JP3381032B2 - Monoclonal antibody - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION [0001] TECHNICAL FIELD The present invention relates to a novel monochrome
Null antibodies, specifically immunocompetent cells
In the interferon-γ (hereinafter, “IFN-γ”
Abbreviated. ) -Specific protein-inducing products
For clonal antibodies. [0002] 2. Description of the Related Art IFN-γ has an antiviral action,
Known as a protein having an action and immunomodulatory action,
Cells produced by immune and mitogen-stimulated cells
It is said that. Because of these biological effects, IFN-
Since its discovery, γ has been put to practical use as an antitumor agent.
Currently, it is a general treatment for malignant tumors including brain tumors
Clinical trials are being vigorously pursued. Currently obtained
The obtained IFN-γ is a natural IFN produced by an immunocompetent cell.
-Γ and IFN-γ collected from immunocompetent cells
Transformant obtained by introducing DNA into Escherichia coli
Recombinant IFN-γ is classified into
In some cases, one of these is called “foreign IFN-γ”
Have been administered. [0003] Of these, natural IFN-γ is usually cultured.
Culture of established immunocompetent cells containing IFN-γ inducer
It is produced by culturing in a medium and purifying the culture.
It is. In this method, the type of IFN-γ inducer is IFN-γ
-Yield and ease of purification, and product safety
It is said to have a great effect on
Navarin A, lentil lectin, American pokeweed
Mitogens such as cutin, endotoxin, and lipopolysaccharide
Is frequently used. However, none of these substances
There is a diversity of molecules, and the quality varies depending on the source and purification method.
The desired amount of an IFN-γ inducer that is easy to move and has a constant inducibility
There is a problem that it is difficult to obtain. In addition, many of the above substances
When administered to a living body,
It may even be toxic,
It was extremely difficult to induce the production of IFN-γ. [0004] The present inventors have found that mammalian cells produce
When I was studying about itokines, the mouse liver
A previously unknown completely novel inducer of IFN-γ
The substance was found to be present. Column chromatograph
Combining various purification methods, mainly
When isolated and examined for its properties and properties, its essence was protein.
White matter with the following physicochemical properties
There was found. (1) Molecular weight SDS-polyacrylamide gel electrophoresis or gel filtration
When measured by the excess method, the molecular weight is 19,000 ± 5,000 da.
Show Luton. (2) Isoelectric point When measured by the chromatofocusing method, 4.8 ± 1.
0 indicates the isoelectric point. (3) Partial amino acid sequence Partial amino acid sequences shown in SEQ ID NOs: 1 and 2 in the sequence listing
With columns. (4) Biological effects Induces IFN-γ production in immunocompetent cells. [0005] Proteins having such physicochemical properties are not yet available.
Not known and determined to be new. There
Then, the present inventors continued to search for mouse hepatocytes diligently.
As a result, the DNA encoding this protein was isolated.
succeeded in. When decoded, this DNA was 471 bases.
An amino acid consisting of a pair and represented by SEQ ID NO: 3 in the sequence listing
It turned out to encode a sequence. Then this D
When NA was introduced into E. coli and expressed,
The protein was produced in good yield. The above findings are the same
Japanese Patent Application No. 6-184162 by the applicant(JP
JP-A-8-27189)Is disclosed. As described above, the protein is an immunocompetent cell.
Has the property of inducing the production of IFN-γ in
A general-purpose IFN-γ inducer, furthermore, an antiviral agent,
Antitumor agents, antibacterial agents, immunomodulators, platelet increasing agents, etc.
A wide variety of applications are expected. Generally, bioactive proteins
If you try to mix quality with pharmaceuticals, the protein
Method that can be purified efficiently and efficiently,
It is essential to develop a method to perform the assay at one time. Such
The best material that enables purification and assays is
A monoclonal antibody specific to the protein
No local antibody has yet been established. [0007] SUMMARY OF THE INVENTION In view of such a situation,
An object of the invention of the present invention is to provide a protein having physicochemical properties as described above.
To provide monoclonal antibodies specific to white matter
You. Another object of the present invention is to provide such a monochrome
To provide a hybridoma capable of producing a null antibody
is there. [0009] Still another object of the present invention is to provide such an object.
An object of the present invention is to provide a method for producing a clonal antibody. [0010] Still another object of the present invention is to provide such an object.
Provided is a method for purifying the protein using a clonal antibody.
It is in. [0011] Still another object of the present invention is to provide such an object.
Provided is a method for detecting the protein using a clonal antibody.
It is in. [0012] According to the present invention, there is provided the above-mentioned first aspect.
Challenges specific to proteins with the following physicochemical properties:
The problem is solved by a monoclonal antibody. (1) Molecular weight SDS-polyacrylamide gel electrophoresis or gel filtration
When measured by the excess method, the molecular weight is 19,000 ± 5,000 da.
Show Luton. (2) Isoelectric point When measured by the chromatofocusing method, 4.8 ± 1.
0 indicates the isoelectric point. (3) Partial amino acid sequence Partial amino acid sequences shown in SEQ ID NOs: 1 and 2 in the sequence listing
With columns. (4) Biological effects Induces production of interferon-γ in immunocompetent cells
Lead. [0013] The present invention solves the second problem by using such a module.
