells.

The selection of the preferred animal has two aspects.
Rabbits are effectively routinely used for antibody production, where an immune response can be generated by species differences with respect to the immunogen,
Generally the first choice. However, chickens provide a more evolved and defined environment in which antibodies are induced. This is an important consideration as rabbits and mice may not elicit an immune response depending on the human antigen. However, one of ordinary skill in the art should be familiar with other suitable animals for use.

Cells useful in the present invention include primary cells isolated from animals, cells cultivated in vitro in primary cells or lines and established cell lines that can be continuously propagated in culture.

"Unsorted human bone marrow cells" means human bone marrow aspirate, such as red blood cells, that has been minimally manipulated so that all other cell lines are present and platelets are removed by centrifugation. Means a sample of aspirate fluid that has been treated accordingly.

“Human peripheral blood cells originating from human bone marrow”
Is a mononuclear cell or CD34 ⁺ which has been released into the bloodstream, for example, into the bloodstream and has an origin in the bone marrow.
Including cells.

"Selected human bone marrow cells" include human bone marrow cells that have undergone a separation process to separate a mixture of cells into various populations by using cell surface markers or cell determinants. Sorting is FACS (fluorescence activated cell selector) or antibody

It may be by a magnetic separation method using a cocktail, microbeads and a magnet. Sorting is performed by positive selection for cells of interest (eg, CD34 ⁺ cells, CD34 by selecting with α-CD34 antibody).
It can be a negative selection in which cells expressing the antigen are separated) or undesired cells are removed from the population (eg, the use of CD38 antibodies removes CD38 ⁺ cells from a given population).

For unsorted and sorted murine bone marrow cells, the same as described for human cells, but with the relevant murine surface antigens.

“Fetal hepatocytes” include cells that have migrated from the blood islands of the yolk sac to the fetal liver, where they develop into hematopoietic cells, including fetal erythrocytes, macrophages and stem / progenitor cells. They are Jordan, CT, McKern,
JP, Remiska, IR, Cell 61: 953-963.
It is obtained in the manner described in (1990). Furthermore, by using the specific antibody AA4.1, a subpopulation of fetal liver tissue containing pluripotent stem / progenitor cells can be enriched (Jordan, CT, McCarne, JP, Remiska, IR, Cell).
61: 953-963, 1990). The cells have CD34 and AC133 as surface markers.

By "yolk sac cell" is meant a cell that is the origin of the first hematopoietic cells in a developing organism. Extra-embryonic tissue cells of the yolk sac migrate from the blood islands of the yolk sac to the fetal liver, where they form a large population of hematopoietic cells, including fetal erythrocytes, macrophages, stem cells and progenitor cells.

“Human or murine embryonal carcinoma cell or line” is a pluripotent cell from a direct culture of normal embryos that can be derived from teratocarcinoma or can be cultured in vitro and is Cells that can be induced to differentiate in the presence of various inducers.

"Human or mouse pluripotent teratocarcinoma cell or line" refers to an undifferentiated cancer cell that includes a transplantable cancer cell derived from a teratocarcinoma and continues to divide to generate more differentiated tissues. It is a disordered mass of cells containing diverse differentiated tissues mixed with stem cells. Teratocarcinoma cells can be grown in culture as permanent cell lines, in which they do not differentiate and continue to grow indefinitely in the appropriate medium. However, these cells are pluripotent, where multilineage differentiation can be induced. Differentiation into a variety of apparently normal specialized cell types can be induced if the medium is changed by adding a differentiation inducer, eg retinoic acid, or if the cells can be aggregated.

[0100] The “murine pluripotent embryonic cell” is a cell derived from a murine undifferentiated embryo cell, and when injected into an undifferentiated embryo cell, the cell colonizes the germ line and reconstitutes the mouse. You can

“Human embryonic stem (ES) cell line” means
Means a cell line derived from an early mammalian embryo that is totipotent and is capable of in vitro growth (Thomson, JA, Itzkowitz-Eldor, J., Shapiro, SS, Wacknitz, MA, Swiergiel, JJ, Marshall, VS,
Jones, JM, Science 282: 1145-114.
7, 1998, Bongso, A., CY Fong, SCNg and S. Ratnam, Hum. Reprod. 9: 2110, 199.
4).

"Cells derived from murine AGM" refers to cells derived from regions including the dorsal aorta, gonads and mesonephros in mammalian embryos that contain high levels of hematopoietic stem / progenitor cells during murine embryogenesis. Meaning (Medvinsky, AL, Samoyrina, NL, Muller, AM, Zielzak, EA, Nature 364: 64-67, 1993, Medvinsky, AL, Gun, OI, Semenova, ML,
Samoyrina, NL Blood 87: 557-566, 199
6).

“Cells involved in organ or tissue regeneration” means double dividing cells such as kidney cells, endothelial cells forming the inner layer of blood vessels, and hepatocytes (michalopoulos,
GK and De Frances, MC, Science 276: 60
-66, 1997) and other cell populations regenerated by stem cell means, such as epidermis, bone, skeletal muscle and neural tissue (McKay, R., Science 276: 66-71, 19).
97).

"Hematopoietic cells" means blood-forming cells. By “cell of neural origin” is meant a cell that originates from the ectoderm, develops into the neural tube or neural crest, and ultimately forms the central and peripheral nervous system. By “RBC lysed human bone marrow cells” is meant whole bone marrow aspirate with the majority of red blood cells (RBCs) and platelets removed through RBC lysis and washing. This population is predicted to include all other hematopoietic lineages.

"Human bone (medullary) mononuclear cells" includes cells in the circulating blood and bone marrow containing single nuclei, such as mononuclear cells, lymphocytes and NK cells. These cells are 1.
Histopark 10 consisting of polysucrose and sodium diatrizoate adjusted to a density of 077 g / m
77 solution (Sigma Diagnostics, St. Louis, Mo.) or similar products can be separated from residual red blood cells, platelets and granulocytes.

By "human bone marrow CD34 ⁺ cells" is meant a population of stem / progenitor cells derived from human bone marrow that expresses the CD34 surface marker on the cell surface. Typically,
These cells are separated using magnetic or FAC sorting methods with antibodies specific for the CD34 molecule.

"FDCP-mixed murine hematopoietic stem cell line" refers to a murine cloned and isolated from long-term murine bone marrow cultures infected with recombinant src oncogenes of Moloney murine leukemia virus and Rous sarcoma virus. Means cell line (Spoon Sir, E., Hayworth, CM, Dan, A., Dexter, TM, Different
iation 31: 111-118, 1986). These cell lines have many of the characteristics of hematopoietic stem cells.

"B6SUTA murine hematopoietic stem cell line"
Means a factor-dependent hematopoietic cell line established from a non-adherent cell population removed from continuous mouse bone marrow cultures (Greenburger, JS, Sakakiney, MA, Humphreys, RK, Eaves, CJ and Echner. , R.
J., Proc. Natl. Acad. Sci. USA 80: 2931-2.
935, 1983).

"P19 teratocarcinoma cell" is a cell line initiated by McBurney et al. (McBarney, MW and Rogers, BJ, Developmental Biology 89:
503-508, 1982), that is, the teratocarcinoma cell line derived from the embryonal carcinoma induced in the C3H / He strain mouse.

"NTera-2 pluripotent embryonal carcinoma cells" means a pluripotent human embryo derived from a single cell clone of NTera-2 cells established from nude mouse xenograft tumors of Tera-2 cells. Phase cancer cell line (Andrews, PW, Damjanov, I., Simon,
D., Banting, GS, Carlin, C., Dracopoly, N.
C., Foff, J., Laboratory Investigation 50:14
7-162, 1984). Tera-2 cells have been isolated from lung metastases from men with primary fetal cancer of the testes.

In another preferred embodiment, the present invention provides a method for identifying agonistic antibodies to growth factor receptors, which comprises immunizing an animal with human bone marrow cells having a surface molecule containing a growth factor receptor, And / or collecting secondary lymphoid organs, isolating RNA from the organs,
Generating a library from RNA containing nucleic acid sequences encoding the scFv fragment of an antibody and cloning the nucleic acid sequence from the library into a phagemid vector to display the scFv fragment on the phagemid surface and to S displayed on phagemid for binding to surface molecules
The method is characterized by the step of identifying those that are agonist antibodies for the growth factor receptor by sieving the cFv fragments and screening for scFv fragments that bind to cell surface molecules in a functional assay.

"To collect" means to kill an animal,
Means to collect primary and / or secondary lymphoid organs such as blood, spleen and bone marrow. "Primary and secondary lymphoid organs" include, but are not limited to, organs such as blood, bone marrow, spleen and lymph nodes.

"Isolating RNA" means agents that inhibit ribonuclease activity, such as phenol and guanidine thiocyanate (Molecular Research Center, Incorporated, Cincinnati,
Lysate the cells in the presence of (OH) and centrifuge or other methods well known to practitioners in the art.
And to separate RNA from proteins.

In a further preferred embodiment, the stem / progenitor cells are unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal hepatocytes, Yolk sac cells, cells derived from murine AGM region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES) Cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells subjected to RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FD
CP-mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem cell line, P19 teratocarcinoma cells and NTer
a-2 is selected from the group consisting of multipotent embryonal carcinoma cells.

In another preferred embodiment, the present invention provides a method for identifying an agonist antibody to a growth factor receptor, which comprises immunizing an animal with human bone marrow cells having a surface molecule containing a growth factor receptor, Secondary lymphoid organs were collected, RNA was isolated from the organs, and antibody F
RNA comprising a nucleic acid sequence encoding an ab fragment
The Fab fragment was displayed on the phagemid surface by cloning the nucleic acid sequence from the library into a phagemid vector, and binding of the Fab fragment displayed on the phagemid to cell surface molecules of target cells. Sieving, dimerizing Fab fragments that bind to cell surface molecules, and screening the dimerized Fab fragments in a functional assay to identify those that are agonistic antibodies to the growth factor receptor. Characterize.

In a further preferred embodiment, the stem / progenitor cells are unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal hepatocytes, Yolk sac cells, cells derived from murine AGM region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES) Cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells subjected to RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FD
CP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem cell line, P19 teratocarcinoma cells and NTera
-2 selected from the group consisting of multipotent embryonal carcinoma cells.

The present invention also relates to a method for producing an agonist antibody against a growth factor receptor, which comprises immunizing an animal with a stem / progenitor cell having a surface molecule containing the growth factor receptor, wherein Generating multiple immune cells expressing antibodies or more, generating a library of multiple immune cells containing antibody-encoding nucleic acid sequences, and cloning the nucleic acid sequences from the library into a surface display vector By surface-displaying the antibody and screening the surface-displayed antibody with the target cells to identify an agonist antibody for the growth factor receptor cell and synthesizing the agonist antibody. And

The term "synthesizing an agonist antibody" means that an antibody is synthesized by introducing a nucleic acid encoding the agonist antibody into antibody cells, and preferably the extracellular medium so that the antibody can be separated. It means to secrete it. High-level expression of heterologous proteins is found in many different systems including E. coli, Saccharomyces cerevisiae, Pichia pastoris, mammalian cells, plants, and insect cells. Has been achieved. The genetically engineered antibody fragments are bacteria (Plaxan, A., Nature 347: 497-498, 1990),
Yeast (Carlsson, JR and Weissmann, IL, Mol.
Cell. Biol. 8: 2647-2650, 1988),
It is expressed in many of these organisms, including plants (Hyatt, A., Kafferky, R., Bowdish, K., Nature 342: 76-78, 1989) and mammalian cells. Incorporation of molecular beacons, such as HIS6, results in rapid and efficient purification by nickel-chelate chromatography from medium or cell lysates (Kloicher, M., Rafioni, S., Steele, RE, Bio.
chim. Biophys. Acta. 1250: 29-34, 199.
5, Berks, EA and Iverson, BL, Biotec
hnol. Prog. 11: 112-114, 1995). Those skilled in the art are familiar with these and other methods for synthesizing heterologous proteins and can readily adapt them to antibody synthesis.

In another preferred embodiment, the present invention is a method of producing an agonist antibody to a growth factor receptor, which comprises immunizing an animal with stem / progenitor cells having a surface molecule containing the growth factor receptor, 1 for surface molecules
Generating Multiple Immune Cells Expressing One or More Antibodies, Creating a Library from Multiple Immune Cells Containing Nucleic Acid Sequences Encoding the Antibody, and Transferring the Nucleic Acid Sequences from the Library to a Viral Display Vector A method comprising the steps of displaying an antibody on the surface of a virus by cloning, screening the antibody displayed on the surface of the virus for an antibody that is an agonist antibody to the growth factor receptor using target cells, and synthesizing the agonist antibody. Is characterized by.

In a further preferred embodiment, the viral display vector is a bacteriophage vector or a phagemid vector.

In another preferred embodiment, the present invention provides a method for producing an agonist antibody to a growth factor receptor, which comprises immunizing an animal with stem / progenitor cells having a surface molecule containing the growth factor receptor, 1 for surface molecules
Generating Multiple Immune Cells Expressing One or More Antibodies and Creating a Library from Multiple Immune Cells Containing Nucleic Acid Sequences Encoding a scFv Fragment of the Antibody and Transferring the Nucleic Acid Sequences from the Library to a Phagemid Upon cloning, the scFv fragments are displayed on the phagemid surface and the phagemid-displayed scFv fragments are screened for binding to target cell cell surface molecules and screened for functional assay binding of scFv fragments. Thereby identifying an agonist antibody for the growth factor receptor and synthesizing the agonist antibody.

[0100] In another preferred embodiment, the present invention provides a method for producing an agonist antibody against a growth factor receptor, which comprises immunizing an animal with stem / progenitor cells having a surface molecule containing the growth factor receptor, 1 for surface molecules
Producing a plurality of immune cells expressing one or more antibodies, making a library from the plurality of immune cells, comprising a nucleic acid sequence encoding a Fab fragment of the antibody,
By cloning nucleic acid sequences from the library into a phagemid vector, Fab fragments were displayed on the surface of the phagemid, and Fab fragments displayed on the phagemid were screened for binding to target cell cell surface molecules, The Fab fragment that binds is dimerized and dimerized F
A method comprising the step of identifying an agonist antibody for the growth factor receptor by screening the ab fragment with a functional assay and synthesizing the agonist antibody.

In a further preferred embodiment, in the method of identifying and producing agonistic antibodies to growth factor receptors, the library is a combinatorial library. Target cells are unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells,
Cells derived from the murine AGM region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES) cell lines, nerves Origin cells, cells involved in organ or tissue regeneration, RBC lysed human bone marrow cells, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FD
CP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem cell line, P19 teratocarcinoma cells and NTera
-2 selected from the group consisting of multipotent embryonal carcinoma cells. s
Screening for cFv fragments is done by bioassay for proliferation, differentiation or activation of target cells. Screening for scFv fragments is done by assays for alterations in transcription of downstream genes or phosphorylation of receptors. Screening for dimerized Fab fragments is performed by bioassay for target cell proliferation, differentiation or activation. Dimerization F
Screening for ab fragments is done by assays for alterations in transcription of downstream genes or phosphorylation of receptors.

The term "combinatorial library" means a collection of nucleic acid molecules that represent the immune repertoire of an organism, in which transposed heavy and light chain V genes are randomly combined to create a library of many artificial V genes. A combination has been created. This significantly increases the number of antibody molecules that can be screened. The combinatorial library is "Phage Display of Peptides and Proteins" edited by Brian K. Kay, Jill Winter and John McCafferty, Chapter 6: "Construction and Scre."
ening of Antibody Display Libraries ”, John McCafferty and Kevin S. Johnson, Academic Press, San Diego, California (199
It can be constructed as described in 6). The combinatorial library of the present invention represents a collection of nucleic acid sequences encoding an immune repertoire of an organism that comprises nucleic acid sequences encoding an antibody or fragment thereof directed to a surface molecule of a particular cell type used for immunization. Since artificial V gene combinations, including those directed against cell surface molecules, are produced, transposition of the heavy and light chain V genes serves merely to increase the number of antibody molecules directed against these surface molecules. . This systematic assembly of nucleic acids displays receptors on the cell surface of the cell type used for immunization and is linked to a signaling cascade leading to the promotion or inhibition of cell proliferation, differentiation, activation or survival. , For example, for the purpose of separating antibody molecules or fragments thereof that specifically bind to growth factor receptors.

A “proliferation or differentiation bioassay” is also intended to include cell survival and activation. For example, the above assays include measurements of Brdu uptake, tritiated thymidine uptake, changes in cellular enzyme levels such as mitochondrial dehydrogenase, visible colony formation, pH changes, Ca ⁺⁺ concentration changes and gene transcription changes. Is not limited to.

“Assaying for changes in transcription of downstream genes” means any gene that is regulated as part of a signal transduction cascade, such as a nuclear transcription factor such as c-myc, c-jun, NF. -Means assaying for changes in transcription of κβ and c-fos. For example, exposing starved (serum and growth factor deficient) target cells to candidate antibodies for a short period of time (eg, 2 hours) and removing R from the cells.
Separate NA. Changes in transcription can be detected by RT-using primers specific for one or more downstream genes.
It can be detected (quantified) by a method including PCR, and then RNA is hybridized to agarose gel electrophoresis or a silicon wafer to which a probe for a specific gene is bound. By using the above chip,
Many genes can be assayed simultaneously.

“Assay for receptor phosphorylation” means that immunoprecipitation of the receptor with an antibody is performed, and then γ-ATP is provided, and S for the receptor phosphorylation.
Examining phosphorylated products by DS-PAGE or high throughput screen.

The invention also features a method of identifying a growth factor receptor, comprising the steps of generating an agonist antibody to the receptor and using the agonist antibody to identify the receptor.

Once an agonist antibody is identified, it can be used to identify the receptor to which it is bound. A person of ordinary skill in the art would be useful in identifying the receptor, eg, immunoprecipitation and / or immunoaffinity purification (Springer, TA (1997),
“Isolation of Proteins Using Antibodies”, Curren
t Protocols in Immunology, (JE Corrigan, AM
You should be familiar with techniques such as Kluis Beek, DH Margulies, EM Shevach, W. Strova, Ed. 821-829, John Willie & Sons, New York).

