JP3439492B2 - Method for detecting human subtype 6 (HHV-6) DNA and identifying subtypes - Google Patents

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for detecting human herpesvirus 6 (HHV-6) DNA and identifying a subtype of HHV-6.

[0002]

2. Description of the Related Art Human Herpesvirus 6
(Hereinafter referred to as HHV-6) was introduced by Saluhu in 1986.
Acquired immune deficiency syndrome (AIDS) due to ddin
The sixth from the lymphocytes of the elderly and patients with lymphocytic disorders
It was isolated as a herpesvirus (1986, Science,twenty three
Four, 596-601), 1988, sudden onset by Yamanishi et al.
It was revealed to be the causative virus of rash (1988,
Lancet, 1065-1067).

HHV-6 was originally isolated from human immunodeficiency virus (HIV) -positive lymphoma and lymphadenitis, and HIV-negative lymphoma, and HBV lymphoma was HHV-6.
It has been suggested that it may be involved in some blood system diseases such as -6 DNA being found. Also, after kidney transplant,
A relationship with rejection after organ transplantation has been suggested, such as a marked increase in HHV-6 antibody titer and separation of HHV-6 from patient lymphocytes that have undergone rejection (1990, Transp.
lantation, 49 , 519-522).

[0004] In the majority of people, HHV-6 infection has been found to occur within the first year of life, although a survey on antibody prevalence revealed it (1989 J. Clin. Microb.
iol. 27 , 651-653), the transmission route of the virus is still unknown. There are also reports that HHV-6 has been separated from saliva.

Recently, HHV-6 is 2 due to DNA polymorphism.
It is divided into two subtypes (1991 J. Clin. Micr
obiol 29 , 367-372), differences in pathogenicity between types, differences in cell affinity, and differences in proliferative properties, and the differences in biological properties have been noted. So far, type A HHV-6 has been mainly isolated from AIDS patients and patients with lymphocytic diseases.
Et al. Reported that all HHV-6 isolated from patients suspected of having fever due to the initial infection with HHV-6 were type B (1992, The New England Journal of Med).
icine, 326 , 1445-1550).

Thus, HHV-6 typing, or type determination, is considered to be of interest in connection with various diseases. However, the conventional method used for HHV-6 typing is to extract and purify DNA from the isolated virus, digest the viral DNA with a restriction enzyme, subject it to electrophoresis, and examine the polymorphism by its electrophoretic pattern. , Type A and type B specific monoclonal antibodies have been used to identify virus-infected cells by fluorescent antibody staining. However, all of these methods involve operations such as virus isolation and culturing, which not only require a great deal of time and labor, but also could not be identified unless the virus isolation was possible. .

[0007]

SUMMARY OF THE INVENTION As mentioned above, HHV
The -6 typing is considered to be interesting in connection with various diseases, but all of the conventional techniques involve virus isolation by cell culture and are very complicated.

The present invention is an HHV for solving the above problems.
-6 providing type-specific DNA, and HHV-
(6) It is intended to provide a simple typing method.

[0009]

[Means for Solving the Problems] In order to solve the above problems, the inventors of the present invention have been in front of HST strains belonging to HHV-6 type B (K. Takahashi et al., J. Virol. The nucleotide sequence of one of the early genes was determined and compared with the previously reported nucleotide sequence of the same region of U1102 strain belonging to HHV-6 type A (1991, J. Virol 65, 5381-5390). As a result, they found a characteristic difference between the nucleotide sequences of the HST strain and the U1102 strain, and completed the present invention. That is, the HS whose nucleotide sequence was analyzed by the present inventors
Within the immediate early genes of the T strain and the previously reported U1102 strain, a new 2
Insertion of the polynucleotide was observed at several positions (see FIG. 1). One is 108 bp and the other is 228
It was bp. The respective nucleotide sequences are shown in SEQ ID NOS: 1 and 2
Are shown in the sequence listing below.

The novel 108 bp and 228 bp polynucleotide sequences were identified as HHV-type HBV-HBV-HBV-type BHHV-6-type HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HBV-HHV-BH-HBV-HHV-BH-HBV-HHV-B-HHV-B-HHV-BH-HHV-BH-HHV-BH-HHV-BH-HHV-BH-HHV-HHV-6
It is considered to be a sequence characteristic of 6 strains.

Therefore, the present invention provides a nucleotide sequence derived from human herpesvirus type 6 shown in SEQ ID NO: 1 or a nucleotide sequence complementary to the nucleotide sequence,
Alternatively, a partial sequence thereof is provided. The present invention also provides a nucleotide sequence derived from human herpesvirus type 6 shown in SEQ ID NO: 2, a nucleotide sequence complementary to the nucleotide sequence, or a partial sequence thereof.

In the present specification, the term "HHV-6 (sub) type B" is used to refer to the type of HHV-6 containing the polynucleotide sequences shown in SEQ ID NOS: 1 and 2 in viral DNA. To do. In addition, "HHV-6
The term “(sub) type A” is used to refer to the type of HHV-6 that does not contain such a polynucleotide sequence.