Solution by hybridoma capable of producing noclonal antibody
Is to decide. [0014] The present invention solves the third problem by using such a module.
In vitro hybridomas capable of producing noclonal antibodies
Alternatively, the process of culturing in vivo and the culture or body fluid
Monoclonal comprising a step of collecting noclonal antibodies
The problem is solved by a method for producing an internal antibody. The present invention solves the above-mentioned fourth problem by using such a mode.
Noclonal antibody is a mixture containing the protein and contaminants
To adsorb proteins to monoclonal antibodies
Process and desorption of adsorbed protein from monoclonal antibody
A protein purification method comprising the step of:
Things. [0016] According to the present invention, the fifth object is achieved by providing a test sample
The monoclonal antibody is brought into contact with the
Solved by a protein detection method that detects the protein more
Is what you do. [0017] BEST MODE FOR CARRYING OUT THE INVENTION Monoclonal antibody of the present invention
Reacts specifically with proteins with specific physicochemical properties
I do. The hybridoma of the present invention can be used
When cultured, such monoclonal antibodies are produced. According to the manufacturing method of the present invention,
The desired amount of such a monoclonal antibody is easily obtained. According to the purification method of the present invention,
From the mixture containing the protein and contaminants, the protein is
It is collected with high purity and efficiency. According to the detection method of the present invention,
Since only the protein in the test sample gives an immune response,
By measuring the immune response by an appropriate method,
Qualitatively or quantitatively detect the protein in the test sample.
Can be. The monoclonal antibody referred to in the present invention is:
Monochrome specific to proteins having the aforementioned physicochemical properties
And the origin, origin,
Classes do not matter. As individual proteins of interest,
For example, the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing
Or a protein having an amino acid sequence homologous thereto
Can be Amino acid sequence shown in SEQ ID NO: 3 in Sequence Listing
An amino acid sequence that is homologous to
The amino acid sequence of SEQ ID NO: 3 without qualitative change
One or more of the amino acids in
Substituted, N-terminal in the amino acid sequence of SEQ ID NO: 3
Adding one or more amino acids to the terminal and / or C-terminal
And one of the N-terminal and / C-terminal amino acids or
Includes two or more deletions. The monoclonal antibody of the present invention
Using a protein or antigenic fragment thereof as an antigen
Can be obtained. Specifically, for example,
Antibodies collected from mammals immunized with such antigen
High levels of somatic cells and mammalian cells that can grow indefinitely
The hybridoma of the present invention
Select hybridoma clones that can produce antibody
It can be obtained by culturing this in vivo or outside.
Wear. Proteins that can serve as antigens are described in, for example,
6-184162 specification(JP-A-8-27189)
Information)Collected from mouse hepatocytes, as disclosed in
The amino acid sequence represented by SEQ ID NO: 3 in the sequence listing, or
DNA encoding an amino acid sequence homologous to
Can be obtained by culturing a transformant,
Are usually used in a fully purified or partially purified state.
You. In order to obtain antigenic fragments, these complete purified products
Or chemically or enzymatically decompose or purify the partially purified product
Based on the amino acid sequence shown in SEQ ID NO: 3 in the table,
What is necessary is just to synthesize tide. The immunization may be performed according to a conventional method.
For example, the above antigen may be used alone or as appropriate with an adjuvant.
Injection into vein, intradermal, subcutaneous or intraperitoneal cavity of mammals
And keep them for a certain period of time. There is no particular limitation on mammals.
Type, size, female, as long as antibody-producing cells at
Males do not matter. Usually rats, mice, hamsters, etc.
Derived from mammals that can be used in infinite breeding
The best one is selected while considering the compatibility with other cells.
It is. Depending on the type and size of mammal, inoculation of antigen
The amount is usually about 5 to 500 μg / animal,
Divide this into 2 to 5 times at intervals of about 1 to 2 weeks
Inoculate. And 3-5 days after the last inoculation, the spleen
And dispersing them to obtain spleen cells as antibody-producing cells
You. Next, the antibody-producing cells thus obtained are
Fusion of infinitely proliferable mammalian cells to achieve
To obtain a cell fusion product containing the hybridoma. Infinite proliferation
Possible mammalian-derived cells typically include P3-NS1-A
g4-1 cells (ATCC TIB18), P3-X63
-Ag8 cells (ATCC TIB9) and SP2 / 0-
Ag14 cells (ATCC CRL1581)
A cell line derived from a myeloma or a mutant thereof is used. Fine
Cell fusion, for example, polyethylene glycol or Sendai
Virus and other fusion promoters and
Method, for example, including a fusion promoter.
Derived from mammals capable of infinite growth with antibody-producing cells in a fusion medium
Of cells are suspended at a ratio of about 1: 1 to 1:10.
Leave the ink at about 30-40 ° C for about 1-5 minutes
Lab. The fusion medium includes, for example, MEM medium, R
Starting with PMI1640 medium and Iskov's modified Dulbecco's medium
Ordinary general ones can be used.