In another preferred embodiment, the present invention provides a method for identifying a growth factor receptor, wherein the surface molecule is sensitized by immunizing an animal with stem / progenitor cells bearing the surface molecule containing the growth factor receptor. Generating a plurality of immune cells expressing one or more antibodies, generating a library from a plurality of immune cells containing nucleic acid sequences encoding a scFv fragment of the antibody, and surfaceing the nucleic acid sequences from the library. The scFv fragment is surface-displayed by cloning into a display vector, and the target cell is used to identify the agonist antibody for the growth factor receptor by screening the surface-display scFv fragment. Characterized by a method comprising the step of identifying the receptor. That.

In a further preferred embodiment, the surface display vector is a bacteriophage vector and the surface display is on the surface of the bacteriophage.

In another preferred embodiment, the present invention provides a method for identifying a growth factor receptor, comprising the step of immunizing an animal with a stem / progenitor cell bearing a surface molecule containing a growth factor receptor, wherein Generating a plurality of immune cells expressing one or more antibodies, creating a library from a plurality of immune cells containing nucleic acid sequences encoding a scFv fragment of the antibody, and transferring the nucleic acid sequences from the library to a phagemid. By cloning into a vector, the scFv fragment was displayed on the surface of the phagemid and s displayed on the phagemid.
The cFv fragment is screened for binding to the cell surface molecule of the target cell and the scFv fragment that binds to the cell surface molecule is screened in a functional assay to identify what is an agonist antibody for the growth factor receptor. Is used to identify the receptor.

In another preferred embodiment, the present invention provides a method for identifying a growth factor receptor, comprising the step of immunizing an animal with a stem / progenitor cell bearing a surface molecule containing the growth factor receptor, wherein Generating a plurality of immune cells expressing one or more antibodies, generating a library from a plurality of immune cells containing nucleic acid sequences encoding a scFv fragment of the antibody, and surfaceing the nucleic acid sequences from the library. Surface-displaying the scFv fragment by cloning into a display vector, sieving the surface-displayed scFv fragment for binding to target cell cell surface molecules,
A method comprising the step of identifying an agonist antibody for the growth factor receptor by screening the scFv fragment that binds to a cell surface molecule in a functional assay, and identifying the receptor using the agonist antibody. .

In another preferred embodiment, the present invention provides a method for identifying a growth factor receptor for a surface molecule by immunizing an animal with a stem / progenitor cell bearing a surface molecule containing the growth factor receptor. Producing a plurality of immune cells expressing one or more antibodies, creating a library from a plurality of immune cells, comprising a nucleic acid sequence encoding a Fab fragment of the antibody, and transferring the nucleic acid sequences from the library to the cells. By cloning into a surface display vector, Fab fragments are surface displayed, the surface displayed Fab fragments are screened for binding to target cell cell surface molecules, and the Fab fragments that bind cell surface molecules are dimerized. , By screening dimerized Fab fragments in a functional assay. , To identify those which are agonist antibodies against growth factor receptors, and wherein the method includes the step of identifying the receptor with an agonist antibody.

In a further preferred embodiment, the surface display vector is a bacteriophage vector and the surface display is at the bacteriophage surface.

In another preferred embodiment, the present invention provides a method for identifying a growth factor receptor, comprising the step of immunizing an animal with a stem / progenitor cell bearing a surface molecule containing a growth factor receptor, wherein Generating a plurality of immune cells expressing one or more antibodies, creating a library from a plurality of immune cells containing nucleic acid sequences encoding a Fab fragment of the antibody, and transferring the nucleic acid sequences from the library to a phagemid. The Fab fragment is displayed on the surface of the phagemid by cloning into a vector, the Fab fragment displayed on the phagemid is screened for binding to the cell surface molecule of the target cell, and the Fab fragment bound to the cell surface molecule is dimerized. Screen the functionalized dimerized Fab fragment By bridging, and identify those which are agonists antibodies against growth factor receptors, and wherein the method includes the step of identifying the receptor with an agonist antibody.

In a further preferred embodiment, the growth factor receptor is a hematopoietic growth factor receptor. "Hematopoietic growth factor receptor" means proliferation / differentiation of stem / progenitor or mature blood cells,
It includes receptors expressed on cells of hematopoietic origin involved in cell survival or functional activation.

Furthermore, the present invention is a method for identifying a growth factor, which comprises producing an agonist antibody against a growth factor receptor, identifying the receptor using this agonist antibody, and using this receptor to grow factor. Is characterized by a method comprising the step of identifying

There are several ways in which natural growth factors can be identified by using growth factor receptors. For example, it is possible to transform cells with the cloned receptor under an inducible promoter for expression, after which the cDNA pool is screened for efficacy in the bioassay. For example, the use of a cytosensor microphysiometer system (Molecular Devices, Sunnyvale, Calif.), A biosensor that monitors receptor transduction responses in the absence of prior knowledge of signal transduction pathways. Alternatively, it is possible to set up a well-identified bioassay by producing chimeric receptors,
For example, there is an increase in specific reporter gene expression. For example, the extracellular domain of the novel receptor can be fused to the intracellular domain of a well characterized receptor, particularly one in which downstream signaling events have been identified. Then the cDNA
Pools can be screened in bioassays for reporter gene expression. One of ordinary skill in the art would be familiar with these and other useful techniques.

In another preferred embodiment, the present invention provides a method for identifying a growth factor, wherein one is directed against the surface molecule by immunizing the animal with stem / progenitor cells bearing the surface molecule containing the growth factor receptor. Generating a plurality of immune cells expressing an antibody or more, generating a library from a plurality of immune cells containing a nucleic acid sequence encoding the scFv fragment of the antibody, and displaying the nucleic acid sequences from the library on a surface display vector. The scFv fragment was surface-displayed by cloning into, and the surface-displayed scFv fragment was screened to identify one that is an agonist antibody for the growth factor receptor, and this agonist antibody is used to identify the receptor. , Including the step of identifying growth factors using this receptor The features.

In a further preferred embodiment the surface display vector is a bacteriophage vector and the surface display is on the bacteriophage surface.

In another preferred embodiment, the present invention provides a method for identifying growth factors, wherein one surface molecule is identified by immunizing an animal with a stem / progenitor cell bearing a surface molecule containing a growth factor receptor. Alternatively, a plurality of immune cells expressing more or more antibodies are generated, a library is prepared from the plurality of immune cells containing a nucleic acid sequence encoding the scFv fragment of the antibody, and the nucleic acid sequences from the library are transferred to a phagemid vector. By cloning,
The scFv fragment was displayed on the surface of the phagemid, the scFv fragment displayed on the phagemid was screened for binding to cell surface molecules of target cells, and the scFv fragments that bind to the cell surface molecule were screened by a functional assay to detect growth factor acceptance. A method comprising identifying an agonist antibody for the body, using the agonist antibody to identify a receptor, and using the receptor to identify a growth factor.

In another preferred embodiment, the present invention is a method for identifying growth factors, wherein one surface molecule is identified by immunizing an animal with a stem / progenitor cell bearing a surface molecule containing a growth factor receptor. Generating a plurality of immune cells expressing an antibody or more, generating a library from a plurality of immune cells containing a nucleic acid sequence encoding a Fab fragment of the antibody, and displaying the nucleic acid sequences from the library on a surface display vector. Cloning the Fab fragments to a surface display, screening the surface displayed Fab fragments for binding to target cell cell surface molecules, dimerizing the Fab fragments that bind cell surface molecules, and dimerizing By screening the somatized Fab fragment with a functional assay, the growth factor To identify those which are agonists antibody to the receptor, the receptor were identified using agonist antibody, and wherein the method includes the step of identifying the growth factors with a receptor.

In a further preferred embodiment, the surface display vector is a bacteriophage vector and the surface display is on the bacteriophage surface.

In another preferred embodiment, the present invention provides a method for identifying growth factors, wherein one surface molecule is identified by immunizing an animal with a stem / progenitor cell bearing a surface molecule containing a growth factor receptor. Generating a plurality of immune cells expressing an antibody or more, generating a library from a plurality of immune cells containing a nucleic acid sequence encoding a Fab fragment of the antibody, and transferring the nucleic acid sequence from the library to a phagemid vector By cloning, F
The ab fragment is displayed on the phagemid surface, the Fab fragment displayed on the phagemid is screened for binding to target cell cell surface molecules, and the Fab fragment that binds to the cell surface molecule is dimerized and dimerized Fab fragments. By a functional assay to identify those that are agonistic antibodies for the growth factor receptor, identify the receptor using the agonist antibody, and identify the growth factor using the receptor. And

In a further preferred embodiment, the growth factor is a hematopoietic growth factor, wherein the growth factor is of the following cell types: unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow. Cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, murine AG
Cells derived from M region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES)
Cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells that have undergone RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FDCP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem Affects proliferation, differentiation, activation or survival of cell lines, P19 teratocarcinoma cells, and NTera-2 multipotent embryonal carcinoma cells.

The present invention also provides a method for screening an agonist antibody, which comprises growing a cell expressing an antibody fragment in the presence of a target cell expressing a receptor to which the antibody is directed, and screening the antibody fragment. , A method of identifying an agonist antibody.

“Cells that express antibody fragments” include prokaryotic or eukaryotic cells which carry a cloned copy of the antibody fragment linked to a host cell-specific promoter and signal sequence, and which span membrane 2. Is it possible to display cell surface antibodies, which may contain a merization domain (Lemon, MA, Troutline, HR, Adams, PD, Brunger, AT, Engelmann, DM, Nat.
Struct. Biol. 1: 157-163, 1994), or monomeric and dimeric antibody fragments.

By "in the presence of target cells" is meant co-culturing cells expressing the antibody or fragment and cells expressing the receptor to which the antibody binds. Screening includes other bioassays or biochemical assays to determine whether the antibody fragment stimulates proliferation, differentiation, activation or survival of target cells.

In a preferred embodiment, the cells that express the antibody fragment are bacterial cells, mammalian cells or yeast. By "bacterial cell" is meant any prokaryotic cell, usually a bacterial cell that produces all genotypes of E. coli or cell surface display molecules. "Mammalian cells" are all cells of mammalian origin.
It is usually clonal with in vitro growth potential.

“Yeast” refers to a yeast cell, typically Saccharomyces, which allows the expression of a plasmid or integrated DNA that has been genetically engineered to produce surface displayed or secreted antibody molecules. Includes Saccharomyces cerevisiae, Schitzosacchamyces pombe, or Pichia pastoris.

In another aspect, the invention features an agonist antibody to a growth factor receptor produced by immunizing an animal with stem / progenitor cells.

In a preferred embodiment, the stem / progenitor cells are
Unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, murine AG
Cells derived from M region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES)
Cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells that have undergone RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FDCP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem Selected from the group consisting of cell lines, P19 teratocarcinoma cells and NTera-2 multipotent embryonal carcinoma cells.

In another preferred embodiment, the invention features an agonist antibody to the growth factor receptor produced by the method of the invention.

The invention also features a combinatorial library made from immune cells generated by immunizing an animal with stem / progenitor cells. In another aspect, the invention features a combinatorial library encoding antibody molecules or fragments thereof that include nucleic acid sequences from immune cells of an animal immunized with stem / progenitor cells. In yet another aspect, the invention features a combinatorial antibody fragment library directed to surface molecules on stem / progenitor cells. In yet another aspect,
The present invention provides one or more antibodies to a surface molecule or antibodies thereof by immunizing an animal with stem / progenitor cells having a surface molecule containing receptors involved in cell proliferation, differentiation, survival or activation. Generating multiple immune cells expressing the fragment, creating a library from multiple immune cells containing nucleic acid sequences encoding an antibody or antibody fragment thereof, and cloning the nucleic acid sequence from the library into a surface display vector By doing so, it is characterized by a combinatorial library created by surface-displaying the antibodies. In a preferred embodiment, the receptor is a growth factor receptor.

In yet another embodiment, the present invention provides a method for producing a combinatorial antibody library encoding an antibody or a fragment thereof against a receptor involved in cell proliferation, differentiation, survival or activation, which comprises the receptor. Immunizing an animal with a stem / progenitor cell having a surface molecule comprising a plurality of immune cells expressing one or more antibodies or antibody fragments directed to the surface molecule, the antibody fragment being derived from the plurality of immune cells. To obtain a nucleic acid sequence encoding the variable region and constant region of the antibody fragment, and randomly combine the nucleic acid sequences encoding the variable region of the antibody fragment to produce a combinatorial library of nucleic acid sequences encoding the antibody fragment. By cloning the antibody into a surface display vector. It features a method comprising the step of displaying a segment. In a preferred embodiment, the receptor is a growth factor receptor.

"Random combination" means to create many artificial variable gene combinations by combining the nucleic acid sequences encoding the transposed heavy and light chain variable genes and using, for example, the PCR overlap reaction. Means

In a preferred embodiment, the stem / progenitor cells are
Unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, murine AG
Cells derived from M region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine embryonic embryonic cells, human embryonic stem (ES)
Cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells that have undergone RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FDCP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem Selected from the group consisting of cell lines, P19 teratocarcinoma cells and NTera-2 multipotent embryonal carcinoma cells. The animal is a rabbit or a chicken. The antibody or fragment thereof is a scFv fragment. The antibody or fragment thereof is a Fab fragment. The antibody or fragment thereof encoded by the combinatorial library is surface-displayed on the phagemid.
In addition, the method of manufacture comprises the step of screening serum collected from the immunized animal for binding to stem / progenitor cells prior to obtaining the nucleic acid sequence encoding the antibody fragment.

The invention also features various equivalent embodiments directed to the identification, synthesis and use of antibodies that are inhibitory to cell proliferation, differentiation, activation or survival. These aspects are similar to those for agonist antibodies and one of ordinary skill in the art should be able to adapt them for application to inhibitory antibodies.

Furthermore, the present invention provides a method for identifying an inhibitory antibody involved in cell proliferation, differentiation or activation, which comprises a stem / progenitor cell having a receptor involved in cell proliferation, differentiation or activation. Immunizing an animal to generate a plurality of immune cells expressing one or more antibodies to a surface molecule, creating a library from the plurality of immune cells containing nucleic acid sequences encoding the antibodies, Inhibition of antibodies by surface-displaying the antibody by cloning the nucleic acid sequence from the library into a surface-display vector and screening the surface-displayed antibody for those that inhibit target cell proliferation, differentiation or activation. A method comprising the step of identifying an antibody.

The term “inhibitory antibody” refers to cell growth, differentiation,
Whole antibodies, including Fab and scFv fragments, which are linked to signal transduction cascades involved in activation, inhibition or survival and which bind to cell surface receptors that inhibit proliferation, differentiation, activation or survival of a single cell, or the like. Includes the fragment. The inhibitory antibody is
It may be inhibited by blocking the action of receptors that promote cell proliferation, differentiation, activation or survival or by mimicking inhibitory molecules that bind to receptors that send negative growth signals.

By "proliferation" is meant active division and progression through various stages of the cell cycle as detected by altered protein synthesis rates, chromosome replication, cell size or cell number.

By "differentiation" is meant a change in cell morphology, behavior or function, or change in gene expression that results in the production of different types of cells with specialized functions as a result of exposure to exogenous factors. . Differentiation, as the term is used in the art, refers to the process by which cells mature and become less pluripotent.

"Activation" refers to the process by which a cell exits G ₀ and enters G ₁ , but does not synthesize DNA,
It does not divide until it receives the second signal. Activation is associated with the expression of a specific set of activating genes and activating antigens. By "survival" is meant that the cells have not undergone apoptosis or destined cell death or necrosis.

Receptors involved in proliferation, differentiation, activation or survival may represent the same receptors that the inhibitory antibody binds to when it acts as an antagonist or blocking antibody. The receptor may be different from the growth factor receptor to which the agonist antibody binds if the inhibitory antibody mimics the inhibitory factor.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to a surface molecule, the plurality of immune cells comprising a nucleic acid sequence encoding the antibody By creating a library and cloning the nucleic acid sequences from the library into a viral display vector, antibodies are displayed on the viral surface and those that inhibit target cell proliferation, differentiation or activation are displayed on the viral surface. A method comprising the step of identifying an inhibitory antibody by screening the antibody in question.

In a further preferred embodiment, the viral vector is selected from the group consisting of bacteriophage and phagemid vectors.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to the surface molecule, the nucleic acid sequence encoding a scFv fragment of the antibody,
By creating a library from multiple immune cells and cloning the nucleic acid sequence from the library into a phagemid vector, the scFv fragment was displayed on the phagemid surface, and the scFv fragment displayed on the phagemid surface was propagated to target cells. ,
A method comprising identifying inhibitory antibodies by screening for those that inhibit differentiation or activation.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to the surface molecule, the nucleic acid sequence encoding a scFv fragment of the antibody,
By creating a library from multiple immune cells and cloning the nucleic acid sequences from the library into a surface display vector, the scFv fragments are surface displayed and the surface displayed scFv fragments are expanded, differentiated or targeted to target cells. A method comprising identifying inhibitory antibodies by screening for those that inhibit activation.

In a further preferred embodiment, the surface display vector is a bacteriophage vector and the surface display is on the surface of the bacteriophage.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to the surface molecule, the nucleic acid sequence encoding a scFv fragment of the antibody,
By creating a library from multiple immune cells and cloning the nucleic acid sequence from the library into a phagemid vector, the scFv fragment was displayed on the phagemid surface and the scFv fragment displayed on the phagemid was displayed on the cell surface of the target cell. A method comprising identifying inhibitory antibodies by sieving for binding to molecules and screening functionally assayed scFv fragments that bind to cell surface molecules for inhibitors of growth, differentiation or activation of target cells. Characterize. Sieving and screening are done as previously described.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to the surface molecule, the nucleic acid sequence encoding a scFv fragment of the antibody,
By creating a library from multiple immune cells and cloning the nucleic acid sequences from the library into a surface display vector, the scFv fragments are surface displayed and the surface displayed scFv fragments are targeted to the cell surface molecules of the target cells. By screening for scFv fragments that bind to cell surface molecules for those that inhibit growth, differentiation or activation of target cells in a functional assay.
A method that includes the step of identifying an inhibitory antibody.