Therefore, HHV-6 type A and type B
By utilizing the above difference of, for example, type B
The HHV-6 subtypes (A and B) can be identified by DNA hybridization using the DNA sequence characteristic of the above as a probe.

As described above, the present invention provides a human herpesvirus by DNA hybridization using the nucleotide sequence derived from HHV-6 shown in SEQ ID NO: 1 or a nucleotide sequence complementary to the nucleotide sequence or a partial sequence thereof as a probe. A method for identifying subtypes A and B of type 6 is provided.

The present invention also relates to the HH shown in SEQ ID NO: 2.
Subtypes A and B of human herpesvirus 6 by DNA hybridization using a nucleotide sequence derived from V-6 or a nucleotide sequence complementary to the nucleotide sequence or a partial sequence thereof as a probe
Provide a way to identify.

The present invention further comprises human herpes by DNA hybridization using as a probe both the nucleotide sequence derived from HHV-6 shown in SEQ ID NOS: 1 and 2 or a nucleotide sequence complementary to the nucleotide sequence or a partial sequence thereof. Provided is a method of identifying subtypes A and B of virus type 6.

For DNA hybridization, the technique described in Molecular Cloning, 1989 etc. is applied. At this time, an enzyme (for example, alkaline phosphatase), a radioisotope (for example, ³² P), or the like is used as a labeling substance for the labeled DNA.

When the HHV-6 content in a human sample such as blood is low, for example, in the early stage of infection, the above 108 b is used.
If DNA is amplified by carrying out polymerase chain reaction (PCR) using a primer set having a sequence common to types A and B, sandwiching p and 228 bp insertion regions,
It is possible to distinguish both types from the difference in the length of the PCR product.

Preferred examples of the primer set that can be used for the above purpose are listed below. These primer sets are the novel ones present on HHV-6 type B DNA.
HHV-6 near the 08 bp and 228 bp nucleotide sequences
It was specifically selected from the common sequences of type A and type B DNA. The sequence actually used as a primer is a partial sequence or the entire sequence of the nucleotide sequence shown in the sequence of the primer set. In addition to the nucleotide sequences listed below, it is also possible to select various possible sequences based on the determined sequences and apply them to the identification method of the present invention.

Primer Set-1 Primer I: 5'-TGATGGCACACAACAAAGAGAT
GTCCAATCCTGACATCTCCA-3'5'-AAGCAGATGAATCAAATCTT-
3'5'-ATGTGAATTTGTAAAAATTTAAT
TACTGCCGCCAAAAAT-3'5'-TGAATTTTCATGGCAA-3'5'-TTATGATGATACTGGTTT-3'5'-ATTAACCTTTAACT-3'5'-AGTCTCCATCTGTAGATCT-3'5'-ATTATTCAGAGAGACTCT
GAATCTATCCATGAAGATGATGAC-
3'primer II: 5'-GGATTTCCTGGGCACATCTGGA
GAA-3 '5'-TGGACATCATTT-3'5'-TCTGGAGAAGGAGT-3'5'-TTTGGATTTTCCCTGGCAC-3'5'-CTGTCTCGCT-3'5'-TACACAGGTTAGGG-3'5'-AGGGCCGCCACATCTCT
GAGGCTGTAC-3 '5'-TTCCCTGGCACATCTGGGAGAAG
GAG-3 ′ primer set-2 primer I: 5′-TTCTCCAGATGTGCCAGGGAAA
TCC-3'5'-AAAATGTTATCCA-3'5'-ACTCCTTTCTCCAGA-3'5'-GTGCCAGGGGAAATCCAAAA-3'5'-AGCAGACAG-3'5'-CCCTACTGTGTA-3'5'-GTACAGCCCTCAGTGACACT
GGGGCGCCCT-3 '5'-CTCCTTCTCCAGATGTGCCAGG
GAA-3 ′ Primer II: 5′-ATCATTTCTGATATTAAAG-3 ′ 5′-GAGTGATCAGTTTCATAACCAA
A-3 '5'-TTTTCATCATTGTTATCGCTTTC
ACTCTCATA-3 '5'-TGCAATGTAATCA-3'5'-TATTCATATGAATGTTATTTAGT
TCT-3 '5'-TTGCTAAATGGGTTATTCTCAT
-3 '5'-GTGACCTCTGGTGGTGAA -3 ' primer set -3 primer I: 5'-TGATGGCACACAACAAAGAGAT
GTCCAATCCTGACATCTCCA-3'5'-AAGCAGATGAATCAAATCTT-
3'5'-ATGTGAATTTGTAAAAATTTAAT
TACTGCCGCCAAAAAT-3'5'-TGAATTTTCATGGCAA-3'5'-TTATGATGATACTGGTTT-3'5'-ATTAACCTTTAACT-3'5'-AGTCTTCCATCTGTAGATCT-3'5'-ATTATTCAGACGGACTCT.
GAATCTATCCATGAAGATGATGAC-
3'primer II: 5'-ATCATTTCTGATATTAAAG-3 '5'-GAGTGATCAGTTTCATAACCAA
A-3 '5'-TTTTCATCATTGTTATCGCTTTC
ACTCTCATA-3 '5'-TGCAATGTAATCA-3'5'-TATTCATATGAATGTTATTTAGT
TCT-3 '5'-TTGCTAAATGGGTTATTCTCAT
-3'5'-GTGACCTCTGGTGGTGAA-3 '.