It is desirable to exclude serums. To select a desired hybridoma,
The cell fusion product obtained as described above was
Transfer to any selection medium, and at about 30-40 ° C for about 3 days
Culture for 3 weeks to kill cells other than hybridomas
You. Next, the hybridoma is cultured by a standard method, and
Antibody secreted into the product should be tested for reactivity with the protein.
test. Testing includes enzyme immunoassay, radioactivity
Detect antibodies in immunoassays and bioassays
Conventional methods are used, for example, Sakuji Toyama
Tamoe Ando, Monoclonal Antibody Experiment Manual, 199
One year, published by Kodansha Scientific, 105th to 1st
On page 52, various methods are described in detail. The
Hybridomas producing protein-specific antibodies are limited.
Immediately cloned by single-
Obtain a loaned hybridoma according to the invention. The monoclonal antibody of the present invention
Obtained by culturing hybridomas in vivo and outside
Can be. Culture is performed by culturing mammalian cells.
Conventional methods are used, for example, in vitro culture media
When culturing in a non-human culture,
When transplanted into warm-blooded animals and cultured in vivo,
Collect monoclonal antibodies from ascites and / or blood
You. Hybridoma M-1 described below is a monoclonal antibody
High productivity and easy to culture in and out of the body
There is a feature that there is. Culture or ascites or blood
To collect monoclonal antibodies, purify antibodies in general
Conventional methods in the art are used to accomplish this. individual
Examples of the method include salting out, dialysis, filtration, concentration, and centrifugation.
Heart separation, fractional precipitation, gel filtration chromatography,
Exchange chromatography, affinity chromatography
Luffy, high performance liquid chromatography, gel electrophoresis
And isoelectric focusing, which can be used as needed.
Applied in combination. The purified monoclonal antibody is
Then, concentrate and dry to a liquid or solid state depending on the application.
You. The monoclonal antibody of the present invention is
Of the protein by affinity chromatography
Very useful for purification. Such a purification method is
Ming monoclonal antibody to the protein and non-protein
Contact with a mixture of contaminants such as
To allow the monoclonal antibody to adsorb only the protein
Process and desorption of adsorbed protein from monoclonal antibody
And both steps are usually carried out in an aqueous medium.
It is done in. The monoclonal antibodies of this invention are generally
Usually used in the state of being bound to a gel-like water-insoluble carrier,
The water-insoluble carrier is packed into a cylindrical tube or the like in the form of a column.
In addition, for example, mouse hepatocyte extract or transformation
When a body culture or a partially purified product thereof is passed,
Monoclonal on a water-insoluble carrier
Adsorb to antibody. The adsorbed protein is a monoclonal antibody
Easy removal by changing the hydrogen ion concentration around the body
Can belong to, for example, the IgG class
When using a monoclonal antibody, the pH on the acidic side
Normally, the pH is 2 to 3, while a model belonging to the class of IgM
When using a noclonal antibody, the pH on the alkaline side
It is usually eluted at pH 10-11. According to the purification method of the present invention,
Proteins can be highly purified with minimal effort and time. Above
As shown in FIG.
-Has the property of inducing the production of
Produced protein is used to induce IFN-γ by cell culture.
As a conductive agent, further having sensitivity to IFN-γ;
For example, viral diseases such as AIDS and condyloma condyloma
Malignant tumors such as disease, kidney cancer, granuloma, mycosis fungoides, and brain tumors
Against immune diseases such as ulcers, rheumatoid arthritis and allergies
It is useful as a therapeutic or prophylactic agent. The protein is Kira
-When it also has the property of enhancing cytotoxicity by cells
May be used in combination with interleukin 2 or tumor necrosis factor as appropriate.
By adoptive immunotherapy, lung cancer, kidney cancer, breast cancer
And therapeutic effects in the treatment of malignant tumors including solid cancers
Significant effects are obtained in improving side effects. The monoclonal antibody of the present invention
Has a wide range of applications in areas requiring white matter detection
You. That is, the monoclonal antibody of the present invention
Immunoassay, enzyme immunoassay, fluorescent immunoassay
When applying labeled immunoassays such as immunoassays
Qualitatively or accurately qualify the protein in the test sample
Quantitative analysis can be performed. In such an analysis,
The monoclonal antibodies of the invention include, for example, radioactive substances,
It is used after being labeled with an element and / or a fluorescent substance. this
The monoclonal antibody of the invention reacts specifically with the protein
And presents an immune response.
If a substance is used as an indicator, only a very small amount of the
Protein can be detected with high accuracy. Sign immunoa
Assays are more numerous at once than bioassays.
Analyzes the test sample and the time and effort required for analysis
And the accuracy of analysis is high.
There is a sign. Therefore, the detection method according to the present invention
It is useful for process control and product quality control when manufacturing the protein.
It is useful. This invention is a monoclonal antibody
Does not concern body labeling or the labeling assay itself
Therefore, detailed explanation is omitted, but for example, P. Thyssen
Written by Eiji Ishikawa, "Enzyme Immunoassay", 198.
9, published by Tokyo Chemical Doujinshi, pages 196 to 348
Describes various methods for that purpose. Hereinafter, the present invention will be described with reference to examples.
However, in the state of the art, there are many such embodiments.