In a further preferred embodiment, the surface display vector is a bacteriophage vector and the surface display is on the surface of the bacteriophage.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells bearing a plurality of immune cells expressing one or more antibodies to a surface molecule, the plurality of immunizing cells comprising a nucleic acid sequence encoding a Fab fragment of the antibody. By creating a library from cells and cloning the nucleic acid sequence from the library into a phagemid vector, the Fab fragment is displayed on the surface of the phagemid, and the Fab fragment displayed on the phagemid is displayed on the cell surface molecule of the target cell. Fab fragments that bind to cell surface molecules And an inhibitory antibody by screening in a functional assay for both monomer and dimerized Fab fragments that bind to cell surface molecules and which inhibit growth, differentiation or activation of target cells. Is characterized by a method comprising the step of identifying

Sieving and screening are sc
The same is done as for the Fv fragment. By "dimerizing a Fab fragment" is meant that a representative portion of a Fab fragment that binds to a cell surface molecule is dimerized. The rest of the Fab fragment remains monomeric. Both monomers and dimers are tested in functional assays.

By "screening both monomeric and dimerized Fab fragments in a functional assay" is meant that the monomer and dimer are screened independently (see discussion for scFv fragments). reference). In addition, Fab fragments (monomers and dimers) can be surface-displayed or soluble molecules.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells bearing a plurality of immune cells expressing one or more antibodies to a surface molecule, the plurality of immunizing cells comprising a nucleic acid sequence encoding a Fab fragment of the antibody. Fab fragments were surface-displayed by creating a library from cells and cloning the nucleic acid sequences from the library into a surface display vector for binding of the surface-displayed Fab fragments to target cell cell surface molecules. After screening, the Fab fragment that binds to the cell surface molecule is dimerized and Identifying inhibitory antibodies by screening in a functional assay for both monomeric and dimerized Fab fragments that bind to cell surface molecules of the molecule for inhibitors of growth, differentiation or activation of target cells Is characterized by a method including.

In a further preferred embodiment, the surface display vector is a bacteriophage vector,
The surface display is on the surface of the bacteriophage.

In a further preferred embodiment of the method of identifying inhibitory antibodies, the animal is a rabbit or chicken. stem/
Progenitor cells are derived from unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, and murine AGM regions. Cells, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine multipotent embryonic cells, human embryonic stem (ES) cell lines, cells of neural origin, organs or Cells involved in tissue regeneration, human bone marrow cells subjected to RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells,
FDCP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem cell line, P19 teratocarcinoma cells and NTe
It is selected from the group consisting of ra-2 pluripotent embryonal carcinoma cells.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunize an animal with stem / progenitor cells containing it, harvest primary or secondary lymphoid organs from the animal, isolate RNA from the organ, and create a library from RNA containing nucleic acid sequences encoding scFv fragments of antibodies And clone the nucleic acid sequences from the library into a phagemid vector to produce scF
v fragments are displayed on the surface of phagemids, Fab fragments displayed on the phagemids are screened for binding to target cell cell surface molecules, and scFv fragments that bind to cell surface molecules inhibit target cell proliferation, differentiation or activation. The method comprises the step of identifying an inhibitory antibody by screening those that do by a functional assay.

In a further preferred embodiment, the stem / progenitor cells are unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal hepatocytes, Yolk sac cells, cells derived from murine AGM region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES) Cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells subjected to RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FD
CP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem cell line, P19 teratocarcinoma cells and NTera
-2 selected from the group consisting of multipotent embryonal carcinoma cells.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunize an animal with stem / progenitor cells containing it, collect primary or secondary lymphoid organs from the animal, isolate RNA from the organ, and create a library from RNA containing nucleic acid sequences encoding Fab fragments of antibodies Then, by cloning the nucleic acid sequence from the library into a phagemid vector, the Gab fragment was displayed on the surface of the phagemid, and the Fab fragment displayed on the phagemid was screened for binding to target cell cell surface molecules. Fab fragments that bind cell surface molecules are dimerized and the Both monomeric and dimeric of Fab fragments that bind to surface molecules of the target cell proliferation,
A method comprising identifying inhibitory antibodies by screening in a functional assay for those that inhibit differentiation or activation.

In a further preferred embodiment, the stem / progenitor cells are unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal hepatocytes, Yolk sac cells, cells derived from murine AGM region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES) Cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells subjected to RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FD
CP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem cell line, P19 teratocarcinoma cells and NTera
-2 selected from the group consisting of multipotent embryonal carcinoma cells.

The present invention also relates to a method for producing an inhibitory antibody relating to cell proliferation, differentiation or activation, which comprises a stem / progenitor cell having a surface molecule containing a receptor involved in cell proliferation, differentiation or activation. By immunizing the animal with
Generating a plurality of immune cells that express one or more antibodies to a surface molecule, creating a library from a plurality of immune cells containing antibody-encoding nucleic acid sequences, and surfaceing the nucleic acid sequences from the library The antibody is surface-displayed by cloning it into a display vector, and the inhibitory antibody is identified by screening the surface-displayed antibody for those that inhibit the proliferation, differentiation or activation of target cells, and the inhibitory antibody is identified. A method comprising the step of synthesizing Synthesis of the inhibitory antibody is performed as described above for the agonist antibody.

In another preferred embodiment, the present invention is a method for producing an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to a surface molecule, the plurality of immune cells comprising a nucleic acid sequence encoding the antibody By creating a library and cloning the nucleic acid sequence from the library into a virus display vector, the antibody is displayed on the surface of the virus and the antibody displayed on the surface of the virus is used for proliferation, differentiation or activation of target cells. Includes steps to identify inhibitory antibodies and synthesize inhibitory antibodies by screening for inhibitors Law and said.

In a further preferred embodiment, the viral vector is a bacteriophage vector or a phagemid vector.

[0165] In another preferred embodiment, the present invention provides a method for producing an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to the surface molecule, the nucleic acid sequence encoding a scFv fragment of the antibody,
By creating a library from multiple immune cells and cloning the nucleic acid sequence from the library into a phagemid, the scFv fragment is displayed on the phagemid surface, and the scFv fragment displayed on the phagemid is a cell surface molecule of the target cell. To identify inhibitory antibodies and synthesize inhibitory antibodies by screening for scFv fragments that bind to cell surface molecules by a functional assay for those that inhibit the proliferation, differentiation or activation of target cells And a method including a step of performing.

[0166] In another preferred embodiment, the present invention provides a method for producing an inhibitory antibody for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells expressing one or more antibodies to a surface molecule, the nucleic acid sequence encoding a Fab fragment of the antibody. The Fab fragment was displayed on the surface of the phagemid by preparing a library from immune cells and cloning the nucleic acid sequence from the library into a phagemid vector. Fab flag that screens for binding to and binds to cell surface molecules The cement was dimerization of target cell proliferation by screening functional assays both monomeric and dimeric of Fab fragments that bind to a cell surface molecule for those that inhibit differentiation or activation,
A method comprising identifying an inhibitory antibody and synthesizing the inhibitory antibody.

In a further preferred embodiment of the claimed method of identifying inhibitory antibodies, the library is a combinatorial library. Target cells are derived from unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, and murine AGM regions. Cells, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines,
Murine pluripotent embryonic cells, human embryonic stem (ES) cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells undergoing RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ Cells, FDCP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem cell line,
P19 teratocarcinoma cells, and NTera-2 multipotent embryonal carcinoma cells. Screening of scFv fragments by functional assay is by bioassay for inhibition of target cell proliferation, differentiation or activation. Functional assay screening of dimerized Fab fragments is by bioassay for inhibition of target cell proliferation, differentiation or activation.

In another embodiment, the present invention provides a method for identifying a receptor involved in cell proliferation, differentiation or activation, which comprises producing an inhibitory antibody against the receptor and using the inhibitory antibody. A method that includes the step of identifying a receptor. Identification of the receptor using an inhibitory antibody against the receptor is performed according to the procedure described above for the agonist antibody.

In another preferred embodiment, the present invention is a method for identifying a receptor involved in cell proliferation, differentiation, survival or activation, which comprises a receptor involved in cell proliferation, differentiation or activation. Immunizing an animal with stem / progenitor cells bearing surface molecules to produce a plurality of immune cells expressing one or more antibodies to the surface molecules,
Generating a library from a plurality of immune cells containing a nucleic acid sequence encoding a scFv fragment of an antibody and cloning the nucleic acid sequence from the library into a surface display vector to surface display the scFv fragment and target cells. Surface-displayed sc for those that inhibit the growth, differentiation or activation of
A method comprising the step of identifying an inhibitory antibody by screening the Fv fragment and using the inhibitory antibody to identify a receptor.

In a further preferred embodiment, the surface display vector is a bacteriophage vector,
The surface display is on the surface of the bacteriophage.

In another preferred embodiment, the present invention is a method for identifying a receptor involved in cell proliferation, differentiation or activation, which comprises a surface molecule comprising a receptor involved in cell proliferation, differentiation or activation. Immunizing an animal with stem / progenitor cells carrying a plurality of immune cells expressing one or more antibodies to the surface molecule, the plurality of immune cells comprising a nucleic acid sequence encoding a scFv fragment of the antibody. By creating a library from immune cells and cloning the nucleic acid sequence from the library into a phagemid vector, the scFv fragment is displayed on the phagemid surface and the scFv fragment displayed on the phagemid is targeted to the cell surface molecule of the target cell. The binding of scFv that binds to the above cell surface molecules is screened. Characterized by the step of identifying an inhibitory antibody by screening the menthol with a functional assay for one that inhibits the proliferation, differentiation or activation of target cells, and identifying the receptor using the inhibitory antibody. To do.

In another preferred embodiment, the present invention is a method for identifying a receptor involved in cell proliferation, differentiation or activation, which comprises a surface molecule comprising a receptor involved in cell proliferation, differentiation or activation. Immunizing an animal with stem / progenitor cells carrying a plurality of immune cells that produce a plurality of immune cells that express one or more antibodies to the surface molecule and that comprise a plurality of nucleic acid sequences encoding a Fab fragment of the antibody. By generating a library from immune cells and cloning the nucleic acid sequences from the library into a surface display vector, Fab fragments are displayed on the surface of the cell, which binds to the cell surface molecule of the target cell. Screened Fab fragments and dimerize Fab fragments that bind to cell surface molecules , Monomeric and dimeric of Fab for those that inhibit target cell proliferation, differentiation or activation
A method comprising identifying inhibitory antibodies by screening both of the fragments in a functional assay and using the inhibitory antibodies to identify the receptor.

In a further preferred embodiment, the surface display vector is a bacteriophage vector,
The surface display is on the surface of the bacteriophage.

In another preferred embodiment, the present invention is a method of identifying a receptor for cell growth, differentiation or activation, the method comprising a surface molecule comprising a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells produces a plurality of immune cells that express one or more antibodies to the surface molecule, resulting in antibody F
The Fab fragment was displayed on the surface of the phagemid by generating a library from a plurality of immune cells containing a nucleic acid sequence encoding the ab fragment, and cloning the nucleic acid sequence from the library into a phagemid vector. The displayed Fab fragments are screened for binding to cell surface molecules in target cells, and the Fab fragments that bind to the cell surface molecules are dimerized to inhibit proliferation, differentiation or activation of target cells in a functional assay. Identifying inhibitory antibodies by screening both monomeric and dimerized Fab fragments for
A method comprising the step of identifying a receptor with an inhibitory antibody.

[0175] In a further preferred embodiment of the method of identifying a receptor involved in cell proliferation, differentiation or activation, the receptor is a hematopoietic receptor. Furthermore, the present invention provides for the proliferation of cells,
A method of identifying an inhibitory factor for differentiation or activation, which comprises producing an inhibitory antibody against a receptor involved in cell proliferation, differentiation or activation, and identifying the receptor using the inhibitory antibody, A method comprising the step of identifying an inhibitory factor with the receptor. This receptor is used to identify inhibitory factors, as described above for identifying growth factors.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory factor for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to the surface molecule, the nucleic acid sequence encoding a scFv fragment of the antibody,
By creating a library from multiple immune cells and cloning the nucleic acid sequences from the library into a surface display vector, scFv fragments were surface displayed on the cell surface and surface displayed s.
The cFv fragment is screened for one that inhibits growth, differentiation or activation of target cells to identify inhibitory antibodies, the inhibitory antibodies are used to identify receptors, and the receptors are used to identify inhibitory factors. A method that includes the step of identifying.

In a further preferred embodiment, the surface display vector is a bacteriophage vector,
The surface display is on the surface of the bacteriophage.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory factor for cell growth, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell growth, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to the surface molecule, the nucleic acid sequence encoding a scFv fragment of the antibody,
By creating a library from multiple immune cells and cloning the nucleic acid sequence from the library into a phagemid vector, the scFv fragment was displayed on the surface of the phagemid, and the scFv fragment displayed on the phagemid was used to target cells in target cells. Screening for binding to surface molecules and screening functionally assayed scFv fragments that bind to cell surface molecules for those that inhibit target cell proliferation, differentiation or activation identify inhibitory antibodies and their inhibitory properties. A method comprising identifying a receptor with an antibody and an inhibitory factor with the receptor.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory agent, which comprises immunizing an animal with stem / progenitor cells having a surface molecule containing a receptor involved in cell proliferation, differentiation or activation. Generating a plurality of immune cells expressing one or more antibodies to the surface molecule, creating a library from the plurality of immune cells, comprising a nucleic acid sequence encoding a Fab fragment of the antibody, Fab fragments were surface-displayed by cloning the nucleic acid sequences from the library into a surface-display vector, and the surface-displayed Fab was screened.
Fa fragment that screens the b fragment for binding to cell surface molecules in target cells and binds to cell surface molecules
b fragment was dimerized and both monomeric and dimerized Fab fragments were tested for functional cell proliferation in functional assays,
A method comprising the steps of identifying an inhibitory antibody by screening for one that inhibits differentiation or activation, identifying the receptor using the inhibitory antibody, and identifying the inhibitory factor using the receptor Is characterized by.

In a further preferred embodiment, the surface display vector is a bacteriophage vector and the surface display is on the surface of the bacteriophage.

In another preferred embodiment, the present invention provides a method for identifying an inhibitory factor for cell proliferation, differentiation or activation, which comprises a surface molecule containing a receptor involved in cell proliferation, differentiation or activation. Immunizing an animal with stem / progenitor cells having a plurality of immune cells that express one or more antibodies to the surface molecule, and comprising a nucleic acid sequence encoding a Fab fragment of the antibody. The Fab fragment was displayed on the surface of the phagemid, and the Fab fragment displayed on the phagemid was cloned into a phagemid vector by preparing a library from immune cells of the target cell. F that binds to cell surface molecules
The inhibitory antibodies were identified by dimerizing the ab fragment and screening both monomeric and dimerized Fab fragments in a functional assay for those that inhibit target cell proliferation, differentiation or activation, A method comprising identifying a receptor using the inhibitory antibody and identifying an inhibitory factor using the receptor.

In a further preferred embodiment of the method of identifying an inhibitory factor, the inhibitory factor is a hematopoietic factor. In another aspect, the invention provides a method for screening inhibitory antibodies for cell proliferation, differentiation, activation or survival, which expresses an antibody fragment in the presence of target cells that express the antibody-directed receptor. The method comprises the step of identifying an inhibitory antibody by growing the cells that are to be grown and screening the antibody fragments for those that inhibit the proliferation, differentiation, activation or survival of the target cells.

In a further preferred embodiment, the cells expressing the antibody fragment are selected from the group consisting of bacterial cells, mammalian cells and yeast. Further, the present invention is a trunk /
It is characterized by inhibitory antibodies against receptors involved in proliferation, differentiation, activation or survival produced by immunizing animals with progenitor cells.

In a preferred embodiment, the stem / progenitor cells are
Unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, murine AG
Cells derived from M region, human or murine embryonal carcinoma cells or lines, human or mouse multipotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES)
Cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells undergoing RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FDCP mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem Selected from the group consisting of cell lines, P19 teratocarcinoma cells, and NTera-2 multipotent embryonal carcinoma cells.

In a further preferred embodiment, the present invention provides
It is characterized by an inhibitory antibody produced by any of the methods for producing an inhibitory antibody against a receptor involved in proliferation, differentiation, activation or survival. Further, the present invention is a method of treating a patient having a disease or disorder characterized by a deficiency of a cell population, comprising immunizing an animal with stem / progenitor cells that stimulate proliferation or differentiation of cells in the population. A method comprising administering to a patient a therapeutically effective amount of an agonist antibody produced by.

“Disease or disorder characterized by a deficiency of a cell population” is, for example, associated with a disease, disorder or inhibition of hematopoiesis in which the number of cells of a given line (s) present in a patient is below normal. Used in treatment. For example,
Patients undergoing chemotherapy show lower than normal levels of neutrophils and platelets. Anemia is an example of when red blood cell levels are below normal.

“Administering” means supplying antibody.

By “therapeutically effective amount” is meant an amount that at least partially reduces or eliminates some of the symptoms associated with a disease or condition. In a preferred embodiment, the cell population is a hematopoietic cell population.

In another preferred embodiment, the present invention is a method of treating a patient having a disease or disorder characterized by a deficiency in a cell population, comprising stem / progenitor cells that stimulate proliferation or differentiation of cells in the population. A method comprising ex vivo contacting a patient's cells with an agonist antibody produced by immunizing an animal.

“Ex vivo” means in vitro.
The average technician in the art can remove cells from a patient,
One of skill in the art should be familiar with maintaining cells outside the patient's body and reintroducing the cells into the patient. In a preferred embodiment, the cell population is a hematopoietic cell population.

In another embodiment, the present invention provides a method of treating a patient having a disease or disorder characterized by an increase in a cell population, comprising the step of treating an animal with stem / progenitor cells that inhibit the proliferation or differentiation of the cell population. A method comprising administering to a patient a therapeutically effective amount of an inhibitory antibody produced by immunization.

By “disease or disorder characterized by an increase in a certain cell population” is meant a disease or disorder in which the number of cells of a given lineage, lineage (s), is greater than normal in the patient. For example, chronic myelogenous leukemia is characterized by myeloproliferation due to the presence of chromosomal translocations in hematopoietic stem cells.
Thrombocytopenia is a disease characterized by an increased number of megakaryocytes. In a preferred embodiment, the cell population is a hematopoietic cell population.

In another embodiment, the invention is a method of treating a patient having a disease or disorder characterized by cells exhibiting abnormal proliferation, which comprises inhibiting the proliferation or differentiation of normal cells,
A method comprising administering to a patient a fixed amount of an inhibitory antibody produced by immunizing an animal with stem / progenitor cells and killing cells exhibiting abnormal growth. By "cells exhibiting abnormal growth" is meant cells that do not exhibit growth control, such as cancer cells.