For example, when the above-mentioned primer set-1 is used, the length of the PCR amplification product of the HHV-6 type B strain is 108 bp longer than that of the type A strain. When the primer set-2 is used, the type B strain is 228 bp longer than the type A strain. When the primer set-3 is used, the type B strain is 336 bp longer than the type A strain. PC with HHV-6 type B strain and type A strain regardless of which primer set is used
Since there is a large difference in the length of the R product, it is possible to easily distinguish both strains by size analysis such as ordinary agarose gel electrophoresis.

Therefore, according to the present invention, the primer I and the primer I selected from the above-mentioned primer set-1 are selected one by one.
Using the combination of II, the polymerase chain reaction of human herpesvirus type 6 (HHV-6) DNA in the sample was performed to amplify the HHV-6 DNA, and the amplified product was subjected to size analysis and the sequence number: HHV-6 shown in 1
HHV-6 DNA containing a derived nucleotide sequence or a nucleotide sequence complementary to the nucleotide sequence or a partial sequence thereof, and HHV-6DN not containing the sequence
A method of distinguishing between HHV-6 subtypes A and B is provided.

The present invention also provides the above-mentioned primer set-2.
After amplifying the HHV-6 DNA by polymerase chain reaction of human herpesvirus type 6 (HHV-6) DNA in a sample using a combination of primers I and II selected one by one from among The amplified product is subjected to size analysis, and HHV containing the nucleotide sequence derived from HHV-6 shown in SEQ ID NO: 2 or a nucleotide sequence complementary to the nucleotide sequence or a partial sequence thereof.
A method for separating HHV-6 subtypes A and B by separating V-6 DNA from HHV-6 DNA not containing the sequence is provided.

The present invention further provides the above-mentioned primer set-
Primers I and II selected one by one from among 3
Human herpesvirus 6 in the sample using the combination of
After carrying out the polymerase chain reaction of the type (HHV-6) DNA to amplify the HHV-6 DNA, the amplified product was subjected to size analysis to obtain the HHV shown in SEQ ID NOS: 1 and 2.
-6-derived HHV-6 DNA containing a nucleotide sequence or a nucleotide sequence complementary to the nucleotide sequence or a partial sequence thereof, and HHV-6 not containing the sequence
HHV-6 subtypes A and B separated into DNA
Provide a way to identify.

Here, known techniques are applied to the polymerase chain reaction, and techniques such as agarose gel electrophoresis are used in size analysis, and these methods are not limited to particular ones.

When PCR was carried out using 13 strains of which the type of HHV-6 had already been clarified using the above-mentioned primer set-2, bands each having a characteristic length for each type were confirmed. It became clear that HHV-6 can be typed by the present invention (see FIG. 2).

When the amount of DNA amplified by PCR is sufficient, the DNA can be confirmed by staining with ethidium bromide after agarose gel electrophoresis.
In a sample with a small amount of HV-6 DNA, a specific band may not be confirmed by ethidium bromide staining even after PCR. In such a case, after Southern blotting, the presence of HHV-6 DNA can be identified by the hybridization method using the polynucleotide in the primer set as a probe.
The polynucleotide sequences in these primer sets are
Since the sequence is common to both types A and B, HHV-6 DNA of either type can be detected. On the other hand, when part or all of the polynucleotide sequence shown in SEQ ID NO: 1 or its complementary sequence is used as a probe, this polynucleotide sequence is a sequence that does not exist in the type A HHV-6 DNA. It hybridizes only with the HHV-6 DNA of B. Here, when PCR is performed using primer set-1 or -3, a part or all of the polynucleotide sequence shown in SEQ ID NO: 1 or its complementary sequence is used as the type B-specific probe. When the primer set-2 or -3 is used, a part or all of the polynucleotide sequence shown in SEQ ID NO: 2 or its complementary sequence is used as the type B-specific probe.

Therefore, after PCR was carried out using the primer set-1, -2 or -3, the presence of HHV-6 DNA was detected by using a part or all of any one of the polynucleotide sequences in these primer sets as a probe. After confirming, the HHV-6 type B was identified by identifying HHV-6 type B with a part or all of any one of the polynucleotide sequences shown in SEQ ID NO: 1 or 2 or its complementary sequences as probes. It can be carried out. Of course, when a large amount of HHV-6 DNA is available, HHV-6 can be obtained by omitting the PCR process and directly combining the above polynucleotide sequences as a probe.
-6 typing is possible.