It can be modified as follows. In view of such a technical level, the present invention
Should not be limited to only these examples
Not even. [0033] Example 1 <Preparation of hybridoma M-1> [0034] Example 1-1 <Preparation of transformant KGFM5> 8 μm of 25 mM magnesium chloride in a 0.5 ml reaction tube
10 μl of 10 × PCR buffer, 25 mM dNT
1 μl of P mix, 2.5 units / μl
1 μl of DNA polymerase, Japanese Patent Application No. 6-184162
Issue statement(JP-A-8-27189)Described in
Prepared from phage DNA clones according to the method
Having the nucleotide sequence of SEQ ID NO: 4 in the sequence listing,
1 ng of recombinant DNA containing DNA encoding white matter,
In the SEQ ID No. 3 in the sequence listing, the N-terminal and C-terminal
5'-GAGGAAT chemically synthesized based on amino acid sequence
TCTGGAGGAAGGTACCATGAACTTT
GGCGCGACTTC-3 'and 5'-GCGAAAG
Represented by CTTCTAACTTTGATGTAAG-3 '
Sense primer and antisense primer
Add the appropriate amount of primer and make up to 100 μl with sterile distilled water.
Was. The mixture is kept at 94 ° C. for 1 minute at 43 ° C.
Incubate in this order for 1 minute at 72 ° C for 1 minute
Cycle was repeated three times, and further at 94 ° C. for 1 minute.
For 1 minute at 60 ° C. and 1 minute at 70 ° C.
Repeat the incubation cycle 37 times PCR reaction
And the 5 'end of the nucleotide sequence shown in SEQ ID NO: 4 and
Eco RI cleavage site and Hind at the 3 'end respectively
  A III cleavage site was provided. PCR product, Stratagene plasmid
Vector "pCR-ScriptSK (+)" 10n
g was ligated with DNA ligase by a conventional method, and
A, which is determined by the competent cell method
E. coli "XL-1 Blue MRF'Kan" strain
And transformed. 50 μg / ml of transformant
In contact with L-broth medium (pH 7.2) containing ampicillin
After seeding and culturing with shaking at 37 ° C. for 18 hours, the culture is centrifuged.
The transformant was separated and collected, and then subjected to normal alkali-SDS
The recombinant DNA was isolated by applying the method. This recombinant DN
When a part of A was analyzed by the dideoxy method,
The DNA having the nucleotide sequence shown in SEQ ID NO: 4 in the sequence listing
The expected DNA is correct in the PCR reaction.
It was confirmed that the gene was amplified properly. Therefore, the remaining recombinant D
Cut NA with restriction enzymes Eco RI and Hind III
After the disconnection, Takara Shuzo DNA Ligation Kit “DNA La
Ignition Kit Version 2 ”
Eco RI-Hind III DNA Fragment
0.1 μg of the previously cut fal
Macia plasmid vector "pKK223-3" 10
ng is allowed to react at 16 ° C for 30 minutes to ligate and replicate.
Thus, a recombinant DNA "pKGFM5" was obtained. Competent
By the cell method, the recombinant DNA pKGFM5 was used
Transforming the strain Y1090 (ATCC 37197),
The obtained transformant “KGFM5” was added to a 50 μg / ml solution.
Inoculate L-broth medium (pH 7.2) containing ampicillin
After shaking at 37 ° C. for 18 hours. Centrifuge culture
And transformants were collected, and normal SDS-A
Extract recombinant DNA pKGFM5 by applying Lucari method
did. When analyzed by the dideoxy method, it is shown in FIG.
Thus, in the recombinant DNA pKGFM5, the sequence
KGFM5cD having the nucleotide sequence shown in SEQ ID NO: 4 in the table
NA was linked downstream of the Tac promoter. [0037] Example 1-2 <Protein by transformant KGFM5
Production of ampicillin 50 μg /
sterilized L-broth medium (pH 7.2) containing
After cooling to 7 ° C., the transformant KG prepared in Example 1-1
FM5 was inoculated and seeded under shaking at the same temperature for 18 hours.
Was. 1 liter of the same fresh medium in a 20-liter jar fermenter
8 liters were similarly sterilized, cooled to 37 ° C., and obtained above.
Seed cultures are inoculated with 1% (v / v) and run at the same temperature for 8 hours.
The cells were cultured with aeration and agitation. Centrifuge the culture to collect the cells,
150 mM sodium chloride, 16 mM hydrogen phosphate
Solution containing 4 mM sodium and 4 mM sodium dihydrogen phosphate (pH
7.3), sonicated, and centrifuged to isolate the bacteria
The crushed material was removed, and the supernatant was collected. The supernatant was added with 4 g of ammonium sulfate under ice-cooling.
0% (w / v), dissolve uniformly, leave for a while,
After centrifugation, the supernatant was collected. This newly generated supernatant
Add ammonium sulfate to 85% (w / v) and at 4 ° C
After stirring for 25 hours and centrifuging, the precipitate containing the protein is removed.
Collected. The precipitate contains 1.5M ammonium sulfate.
Dissolve in 150 mM phosphate buffer (pH 6.6)
10 mM phosphate buffer containing 1.5 M ammonium sulfate beforehand
Pharmacia equilibrated with liquid (pH 6.6)
Into the column of “Phenyl Sepharose”
After washing the buffer with fresh same buffer,
10 mM phosphate buffer under a gradient of ammonium sulfate
The buffer (pH 6.6) was passed. Next, with an ammonium sulfate concentration of 0.9 M
The fractions eluted in the vicinity are pooled, and after membrane concentration, 10 mM phosphate
Dialysis against buffer (pH 6.5) at 4 ° C. for 18 hours,
Equilibrate in advance with 10 mM phosphate buffer (pH 6.5)
Load on the column of "DEAE5PW" made by Tosoh
After washing the column with fresh identical buffer,
Under a concentration gradient of sodium chloride rising to 2M, 10 mM
Pass through a phosphate buffer (pH 6.5) and concentrate sodium chloride.