By "killing" is meant exposing cells exhibiting abnormal growth to factors that induce cell death, such as radiation or chemotherapeutic agents. One of ordinary skill in the art would be familiar with administering the above factors to a patient. Killing can be done in vivo or ex vivo. In a preferred embodiment, the cells are hematopoietic cells.

In another embodiment, the present invention is a method of treating a patient having a disease or disorder characterized by cells exhibiting abnormal proliferation, wherein an antibody binds to cells exhibiting abnormal proliferation and causes them to die. As described above, comprising administering to a patient a fixed amount of an antibody that specifically binds to a cell, is linked to a toxin or a radiolabel, and is produced by immunizing an animal with stem / progenitor cells. To do.

The antibodies of the invention can be conjugated to toxin proteins to form fused immunotoxins that can be used in the treatment of malignancy or other medical conditions. Toxic proteins that can be linked to the antibody binding domain include diphtheria toxin, Pseudomonas exotoxin A, among others (Hartler, AA, Frankel, AE, J.Cl.
in. Oncol. 7: 1932-42, 1989). One of ordinary skill in the art should be familiar with the construction of the above fusion immunotoxins.

The present invention also provides a method for identifying a cell, which comprises:
A method comprising contacting cells with an antibody specific for a cell type produced by immunizing an animal with stem / progenitor cells under conditions where the antibody specifically binds to the cells and detecting antibody binding And

By "specifically binds" is meant that the binding to an antigenic determinant is specific to a particular cell type. In a preferred embodiment, the cells are hematopoietic cells and the antibody is linked to a radiolabel.

Those skilled in the art should be familiar with the use of antibodies as contrast agents (Britz, HB, Tyler, A., Bjorn, MJ, Leslie, T.,
Weiden. PL, Clin. Nucl. Med. 22: 615-62.
0, 1997 and Li Destri, G., Greco, S., Linzivillo, C., Racalbut, A., Cleri, R., Di Cataldo, A., Surg. Today 28: 1233-1236,
1998).

In another embodiment, the present invention is a method of separating a population of specific cells, wherein a sample containing potentially specific cells is subjected to stem / progenitor cells under conditions in which the antibody specifically binds to the population of cells. A method comprising contacting with an antibody that specifically binds to a population of cells produced by immunizing an animal and separating the population of cells using the bound antibody.

By “separating with a bound antibody” is meant using the identified antibody in a cell separation method, eg, fluorescence activated cell selection (FACS) or magnetic selection. In the FACS selection method, the antibody is often conjugated to a fluorescent molecule. In the magnetic selection method, the antibody is directly or indirectly linked to magnetic microbeads.

In a preferred embodiment, the cells are hematopoietic cells.

In another embodiment, the present invention is a method of expanding a cell population, which comprises stimulating proliferation or differentiation of cells and immunizing an animal with stem / progenitor cells and the cell population. A method comprising the step of contacting

“Amplifying” means inducing the proliferation of one or more cells. In a preferred embodiment, the cells are hematopoietic cells.

[0205] In another embodiment, the present invention provides stem / progenitor cells by conjugating antibodies or fragments thereof produced by immunizing an animal with stem / progenitor cells to a receptor.
Methods of modulating the activity of receptors present on the surface of progenitor cells involved in cell proliferation, differentiation, survival or activation are provided.

“Modulate” means to stimulate, suppress, or block receptor activation. In a more preferred embodiment, the receptor is a growth factor receptor.

Other features and advantages of the invention will be apparent from the following description and claims of its preferred embodiments. All references, publications and patents cited in this specification are incorporated by reference in their entirety.

DESCRIPTION OF THE FIGURES FIG. 1 shows a schematic of the vectors used for phage display. 2A and B show a schematic of the primers used in the scFv cloning scheme. Figure 3
A, 3B, 3C and 3D show schematics of the primers used in the Fab cloning scheme. FIG. 4 shows Sc
A schematic of the Fv cloning plan is shown. 5A and 5
B shows a schematic of the vector used in the Fab cloning scheme.

Description of Preferred Embodiments Hereinafter, various embodiments and specific examples of the present invention will be described in more detail with reference to Examples, but are not intended to limit the scope in any way. Those skilled in the art will appreciate that the examples for hematopoietic cells are also applicable to the screening of other factors involved in the proliferation, differentiation, activation and survival of other cell lineages. Moreover, one of ordinary skill in the art would be able to understand and easily adapt these methods of identifying inhibitory antibodies, receptors and inhibitors.

Example 1 Screening for Agonist Antibodies to Hematopoietic Growth Factor Receptors Immunized chickens and rabbits were tested for human bone marrow cells (sorted and unsorted) (Poetic Technologies, Germantown, Md.), Murine bone marrow cells (sorted). (Sorted and unsorted) (Rabbit and Rodent Diagnostic Associates, San Diego, CA), fetal hepatocytes (Jordan, CT, McCern,
JP, Remiska, IR, Cell 61: 953-963.
(Obtained as described in 1990)). Furthermore, by using the specific antibody AA4.1, stem cells and yolk sac cells (Rabbit and
Rodent Diagnostic Associates,
San Diego, CA), mononuclear cell products (Poetic Technologies, Germantown, MD). Immunization
Murine hematopoietic cell lines, such as FDCP-mixed (Spooncer, E., Hayworth, CM, Dan, A., Dexter, T.
M., Differentiation 31: 111-118, 198.
6) and B6SUTA (Greenburger, JS, Sakakiney, MA, Humphreys, RK, Eaves, C.
J., Echner, RJ, Proc. Natl. Acad. Sci, USA 8
0: 2931-2935, 1983). Hematopoietic stem / progenitor cells isolated from circulating blood can also be used, as described above. In addition, immunization
It can be performed with other cells such as P19 cells, NTera-2 cells and human ES cell lines. Bone marrow cells can be sorted by using antibodies (eg, α-CD3) bound to magnetic beads.
4) The magnetic selection method is used. Cells are pre-coated with monoclonal antibodies that recognize cell surface molecules. The monoclonal antibody is bound to the magnetic beads by a secondary antibody conjugated to the beads. The cells are then removed with a magnet. Magnetic sorting involves positive selection in which cells of interest are bound by an antibody (eg, a population of stem cells bound to the antibody) (milteni.
Biotech, Auburn, CA) or a negative choice to capture unwanted cells with a magnet (Stem Cell Technologies, Vancouver BC, Canada).

In the fluorescence activated sorting method, cells labeled with an antibody conjugated to a fluorescent molecule are loaded onto a flow cytometer, eg Becton-Dickinson FACS.
Electronically sort with an IV or FACS Vantage Cytometer or sorter of equal content. Fluorescent molecule-conjugated antibodies recognize specific cell surface antigens. These antibodies are conjugated to fluorescent markers such as fluorescein isothiocyanate (FITC) or phycoerythrin (PE) (Becton-Dickinson, San Jose, CA, Biosource International, Camarillo, CA).

Immunization may be by any conventional route including, but not limited to, intraperitoneal, subcutaneous, intramuscular, intravenous. Immunization can be in the presence or absence of an adjuvant. Generally, 1-10 million cells are injected in the primary immunization. Animals extensively immunized with, for example, RBC lysed and platelet-depleted bone marrow products have all of the remaining lineages, including stem / progenitor cells. By using these types of bone marrow products, the response to the antigen is naturally very broad with antibodies raised against a wide variety of surface receptors. In the case of selected populations, eg animals immunized with CD34 ⁺ cells, there will be less diversity in the immune response, but may facilitate identification of antibodies with stem cell or lineage specific effects.

Following the primary immunization, animals are boosted one or more times with the same immunogen, producing a secondary immune response. Libraries created from secondary immune responses will naturally yield antibody fragments with even higher affinity due to affinity maturation.

Post-pre-immunization booster immunizations are performed, blood is collected and serum is prepared for serum antibody evaluation. Indirect cell ELISA with pre-immune and immune sera against target cells
Is used to screen for antibodies to uncharacterized cell antigens. These whole cell ELI
In SA, target cells (1 × 10 ⁷ cells / ml) are distributed into microtiter plates (1 × 10 ⁶ cells / well) and slowly sedimented (1500 rpm / 4 ° C./5 ′).
The culture supernatant is removed by aspiration. Wash cells with buffer (P
Briefly wash with BS / 1% BSA / 0.1% NaN ₃ )
Allow to settle. Cells are 1/50, 1/100, 1/50
0, 1/1000, 1/5000 containing serum diluent 10
Resuspend in 0 μl solution. Incubate cells and antibody at 4 ° C. for 1 hour. The sample slowly settles again. The supernatant is removed by aspiration and the cells are washed twice with wash buffer. 2 ⁰ The antibodies of the pellets 100 [mu] l - resuspended in enzyme conjugate (secondary goat conjugated to alkaline phosphatase or horseradish peroxidase anti-rabbit or goat anti-chicken antibody). The plates are incubated at 4 ° C / 1 hour, then the cells are washed twice with wash buffer. Resuspend the pellet in 100 μl / well of developer reagent. The developer is PNPP (Sigma, St. Louis, Missouri) for the alkaline phosphatase secondary antibody or ABTS (Sigma, St. Louis, Missouri) for the horseradish peroxidase antibody. The enzymatic reaction is allowed to continue and read visually or at a microtiter plate reader at the appropriate wavelength. Only those immunizations that produce positive serum ELISA test results will be taken to the next step of the method (library construction).

Library Construction Within one week after the final boost, animals will be captured and primary and secondary lymphoid organs (spleen, bone marrow and blood) will be harvested after a positive serum ELISA test. Peripheral blood lymphocytes,
Separate from blood in Ficoll or Percol cushions (Sigma, St. Louis, MO). RNA is isolated from spleen, bone marrow and peripheral blood lymphocytes by the phenol / guanidine thiocyanate method (Tri Reagent, Molecular Research Center, Cincinnati, Ohio). RN using the first strand cDNA synthesis kit (Boehringer Mannheim, Indianapolis, Indiana) with oligo (dT) ₁₅ primer, deoxynucleotides and AMV reverse transcriptase
Reverse transcribe A into cDNA.

Fab fragments and / or single chain variable region (scFv) expression libraries are constructed from each immunized animal. The surface display vector for each library is pRL4 (see Figure 1) and is capable of displaying chimeric expression products on the surface of packaged phagemid particles. pRL4 is a modified version of pComb3H (Barbus, CFIII and Burton, DR, 1994. Monoclonal Antibodies from Comb
inatorial Libraries. Cold Spring Harbor
Laboratory Course Manual, Cold Spring Harbor, New York, Burton, DR, Barbus,
CFIII, Advances in Immunology 57: 191-28.
0, 1994, Lang, IM, Chuang, TL, Barbus, CFIII, Shrief, RR, J. Biol. Chem. 27.
1: 30126-30135, 1996). It contains the primer NPCAMB-F1 (CACATCATGCGC).
ATACCCGTACGACGTTCCGGACTAC
GCTTCTTAGGAGGGGTGGTGGCTCT,
SEQ ID NO: 1) and NPC3AMB-B (GCTTAC
AATTTCCCCAGATCTGCG, SEQ ID NO: 2) and template plasmid pComb3H (Barbus, CFIII)
And Burton, DR, Cold Spring Laboratory Course Manual, Monoclonal Antibodies fr
PC using om CombinatorialLibraries, 1994)
It was constructed by R amplification. It is a hemagglutinin decapeptide (HA-dp) (Field, J., Nikawa, JI, Broek, D., McDonald, B., Rogers, L., Wilson, IA, Lerner, RA, Wiggler, M. , Mol. Cel
I. Biol. 8: 2159-2165, 1988), a fragment containing the amber stop codon (TAG) and gene III is amplified. The generated PCR product is HIS6
Primer NPC3AMB-F2 (GA with sequences and SfiI and SpeI restriction sites added at the 5'end.
GGAGGGAGGAGGAGGAGACTAGTGGG
CAGGCCGGCCAGCACCCATCACCATC
ACCATGGCGCATACCCGT, SEQ ID NO: 3)
And secondary P by NPC3AMB-B (SEQ ID NO: 2)
Used as template in CR reaction. The final PCR product was cloned into the vector pComb3H and confirmed by sequence analysis and functional expression. In pRL4, the antibody fragment is cloned into the SfiI restriction site.

In pRL4, the single chain antibody fragment is cloned downstream of the E. coli lacZ promoter, ribosome binding site and ompA leader sequence. With these elements, IPT
Expression by G can be induced and secretion into the periplasm via the OmpA leader sequence can occur.

Final hybrid Fab in pRL4
In the expression construct, the light and heavy chains are cloned as a single SfiI fragment. In this method, the light chain fragment is cloned downstream of the E. coli lacZ promoter, ribosome binding site and ompA leader sequence. Expression by IPTG is induced by these elements, and secretion from cells via the ompA leader sequence can be performed. The light chain fragment is followed by the sequence provided by the PCR primer, which includes a stop codon, a second ribosome binding site and an E. coli pelB leader sequence. Hybrid heavy chain gene, filamentous phage gene III
It is fused in frame with the (gIII) sequence (amino acids 230-406). The amber stop codon is at the fusion junction. Amber mutagenesis is suppressed in supE bacterial hosts such as ER2357 (New England Biolabs, Beverly, Mass.).
Upon promoter induction, a single polycistronic message is transcribed and translated as two polypeptides, a light chain and a heavy chain gene III fusion protein. After synthesis, these polypeptides are transported into the bacterial periplasmic space as directed by the leader sequence. In the periplasmic space, the heavy chain pIII fusion protein is inserted into the membrane and the light and heavy chains are covalently linked by disulfide bonds, forming the antigen binding site. Human constant region CH1 and C _L sequences include the cysteines that form a disulfide bond between the heavy and light chains. Upon superinfection with helper phage, these fragments are exported from the cells on the phage surface as Fab-pIII fusions. In non-supE hosts, such as TOP10F '(Invitrogen, Carlsbad, CA), the amber stop codon is recognized and a soluble Fab fragment is produced. p
Other features of RL4 include two molecular markers, HA and H.
There is 6 HA-labeled HA.11 antibody (Babco,
Recognized by Berkerry, CA). Hi
The s6 label allows for affinity purification of antibody fragments by nickel-chelate chromatography (Qiagen, Santa Calita, CA).

ScFv fragment single chain variable region libraries (scFv) are constructed from each immunized animal. Single chain libraries are useful because the entire binding domain is contained in one polypeptide. The light chain variable region is separated from the heavy chain variable region by a linker region. The use of short linkers (<11 amino acids) is
It is suitable for dimeric complexes where the V _{H of the} cFv is associated with the V _{L of} another ScFv molecule and vice versa, these molecules are called diabodies (Coat, A .;
A., Marky, RL, Cardwell, JB, Gruen, L.
C., Ivanchi, N, Lawrence, MG et al., Eur. J. Bioch
em. 221: 151-157, 1994). This is because the folding of the monomeric ScFv is impaired by the <11 amino acid linker (Alfzan, K., Takkinen, K., Sizmann, D., Sodarlund, H. and Tili,
TT, Protein-Eng. 8: 725-731, 1995).
Dimer formation is excluded because the long linker (> 11 amino acids) favors folding of the monomer ScFv into a single antigen binding domain. In this example, s
The cFv fragment is constructed with a short linker of 7 amino acids or a long linker of 18 amino acids.

The design of pRL4 allows for dimerization of the scFv antigen binding domain in soluble form on the phage surface as detailed below. The plasmid is a supE bacterial host, such as ER2537 (F'Sup
E, New England Biolabs, Beverley,
Amber mutagenesis is suppressed by almost 50 percent of the time when transformed into Massachusetts. Thus, half of the expressed scFv is fused with the filamentous phage gene III protein (amino acids 230-406) and the other half is terminated just before gene III, producing soluble scFv. Both scFv-pIII fusions and soluble scFv products have an Omp A signal sequence and are transported to the periplasm where they can form a dimeric scFv complex called a diabody (Coat, AA, Malby, RL, Cardwell, J.
B., Gruen, LC, Ivanchi, N., Lawrence, MC
Et al., Eur. J. Biochem. 221: 151-157, 199.
4). Diabodies have one scFv V _H with the second s
It is expected to pair with the _{VL of} cFv-pIII and fold to form a bivalent antibody fragment. Upon superinfection with helper phage, these diabodies are exported from the cells as pIII-antibody fragments on the phage surface. Non-supE host, eg TOP10F '
(Invitrogen, Carlsbad, Calif.), The amber stop codon was recognized and soluble sc
Fv diabodies are produced.

2A and B are schematics of the primers used in the scFv cloning scheme. All immunoglobulin variable regions are also known as complementarity determining regions (CDRs) intended to form an antigen binding site,
It is composed of the hypervariable regions and the less frequent variable regions known as the framework regions (FR). Oligos are designed to anneal to and amplify the entire framework regions of published antibodies of a given organism. Antibody sequences from many organisms
Single Source: Kabat, EA, Wu, TT, Perry, HM,
Gottesman, KS and Foeler, C. 1991. Seque
nces of Proteins of Immunological Interest. 1-3
Volume, Ministry of Health and Welfare, Directorate General of Public Health, National Institutes of Health, NI
It is edited in H Publication No. 91-3242. A set of primers for amplification of the whole immunoglobulin repertoire of various animals has been developed and used successfully as described (Barbus, CFIII and Burton, D.
R., 1994, Monoclonal Antibodies from Combinato
rial Libraries, Cold Spring Harbor Laboratory Course Manual). These primers contain restriction sites for cloning and linker sequences between the light and heavy chain variable regions to provide the amino acids linking the light and heavy chain variable regions into a single polypeptide used for PCR overlap extension. including. The linker sequence can be short (eg, encoding 7 amino acids) or long (eg, encoding 18 amino acids). The rabbit variable light chain "forward" primer binds to a sequence within framework 1 (FR1) of the specific light chain (s). The degeneracy is incorporated into the primer such that a single primer amplifies other closely related FR1 variable region sequences. A restriction site is incorporated at the 5'end of each primer to facilitate cloning. Similarly, there are "reverse" primers for the rabbit variable light chain sequence that anneal to each specific group (s) of rabbit light chain FR4 regions. Restriction sites and linker sequences are "reverse"
Incorporated at the 3'end of each of the primers. For single-stranded short libraries, the sequence is 5'-GGAAGAAGAG
GAACC-3 '(SEQ ID NO: 34). In the case of the rabbit heavy chain variable region fragment, the sequences that bind to the FR regions are designed as well, except that the primers are designed to anneal to the published rabbit heavy chain sequence (Kabat, EA et al., 1991). Restriction sites and linker sequences are incorporated at the 5'end of each of these primers and used during the second round of PCR amplification. The linker sequence incorporated into the heavy chain variable region primer is a light chain linker sequence 5′-GGTGGTTCGTCTAGAT
It is the reverse complement of CTTCC-3 '(SEQ ID NO: 35). Briefly, variable heavy (V _H ) and light (V _L ) chains were amplified separately and then combined for additional rounds of PCR amplification by overlap extension through the linker region,
Generate scFv fragment product. This cloning step may also randomly associate the heavy and light chains. All products are amplified with oligos attached to the final 5'and 3'ends of the resulting annealing product. The final PCR product contains V _H and V _L regions each separated by a short linker (7 amino acids) and is cloned into pRL4 (FIG. 1). To construct a scFv length library, the method is the same, except that the linker sequence incorporated into the light chain reverse primer is extended by 33 nucleotides and encodes an additional 11 amino acids. In this case, the array CCCACCACCGCCCGAGCCA
CCGCCACCAGAGGA (SEQ ID NO: 36) is 7
It is included just 3'to the nucleotide encoding the short amino acid linker. The heavy chain primers for the scFv long library are the same as those used for the scFv short library. One of ordinary skill in the art would be able to extrapolate from these designs and design other primers that would amplify large immunoglobulin repertoire libraries from many different species.