Alternatively, DN of HHV-6 type A and B
A type A-specific probe and a type B-specific probe are set by utilizing the difference in the A base sequence, and hybridization is performed on the PCR product of HHV-6 DNA containing the recognition sites of these probes. It is possible to determine. Examples of effective probes for this include:

Type A specific probe: (1) 5'-GAACTCCATCAGCGCGCTC
CAG-3 ′, type B specific probe: (2) 5′-TAAATCCATTACTGGCCTTT
GAA-3 '.

Therefore, the present invention provides the above nucleotide sequence.
(1) and (2) or nucleotide sequences complementary to these sequences, or consisting of a partial sequence thereof, each nucleotide sequence specific to type A and type B is independently used as at least one probe, Also provided is a method of distinguishing human herpesvirus type 6 subtypes A and B by hybridizing with human herpesvirus type 6 DNA in a sample.

According to the present invention, the following nucleotide sequence: (1) 5'-TGATGGCACACAACAAAAGA
GATGTCCAATCCCTGACATCTCCA-
3 '(2) 5'-AAGCAGATGAATCAAATCT
T-3 '(3) 5'-ATGTGAATTGTAAAAATTT
AATTACTGCCGCCAAAAAAT-3 '(4) 5'-TGAATTTTCATGGCAA-3' (5) 5'-TTATGATGATACTGGTTT-
3 '(6) 5'-ATTAAACCTTTAACT-3' (7) 5'-AGTCTTCCATCTGTGAT-
3 '(8) 5'-ATTATTCAGAGGAATCTTCT
ATCGAATCTATCCATGAAGATGATG
AC-3 '(9) 5'-TTCTCCAGATGTGCCAGG
AAATCC-3 '(10) 5'-AAAATGTATCCCA-3' (11) 5'-ACTCCTTCTCCAGA-3 '(12) 5'-GTGCCAGGGAAATCCAAA-
3 '(13) 5'-AGCAGACAG-3' (14) 5'-CCCTAACTGTGTA-3 '(15) 5'-GTACAGCCCTCAGTGACAGA
TCTGGGCGGCCCT-3 '(16) 5'-CTCCTTCTCCAGATGTGCC
AGGGAA-3 '(17) 5'-ATCATTTCTGATATTAAAG
-3 '(18) 5'-GAGTGATCAGTTTCATAAC
CAAA-3 '(19) 5'-TTTTCATCATTGTTATCGCT
TTCACTCTCATA-3 '(20) 5'-TGCAATGTAATCA-3' (21) 5'-TATTCATATGAATGTTTATT
AGTTCT-3 '(22) 5'-TTGCTAAATGGTGTATTCT
CAT-3 '(23) 5'-GTGACCTCTGGTGGTGAA-
DNA using as a probe at least one nucleotide sequence selected from the group consisting of 3'or a nucleotide sequence complementary to the nucleotide sequence and the nucleotide sequences shown in SEQ ID NOS: 1 and 2 or a complementary sequence thereof or a partial sequence thereof. It is also possible to detect HHV-6 DNA by hybridization, therefore the present invention also provides a method for detecting HHV-6 DNA.

[0033]

EXAMPLES Examples of the present invention will be shown below, but the present invention is not limited to these examples.

Example 1 a) Extraction of DNA Human peripheral blood mononuclear cell culture cells were infected with HHV-6, and after culturing, the infected cells were collected by centrifugation. Cell lysis buffer (10 mM Tris-HCl (pH8.0), 150 mM NaC was added to the infected cell sediment.
l, 0.4% SDS, 10 mM EDTA, 1 mg / ml Proteinase K) is added in an amount of 0.4 ml, and the mixture is incubated at 65 ° C. overnight (or at 56 ° C. for 3 hours). After the incubation, 200 μl of phenol / chloroform (1: 1) mixed solution is added, shaken vigorously, and the solution is separated into two layers by centrifugation, and the upper aqueous layer is collected. After repeating the same operation twice more, 300 μl of chloroform was added and the mixture was vigorously shaken and further centrifuged, and then the upper aqueous layer was recovered. The same operation is repeated once more. 10μ in the finally collected water layer
g of yeast tRNA and 3-fold amount of ethanol were added,
Let stand at ℃ for 1 hour or more. After precipitating the DNA by centrifugation, the precipitate is washed with 80% ethanol, air-dried,
It was dissolved in 0.5 × TE (5 mM Tris-HCl (pH8.0), 0.5 mM EDTA) and used as a sample for PCR.

B) HHV-6 DNA by PCR PCR was carried out using the above sample (for PCR, see, for example, RK Saiki et al., Science, 230 , 1350 (198).
5)). As HHV-6, HST strain and U1102 strain were used. The following oligonucleotides were used as primers.

Primer A: 5'-TTCTCCAGA
TGTGCCAGGGAAATCC-3 'Primer B: 5'-GTACAGCCTCAGTGA
CAGATCTGGGC-3 ′ Primer C: 5′-CATCATTGTTATCGC
TTTCACTCTC-3 ′ Primer D: 5′-TATTCATATGAATGT
When performing TATTTAGTTCT-3 ′ PCR, the combinations of the above primers were A and C, A and D, B and C, and B and D, respectively.