The fraction eluted at around 0.1 M was collected. Thereafter, this fraction was concentrated on a membrane, and was previously phosphated.
Equilibrated with a salt buffer (hereinafter referred to as “PBS”)
Of the "Super Dex 75" made by Pharmacia
Molecules loaded on the column and eluted through fresh PBS
When a fraction with a volume of around 19,000 daltons was collected,
An aqueous solution containing about 4.7 mg of the purified protein was obtained. Whole spirit
The yield throughout the manufacturing process was about 26%. Japanese Patent Application No. 6-184162(JP
8-27189)Analysis according to the method described in
As a result, the purified protein has the following physicochemical properties:
I was That is, SDS-polyacrylic acid under non-reducing conditions
Luamide gel electrophoresis showed a molecular weight of 19,000 ±
IFN-γ inducibility at a position corresponding to 5,000 daltons
Chromatofocusing while showing one major band
Then, the isoelectric point was shown at 4.8 ± 1.0. Also, birds
The two types of peptide fragments obtained by digestion with psin have the sequence
Having the amino acid sequence shown in SEQ ID NOS: 1 and 2 in the table
I was [0042] Example 1-3 <Preparation of Hybridoma M-1> 10
Obtained intraperitoneally in a week-old SD rat by the method of Example 1-2
Purified protein with complete Freund's adjuvant for 20
Inoculation was performed at a rate of μg / animal. Then every two weeks
Inoculate the same amount twice, and the same amount one week after the last inoculation
Was further injected intravenously, and three days later the spleen was removed and dispersed.
Splenocytes were obtained. The splenocytes were combined with mouse myeloma-derived SP2 /
0-Ag14 cells (ATCC CRL1581)
RPMI 1640 medium without serum pre-warmed to ° C.
(PH 7.2) at a cell density of 3 x 10^FourPieces / ml
And 1 × 10^FourCells / ml.
After separation, a precipitate was collected. This precipitate has an average molecular weight of 1,5.
00 Dalton 50% (w / v) polyethylene glycol
Serum-free RPMI 1640 medium (pH 7.
2) Add 1 ml dropwise over 1 minute and incubate at 37 ° C for 1 minute.
After incubation, remove serum until the total volume is 50 ml.
Containing RPMI 1640 medium (pH 7.2)
After centrifugation, the precipitate was collected. HAT
Suspend in medium and place in 200 well microplate
Dispense μl / well and incubate at 37 ° C for 1 week
To select a hybridoma. Secreted into the culture supernatant in each well
For antibody, purified protein obtained by the method of Example 1-2
The reactivity with was determined by enzyme immunoassay.
A hybrid that produces an antibody reactive with the purified protein
Ma was sorted out. Continue to use this hybridoma
Therefore, the limiting dilution is applied repeatedly, and the monochrome
Hybridoma clone M- capable of producing an internal antibody
1 was obtained. [0045] Example 2 <Preparation of monoclonal antibody M-1 mAb
And Western blotting analysis> [0046] Example 2-1 Monoclonal Antibody M-1 mAb
Preparation> Hybridoma M obtained by the method of Example 1-3
-1 at a cell density of about 1 × 10⁶5% so that it will be pieces / ml
(V / v) RPMI 1640 medium supplemented with bovine serum
(PH 7.2), while expanding the culture scale,
5% CO_TwoThe cells were cultured at 37 ° C. in an incubator. Expected
When the cell density reaches the above, hybridoma M-1 is predicted.
Immunosuppression with rabbit anti-hamster thymocyte antibody
And pristane intraperitoneally 0.5 ml / animal
1 × 10 intraperitoneally in 5 week old hamsters⁷
Each animal was inoculated by injection and bred for 1 week in a usual manner. [0047] Ascites was collected from the hamster, and 3 hours with PBS.
After double dilution, ammonium sulfate will be 50% saturated
And allowed to stand at 4 ° C. for 24 hours.
Was collected. The precipitate is washed with 20 mM potassium dihydrogen phosphate aqueous solution.
After dialysis against the solution (pH 6.7) at 4 ° C. overnight,
Hydroxyapa equilibrated with the same fresh aqueous solution
Load on a tight column and concentrate at 20 mM to 300 mM
Potassium dihydrogen phosphate aqueous solution (pH
6.7) After passing through, the monoclonal of the present invention
An aqueous solution containing the antibody M-1 mAb was obtained. The yield is c
It was about 5 mg per muster. I used the usual law
Analysis revealed that this monoclonal antibody M-1m
Abs belonged to the class of IgM. [0048] [Example 2-2] <Western blotting analysis>
Thiothreitol 100 mg, 10% (w / v) SDS
Mixed solution consisting of 0.5 ml of aqueous solution and 1 ml of glycerol
Then, 1 μg of the purified protein obtained by the method of Example 1-2 was added.