The heavy and light chain variable region genes are separately amplified by PCR using the cDNA as a template. The primers used will depend on the animal immunized.
Construction of the scFv library from rabbits is performed as follows (see Figure 2). The light chain variable region gene was labeled with the forward kappa primer RSCVK-1 (GGGCCC
AGGCGGCCGAGCTCGTGMTMTGACCCA
GACTCCA, SEQ ID NO: 4), RSCVK-2 (GG
GCCCAGGCGCGCCGAGCTCGATMTGA
CCCAGACTCCA, SEQ ID NO: 5), RSCVK-
3 (GGGCCCAGGCGGGCCGAGCTCCGTG
ATGACCCAGACTGAA, SEQ ID NO: 6) and forward lambda primer RSClambda1 R
SCL-1 (GGGCCCAGGCGCGCCGAGCT
Amplify from first strand cDNA using CGTGCTGAACTCAGTCGCCCTC, SEQ ID NO: 7) (Gibco / BRL, Gaithersburg, MD) (see Figure 2A). These primers are based on framework 1 (FR1) of different light chain groups (Kabat, EA et al., 1991).
A variable sequence restriction site 5'is added to the sequence for cloning purposes. The reverse primer for amplifying kappa light chain was RKB9J0-B (GGAAGATCTAG
AGGAACCACCTAGAGATCTCCAGCTC
GGTCCC, SEQ ID NO: 8), RKB9J10-B (G
GAAGATCTAGAGGAACCACCTTTGA
TTTCCACATTGGGTGCC, SEQ ID NO: 9), R
KB42J0-B (GGAAGATCTAGAGGAA
CCACCTTTGACSACCACCTCCGGTCC
C, SEQ ID NO: 10), and the reverse primer for lambda light chain amplification is Rjlambda0-B (GGA
AGATCTAGAGGAACCACCCGCTGTG
ACGGTCAGCTGGGTCCC, SEQ ID NO: 11)
(Gibco / BRL, Gaithersburg, MD)
(See FIG. 2A). These primers bind to the FR4 sequences of the kappa and lambda light chain groups and contain the extension sequences used to generate the linker sequence by PCR overlap extension. In the light chain reaction, each kappa forward primer pairs with each kappa reverse primer in 9 separate reactions. The 10th light chain reaction uses two lambda primers. The heavy chain variable region gene was labeled with the forward primer RSCVH01 (GGTG
GTTCCTCTAGATCTTCCCAGTCGGT
GGAGGAGTCCCRGG, SEQ ID NO: 12), RSC
VH02 (GGTGGGTTCCTCTAGATCTTC
CCAGTCGGGTGAAGGAGTCCGAG, SEQ ID NO: 13), RSCVH03 (GGTGGTTCCCTC)
TAGATCTTCCCAGTCGYTGGAGGAG
TCCGGG, SEQ ID NO: 14) and RSCVH04
(GGTGGGTCTCCTAGATCTTCCCAG
SAGCAGCTGRTGGAGTCCCGG, SEQ ID NO: 15) (Gibco / BRL, Gaithersburg, MD) is used for amplification (see FIG. 2B). These oligonucleotides bind the variable region framework 1 sequence and contain a 5'extension that is used to generate the linker sequence by overlapping PCR extension. The reverse primer for heavy chain amplification is RSCG-B (CCTGGCCG
GCCTGGCCACTAGTGACTGAYGGAG
CCTTAGGTTGCCC, SEQ ID NO: 16) (Gibco / BRL, Gaithersburg, MD) (see Figure 2B). RSCG-B is a rabbit constant FR4 /
Since it binds to the CH1 sequence and bears the extension of the restriction site, cloning is facilitated. In the heavy chain PCR reaction, each forward primer is paired with four independent reverse primers for the heavy chain reaction.

After heavy and light chain amplification and gel purification of the fragments, when the light and heavy chain fragments are all combined, an additional round of PCR amplification results in overlap extension. In this final overlap PCR reaction, the light chain variable region fragment and the heavy chain variable region fragment are annealed and amplified. This PCR
The reaction is based on the primer RSC-F (GAGGAGGGAGGG
AGGAGGAGGGCGGGCCCAGGGCGGCC
GAGCTC, SEQ ID NO: 17) (Gibco / BRL, Gaithersburg, MD) (see Figure 2A) and R
SC-B (GAGGAGGGAGGGAGGGAGGCCC
TGGCCGGCCCTGGCCACTAGTG, SEQ ID NO: 18) (Gibco / BRL, Gaithersburg, MD) (see Figure 2B), which bind to light and heavy chain variable region sequences engineered into restriction sites. To do. This cloning step results in a random association of heavy and light chains. The PCR product is
Limited by SfiI. The final SfiI restriction fragment contains one heavy chain variable region and one light chain variable region each separated by a linker and is cloned into the SfiI site of pRL4 (see Figure 4). The ligation was performed using E. coli ER2537 genotype: F'proA ⁺ B ⁺ lacI ^q / Δ (lacZ) M1.
5 / fhuA2 (tonA) Δ (lac-proAB) su
pEthi-1Δ (hsdMS-mcrB) 5,
Ampicillin resistant (Amp ^R ) colonies are selected in the fraction of all transformants. The rest of the transformants are amplified in liquid culture. The colony size is used to measure the size of the colonies. To confirm that the antibody fragment has been successfully cloned in the plasmid, a random analysis of individual clones by restriction digests is used to check for inserts of the appropriate size. A single library of scFv fragments contains over 10 ⁷ individual components.

In the final single chain expression construct in pRL4, the single chain antibody fragment is cloned downstream of the E. coli lacZ promoter, ribosome binding site and omp A leader sequence. These elements induce expression by IPTG,
Upon expression in suppressor strain ER2537, cells secrete through the omp A leader sequence. The single-stranded fragment was used as a filamentous phage gene III (gIII) sequence (amino acid 2
30-406) in the frame. The gIII protein product, pIII, is a small coat protein required for infectivity. Upon induction of the promoter by IPTG, a single chain antibody-pIII fusion is synthesized and transported to the bacterial periplasmic space. In the periplasmic space, scFv-gene II
The I fusion protein is inserted into the membrane. Upon superinfection with helper phage, these fragments were
Exported from cells on the surface of phage as antibody fragments. Other possible proteins used for fusions on the phagemid surface include filamentous coat protein p
There are VIII and other coat proteins.

For the chicken scFv library, the method is essentially the same, except that the primers used are specific for chicken light and heavy chain sequences (Kabat, EA et al., 1991). The primer extension and linker sequences are the same as for the rabbit primer, and p
Cloning into RL4 is simplified. Based on the primers shown in the examples and the sequences disclosed by Kabat, EA et al., One of ordinary skill in the art can easily design primers of any kind to construct scFv libraries. .

Fab Fragments Fab fragment libraries maintain natural antigen recognition sites and are useful in ensuring maintenance of affinity.

Primers are designed based on published ER and constant region sequences (Kabat, EA et al., 19).
91). In the current scheme, primers are used for hybrid antibody fragment construction (rabbit variable / human constant), but primers can be designed as well with constant regions from any kind. For example, a Fab fragment library derived from rabbits can have both variable and constant regions from rabbits. In this case, the variable region forward primer remains the same,
The reverse primer comprises constant region sequences from the rabbit kappa light chain, rabbit lambda light chain or rabbit heavy chain sequences. Hybrid Fab libraries can also be constructed. These libraries contain variable regions from immunized animals and constant regions from human IgG1 ( _CL and C
_H 1). In case of hybrid Fab,
Each Fab fragment is the constant region of the variable regions and human IgG1 from immunized animals (C _L and CH1)
It is composed of A set of primers for the amplification of the rabbit and chicken immunoglobulin repertoires and for the production of chimeric Fabs has been developed (Barbus,
C.F.III and Burton, D.R., 1994. Monoclo
nal Antibodies from Combinatorial Libraries. Cold Spring Harbor Laboratory Course Manual, and November 1997 course on monoclonal antibodies from combinatorial libraries, Cold Spring Harbor Laboratory). The "forward" primer is paired with the "reverse" primer to PCR amplify the rabbit variable kappa sequence and one forward primer is paired with the one reverse primer to amplify the lambda light chain variable region sequence. The human constant kappa sequence is the human kappa constant region sequence published in the phage display plasmid (Kabat, EA et al., 199).
1) human antibody Fab (Person, MA, Khao Chien, RH and Burton, DA, Proc. Natl. Acad.) Using a "forward" primer that anneals to 1) and a reverse primer that anneals to the pelB leader sequence.
Sci. USA 88: 2434-2436, 1991).
An overlapping PCR reaction in which the entire light chain fragment is pooled with the human constant kappa fragment produces a hybrid light chain fragment. A similar method is used for heavy chains to produce hybrid heavy chain fragments. Final and third round PCR
In the reaction, the hybrid light chain is pooled with the hybrid heavy chain and overlapping PCR amplification is performed with external primers to generate fragments with both hybrid light chain and hybrid heavy chain sequences, respectively.

The heavy and light chain variable region genes are amplified by PCR using the cDNA as a template. Rabbit Fa
In the case of the b fragment library, the construction is done as follows. Forward primers RSCVK1 (SEQ ID NO: 4), RSCVK2 (SEQ ID NO: 5), RSCVK3
(SEQ ID NO: 6) (Operon Technologies, Alameda, Calif.) Is used to amplify the light chain variable region gene (see FIG. 3A). These primers bind to framework 1 (FR1) sequences of different kappa light chain groups (Kabat, EA et al., 1991) and incorporate variable sequence restriction enzyme sites 5 ′ for cloning purposes. For the design and use of rabbit primers for amplification of mRNA encoding rabbit kappa and gamma heavy chains to construct antibody libraries from this species, see Lang, I. et al.
M., Barbus, CFIII, Shrief, RR, Gene 17
2: 295-298 (1996). The lambda light chain is amplified with the forward primer RSCL-1 (SEQ ID NO: 7). The reverse primer for amplification of kappa light chain is RHHybK1-B (AGATGGTGCA
GCCACAGTTCGTTTGATTTCCACAT
TGGTGCC, SEQ ID NO: 19), RHHybK2-B
(AGATGGTGCAGCCACAGTTCGTAG
GATCTCCAGCTCGGTCCC, SEQ ID NO: 2
0), RHHybK3-B (AGATGGTGCAGC
CACAGTTGCTTTGACSACCACCCTCG
GTCCC, SEQ ID NO: 21) (Operon Technologies, Alameda, CA) (see Figure 3A). The reverse primer for lambda light chain is RHHyb
LB (AGATGGTGCAGCCACAGTTTCG
GCCTGTGACGGTCAGCTGGGTCCCC,
SEQ ID NO: 22). These primers bind to the FR4 sequences of the light chain family (Kabat, EA et al., 1991) and contain an extension of the human constant region sequences. This extension allows the addition of human kappa chain constant region sequences in the second round of the PCR reaction. In the light chain reaction, each kappa forward primer is paired with each kappa reverse primer in 9 independent PCR reactions. First
The 0 light chain PCR reaction uses lambda forward and reverse primers. Human constant kappa sequences can be amplified from any human kappa chain clone. In this case, the forward primer, HKC-F (CGAACT
GT GGCTGCACCATCTGTC, SEQ ID NO: 2
3) (see FIG. 3B) is Kabat, EA et al. (1991).
Binds to the human constant kappa sequence as published by. Reverse primer, read B (GGCCATGGCTGG
TTGGGGCAGC, SEQ ID NO: 24) is pComb3.
It binds to the human kappa chain plasmid sequence cloned in H. Alternatively, the primer can be Escherichia
It can be designed to incorporate sequences necessary for expression in E. coli (eg, stop codons, ribosome binding sites, and pelB leader sequences). After gel purification of the fragment, a second PCR reaction is performed in which the variable region PCR is performed.
All fragments are human constant kappa PCR fragments and primer RSC-F (SEQ ID NO: 17) (FIG. 3A).
Reference) and lead B (SEQ ID NO: 24). This reaction results in the fusion of the light chain variable region to the human constant kappa sequence.

The heavy chain variable region genes are: Lang, IM, Barbus, CFIII, Shrief, RR, Gene 172: 29.
5-8 (1996), the forward primer RhyVH1 (GCTGCCCAACCAGC).
CATGGCCCAGTCGGTGGAGGAGTCC
RGG, SEQ ID NO: 25), RhyVH2 (GCTGCC
CAACCAGCCATGGCCCAGTCG GTG
AAGGAGTCCGAG, SEQ ID NO: 26), RhyV
H3 (GCTGCCCAACCAGC CATGGCC
CAGTCGYTGGAGGAGTCCGGG, SEQ ID NO: 27) and RhyVH4 (GCTGCCCAACC)
AGCCATGGCCCAGSAGCAGCTGRG
It is amplified using GAGTCCGG (SEQ ID NO: 28) (see FIG. 3C). These primers contain a 5'sequence that encodes the pelB leader sequence. Rabbit heavy chain reverse primer, RHHyIgGCH1-B (CGATGG
GCCCTTGGTGGAGGGCTGARGAGYAG
GTGACCAGGGTGCC, SEQ ID NO: 29) binds to rabbit steady FR4 sequences, having a stretch of human constant C _H 1 sequence. Therefore, four independent PCR reactions
It is performed by each forward primer and reverse primer. Human constant IgG sequence is used as a template for pC
Human antibody clones and human constant I in OMB3H
gG sequence, HIgGCH1-F (GCCTCCACCA
AGGGCCCATCGGTC, SEQ ID NO: 30), a forward primer that anneals, and a reverse primer that anneals to a plasmid sequence, dp-s
eq (AGAAGCGTAGTCCGAACGTC,
It can be amplified by PCR using SEQ ID NO: 31) (Fig. 3). Alternatively, the human sequence can be found in Kabat, EA et al. (1
It can be amplified from any human antibody cDNA library by using a primer that anneals to a constant region sequence as described by 991) and incorporates the restriction site of the reverse primer for cloning purposes. After gel purification of the fragments, a second set of heavy chain P
A CR reaction is performed and all heavy chain variable region amplified fragments are combined with human heavy chain constant region fragments.
Primer lead VH (GCTGCCCAACCAGC
CATGGCC, SEQ ID NO: 32) and dp-ex (G
AGGAG GAGGAGGGAGGAGAGAAGCG
The heavy chain variable region can be fused to the human constant region sequence by an overlapping PCR extension reaction using TAGTCCGGAACGTC, SEQ ID NO: 33) (see Figure 3D). In the final overlap PCR reaction, the hybrid light and heavy chains were annealed,
Primers RSC-F (SEQ ID NO: 17) and dp-e
Amplified with x (SEQ ID NO: 33). The resulting fragment is restricted with the appropriate enzymes, gel purified, S
It is cloned into fiI digested pRL4 as a single SfiI fragment containing both the hybrid light and heavy chains. FIG. 5 shows a schematic diagram of a Fab cloning strategy illustrating the final hybrid Fab fragment cloned into pRL4. The ligation reaction is transformed into E. coli ER2537 and ampicillin resistant (Amp ^R ) colonies are selected in all fractions of transformation. The rest is amplified in liquid culture. The size of the library is measured using the number of colonies.

For chicken Fab fragment libraries, the method is essentially the same, except the primers used are specific for chicken light and heavy chain sequences (Kabat, EA et al., 1991). The primer extension sequence is the same as the rabbit primer and simplifies cloning into pRL4 and produces a hybrid Fab fusion.

After the libraries have been constructed, target cells are used to screen them.

Target cells Target cells are selected based on the immunogen used, the desired product and the goals of the screen. For a very broad screen, it is important that the majority of hematopoietic cell lineages be present in the immunized population of cells. For example, immunization with a population of mononuclear cells, which is predicted to include stem cells, progenitor cells, lymphocytes, monocytes and NK cells, is fairly widespread and stem cells, progenitor cells of different lineages, lymphocytes, monocytes, It has the potential to produce agonistic or inhibitory antibodies against spheres or NK cells. A more extensive screen uses whole bone marrow aspirate that has lost most of its red blood cells and platelets due to RBC (red blood cell) lysis and washing. This population is predicted to include all other hematopoietic lineages. Once these libraries have been constructed, the target cells for screening will vary with the goals of the screen. To identify relevant antibodies for multiple lineages at once, the target cell population can be the same as the immunogen, and can be a diverse population of cells as well as very broad. These tests find interesting agonists and inhibitors for a wide variety of cells at once. For high throughput screening on diverse cell populations, it is necessary to confirm that each component of the antibody library is exposed to each cell line at various stages of maturation. An alternative method identifies antibodies related to a single line by limiting the target population to a single line. For example, neutrophils are Tarstappen, LW,
Safford, M., Loken, MR, Leukemia 4: 657
-663 (1990)
It can be separated from cells of other lineages using a combination of light scatter signals in cytometry and monoclonal antibodies, CD11b, CD15 and CD16. By separating many other hematopoietic lineages for use as target cells, antibodies relevant to specific lineages can be identified.