The reaction conditions for PCR are as follows:
The final concentration was 10 mM Tris-HCl (pH 8.3), 1.5 mM MgC
l ₂ , 0.01% gelatin, dNTP 200 μM, each primer 5
Add each composition to 0 pM, 2.5 units of Taq polymerase and make the final 50 μl at 90 ° C for 1 minute, 60 ° C
PCR was performed by repeating a cycle of 2 minutes and 72 ° C. for 3 minutes for 25 cycles (FIG. 3). Amplified products were subjected to agarose gel electrophoresis and analyzed by size.

As shown in FIG. 3, the PCR product of the U1102 strain was H in any combination of the four sets of primers.
The length was clearly shorter than the PCR product of the ST strain, and both strains could be easily discriminated.

Example 2 a) Extraction of DNA U known to be type A as HHV-6
1102 strain and GS strain (1986, Science, 234, 596-601)
), An HST strain known to be type B (K.
Takahashi et al., J. Virol., 3161-3163, 1989), Z2.
9 strains (1988, J. Infect. Dis, 157, 1271-1273) and E
nders strain and type A specific monoclonal antibody and type B specific monoclonal antibody reacts with both DA type which is considered to be an intermediate type between type A and type B. We examined whether they could be identified. In addition, as a clinical sample, OK isolated from peripheral blood of patients with acute rash in Japan
HHV-7 (1990, Proc. Natl. Acad. 1990) which is said to have some homology with C strain, NKT strain, 103 strain, 101 strain, Inoue strain and Kitahara strain and HHV-6.
Sci, 87, 748-752). Extraction of DNA was performed according to the method described in Example 1.

B) Typing of HHV-6 by PCR PCR was performed using the DNA extracted from each of the above HHV-6 as a sample. PCR was carried out according to the method shown in Example 1, and the combination of the primers A and C shown in Example 1 was used as the primers. The result is shown in Figure 2.
It was shown to.

With the combination of primers A and C, the HST strain of type B gives a PCR product of 554 bp and the U1102 strain of type A gives a PCR product of 326 bp. As is apparent from FIG. 2, Z29 belonging to type B
Strains and Enders strains are the same type B HST
A band was detected at the same electrophoretic position as the strain, while a GS strain belonging to type A had a band detected at the same electrophoretic position as the U1102 strain of the same type A, and HHV-6 typing is possible by using the method of the present invention. It was verified that In addition, in the DA strain that was considered to be the intermediate type of both types, a weak band was detected near 554 bp in addition to the 326 bp band, which indicates that the DA strain contains both types of virus, not the intermediate type. The possibility was considered.

All the isolates from patients with exanthema subitum in Japan were of the same type B as the HST strain. HHV-7 was not detected by this method.

Example 3 a) Extraction of DNA U known to be type A as HHV-6
HST known to be 1102 strain and type B
Strains were used according to the method described in Example 1, respectively.
Extraction of NA was performed.

B) Preparation of probe A probe utilizing the sequence shown in SEQ ID NO: 1 has 5'-GTAGAAATTTTTAAAATA within the sequence.
CATGGAAG-3 'and 5'-GTTTGTAAG
A set of primers of TTTTTGTCTTGTTGGG-3 ′ was set, and DN was prepared by the PCR method shown in Example 1.
A is amplified and the amplified product is a random primer DNA
It was prepared by labeling with ³² P using a labeling kit (Takara Shuzo).

The probe utilizing the sequence shown in SEQ ID NO: 2 has 5'-ACAACAAAGACA in the sequence.
TTTTGCTTACAGCC-3 'and 5'-GAT
TCACTAGACTTTTCACAGCTCC-3 '
PCR was performed by setting a set of primers
DNA is amplified by the method and the amplified product is labeled with ³² P using a random primer DNA labeling kit (Takara Shuzo).
Prepared by labeling.

C) PCR and Southern Blot Hybridization PCR was performed using the DNA extracted from each of the above HHV-6 as a sample. As a primer, 5'-GAGGAATC was used for amplification of the region containing the sequence shown in SEQ ID NO: 1.
TTCTATCGAATCTATCC-3 'and 5'-
TTCCCTGGCACATCTGGAGAAGGAG
The -3 'combination was used. Amplification of the region containing the sequence shown in SEQ ID NO: 2 was performed using the combination of primers A and C shown in Example 1. PCR was performed according to the method described in Example 1.

The product amplified by PCR was electrophoresed in a 1% agarose gel, and then the DNA was transferred onto a nylon membrane (Hybond N +; manufactured by Amersham). The transferred membrane was treated with 6% SSPE (0.9 M NaCl, 6 mM EDT) containing 2% SDS and 3% skim milk.
A, 0.06 M sodium phosphate buffer (pH 7.
4)) at 65 ° C. for 6 hours, then the solution was replaced with a solution containing ³² P-labeled probe, and hybridization was further performed at 65 ° C. for 16 hours. After the completion of hybridization, the membrane was washed with 2 × SSPE at room temperature for 20 minutes, and further washed with 2 × SSPE at 65 ° C. for 20 minutes twice, 0.2 ×.
Washing with SSPE at 65 ° C. for 20 minutes was performed twice. The washed membrane was contacted with an X-ray film and the film was exposed to light to confirm the presence or absence of probe hybridization.