After incubating at 37 ° C for 1 hour,
Liacrylamide gel electrophoresis was performed. Gel by standard method
Transfer to nitrocellulose membrane
After immersion in the culture supernatant of Bridoma M-1 for 1 hour,
50 mM Tris containing 05% (v / v) Tween 20
Wash with hydrochloric acid buffer (pH 7.5) to remove excess antibody
Was. Nitrocellulose membrane for horseradish peroxidase
Containing rabbit-derived anti-rat Ig antibody labeled with
For 1 hour to react, 0.05% (v / v)
50 mM Tris-HCl buffer (pH 7.
After washing in 5), 0.005% (v / v) hydrogen peroxide
50 mM toluene containing 0.3 mg / ml diaminobenzidine
Squirt in squirrel-HCl buffer (pH 7.5) to develop color
Was. At the same time, in place of the purified protein,
Purified protein derived from mouse hepatocytes obtained by the method of 4 or
Providing a system using recombinant human interleukin 12,
Controls were treated as described above. The molecular weight marker
Include bovine serum albumin (67,000 daltons),
Ovalbumin (45,000 daltons), carbonic
Quanhydrase (30,000 Dalton), Trypsi
Inhibitor (20,100 daltons) and α-lac
Toalbumin (14,400 daltons) was used. result
Is shown in FIG. As can be seen from the results in FIG.
Null antibody M-1 mAb was obtained by the method of Example 1-2.
Purified protein (lane 1) and the method of Example 4
Specifically reacts with the purified protein (lane 2)
No reaction to interleukin 12 (lane 3)
Was. This means that the monoclonal antibody of the present invention
Has specific physicochemical properties irrespective of manufacturing method
It supports that it reacts specifically with proteins. [0051] Example 3 <Immunoaffinity chromatography
-Purification of protein> [0052] Example 3-1 <Immunoaffinity Chromatography
Preparation of gel for fee> Model obtained by the method of Example 2-1
Take 80 mg of the noclonal antibody M-1 mAb and add 0.5 mg
0.1 M borate buffer (pH 8.
Dialysis was performed overnight at 4 ° C against 5). As a water-insoluble carrier
"CNBr-activated Sepharose 4B" manufactured by Pharmacia
4 g was swollen in 1 mM aqueous hydrochloric acid, and
Aqueous solution, 0.1 M boric acid buffer containing 0.5 M sodium chloride
After washing in the order of buffer solution (pH 8.5),
Add about 10 ml of an aqueous solution of lonal antibody and leave at room temperature for 2 hours.
While gently stirring at 4 ° C. overnight. Then the gel
Is washed with a 1 M aqueous solution of ethanolamine (pH 8.0)
And 0.1 M boron containing 0.5 M sodium chloride.
Acid buffer (pH 8.5) and 0.5 M sodium chloride
0.1M acetate buffer (pH 4.0)
And washing 5 times, and finally washing with PBS.
To obtain a gel for immunoaffinity chromatography
Was. Analysis by a conventional method showed that about 1 ml of gel
6 mg of monoclonal antibody M-1 mAb bound
Was. [0053] Example 3-2 <Immunoaffinity Chromatography>
Purification of protein by fee> Immunoassay obtained in Example 3-1
Purify 10 ml of affinity chromatography gel.
Fill the inside of a plastic cylindrical tube in a column shape and use PBS.
After washing, the protein obtained by the method of Example 1-2 was washed
Fraction 1 containing phenyl sepharose containing 0.1 mg / ml
0 ml was loaded. After washing with fresh PBS, the column
35 mM ethylamine aqueous solution (pH 10.8)
Then, a fraction capable of inducing IFN-γ was collected. Picture taken
After pooling and concentration, the IFN-γ-inducing activity and protein
When the content was measured, the purified protein had a purity of 95% or more.
Was obtained at a yield of almost 100% per raw material.
found. [0054] Example 4 <Immunoaffinity chromatography
-Purification of protein> -80-week-old female CD-1 mouse 60
No corynebacterium parvum (ATC)
C11827) at 60 ° C. for 1 hour
The body is injected at 1 mg / animal and given for 7 days in the usual manner.
After growth, 1 μg / animal of purified lipopolysaccharide derived from Escherichia coli
Injection was given. After 1-2 hours, the mice are sacrificed and
After blood collection, the liver was removed and 8 volumes of 50 mM phosphate buffer was added.
(PH 7.3), crushed by homogenizer and extracted
did. Extract is centrifuged at about 8,000 rpm for 20 minutes
And about 9 l of the resulting supernatant contains saturated ammonium sulfate.
50 mM phosphate buffer (pH 7.3) was replaced with ammonium sulfate
To 45% saturation and left at 4 ° C for 18 hours
Then, centrifuged at about 8,000 rpm for 30 minutes to remove the protein.
About 19 l of supernatant containing white matter was obtained. The supernatant was previously containing 1M ammonium sulfate.
Equilibrated with 50 mM phosphate buffer (pH 7.3)
"Phenyl Sepharose" manufactured by Italia Pharmacia, about 4.6
Load 1 column and wash column with fresh identical buffer
Then, the concentration of ammonium sulfate falling from 1M to 0.2M
A 50 mM phosphate buffer (pH 7.3) was added to the SV
The solution was passed at 0.57. 0.8M ammonium sulfate concentration
Fraction containing the protein eluted at around 4.8 l
Was collected, concentrated on a membrane, and subjected to 20 mM phosphate buffer (pH 6.