Alternatively, related antibodies may be identified that play a role in human hematopoietic stem cell regeneration or differentiation. Studies show that human bone marrow cells have CD34 ⁺ CD3
Eight fractions have been shown to contain stem cells that allow long-term transplantation and multilineage differentiation (Williams Hemat
Revisited by ology, 5th edition Editors: Ernest Butler, Marshall A. Richtmann, Barry S. Coller,
Thomas J. Kipps McGraw-Hill, Peter J., USA. In the chapter "Hematopoietic stem cells, progenitor cells and cytokines" by Kesenbury). Since stem cells occupy a very small fraction of human bone marrow cells (1
Surface-specific ligands of progenitor human stem cells, <1 in x10 ⁵ bone marrow cells), can be identified from antibody libraries using human CD34 ⁺ sorted primary human cells as the immunogen. In this case, the target cells may be a CD34 ⁺ population,
Antibodies that recognize CD34 ⁺ CD38 ⁻ cells can be identified by FACS sorting, magnetic sorting, or by sieving on the target cells. Another target in this case may be a murine hematopoietic stem cell line, such as FDCP-mix or a murine pluripotent hematopoietic stem cell line (Spooncer, E., Hayworth, CM, Dan A., Dexter, TM 1986. . Differentiation 31: 111-
118). The advantages of using cell lines as targets are their availability, clonal properties and ease of manipulation.

Therefore, the target cells are the immunogens used,
Desired end product, desired screen range, availability,
Selected based on criteria including ease of handling. If the initial target cells are murine cells, eventually the test will be performed on a suitable human cell line.

Preferred primary cells and cell lines for hematopoiesis are lysed whole blood, human bone marrow mononuclear cells, FDC.
P-mix and CD34 ⁺ sorted bone marrow cells.
In the case of P19 cells, the preferred target is p19 cells,
In the case of NTERA cells, the preferred target cells are NTERA cells.

Sieving Phage (bacteriophage or phagemid) display antibody libraries can be prepared by using mouse cell lines, human cell lines and sorted and unsorted primary bone marrow by using a method called sieving and FACS sorting and magnetic cell sorting. Including samples, phage are selected that bind to a variety of target cells and carry antibody fragments that remain on the cell surface or are internalized. A method for sieving whole cells has been previously reported (Siegel, DL, Chang, T.
Y., Russell, SL and Bunya, VY, J. Immunol. Me
thods 1997, 206: 73-85).

Prior to performing the selection method, the primary library is electroporated into host cells (ER2537). Library cultures are grown to exponential phase and superinfected with a helper phage, eg, a commercial helper phage such as VCSM13 (Stratagene, La Jolla, Calif.). Superinfection provides the residual phage components needed to package the plasmid into phagemid particles. After overnight growth, the phagemid in the culture supernatant is precipitated with polyethylene glycol (PEG). PE
The G supernatant is used for sieving (cell surface, internalization and membranes), FACS sorting and magnetic sorting to purify bound antibody from unbound agent.

In sieving, the antibody-phage library is incubated with target cells and non-adherent phage are removed by multiple washes. A typical sieving protocol is as follows:

1. PBS + 1% BSA or 10% FB
Block phage particles with S + 4% milk powder + NaN ₃ (except when assaying internalized antibody). 2. Add target cells to blocked phage (approximately 5 × 10 ⁶ cells) Mix at 3.4 ° C. or 37 ° C. and rotate gently. 4. Wash cells twice with 1 ml ice cold PBS / 1% BSA / NaN ₃ or room temperature PBS / 1% BSA / NaN ₃ . 5. Specific antibody-phage bound to cells was
It can be eluted with low pH, for example 76 mmol citric acid in PBS, pH 2.5 for 10 minutes. 6. The eluted phage was treated with 1 mol of Tris-HCl, p.
Neutralize with H7.4. 7. After neutralization, antibody-phage is used to infect ER2537 and amplified during overnight growth for subsequent rounds of sieving.

In general, 3-4 rounds of sieving are performed for each library. Soluble using a commercially available secondary antibody (sheep anti-M13 antibody-HRP) or a commercially available HA..11 antibody (Babco, Berkerry, Calif.) That recognizes the HA tag incorporated into each antibody from the phage ELISA or PRL4 sequence. An antibody ELISA can be performed on whole cells after each sieving round to assess the enrichment of bound antibody to total unbound agent. After the final round of sieving, antibody-phage are picked from agar plates as single colonies, grown as monoclonal antibody-phage and screened by whole cell ELISA to identify specific binders. Specifically, antibody-phage is infected with Top10F 'bacteria and plated for single colonies. Single colonies are picked from agar plates, grown and induced by IPTG. Soluble antibodies are screened by whole cell ELISA to identify specific binding agents. In addition to viable cells, screening can be done on intact, lightly fixed target cells.

If the target cells can be identified by cell surface markers, the relevant antibody-phage can be identified by FACS or magnetic sorting. For example CD34 ⁺
The cells are used as immunogens and the desired antibody fragment is CD34 ⁺ CD38 ⁻ cells or CD34 ⁺ CD38 ⁺
When bound to cells, the phage-antibody library is added to the CD34 ⁺ population of cells and incubated to effect antibody-phage binding to the cell surface. After binding, cells are washed, pelleted and fluorescein isothiocyanate (FITC) -conjugated CD.
Resuspend in 38 antibody solution. After incubation and washing, cell sorting is performed. Effective use of the FACS sorting method identified phage antibodies specific for a subset of leukocytes (DeKruyf, J., Tarstappen, L., Boel, E., Logtenberg, T., Proc. Natl. A
cad. Sci. USA 92: 3938-3942, 199.
5). Phage at low pH in two populations CD34 ⁺ CD38 ⁻
Elute from cells or CD34 ⁺ CD38 ⁺ cells, neutralize and use to infect bacterial cells. Phage or soluble antibody can then be produced from individual colonies for further analysis. In the case of antibodies directed against CD34 ⁺ CD34 ⁻ cells, the phage interacting with structures present in all or most of the cells in the heterogeneous population are CD38 ^+.
Absorption by the cells effectively enriches the CD38 ^- cell-specific phage. Due to the considerable shearing forces exerted on cells and bound phage during fluorescence activated cell sorting, they are selected for relatively high affinity antibodies.

Alternatively, adsorbent cells may be used to allow for common antigens that bind non-specifically to the cell surface or are not specific to stem / progenitor cells, such as receptors involved in the cell's housekeeping function. Bound phages can be eliminated. Adsorbent cells for CD34 ⁺ stem / progenitor cells are further differentiated CD34 ⁻ cells,
⁺ Can be doped with cells.

The phage antibody library was labeled with CD3
4 ⁺ : CD34 ^{− In} addition to a 1: 5 mixture of cell populations (eg mononuclear cells are predominantly CD34 ⁻ and can be added to pre-sorted CD34 ⁺ cells), incubation leads to antibody-phage on the cell surface. Coupling can occur. After binding, cells are washed, pelleted and fluorescein isothiocyanate (FITC) conjugated CD
34 antibody solution and phycoerythrin (PE) conjugated CD38 antibody solution. After incubation and washing, cell sorting is performed to obtain two distinct cell populations; CD34 ⁺ CD38 ⁺ and CD34 ^+.
CD38 ^- to collect. Phage are eluted from the two populations at low pH, neutralized and used for bacterial cell infection. Phage or soluble antibody can then be produced from individual colonies for further analysis. Thus, phage that interact with structures present in all or most of the cells in the heterogeneous population are adsorbed by the presence of CD34 ^- mononuclear cells, effectively enriching for CD34 ⁺ cell-specific phage.

As an alternative to the FACS selection method, CD
Magnetic sorting can also be used to identify antibody / phage-antibodies specific for 34 ⁺ CD38 ⁻ cells and CD34 ⁺ CD38 ⁻ cells. Magnetic sorting can give rise to a high background of non-specific antibodies, but can be less precise than FACS sorting.

The target cell is a cell surface marker, eg NT
If not easily identified by era-2 cells, the relevant antibody-phage can be identified using the same technique as FACS or magnetic sorting in the presence or absence of excess adsorbent cells. . When sorting in the presence of an excess of adsorbent cells, the cell population of interest can be biotinylated and an excess of irrelevant adsorbent cells, such as fibroblast cell lines, added to bind the phage-antibody to the mixture. The cells of interest bound by the phage-antibody are removed using the streptavadine-PE conjugate.

For any particular type of target cell type, adherent cells are selected that are more differentiated than the target cells, or of a xenogeneic or unrelated cell type. Adsorbent cells typically lack specific surface molecules present on target cells, but have surface molecules common to many cells. The preferred adsorbent cells are fibroblasts.

Phage displaying antibodies that recognize the receptor can also be identified using an internalization protocol. For example, mammalian cells are washed with ice-cold buffer (eg, PBS containing 5% FBS) and then exposed to phagemid displaying monomeric or dimeric antibody for 15 minutes to 1 hour incubation on ice. The cells are then washed with ice cold buffer,
Internalization is performed by pouring into fresh culture medium and incubating at 37 ° C. The cells are then lysed and the internalized phagemid is recovered. The phagemid can be recovered by direct infection of the bacterial cells with phagemid particles, or alternatively, the phagemid can be recovered by electroporation of the bacterial cells and selected for antibiotic resistance encoded by the phagemid.

Alternatively, phage displaying antibodies that recognize the receptor can be screened by membrane sieving. Proteins are isolated from cells of interest, such as stem cell lines or NTera-2 cell lines and unrelated cell types, such as fibroblast cell lines. Proteins are separated by electrophoresis on one or two dimensional polyacrylamide gels. After electrophoresis, the proteins are transferred to a membrane support such as nitrocellulose or nylon. Proteins can be stained prior to migration, alternatively by using the same gel for electrophoresis, one can be stained with silver or Coomassie blue to detect protein bands or spots and the other used for membrane sieving. It Unique regions of the membrane can be selected for sieving based on comparison of unrelated cell types to the cell line of interest, alternatively the larger region of the membrane containing many spots. The patterns can be compared and different regions can be selected between the two cell lines. These areas are cut from the membrane as a solid support for sieving.
Application of phage to these regions results in binding. The membrane is washed and the phage are eluted from the membrane, infecting bacterial cells for amplification.

From the screening methods described above, a diverse collection of phage surface-displayed antibody binding sites that non-covalently bind to random cell surface targets in hematopoietic or other cells can be constructed. FA
After CS sorting, magnetic sorting or sieving, clones can be analyzed individually.

After separation of the high affinity antibody binders by dimerization sieving, a bioassay for a functional screen of agonist antibodies is performed. Since dimerization is often a prerequisite for activation of many receptors, bioassays
We focus on agonistic antibodies that stimulate the receptor through promoting merization. As previously reported, single-stranded multivalency is addressed in the linker design. The multivalency of Fab fragments can be addressed in several ways. Some recent reports in the literature have shown success in dimer antibody fragmentation applicable to phage displays (DeKruyif, J. and Rothtenberg, T.).
1996. J. Biol. Chem. 271: 7630-763.
4, Puck, P. and Placsan, A. 1992. Bioch
emistry 31: 1579-1584, and Holliger,
P. and Winter, G. 1993. Current Opin. Biote
ch. 4: 446-449). At least 2 bivalent Fabs
Can be created in any way. In one method, dimerization is pRL4
Achieved by adding a dimerization domain to
RL8 is formed (see Figure 5B). There are some dimerization domains (lexA, Zn fingers, fos, jun, etc.) that can be used in these vectors to give the Fab fragment multivalency. The dimerization domain is represented by the following jun (Decruiff, J. and Logtenberg, T., J. Biol. Chem. 271: 7630-76.
34, 1996, Costelney, SA, Cole, MS and Zo, JY, J. Immunol. 148: 1547-155.
3, 1992), LexA dimerization region (Kim, B. and Little, JW, Science 255: 203-206, 1).
992), the yeast GCN4 dimerization domain (Van Hekeren, WJ, Sellers, JW, Stroul, K., Nucle.
ic Acids Res. 20: 3721-3724, 199.
2), Gin invertase from bacteriophage Mu (Spany-Decking, L., Schleicher,
E., Franken, K., Van De Putte, P., Gozen,
N., J. Bacteriol. 34: 1779-1786, 199.
5), Escherichia coli (E. coli) NTRC protein dimerization domain (Klose, KE, North, AK,
Stedman, KM, Kusutsu, S, J. Mol. Biol. 241:
233-245, 1994) and HSV-1 ICP.
42-merization domain (Garinari, P., Viwewell,
K., Nardi, MC, Zilikunii, J., J. Virol. 68:
3809-3820, 1994), but is not limited thereto. Also, the thermodimer domain from a thermophilic organism can be utilized (McBears, G., Cust, P., Hilvert, D., Biochemistry 3
7: 100062-73, 1998 and McBeath,
G., Cust, P., Hilvert, D., Science 279: 1
958-61, 1998). These are functional domains that, when incorporated into a molecule, allow dimerization to occur. One of ordinary skill in the art would be familiar with these and other dimerization domains and their use for dimerizing proteins. After the screening or selection steps of the Fab library, the screened library of molecules is restricted with SacI and SpeI and cloned into pRL8. Subsequent to FRL selection or sieving, individually or all together, into the pRL8 vector, dimeric soluble binding Fabs can be expressed for analysis in bioassays.
In pRL8, antibody fragments are transported to the periplasmic space where they form dimers. The advantage of this method is that it allows sieving of monomeric Fab fragments and is suitable for high affinity Fabs.

Another method uses a secondary antibody. pRL
4 has a hemagglutinin decapeptide label recognized by a commercially available HA.11 antibody (Babco, Burkerry, CA). Fa identified by FACS sorting or sieving to be tested in a bioassay
b is pre-incubated with HA.11, which promotes dimerization, before being added to the bioassay.

Bioassay Once the binding scFvs were identified by sieving,
Individual clones, each expressing a unique dimerized scFv on the phage surface, are tested for growth, differentiation, activation or survival effects on target cells. In addition, soluble dimerized scFv will be tested in the bioassay. Simple transformation of the selected phage into Top10F '
Bacteria produced soluble scFv can be secreted into the periplasm. Lysates of individual E. coli transformants can be tested for agonistic activity.
Fab antibody was transferred to pRL8 for dimerization (Fig. 5B).
Cf.), expressed as a soluble dimerized Fab fragment in the bacterial host Top10F '.

Several bioassays can be used in high throughput screens. One of ordinary skill in the art would be familiar with these and other suitable bioassays. Several non-radioactive assays have been developed that can analyze DNA synthesis or enzymatic activity. For example, the assay method reported by Mosman (Mosman, T., 1983. J. Immunol. Methods 65:55.
-57) based MTT cell proliferation assay (catalog number G4000) (Promega Corporation, Madison, Wisconsin) may be used. This protocol is quick and easy and results in less than a day. In this assay, MTT (3- [4,5-dimethylthiazol-2-yl] -2,5-diphenyltetrazolium bromide), a tetrazolium salt, turns into a blue formazan product due to mitochondrial dehydrogenase activity in living cells. To be converted. The dehydrogenase content, and thus the amount of colored product produced, is proportional to the cell number. The colored product is detectable with an ELISA plate reader at 570 nm. The assay is performed in triplicate in a 96-well microtiter plate all together. Briefly, primary hematopoietic cells or growth factor-dependent cell lines are plated in 100 μl aliquots in culture medium in 96-well plates. After adding various concentrations of antibody or control growth factor, the cells are incubated for 48-72 hours at 37 ° C. and 5% CO ₂ in a fully humidified atmosphere. Add MTT to each well and EL
Monitor growth with an ISA plate reader.

For example, in a proliferation assay using TF-1 cells, bacterial cells containing the phagemid expressing the antibody are treated with a medium (in the case of TF-1 cells: RPMI2.7 /) of a mixture of a mammalian cell medium and a bacterial medium. SD 0.3 /
Carb 100 μg / ml) in 96 ml deep well plates in 1 ml at 37 ° C. overnight. TF
-1 cells are human bone marrow erythroleukemia cell lines that respond to diverse cytokines (Kitamura, T., Tange, T., Terrasawa, T., Chiba, S., Kwaki, T., Miyagawa, K., Piao, YF, Miyazono, K., Urabe, A., Takaku, F., Cell P
hysiol. 140: 323-334, 1989, Kitamura, T., Tojo, A., Kuwaki, T., Ciba S., Miyazono, K., Urabe, A., Takaku, F., Blood 73: 375-.
380, 1989, Kitamura, T., Taku, F., Miyajima, A., Int. Immunol. 3: 571-577, 199.
1). The next day, the overnight culture is subcultured to a new tray 1/10 and left at 37 ° C. for 2 hours. IP at 37 ℃ for 4 hours
After induction with TG, the plate is 2000 rpm / 1 at room temperature
Centrifuge 5 '. 96 μl of 50 μl of each culture supernatant
Filter through a well filter tray (Millipore) and sterilize the 96-well assay plate. Pre-washing mammalian cells to remove growth factors, 1 × 10 ⁵ cells / ml
Resuspend at a concentration of. Add 50 μ cells to each well.
The assay plate is incubated for 72 hours in a 37 ° C./5% CO ₂ incubator. After 72 hours, develop the tray by adding 40 μl of medium / MTS / PMS per well. MTS is a highly soluble version of MTT with improvements. Both assays are based on the cell conversion of tetrazolium salts. ATM
The proliferation assay kit (catalog number G5421) can be purchased from Promega, Inc. (Madison, WI). Plates are kept in a 37 ° C./CO ₂ incubator and read on a microplate reader at OD ₄₉₀ at 1, 4, and 8 hours.

The activities of cytokines are often synergistic. Synergy can be evidenced by the binding of the ligand to two different receptors and then sending the correct signal, or the priming action of the ligand / receptor interaction that prompts the cell to respond to the second cytokine. Furthermore, the cytokines that act early in the development of lineage are:
It is often more synergistic than the cytokines that act in later stages of the developmental pathway. Therefore, by using suboptimal concentrations of growth factors in these bioassays, synergy can be investigated. The conditions for the suboptimal concentration are determined for each assay. This involves adding serial dilutions of growth factors to the assay individually and as a mixture below which levels the single factor does not enhance the response compared to the mixture, and below which the mixture enhances the response in the bioassay. Not done by measuring the level. In addition, by adding bone marrow stromal cells in the bioassay,
Other requirements may be provided that may play a role in the synergistic response.