FIG. 4 is a ethidium bromide staining diagram (A) of the PCR product of the region containing the sequence shown in SEQ ID NO: 1 after agarose gel electrophoresis and hybridization with a DNA probe prepared based on the sequence. The result (B) was shown.

FIG. 5 shows an ethidium bromide staining diagram (A) of the PCR product of the region containing the sequence shown in SEQ ID NO: 2 after agarose gel electrophoresis and hybridization with a DNA probe prepared based on the sequence. The result (B) was shown.

In each case, SEQ ID NOS: 1 and 2
Both of the probes prepared based on the respective sequences shown in 1) hybridized only with the DNA of the HST strain belonging to type B, and did not hybridize with the DNA of the U1102 strain of type A. Therefore, HHV-6 can be typed by using the DNA sequences shown in SEQ ID NOs: 1 and 2 as a probe.

Example 4 a) Extraction of DNA U known to be type A as HHV-6
1102 strain and H known to be type B
DNA was extracted from the ST strain and the cultured human peripheral blood mononuclear cell culture cells of clinical isolates 1 and 2 of unknown type. DNA
Was extracted according to the method described in Example 1.

B) Amplification of DNA by PCR and dot blot PCR was performed using the DNA extracted from each of the above HHV-6 as a sample. PCR was carried out according to the method shown in Example 1, and the primer was the combination of the primers A and C shown in Example 1. Nylon membrane filter (Amer
sham Hybond N +), 0.5 μl each, and treated with 0.4N NaCl for 20 minutes, then 6 × S
Neutralized with SPE.

C) Alkaline phosphatase labeled DNA
Preparation of probe As an HHV-6 type-specific enzyme-labeled probe,
5'-GAACTCCATCAGCGGCCTCCCAG
-3'-oligonucleotide is a type A-specific probe, 5'-TAAATCCATTACTGGC
Since the oligonucleotide having CTTGAA-3 'is used as a probe specific for type B, these are
DNA s manufactured by Applied Biosystems
It was synthesized using synthesizer (381A), and an amino group was added to its 5 ′ end using aminolink II. A DNA having an amino group added thereto is subjected to EMCS [N- (ε-
Maleimidocaproxy) succi
nimide] to maleimidate, while alkaline phosphatase added 2-SH with 2-iminothiolane. An alkaline phosphatase-labeled DNA probe was prepared by mixing and reacting both.

D) Hybridization The membrane filter prepared in b) was treated with 2 × SSPE,
Wash with 0.1% SDS for 5 minutes at room temperature, then 2x SSP
E, wash with 0.1% SDS at 40 ° C for 5 minutes 3
I went there. Hybridization solution (5 x SSP
E, 5 × Denhardt's, 0.5% SDS, 1%
Casein) at 50 ° C. for 30 minutes, and then one of the two enzyme-labeled probes prepared in c) was added (final concentration of alkaline phosphatase 0.1 μg / ml), and the mixture was incubated at 50 ° C. for 1 hour. Hybridization was performed. 1xS after hybridization
Wash with SC, 1% SDS for 5 minutes at 40 ° C for 2 minutes.
Washing with 1 × SSC and 1% Triton X-100 for 5 minutes at 40 ° C. twice, and washing with 1 × SSC for 5 minutes at room temperature twice. Alkaline phosphatase substrate reaction solution (0.3M Tris-HCl, 0.1M NaCl, 50
mM MgCl ₂ (pH 9.8)) was added, and the mixture was incubated at room temperature for 5 minutes, and then the NTB solution [70% N′N-Dime was used.
NTB (Nitro T in tylformamide)
dissolved in a concentration of 75 mg / ml], 33 μl / 7.5 ml, BCI
P solution [100% N'N-Dimethylformam
BCIP (5-bromo-4-chloro) on the side
-50 mg / -3-Indophosphonate
25 μl / 7.5 ml was added thereto and the mixture was reacted at 37 ° C. for 2 hours.

The results are shown in FIG. In A of FIG. 6, a probe specific to type A was used, and in B, a probe specific to type B was used. In addition, PCR product 1 is U1102 strain, 2
Indicates HST strain, 3 indicates clinical isolate 1, and 4 indicates clinical isolate 2. As shown in the figure, the type A specific probe is U
It hybridizes with the PCR product of 1102 strain, but HS
It did not hybridize with the T strain, and the type B-specific probe hybridized with the HST strain but not with the U1102 strain. By using these probes, it is possible to easily and quickly identify the type by performing dot blot without performing Southern blot of the PCR product. In addition, this method revealed that clinical isolate 1 was type A and clinical isolate 2 was type B.

[0056]

EFFECTS OF THE INVENTION Although the typing of HHV-6 is considered to be interesting in relation to various diseases, the typing has hitherto required several weeks or more. INDUSTRIAL APPLICABILITY According to the present invention, the presence or absence of HHV-6 DNA can be determined from a clinical specimen, and its typing can be performed simply and quickly, which is an extremely effective research means in the fields of clinical medicine, basic medicine and the like. Is believed to have been provided.