After dialysis against 5) at 4 ° C for 18 hours,
Pharmacy equilibrated with buffer (pH 6.5)
"DEAE-Sepharose" column of about 250 ml
Loaded. After washing the column with fresh identical buffer,
Under a concentration gradient of sodium chloride rising from
20 mM phosphate buffer (pH 6.5) was added to the column with SV1.
After passing through in step 2, the protein was found to have a salt of about 0.13M.
It eluted at the sodium chloride concentration. Collect about 260 ml of the eluate containing the protein.
Then, after concentrating and purifying in the same manner as in Example 3, the purity was
More than 95% of purified protein is almost 100% per raw material
In the yield. [0057] Example 5 <Protein by enzyme immunoassay
Detection> by the method of Example 1-2 according to a conventional method
After immunizing rabbits with the purified protein obtained, blood was collected
Then, the IgG antibody was isolated. Put this IgG antibody in PBS
Dissolve to 20 μg / ml and use a 96-well microphone
100 μl / well was dispensed to the plate. Microphone
After incubating the plate for 3 hours at room temperature,
The gG solution was removed and 1% (w / v) bovine serum albumin was added.
Add 200 μl / well of PBS at 4 ° C. overnight
It was left still. The PBS was removed from the microplate.
After washing with PBS containing 05% (v / v) Tween 20,
0.5% of purified protein obtained by the method of Example 1-2
(W / v) As appropriate with PBS containing bovine serum albumin
Dilute to a concentration and add 100 μl / well, with shaking,
The reaction was performed at room temperature for 2 hours. 0.05% (v / v) twist
Washed with PBS containing DNA 20 and labeled with biotin
100 μl / well of clonal antibody M-1 mAb
In addition, the reaction was carried out at room temperature for 2 hours while shaking.
% (V / v) after washing with PBS containing Tween 20
Between horseradish peroxidase and streptavidin
Add 100 μl / well of complex and shake the chamber
The reaction was allowed to proceed for another 2 hours at the temperature. 0.05% (v / v)
After washing with PBS containing Tween 20, binding to purified protein
O-phenylene activity of isolated horseradish peroxidase
Absorbance at 492 nm wavelength using diamine as a substrate
Measured. Table 1 shows the results. [0059] [Table 1] As is evident from the results in Table 1, this detection method
By law, at least about 50-2,000p
g / ml of the protein can be accurately detected. [0061] Example 6 <Detection of protein by radioimmunoassay
Ex.) Obtained by the method of Example 1-2 according to a conventional method.
After immunizing rabbits with the purified protein, blood is collected,
IgG antibodies were isolated. This IgG antibody was purified by
Adsorb to polyimmune beads for geoimmunoassay,
In PBS containing 2% (w / v) bovine serum albumin, 4
The mixture was allowed to stand at 0 ° C. overnight to obtain a solid phase antibody. Each of the solid phase antibodies was placed in a test tube,
0.5% (w) of the purified protein obtained by the method of Example 1-2
/ V) Concentration appropriately with PBS containing bovine serum albumin
And then add 0.2 ml each and let stand at 4 ° C for 4 hours
Was. The solid phase antibody was combined with 0.05% (v / v) Tween 20.
In PBS containing 0.5% (w / v) bovine serum albumin
After washing, the monochrome obtained by the method of Example 2-1
Null antibody M-1 mAb was prepared by a standard method.¹²⁵I label.
2 ml (1 × 10^Fivecpm), and leave at 4 ° C overnight.
did. Remove excess labeled antibody and remove 0.05% (v / v)
Tween 20 and 0.5% (w / v) bovine serum albumin
After washing with PBS containing
Was measured for radioactivity. Table 2 shows the results. [0063] [Table 2] As is clear from the results in Table 2, this detection method
By law, at least about 100 to 1,200
pg / ml of the protein can be accurately detected. [0065] As described above, the present invention has
Lonal antibodies produce IFN-γ in immunocompetent cells.
Reacts specifically to proteins that induce life. Therefore,
The monoclonal antibody of the present invention can be used for purifying such a protein.
And have a wide variety of uses for detection. So
Useful monoclonal antibodies of the invention are hybrid
The desired amount can be easily obtained by the manufacturing method using
it can. The present invention exhibits such remarkable functions and effects.