In addition, cell proliferation can be examined by monitoring DNA synthesis. A non-radioactive colorimetric assay for 5-bromo-2'-deoxy-uridine (BrdU) uptake (Boehringer Mannheim, Indianapolis, Ind.) Can be performed in a microtiter plate format. Here, cells are cultured in 96-well plates and incubated with BrdU and suboptimal concentrations of cytokines. The amount of BrdU is measured after labeling with peroxidase-labeled anti-BrdU antibody. The final results are analyzed by a 405 nm ELISA plate reader.

A radioactive mitogenic assay (Rynees and Ross, which measures the rate of DNA synthesis as an indicator of proliferation,
Methods of Enzymol. 109: 749-773, 198.
5) can also be used. These assays examine changes in [ ³ H] -thymidine incorporation rates in target cells. Also, these assays allow simultaneous and rapid screening of many antibody fragments. They are commonly used as a convenient way to assess the stimulatory and inhibitory effects on the growth of many different cells. The cells are cultured in suspension until they reach an exponential growth rate. The cells are then washed out of the culture medium in which they were cultured and recultured in fresh medium. About 1-
96 in a total volume of 100 μl at a concentration of 2 × 10 ⁵ cells / ml
Aliquot into well plates. Dilution of phage supernatant, soluble dimerized Fab or scFv antibody was added and cells were incubated at 37 ° C. in a gas-fed CO ₂ incubator.
Incubate for 48 hours. After incubation, [ ³ H] thymidine (937 kBq) is added to each well and incubated for an additional 4 hours. Then
Cells are removed from the incubator and counted directly on a benchtop microplate scintillation counter, eg, Packard TopCount NXT Instruments (Packard, Meriden, Connecticut). Alternatively, cells can be serially transferred to a GF / C filter in a Millipore cell harvester (Millipore, Bedford, Mass.) Or similar device.
Then, the radioactivity associated with the acid-insoluble substance retained on the filter is measured. Apply commercially available dilutions of growth factors to positive control wells. Negative controls include supernatants from cells bearing non-inserts containing similarly tested plasmids or unrelated antibodies. The growth-promoting activity in the samples is quantified by comparing the relative growth-promoting activity of the standards and dilutions of the phage supernatant under test.

Activation can be tested by assaying a second messenger or by a transcription readout assay. Survival can be assayed, for example, by monitoring apoptosis using an assay, such as a tunnel assay, or by other methods known to practitioners in the art.

Other useful assays to analyze cell signaling, activity of kinases and phosphatases and ultimately cell activity as a result of agonist activity include second messengers such as cAMP, Ca ⁺⁺ , diacylglycerin (DAG). ) And isositol 1,4,5-triphosphate (IP3) production. Measurement of intracellular calcium concentration, intracellular pH and spikes in membrane potential in a high throughput screening assay was performed using an instrument such as the FLIPR fluorometric imaging plate reader system (Molecular Devices, Sunnyville, Calif.). Can be carried out. Some fluorescent probes are available for the second messenger concentration test (Molecular
Probes, Eugene OR). Second messenger concentration measurements can also be performed at the single cell level (Devernaldi, MA and Bruker, G., Proc. Natl.
Acad. Sci. USA 93: 4577-4582, 199.
6). In addition, assays that examine other signaling events such as phosphorylation, apoptosis or RNA or protein levels of specific genes are also useful. For example, most cytokines have been shown to activate the enzyme PI3-K (Silvenoinen, O., Ele, J.
N., Signaling by the Hematopoietic Cytokine Recep
Outlined in R. Tors. G. Randes Company, Austin, Texas, 1996). Furthermore, the Jak group of tyrosine kinases has been shown to be central messengers of cytokine receptor signaling (Ile, JN, Vitzn, BA, Kelle, FW Annu. Rev. Immunol. 13:
369-398, 1995). In addition, some other tyrosine kinases, such as members of the Src family, are activated in response to certain cytokine stimuli. In the case of RNA or protein, c-Jun, c-Fos and N
fκβ is rapidly and transiently upregulated upon cytokine stimulation, and c-Myc induction is slow. These proteins are required for G1 transitions and proliferation (Silvenoyenen, O., Ehle, JN.
Signaling by Hematopoietic Cytokine Receptors. G. Randes Company, Austin, Texas 1996). High throughput screens that detect increases in these transcripts may also be utilized.

In the transcription readout assay, changes in transcription of specific genes are observed after exposure of cells to growth factors or growth factor mimetics (agonists or inhibitory antibodies). For example, in a myc readout assay, cells were deprived of IL-3 growth factor for 8 hours from an IL-3 dependent FDCP-mixed cell line, which was then exposed to a growth factor mimic or natural growth factor for 2 hours at 37 ° C. Expose. At this point, cells are harvested, RNA is isolated and reverse transcriptase polymerase chain reaction (RT-PCR) is performed using primers specific for the myc gene. PCR products are quantified by subjecting the RT-PCR reaction to horizontal agarose gel electrophoresis. in this case,
Expression of a single gene is monitored.

Alternatively, assays for changes in gene expression can be monitored using CHIP technology and agonist antibodies can be identified under high probe sensitivity conditions and dynamic range. Thus, 10,000 or less can be analyzed for changes in expression. Among the desired genes that can be monitored are especially c-myc, c-jun, N
F-κβ can be mentioned. These genes are downstream of various signal transduction pathways, and their expression naturally changes during mitogen response. One type of commercially available CHIP (Affymetrix, Santa Clara, Calif.) Allows oligonucleotides from the desired test gene to be printed out on a glass surface. The target cells are exposed to the test agonist antibody. RNA is isolated from cells exposed to the test agonist antibody, copied into cDNA and transcribed in vitro in the presence of biotin. Hybridization of in vitro transcribed, biotinylated mRNA is used as a probe in these sequences. Genes exhibiting increased transcription upon exposure to the test agonist antibody are then measured by scanning the chip. DN for another version of CHIP technology (Insight, Palo Alto, CA)
Since the amount of A is not normalized on glass, competitive hybridization is set up. RNA is isolated from cells before and after exposure to agonist. CDN from each sample
A is made, in which one cDNA reaction incorporates one label, eg Cy-3, and the other cDNA population incorporates a different label, eg Cy-5. Images are collected by detecting the signal and comparing with dual laser scans.

Visual Assays All scFvs or Fabs that show a proliferative response in the above assay are also tested by the traditional methylcellulose colony formation assay (Stem Cell Technologies, Vancouver BC, Canada). In these assays, colony growth and morphological changes are evaluated by light microscopy.

Visual examination for growth or differentiation effects in semi-solid agar cultures or methylcellulose was performed using unsorted or sorted primary hematopoietic cells and stem cell lines (Stem Cell Technologies, Vancouver BC, Canada). Get (Eves, CJ Assays of
Hemopoietic Progenitor cells. Williams Hematology
5 (E. Butler, MA Lichtmann, BS Coller and TJ Kipps, Ed.), McGraw-Hill, Inc., L22-L26, 1995).

The hematopoietic colony assay uses a culture medium that maximizes the growth and differentiation of hematopoietic cells. The addition of methylcellulose facilitates the recognition and enumeration of different colonies because the clonal progeny of a single progenitor cell remain in one place. All necessary ingredients are basic methylcellulose medium (eg Iscove MDM, BSA,
β-mercaptoethanol, L-glutamine), but supplements colony stimulating factor. See if they can be replaced by growth factors by adding test antibodies (phage supernatant, soluble antibody). 5 in the air
After the addition of the antibody in a humidified atmosphere of 37 ° C. in% CO ₂ , hematopoietic cells in methylcellulose culture are incubated for 10-12 days. After 10-12 days of incubation,
Colonies are counted using an inverted microscope. 8-1
After 0 days, colonies are counted again. A comparison is made between the antibody and control containing medium in the presence and absence of growth factors. Furthermore, individual cells can be examined cytologically by picking colonies from methylcellulose and staining with Wright's dye (Atlas of Hematological
See Cytology, FGJ Hayho and RJ Fremans, Willie-Interscience 1970).

Another example of a visual assay is Pichia co-culture with bone marrow cells. For example, one or more FA
After sieving the CD34 + or human fetal liver library by CS or magnetic sorting, the antibody gene was cloned from the screened library into a Pichia expression vector to place the antibody gene under control of the pGAP promoter, Secreted from cells using factor-leading sequences (Invitrogen, Carlsbad,
California) (Das, RC, Schulz, JL, Lehmann, DJ, Mol. Gen. Genet. 218: 240-8, 19)
89). Pichia transformants are selected with YPD + Zeocin. The colonies are replica-plated on an "Iscoves plate" (Iscoves medium + agar). The cells are scraped from the plate in 5 ml Iscoves medium, centrifuged, resuspended in 06 ml Iscoves medium and counted. Thaw methylcellulose medium without added growth factors (Catalog # 4230 Stem Cell Technologies, Vancouver BC, Canada). 5000 Pichia cells and 50,000 human bone marrow CD34 + cells are cultured in medium per 3 cm dish. Incubate the plates in a humidified atmosphere of 37 ° C, 5% CO2. Evaluation is performed on days 5-12. When bone marrow colonies are shown, nearby yeasts are picked from methylcellulose and retested in a similar manner. Antibody genes can be fingerprinted from Pichia by whole cell PCR and restriction digestion with ECORII. By purifying the antibody released into the medium and using it in a FACS sorting method, the population of cells to which the antibody binds can be examined in the presence of other known fluorescein-conjugated antibodies. Here, the primary antibody is secreted from yeast. Two
The secondary antibody is a HA.11-FITC conjugate (Babco, Berkerry, CA).

Stem Cell Assays Candidates identified in stem cell-specific assays were cultured in serum-free medium for their ability to stimulate regeneration (Stem Cell Technologies, Vancouver BC, Canada), and in the presence of agonist. Long-term culture starting cells (LT
C-IC) will be further analyzed (Stem Cell Technologies, Vancouver BC, Canada). Agonists that would expand LTC-IC in vitro were identified by restriction enzyme footprinting and DNA
Unique clones are identified by subjecting them to DNA analysis, including sequencing. By further assaying for specific agonists, cells cultured in the presence of agonists showed that irradiated mice (Hodgson, GS and Bradley, TR, Nature 281: 381-382, 1979,
Harrison, DE, Blood 55: 77-81, 1980)
Or NOD / SCID mouse (Coneary, E., Kashman, J., Pezzer, A., Ears, C., Proc. Natl.
Acad. Sci. USA 94: 9836-9841, 19
In 97) it is determined whether it supports long term transplantation.
Agonists found to be of interest by these criteria are subjected to sequence analysis, binding studies and used to identify receptors through immunoprecipitation, protein sequence analysis and database searches.

Effect of Receptor If the receptor encodes a kinase or the receptor induces a kinase activity even when the receptor is unknown, the receptor-containing membrane extract is used in the presence of the test compound (antibody). [Γ-
By incubating with 32P] ATP,
Receptor phosphorylation can be examined. The extracts are then examined for receptor phosphorylation by gel electrophoresis and autoradiography. These and other techniques for examining receptor phosphorylation are familiar to practitioners in the art.

Antibody Synthesis Once antibody fragments have been identified in a bioassay, they are selected for high level expression as soluble antibody fragments. Soluble ScFv or Fab fragments can be isolated from bacterial hosts such as Top
10F '(Invitrogen, Carlsbad, CA).

Single colonies of cells are grown up and the soluble antibody fragment is purified using the vector-engineered His6 sequence, for example by the nickel-chelate chromatography method.

Using the techniques known to those of ordinary skill in the art, it should be possible to synthesize antibodies in other organisms such as yeast, mammals, insects and plants (Carlsson, JR and Weissmann, IL, Mol. Cell. Biol.,
8: 2647-2650, 1988, Toril, JJ, Shirtman, AR, Gangley, S., Curr. Opin. Biotechn.
ol. 6: 553-560, 1995, Hyatt, A.,
Kafferky, R., Bowdish, K., Nature 34
2: 76-78, 1989).

Example 2 Identification of Growth Factor Receptors First generation agonist molecules were categorized according to the cell type that they appear to be proliferating and / or differentiating.
Receptors can be identified using several methods including immunoprecipitation and affinity chromatography and chemical cross-linking, followed by protein sequencing and database searching.

For immunoprecipitation, cells are radiolabeled, lysed in the presence of a detergent such as Triton X-100, and the bound protein is precipitated by antibody and SD
It can be analyzed by S-PAGE followed by autoradiography. Thus, this provides for detection of the receptor, characterization of its molecular size, and identification of other subunits or associated proteins. In addition, the proteins can be electrophoretically transferred to a sheet of polyvinylidene difluoride (PVDF) and stained with Coomassie blue. The separated bands can be removed, analyzed by an automated protein sequencer, and then database searched to determine if the receptor is novel or previously identified. Furthermore, by cleaving the protein with a proteolytic enzyme, the internal amino acid sequence can be measured.

In conventional immunoaffinity purification, the antibody is covalently attached to a solid phase matrix. Typically, the antibody is attached to Sepharose. Cell lysates are prepared in the presence of detergents such as Triton X-100 to produce lysed and solubilized integral membrane proteins. The lysate is applied to the column, the column is washed and the bound proteins are eluted by a brief exposure to high or low pH buffer. Each is followed by partial amino acid sequencing and database search. Alternatively, specific elution can be performed with soluble scFv. Pre-columns are often used to reduce non-specific binding. When multiple types are present, cell surface radioreceptor cross-linking of radiolabeled scFv to intact cells can determine which are the ligand binding subunits for agonists.

Expression cloning methods may also be used. A cDNA library is constructed from cells that respond to the antibody. The library is cloned into a mammalian expression vector and transfected into mammalian cells. Cells expressing the receptor are identified by affinity chromatography or "conventional sieving", in which antibody phage of a single species each have different cD
It has been placed in contact with a pool of cells expressing NA clones.

Once the receptor has been identified, it can be cloned using standard molecular biology techniques. By carrying out a transient transfection assay with the cDNA encoding the receptor in mammalian cells, it can be established that it is the receptor recognized by the antibody. For example, COS cells can be used for receptor expression (Nail, JD, Sellers, JC, Mass Grove, LC, Duck,
LW, Mol. Cell. Endrocrinol. 127: 143-1
54, 1997).

Identification of Natural Ligands Natural ligands of newly identified receptors can be identified by heterologous expression of the receptor in mammalian cells or yeast, preferably cells that normally do not express the receptor. The pool of secreted factors from the expressed cDNA library can be added to receptor expressing cells and analyzed in the same bioassay used to identify agonists (Lee, F. et al., Proc. Natl. Acad. Sci. 82: 4
360, 1985). In addition to transient expression systems, permanent expression systems in retroviral vectors can also be used in these assays (Reiner, JR and Gonda,
TJ, Mol. Cell. Biol., 14: 880, 1994).
Positive responses are linked to individual clones expressing the specific ligand cDNA. In addition, competition experiments can be performed with ligand and agonist antibody, but labeled with ¹²⁵ I or a fluorescent compound.

One of ordinary skill in the art should be familiar with these and other techniques for identifying natural ligands when the receptor is known.

Screening for Inhibitory Antibodies Inhibitory antibodies are screened using the same assays, sieving and bioassays used for screening for agonist antibodies. However, in bioassays, additional growth factors such as IL
-3 may be included in the culture to grow the cells,
Inhibition of proliferation, differentiation, survival or activation is observed.

Example 3 Phage Display Library for Hematopoietic Cells and Other Cell Types The following cells or cell lines: human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, human bone marrow cells subjected to RBC lysis,
Animals (rabbits) were individually immunized with human fetal liver cells, human NTera-2 cell line, murine P19 cell line and mouse FDCP-mixed cell line. Following the protocol of Example 1, rabbits were immunized with whole cells until strong positive responses were detected 3-5 times at 3 week intervals.

Approximately 5 ml of blood was drawn from each animal prior to immunization. The blood was immediately processed into serum by coagulating, centrifuging, precipitating cells and transferring the serum to a new tube. Serum from each animal was stored at -20 ° C. After the first immunization and two boosts, blood was again collected from each animal and processed into serum. A whole cell ELISA was performed comparing pre-immune serum with post-immune serum.
A dilution of serum, eg 1/50 in 5% milk in PBS,
1/100, 1/500, 1/1000, 1/5000
Was manufactured. The same type of cells used for immunization (1
X 10 ⁶ ) was applied to the plates, serum dilutions were added and the cells were incubated. The secondary antibody is an enzyme-conjugated antibody against the host animal IgG being tested,
For example, goat anti-rabbit IgG alkaline phosphatase conjugate or peroxidase conjugate. The results were read visually or the plates were centrifuged and the supernatant removed and placed in new wells for ELISA plate reading. The readings were graphed to determine the half maximal serum response or the dilution giving a response equal to or half the maximal response.

When a positive response was detected, the animals were sacrificed and spleen, bone marrow and peripheral blood lymphocytes were collected. By separating RNA from these organs and constructing a library in the same manner as in Example 1, an antibody fragment library displayed on the surface of phagemid was prepared. The ligation reaction was electroporated into ER2537. Small aliquots were cultured and library cloning efficiency and potential diversity was measured as in Example 1. The results are shown in Table 2.

[0282]

[Table 3]

One of ordinary skill in the art would use the above protocol to treat other animals, such as chickens, with other cell types and lineages, such as yolk sac cells, cells derived from the murine AGM region, murine compound. By immunizing with competent embryonic cells, human embryonic stem (ES) cell lines, cells of neural origin, cells involved in organ or tissue regeneration, phage display to various receptors in some cell types It will be appreciated that additional libraries of antibody fragments can be created.

Pharmaceutical Formulations and Routes of Administration The agents described herein may be administered to a human patient itself, or in a pharmaceutical composition in which it is mixed with a suitable carrier or excipient (s). For the formulation and administration technique of the compound of the present invention, refer to “Remington's Pharmaceutical S
ciences ”Mac Publishing Company, Easton, PA, latest edition.

Routes of administration Suitable routes of administration include, for example, oral, rectal, transmucosal or intestinal administration, parenteral delivery such as intramuscular, subcutaneous, intramedullary injection, intrathecal, direct intraventricular, intravenous, intraperitoneal , Intranasal or intraocular injection. Alternatively, the drug may be administered locally rather than systemically.

In addition, the drug may be administered in a targeted drug delivery system, such as liposomes coated with tumor-specific antibodies. The liposomes are targeted and taken up selectively by the tumor.