[0057]

[Sequence list]

SEQ ID NO: 1 Sequence length: 108 Sequence type: Nucleic acid Number of chains: double-stranded Topology: linear Sequence type: genomic DNA Array AATGTAGAAT ATTTAAAATA CATGGAAGTA CAATCTCCTA CTGATAATAA TACTCCCACC 60 CCATCAAAGA ACAATGAATC CCCAACAAGA CAAAAACTTA CAAACATA 108 SEQ ID NO: 2 Sequence length: 228 Sequence type: Nucleic acid Number of chains: double-stranded Topology: linear Sequence type: genomic DNA Array GGTCTGAACA ACAAGACATT TTGCTTACAG CCCCGATCAA AGGTCACAGA CAAAAGAAAG 60 GATTCAGGAA AAAGGTTCTA ACTCCAAGTG TACCGAAACG CTTCCTTGTA TGACCTTTAC 120 CGACTCAGCA ACTCCTGTCA AAAGTCATGA TGCAATTCAG GATACTTTAA ATCCAGAAAG 180 TAAAATAGAC AAAGAATTGG GAGCTGTAGA AAGTCTAGTG AATCTATG 228

T

[Brief description of drawings]

FIG. 1. HS compared to HHV-6 U1102 strain.
The novel 108 bp and 228 bp nucleotide sequence sites on the T strain genome are shown.

FIG. 2 shows the sizes of 13 types of HHV-6 strains and 2 types of HHV-7 strains belonging to either type A or B, obtained by subjecting each viral DNA to PCR amplification and then subjecting to agarose gel electrophoresis. It is a migration photograph showing that the subtypes can be identified by.

FIG. 3 shows that subtypes can be distinguished by size, which was obtained by performing agarose gel electrophoresis after each PCR of DNA of HST strain and U1102 strain using 4 types of primer sets. It is a migration photograph shown.

FIG. 4 is a ethidium bromide staining diagram (A) of a PCR product of a region containing the nucleotide sequence represented by SEQ ID NO: 1 after agarose gel electrophoresis, and hybridization with a DNA probe prepared based on the sequence. It is a photograph showing the result (B).

FIG. 5 is a ethidium bromide staining diagram (A) of a PCR product of a region containing the nucleotide sequence shown in SEQ ID NO: 2 after agarose gel electrophoresis, and hybridization with a DNA probe prepared based on the sequence. It is a photograph showing the result (B).

FIG. 6 is a dot blot photograph showing the result of performing subtype discrimination by hybridization using a probe specific for type A (A) or a probe specific for type B (B).

[Explanation of symbols] 1 U1102 strain, 2 HST strain, 3 clinical isolates 4 clinical isolates

─────────────────────────────────────────────────── ─── Continuation of the front page (56) References J. Clin. Microbio l. , Vol. 29 (2), p. 367-372 (1991) J. Virol. , Vol. 65 (10), p. 5381-5390 (1991) J. Virol. , Vol. 63 (7), p. 3161-3163 (1989) (58) Fields surveyed (Int.Cl. ⁷ , DB name) C12Q 1/68 C12N 15/09-15/90 GenBank / EMBL / DDBJ / GeneSeq CA / BIOSIS / MEDLINE / W PIDS (STN)

Claims (9)