It is of great significance to contribute to the world
This is an invention. [0067] [Sequence list] SEQ ID NO: 1 Array length: 25 Sequence type: amino acid Topology: linear Sequence type: Peptide Fragment type: middle fragment Array   Ile Ile Ser Phe Glu Glu Met Asp Pro Pro Glu Asn Ile Asp Asp Ile Gln   1 5 10 15   Ser Asp Leu Ile Phe Phe Gln Lys           20 25 [0068] SEQ ID NO: 2 Array length: 18 Sequence type: amino acid Topology: linear Sequence type: Peptide Fragment type: middle fragment Array   Gln Pro Val Phe Glu Asp Met Thr Asp Ile Asp Gln Ser Ala Ser Glu Pro   1 5 10 15   Gln [0069] SEQ ID NO: 3 Sequence length: 157 Sequence type: amino acid Topology: linear Sequence type: protein Array   Asn Phe Gly Arg Leu His Cys Thr Thr Ala Val Ile Arg Asn Ile Asn Asp     1 5 10 15   Gln Val Leu Phe Val Asp Lys Arg Gln Pro Val Phe Glu Asp Met Thr Asp            20 25 30   Ile Asp Gln Ser Ala Ser Glu Pro Gln Thr Arg Leu Ile Ile Tyr Met Tyr    35 40 45 50   Lys Asp Ser Glu Val Arg Gly Leu Ala Val Thr Leu Ser Val Lys Asp Ser                55 60 65   Lys Xaa Ser Thr Leu Ser Cys Lys Asn Lys Ile Ile Ser Phe Glu Glu Met        70 75 80 85   Asp Pro Pro Glu Asn Ile Asp Asp Ile Gln Ser Asp Leu Ile Phe Phe Gln                    90 95 100   Lys Arg Val Pro Gly His Asn Lys Met Glu Phe Glu Ser Ser Leu Tyr Glu           105 110 115   Gly His Phe Leu Ala Cys Gln Lys Glu Asp Asp Ala Phe Lys Leu Ile Leu   120 125 130 135   Lys Lys Lys Asp Glu Asn Gly Asp Lys Ser Val Met Phe Thr Leu Thr Asn               140 145 150   Leu His Gln Ser       155 [0070] SEQ ID NO: 4 Sequence length: 471 Sequence type: nucleic acid Number of chains: double strand Topology: linear Sequence type: cDNA to mRNA origin   Organism name: Mouse   Tissue name: liver Array features   Symbol representing sequence: mat peptide   Location: 1..471   How the features were determined: S Array   AAC TTT GGC CGA CTT CAC TGT ACA ACC GCA GTA ATA CGG AAT ATA AAT 48   Asn Phe Gly Arg Leu His Cys Thr Thr Ala Val Ile Arg Asn Ile Asn     1 5 10 15   GAC CAA GTT CTC TTC GTT GAC AAA AGA CAG CCT GTG TTC GAG GAT ATG 96   Asp Gln Val Leu Phe Val Asp Lys Arg Gln Pro Val Phe Glu Asp Met                20 25 30   ACT GAT ATT GAT CAA AGT GCC AGT GAA CCC CAG ACC AGA CTG ATA ATA 144   Thr Asp Ile Asp Gln Ser Ala Ser Glu Pro Gln Thr Arg Leu Ile Ile            35 40 45   TAC ATG TAC AAA GAC AGT GAA GTA AGA GGA CTG GCT GTG ACC CTC TCT 192   Tyr Met Tyr Lys Asp Ser Glu Val Arg Gly Leu Ala Val Thr Leu Ser        50 55 60   GTG AAG GAT AGT AAA AYG TCT ACC CTC TCC TGT AAG AAC AAG ATC ATT 240   Val Lys Asp Ser Lys Xaa Ser Thr Leu Ser Cys Lys Asn Lys Ile Ile    65 70 75 80   TCC TTT GAG GAA ATG GAT CCA CCT GAA AAT ATT GAT GAT ATA CAA AGT 288   Ser Phe Glu Glu Met Asp Pro Pro Glu Asn Ile Asp Asp Ile Gln Ser                   85 90 95   GAT CTC ATA TTC TTT CAG AAA CGT GTT CCA GGA CAC AAC AAG ATG GAG 336   Asp Leu Ile Phe Phe Gln Lys Arg Val Pro Gly His Asn Lys Met Glu               100 105 110   TTT GAA TCT TCA CTG TAT GAA GGA CAC TTT CTT GCT TGC CAA AAG GAA 384   Phe Glu Ser Ser Leu Tyr Glu Gly His Phe Leu Ala Cys Gln Lys Glu           115 120 125   GAT GAT GCT TTC AAA CTC ATT CTG AAA AAA AAG GAT GAA AAT GGG GAT 432   Asp Asp Ala Phe Lys Leu Ile Leu Lys Lys Lys Asp Glu Asn Gly Asp       130 135 140   AAA TCT GTA ATG TTC ACT CTC ACT AAC TTA CAT CAA AGT 471   Lys Ser Val Met Phe Thr Leu Thr Asn Leu His Gln Ser   145 150 155

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a view showing the structure of recombinant DNA pKGFM5. FIG. 2 shows the monoclonal antibody M-1 mA according to the present invention.
FIG. 4 is a western blotting diagram showing the reactivity of b with various proteins. [Description of Signs] cDNA encoding KGFM5 cDNA protein Ptactac promoter rrnBT1T2 Transcription termination region of ribosomal RNA operon AmpR Ampicillin resistance gene pBR322ori Replication origin in Escherichia coli

──────────────────────────────────────────────────の Continued on the front page (58) Fields surveyed (Int. Cl. ⁷ , DB name) SwissProt / PIR / GeneSeq GenBank / EMBL / DDBJ / GeneSeq BIOSIS / WPI (DIALOG) PubMed

Claims (1)

(57) [Claims] [Claim 1] SEQ ID NO: 3 in the sequence listing (provided that
“Xaa” shall mean methionine or threonine. It has an amino acid sequence shown in), obtained a mammal with a protein or antigenic fragment thereof induces the production of interferon -γ immunocompetent cells via a process of immunization, protein and immune Reactive antibodies.