Compositions / Formulations The pharmaceutical compositions of the invention may be prepared in a manner known per se, eg by conventional mixing, dissolving, granulating, dragee-forming, pasting, emulsifying, encapsulating, entrapping (fixing) or It can be manufactured using the freeze-drying method.

Thus, the pharmaceutical composition used in accordance with the invention comprises one or more physiologically acceptable excipients and excipients which comprise excipients and auxiliaries which facilitate the processing of the active molecule into pharmaceutically usable formulations. It can be formulated by a conventional method using the obtained carrier. Proper formulation is dependent upon the route of administration chosen.

For injection, the agents of the invention may be formulated in aqueous solution, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution or saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. The penetrants are known in the art.

For oral administration, the drug can be formulated readily by combining the active molecule with pharmaceutically acceptable carriers well known in the art. With the above carriers, the compound of the present invention can be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like for oral ingestion by the patient to be treated. Pharmaceutical formulations for oral administration use solid excipients, optionally milling the resulting mixture, processing the granule mixture after addition of suitable auxiliaries to give tablets or dragee cores if desired. Suitable excipients are especially fillers such as sugars such as lactose, sucrose, mannitol or sorbitol, cellulosic preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum,
Methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinylpyrrolidone, agar or alginic acid or its salts, such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, optionally including gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol and / or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. . By adding a dye or pigment to the tablet or dragee coating,
Different combinations of active compound doses can be identified or characterized.

Pharmaceutical formulations which can be used orally include push-fit capsules made of gelatin, as well as soft, encapsulated capsules made of gelatin and a plasticizer, such as glycerine or sorbitol. Push-fit capsules may contain the active ingredient in admixture with filler such as lactose, binders such as starches, and / or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.

For buccal administration, the drug may take the form of tablets or lozenges formulated in conventional manner.

For administration by inhalation, the agents used according to the invention are conveniently delivered in the form of an aerosol spray, from pressurized packs or nebulizers, in which case a suitable propellant,
For example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas is used. In the case of a pressurized aerosol the dosage unit may be determined by delivering a metered amount with an attached valve. Gelatin capsules and cartridges, for example, for use in an inhaler or insufflator, may be formulated containing the compound and a suitable powder base such as a powder mix of lactose or starch.

The drug may be formulated for parenteral administration by injection, eg by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, eg, ampoules or multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.

Pharmaceutical formulations for parenteral administration include aqueous solutions of the active molecule in water-soluble form. Additionally, suspensions of the active molecule can be prepared as oily injection suspensions. Suitable lipophilic solvents or excipients include fatty oils such as sesame oil or synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, eg sterile pyrogen-free water, before use. The drug may also be formulated in rectal compositions, eg, containing conventional suppository bases, eg cocoa butter or other glycerides, eg as suppositories or retention enemas.

In addition to the formulations described previously, the agents may also be formulated as a depot product. The long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the drug may be provided by a suitable polymeric or hydrophobic material (eg, as an acceptable emulsion in oil) or an ion exchange resin,
Alternatively, it may be formulated as a low soluble derivative, for example as a low soluble salt.

The hydrophobic pharmaceutical pharmaceutical carrier of the present invention is a cosolvent system comprising benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. The cosolvent system is
It can be the VPD solvent system. VPD is a volumetric solution of 3% w / v benzyl alcohol, 8% w / v non-polar surfactant polysorbate 80 and 65% w / v polyethylene glycol 300 plus an appropriate amount of absolute ethanol. The VPD co-solvent system (VPD: 5W) is composed of VPD diluted 1: 1 with 5% dextrose in aqueous solution. This co-solvent system dissolves well even in hydrophobic compounds and, by itself, has low toxicity upon systemic administration. Of course, the proportions of the co-solvent system can be varied considerably without destroying its solubility and toxic properties. Further, the co-solvent component can also be changed to other components. For example, other low toxicity non-polar surfactants can be used in place of polysorbate 80. The polyethylene glycol fraction size can also be varied. Other biocompatible polymers can also be used instead of polyethylene glycol, such as polyvinylpyrrolidone. Other sugars or polysaccharides may be used instead of dextrose.

Alternatively, other delivery systems for hydrophobic pharmaceutical compounds can be used. Liposomes and emulsions are well known examples of delivery vehicles or carriers for hydrophobic drugs. Certain organic solvents, such as dimethylsulfoxide, may also be used, but usually at the expense of increased toxicity. In addition, the compounds can be delivered using a sustained-release system, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent.
Various sustained release matrices have been established and are familiar to those skilled in the art. Sustained-release capsules may range from a few weeks or less to 1 depending on their chemical nature.
The compound may be released over a period of over 00 days. Depending on the chemical nature and biological stability of the therapeutic reagent, additional methods for protein stabilization can be used.

The pharmaceutical compositions may also include suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin and polymers such as polyethylene glycol.

Many of the agents of the present invention may be provided as salts with pharmaceutically compatible counterions. Pharmaceutically compatible salts can be formed with many acids, such as hydrochloric acid,
Examples include, but are not limited to, sulfuric acid, acetic acid, lactic acid, tartaric acid, malic acid, succinic acid. Salts tend to be readily soluble in the corresponding free base form, aqueous or other protic solvents.

Effective Dosages Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve its intended purpose. More specifically, a therapeutically effective amount means an amount of drug effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure herein.

For any agent used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC ₅₀ as measured in cell culture (eg, the concentration of test molecule that promotes or inhibits cell proliferation or differentiation). The above information can be used to more accurately determine useful doses in humans.

The toxicity and therapeutic efficacy of the agents described herein can be measured, for example, by the LD ₅₀ (the dose lethal to 50% of the population) and ED ₅₀ (the dose therapeutically effective in 50% of the population). It can be measured by standard pharmaceutical methods in cell cultures or laboratory animals for measuring. The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio between LD ₅₀ and ED _50. Molecules that exhibit high therapeutic indices are preferred. The data obtained from these cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. Dose of the molecule is preferably comprised within the range of circulating concentrations that include the ED ₅₀ with no little or no toxicity. The dosage can vary within this range depending on the dosage form used and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's medical condition.
(Eg, Fingle et al., 1975, “The Pharmacologica
l Basis of Therapeutics ”, Chapter 1, page 1).

By individually adjusting the dose and interval, the plasma level or minimum effective concentration (ME) of the active moiety sufficient to promote or inhibit proliferation or differentiation of cells.
C) may be provided. The MEC will vary with each drug but can be estimated from in vitro data using the assay described. The dose required to achieve MEC will depend on the particular characteristics and route of administration. However, HPLC
Plasma concentrations can be measured by using assays or bioassays.

Dosage intervals can also be determined using MEC value. 10-90% of the time, preferably 30-90%
And most preferably the compound should be administered using an uptake regimen that maintains plasma levels above the MEC between 50-90%.

In the case of local administration or selective uptake, the effective local concentration of drug may not be related to plasma concentration. Of course, the amount of drug administered will depend on the subject being treated, the weight of the subject, the severity of the affliction, the manner of administration and the judgment of the attending physician.

Treatment The antibodies and factors covered by the claims of the present invention are useful for the amplification of various clinically relevant cell types. Treatment can be in vivo or ex vivo. For example,
Agonist antibodies are, for example, patients suffering from a deficiency of hematopoietic cell population induced by a disease, disorder or treatment associated with hematopoiesis which is present when the number of cells of a given line (s) present in the patient is below normal. It is useful for the treatment of. Below are provided examples, but only some, of the conditions that can be treated with the claimed antibodies and agents of the present invention, and one of ordinary skill in the art would appreciate that other treatments would benefit from such treatments. It should be possible to identify diseases and conditions. For example, HIV-infected patients, patients undergoing chemotherapy, bone marrow transplant patients and patients suffering from myeloproliferative disorders show lower than normal levels of specific hematopoietic lineages. Neutropenia is
A decrease in the number of circulating terminally differentiated neutrophils. Neutropenia refers to viral and severe bacterial infections, exposure to drugs such as certain antibiotics and anticonvulsants, autoimmune processes such as those found in systemic lupus erythematosus, myeloinfiltrative processes such as leukemia. , Secondary to or associated with some pathophysiological conditions, including, metastatic tumors and myelofibrosis, and inborn errors of metabolism, such as propionic acidemia and isovaleric acidemia. Some chronic primary neutropenic diseases are inherited, such as periodic neutropenia, while others occur with impaired immune function, such as the Epstein-Barr virus. Or, it is caused by human immunodeficiency virus infection. Other pathologies may be associated with chronic idiopathic neutropenia, including Schbachmann syndrome, X-linked agammaglobulinemia, hypogammaglobulinemia and hypocellular cellular immunity. Acquired granulocytopenia is a blood disorder characterized by a reduced number of granulocytes in the circulation due to impaired granulocyte production in the bone marrow. Patients undergoing renal dialysis often suffer from treatment-related anemia in which red blood cell levels are below normal. In aplastic anemia, myelosuppression may induce pancytopenia or may only affect red blood cells, white blood cells or platelets. Agonist antibodies and factors augment the medical facility of therapeutic agents for these and other diseases and disorders characterized by a deficiency of specific cell populations, such as hematopoietic cells.

The antibodies and factors covered by the claims of the present invention are also useful for suppressing clinically relevant cell types. For example, abnormal proliferation of hematopoietic cell populations includes diseases in which the number of cells of a given lineage (s) present in a patient is higher than normal. Chronic myelogenous leukemia is a disease characterized by myeloproliferation due to the presence of chromosomal translocations in hematopoietic stem cells. Thrombocytopenia is a disease characterized by an increased number of megakaryocytes. Polycythemia vera, granulocytes, monocytes,
Is a form of myeloproliferative syndrome in which platelet and red blood cell counts are usually high. The disease is induced by neoplastic clones of hyperproliferating stem cells. Allergic diseases,
In rhinitis, asthma and eczema, for example, there is an overproduction of basophilic cells, mast cells and eosinophils. The inhibitor of eosinophil, mast cell and basophilic cell production shown by the claims of the present invention can serve as a therapeutic agent for patients with severe allergy. Furthermore, the clinical use of inhibitors in chemotherapy can suppress the growth of normal cells, and cancer cells continue to grow throughout the cell cycle, making them more sensitive to chemotherapeutic agents.

Molecules covered by the claims of the present invention may also be used for ex vivo proliferation and differentiation of cells.
It is useful for gene therapy purposes, such as traditional viral vector methods, and autologous bone marrow transplants. Gene transfer to hematopoietic progenitor cells is a major goal of gene therapy for malignant and non-malignant diseases. Most gene therapy vectors used require mitosis for integration of the viral genome into cellular DNA. Integration is preferred because a single stem cell divides to form many progeny cells. Agonist antibodies, factors or combinations of the above administered prior to or during vector exposure may promote ex vivo proliferation of stem cells.

In addition, the antibodies of the invention can be radiolabeled for radioimmunotherapy or conjugated to toxins to deliver them to specific cell types, thereby killing those cells.

Diagnosis and Purification Molecules included in the claims include cell line-specific antibody fragments conjugated to a fluorescent marker or used as a primary antibody, with a secondary antibody associated with the fluorescent marker. It can be used in conjugated diagnostics and can be used in flow cytometric analysis to identify clinically relevant cell types, eg, in the blood or bone marrow of a patient. In addition, these molecules can be used in cell separation methods such as fluorescence activated cell sorting (FACS) or magnetic sorting. In the fluorescence activated cell sorting method, cells labeled with a fluorescent molecule are sorted electronically on a flow cytometer, such as a Becton-Dickinson (San Jose, Calif.) FACSIV cytometer or an instrument of equivalent content. Fluorescent molecules are antibodies that recognize specific cell surface antigens. The antibody is conjugated to a fluorescent marker such as fluorescein isothiocyanate (FITC) or phycoerythrin (PE). In the magnetic sorting method, the antibody is directly or indirectly conjugated to magnetic microbeads. Cells are pre-coated with cell surface molecules such as agonists or inhibitory antibodies that recognize receptors involved in proliferation, differentiation, activation or survival. The antibodies are conjugated to agonist or inhibitory antibodies, eg, magnetic beads conjugated with secondary immunoglobulins that bind HA molecule labels engineered to each antibody. The cells are then removed with a magnet. Magnetic sorting is a positive selection in which cells of interest are bound by an antibody or magnet.
Or it could be a negative choice to separate unwanted cells onto the magnet.

Alternatively, the radiolabeled antibody may be used for diagnostic purposes. Other embodiments are within the scope of the claims.

[0315] [Brief description of drawings]

FIG. 1 shows a schematic of the vector used for phage display.

FIG. 2A shows a schematic of the primers used in the scFv cloning scheme.

FIG. 2B shows a schematic of the primers used in the scFv cloning scheme.

FIG. 3A shows a schematic of the primers used in the Fab cloning scheme.

FIG. 3B shows a schematic of the primers used in the Fab cloning scheme.

FIG. 3C shows a schematic of the primers used in the Fab cloning scheme.

FIG. 3D shows a schematic of the primers used in the Fab cloning scheme.

FIG. 4 shows a schematic of the ScFv cloning scheme.

FIG. 5A shows a schematic of the vectors used in the Fab cloning scheme.

FIG. 5B shows a schematic of the vectors used in the Fab cloning scheme.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁷ Identification code FI C12Q 1/68 G01N 33/566 G01N 33/566 C12N 15/00 ZNAA (56) Reference JP-A-56-95118 (JP, A) ) JP-A-56-95120 (JP, A) JP-A-56-95121 (JP, A) JP-A-8-208697 (JP, A) Bone, 1997, vol. 21, no. 3, p. 225-235 Methods in Enxymology, 1993, vol. 217, p. 228-257 (58) Fields investigated (Int. Cl. ⁷ , DB name) G01N 33/53 C07H 21/04 C07K 16/28 C12N 15/09 ZNA C12P 21/08 C12Q 1/68 G01N 33 / 566

Claims (16)

(57) [Claims] 1. A method for identifying an agonist antibody or an inhibitory antibody against a receptor involved in cell proliferation, differentiation, survival or activation, which comprises immunizing an animal with cells having a surface molecule containing the receptor. by, producing a plurality of immune cells expressing one or more antibodies against surface molecules, including nucleic acid sequence encoding the antibody, to prepare a library from the plurality of immune cells, the live Cloned the nucleic acid sequence from the rally into a surface display vector to surface display the antibody, and target cells to screen the surface displayed antibody for agonist or inhibition of the receptor. A method comprising identifying a sex antibody. 2. The method of claim 1, wherein the receptor is a growth factor receptor. 3. The method of claim 1 or 2, wherein the antibody is a scFv fragment. 4. The antibody is a Fab fragment.
The method according to claim 1 or 2. 5. The method according to claim 1, wherein the surface display vector is a phagemid vector. 6. The method of claim 5, wherein the antibody is a scFv fragment and the scFv fragment displayed on phagemid for binding to target cell receptors is screened and in a functional assay. A method comprising identifying one that is an agonist antibody for the receptor by screening the scFv fragment that binds to the receptor. 7. The method of any one of claims 1-5, wherein the antibody is a Fab fragment and the surface-displayed Fab fragment is screened for binding to a target cell receptor. And dimerizing the Fab fragment that binds to the receptor, and screening the dimerized Fab fragment in a functional assay to identify one that is an agonist antibody for the receptor. Method. 8. The cells are unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells,
Unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, cells derived from the murine AGM region, human or murine embryonal carcinoma cells or strains, human or mouse pluripotent teratocarcinoma cells or strains, Murine pluripotent embryonic cells, human embryonic stem (ES) cell lines, cells of neural origin, cells involved in organ or tissue regeneration, human bone marrow cells undergoing RBC lysis, human bone marrow mononuclear cells, human bone marrow C
8. Any of claims 1-7 selected from the group consisting of D34 ⁺ cells, FDCP-mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem cell line, P19 teratocarcinoma cells and NTera-2 pluripotent embryonal carcinoma cells. The method according to item 1. 9. The method of any one of claims 1-8, wherein the library is a combinatorial library. 10. The method of any one of claims 1-9, further comprising growing cells expressing an antibody fragment in the presence of target cells expressing a receptor to which the antibody is directed. , And by screening the antibody fragments,
A method comprising identifying an agonist antibody. 11. A combinatorial library prepared by the method according to claim 1. 12. A method for producing a combinatorial antibody library encoding an antibody against a receptor involved in cell proliferation, differentiation, survival or activation, or a fragment thereof, which comprises a cell having a surface molecule containing the receptor. Immunizing an animal produces a plurality of immune cells that express one or more antibodies or antibody fragments directed against the surface molecule, from which the variable and constant regions of the antibody fragment are generated. obtaining nucleic acid sequences encoding the nucleic acid sequence encoding the variable region of the antibody fragment by combining at random, to produce a combinatorial library of nucleic acid sequences encoding the antibody fragments, the surface of nucleic acid sequences of the library The antibody fragment by cloning into a display vector Method comprising the surface display. 13. Furthermore, prior to obtaining a nucleic acid sequence encoding said antibody fragment comprises the step of screening the sera obtained from the immunized animal for binding to said cells, The method of claim 12, wherein. 14. The cells are unsorted human bone marrow cells, human peripheral blood cells originating from human bone marrow, sorted human bone marrow cells, unsorted murine bone marrow cells, sorted murine bone marrow cells, fetal liver cells, yolk sac cells, mice. Cells derived from AGM region, human or murine embryonal carcinoma cells or lines, human or mouse pluripotent teratocarcinoma cells or lines, murine pluripotent embryonic cells, human embryonic stem (ES) cell lines, neural origin , Cells involved in organ or tissue regeneration, human bone marrow cells subjected to RBC lysis, human bone marrow mononuclear cells, human bone marrow CD34 ⁺ cells, FDCP-mixed murine hematopoietic stem cell line, B6SUTA murine hematopoietic stem cell line, P19 14. The method of claim 12 or claim 13 selected from the group consisting of teratocarcinoma cells and NTera-2 pluripotent embryonal carcinoma cells. 15. The method according to any one of claims 1 to 9, wherein the antibody is an inhibitory antibody for cell growth, differentiation, activation or survival, and further, target cell growth or differentiation. , A method comprising identifying inhibitory antibodies by screening the surface-displayed antibodies for inhibitors of activation or survival. 16. The method of claim 15 , further comprising growing cells that express the antibody fragment in the presence of target cells that express the receptor to which the antibody is directed,
Then, a method comprising the step of identifying an inhibitory antibody by screening the antibody fragment for one that inhibits proliferation, differentiation or activation of target cells.