(57) [Claims] 1. A nucleotide sequence derived from human herpesvirus type 6 shown in SEQ ID NO: 1, a nucleotide sequence complementary to the nucleotide sequence, or at least 15
A DNA consisting of a partial sequence having a length of base pairs. 2. A nucleotide sequence derived from human herpesvirus 6 shown in SEQ ID NO: 2 or a nucleotide sequence complementary to the nucleotide sequence, or at least 15
A DNA consisting of a partial sequence having a length of base pairs. 3. Human herpesvirus type 6 subtypes A and B are identified by DNA hybridization using as a probe a DNA consisting of the nucleotide sequence according to claim 1 or a partial sequence thereof having a length of at least 15 base pairs. how to. 4. At least one of the following nucleotide sequences:
Primers I and II consisting of a partial or full sequence having a length of 2 base pairs: Primer I: 5'-TGATGGCACACAACAAAGAGAT
GTCCAATCCTGACATCTCCA-3'5'-AAGCAGATGAATCAAATCTT-
3'5'-ATGTGAATTTGTAAAAATTTAAT
TACTGCCGCCAAAAAT-3'5'-TGAATTTTCATGGCAA-3'5'-TTATGATGATACTGGTTT-3'5'-ATTAACCTTTAACT-3'5'-AGTCTCCATCTGTAGATCT-3'5'-ATTATTCAGAGAGACTCT
GAATCTATCCATGAAGATGATGAC-
3'primer II: 5'-GGATTTCCTGGGCACATCTGGA
GAA-3'5'-TGGACATCATTT-3'5'-TCTGGAGAAGGAGT-3'5'-TTTGGATTTTCCCTGGCAC-3'5'-TACACAGTTTAGGG-3'5'-AGGGCCGCCCAGATCTGTCACT
GAGGCTGTAC-3 '5'-TTCCCTGGCACATCTGGGAGAAG
Human herpesvirus 6 (HHV type 6 in the sample was used by using a combination of primers selected one by one from GAG-3 ′.
-6) The HHV is obtained by carrying out a polymerase chain reaction of DNA.
After amplification of -6 DNA, the amplified product is subjected to size analysis to separate HHV-6 DNA containing the nucleotide sequence according to claim 1 or a partial sequence thereof and HHV-6 DNA not containing the sequence, and HHV-6 A method of identifying subtypes A and B of -6. 5. Human herpesvirus type 6 subtypes A and B are identified by DNA hybridization using as a probe a DNA consisting of the nucleotide sequence according to claim 2 or a partial sequence thereof having a length of at least 15 base pairs. how to. 6. At least one of the following nucleotide sequences:
Primers I and II consisting of a partial or full sequence having a length of 2 base pairs: Primer I: 5'-TTCTCCAGATGTGCCAGGGAAA
TCC-3 '5'-AAAATGTATCCA-3'5'-ACTCCTTTCTCCAGA-3'5'-GTGCCAGGGAAATCCAAA-3'5'-CCCTACTACTGTGTA-3'5'-GTACAGCCCTCAGTGACAGATCT
GGGGCGCCCT-3 '5'-CTCCTTCTCCAGATGTGCCAGG
GAA-3 ′ Primer II: 5′-ATCATTTCTGATATTAAAG-3 ′ 5′-GAGTGATCAGTTTCATAACCAA
A-3 '5'-TTTTCATCATTGTTATCGCTTTC
ACTCTCATA-3 '5'-TGCAATGTAATCA-3'5'-TATTCATATGAATGTTATTTAGT
TCT-3 '5'-TTGCTAAATGGGTTATTCTCAT
-3 ′ 5′-GTGACCTCTGGTGGTGAA-3 ′, using a combination of primers selected one by one, the human herpesvirus type 6 (HHV
-6) The HHV is obtained by carrying out a polymerase chain reaction of DNA.
After amplification of -6 DNA, the amplified product is subjected to size analysis to separate HHV-6 DNA containing the nucleotide sequence according to claim 2 or a partial sequence thereof and HHV-6 DNA not containing the sequence, and HHV-6 DNA is isolated. A method of identifying subtypes A and B of -6. 7. Probe both the nucleotide sequence according to claim 1 or a partial sequence thereof with a length of at least 15 base pairs and the nucleotide sequence according to claim 2 or a partial sequence thereof with a length of at least 15 base pairs. A method for distinguishing human herpesvirus type 6 subtypes A and B by DNA hybridization used as. 8. At least one of the following nucleotide sequences:
Primers I and II consisting of a partial or full sequence having a length of 2 base pairs: Primer I: 5'-TGATGGCACACAACAAAGAGAT
GTCCAATCCTGACATCTCCA-3'5'-AAGCAGATGAATCAAATCTT-
3'5'-ATGTGAATTTGTAAAAATTTAAT
TACTGCCGCCAAAAAT-3'5'-TGAATTTTCATGGCAA-3'5'-TTATGATGATACTGGTTT-3'5'-ATTAACCTTTAACT-3'5'-AGTCTCCATCTGTAGATCT-3'5'-ATTATTCAGAGAGACTCT
GAATCTATCCATGAAGATGATGAC-
3'primer II: 5'-ATCATTTCTGATATTAAAG-3 '5'-GAGTGATCAGTTTCATAACCAA
A-3 '5'-TTTTCATCATTGTTATCGCTTTC
ACTCTCATA-3 '5'-TGCAATGTAATCA-3'5'-TATTCATATGAATGTTATTTAGT
TCT-3 '5'-TTGCTAAATGGGTTATTCTCAT
-3 ′ 5′-GTGACCTCTGGTGGTGAA-3 ′, each of which was selected one by one, was used to detect human herpesvirus 6 (HHV) in the sample.
-6) The HHV is obtained by carrying out a polymerase chain reaction of DNA.
After amplification of -6 DNA, the amplified product is subjected to size analysis to separate into HHV-6 DNA containing both the nucleotide sequence according to claims 1 and 2 or a partial sequence thereof and HHV-6 DNA not containing the sequence. HHV-6
To identify subtypes A and B of. 9. The following nucleotide sequence: 5'-GAACTCCATCAGCCGCCTCCCAG.
-3 'and 5'-TAAATCCCATACTGGCCTTGAA
-3 'or a nucleotide sequence complementary to the nucleotide sequence or a partial sequence thereof having a length of at least 15 base pairs, each independently consisting of at least 1 DNA consisting of each nucleotide sequence specific to type A and type B A method for identifying subtypes A and B of human herpesvirus type 6 by using each of them as a probe and hybridizing with human herpesvirus type 6 DNA in a sample.