CN112111496A - ApoE gene, recombinant protein, polyclonal antibody and preparation method and application of apoE gene and recombinant protein - Google Patents

ApoE gene, recombinant protein, polyclonal antibody and preparation method and application of apoE gene and recombinant protein Download PDF

Info

Publication number
CN112111496A
CN112111496A CN202011015704.8A CN202011015704A CN112111496A CN 112111496 A CN112111496 A CN 112111496A CN 202011015704 A CN202011015704 A CN 202011015704A CN 112111496 A CN112111496 A CN 112111496A
Authority
CN
China
Prior art keywords
apoe
protein
recombinant protein
recombinant
polyclonal antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202011015704.8A
Other languages
Chinese (zh)
Inventor
张莹莹
朱珠
杨辉
魏文志
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangzhou University
Original Assignee
Yangzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangzhou University filed Critical Yangzhou University
Priority to CN202011015704.8A priority Critical patent/CN112111496A/en
Publication of CN112111496A publication Critical patent/CN112111496A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/775—Apolipopeptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/06—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from serum
    • C07K16/065—Purification, fragmentation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention relates to gobiocypris rarus (the invention) which researches the structure and function of biomacromolecule from molecular level, belongs to the field of genetic engineering and protein-nucleic acid systemGobiocypris rarus) Apolipoprotein ApoE gene nucleotide sequence, codon optimized nucleotide sequence and coded amino acid sequence, in particular to an expression preparation method of gobiocypris rarus ApoE recombinant protein and preparation of a protein anti-rabbit polyclonal antibody. The ApoE of gobiocypris rarus can be further studied and analyzed in vitro by recombinant expression of the ApoE of the gobiocyprisrarus, and in additionThe preparation of the polyclonal antibody can lay a foundation for further detecting the content of ApoE in the fish body.

Description

ApoE gene, recombinant protein, polyclonal antibody and preparation method and application of apoE gene and recombinant protein
Technical Field
The invention relates to a protein-nucleic acid system for researching the structure and function of biomacromolecule from molecular level, belonging to the field of gene engineeringGobiocypris (Gobiocypris rarus) Apolipoprotein ApoE gene nucleotide sequence, codon optimized nucleotide sequence and coded amino acid sequence, in particular to an expression preparation method of gobiocypris rarus ApoE recombinant protein and preparation of a protein anti-rabbit polyclonal antibody.
Background
ApoE is a polymorphic protein involved in the conversion and metabolism of lipoproteins, whose genes regulate many biological functions, and is mainly present in CM, VLDL, IDL and partial HDL, and in all the different species studied. Critical nutritional and biochemical studies in animals and humans have shown that ApoE plays an important role in lipoprotein catabolism in the liver and extrahepatic tissues. ApoE can cause the activation of vascular endothelial cells and mononuclear cells, starts related signal paths to increase the cell adhesion rate of gobiocypriss rarus, belongs to Cyprinaceae and gobiocypriss, only 1 of the genus belongs to the family of Cyprinaceae and gobiocypriss, is a special species in China, has a small wild number, and is only found in plains near the branch flow of the great river upstream of the Yangtze river and the Sichuan adult and small rivers in the western marginal region thereof. Gobiocypris rarus has the excellent characteristics of small size, short reproduction period, fast sexual maturity, multiple spawning batches, artificial control of embryonic development, sensitivity to chemical substances and the like, and has the advantages of a series of experimental fishes such as single type species, wide temperature application range, convenient feeding and management, transparent egg membranes and the like, so that the gobiocypris rarus is the fish which is most suitable for being used as experimental animals and is discovered in China so far. Fish is an ideal cardiovascular disease research model, and the research on ApoE is helpful for understanding the cholesterol transport process in the body. After the animals ingest the high cholesterol diet, the plasma ApoE concentration increases significantly, and two lipoproteins rich in cholesterol, namely β -VLDL and HDLc, appear in the blood, both of which contain more ApoE. However, the current antibodies to ApoE are mainly concentrated on mammals and no antibodies are available for fish use. Most of the recombinant proteins obtained by prokaryotic expression methods exist in the form of inclusion bodies and have no biological activity.
Disclosure of Invention
In order to solve the technical problems, the invention provides an apoE gene, recombinant protein, polyclonal antibody and a preparation method and application of an apoE gene of gobiocyprisrarus, so as to solve the problems that apoE protein measurement cannot be carried out due to lack of fish apoE detection antibodies and the like.
The technical scheme of the invention is as follows:
ApoE gene of gobiocypris rarus apolipoprotein and named as ApoE geneGrApoE, the nucleotide sequence of which is SED ID NO: 1 is shown.
A codon-optimized gobiocypris rarus apolipoprotein ApoE gene has a nucleotide sequence shown as SED ID NO: 2, respectively.
A recombinant protein of apoE of apolipoprotein of gobiocypris rarus, the amino acid sequence of which is as follows, SED ID NO: 3, respectively.
The preparation method of the apoE recombinant protein of the gobiocypris rarus apolipoprotein comprises the following steps:
constructing a recombinant plasmid: optimizing gene sequence SED ID NO of apoE codon of gobiocypris rarus: 2 into pET30a expression vector to obtain pET30a- GrApoERecombinant plasmids;
induced expression of recombinant protein: pET30a- GrApoEAnd (3) transforming the recombinant plasmid into escherichia coli, culturing, inducing, cracking and purifying to obtain the recombinant protein of the apoE of the gobiocypris rarus.
In some embodiments, the induced expression of the recombinant protein comprises: codon-optimized SED ID NO: 2 sequence and pET30a expression vector are directly synthesized and are connected in, then the obtained product is transformed with escherichia coli competent cell BL21, and then the obtained product is cultured and coated on a solid culture medium, the single clone is selected, bacteria colony PCR is carried out, bacteria shaking is carried out, IPTG is added for induction culture, a crude product is obtained, the obtained bacteria are collected, SDS-PAGE (polyacrylamide gel electrophoresis) protein detection is carried out, an ultrasonic crusher is used for cracking the bacteria, finally, recombinant protein purification is carried out, and the purity after purification is detected. Further, the crushing conditions are as follows: crushing for 4 s, closing for 3 s at intervals, and carrying out ultrasonic crushing for 30 min.
The method specifically comprises the following steps: competent cells to Escherichia coliE. coliBL21 was added with pET30a- GrApoEThe recombinant plasmid is stirred uniformly, is kept stand in ice bath for 30min, is then placed in water bath at 42-45 ℃ for heat shock for 90 s, and is transferred into the ice bath for placement for 2-5 min; adding 900 mu L of sterile LB culture solution into each sample, uniformly mixing, performing shaking culture at 36-38 ℃ (about 37 ℃) for about 50-70min to recover the thalli, then sucking 100 mu L of recovered bacteria solution, coating the recovered bacteria solution on a resistance plate to obtain an LB solid culture medium containing kanamycin, inverting 36-38 ℃, and performing overnight culture at 37 ℃ until colonies appear; selecting escherichia coli containing recombinant plasmids, adding a liquid culture medium, carrying out shake culture at 37 ℃ until the OD600 of a bacterial liquid is 0.4-0.6, adding isopropyl-beta-D-thiogalactoside with the final concentration of 1mM, carrying out induction culture at 16 ℃ for 4 hours, and collecting thalli;
resuspending the collected thallus with sterilized water, freezing at-80 deg.C, and repeatedly freezing and thawing for 1-2 times; subjecting the re-suspended thallus subjected to induced culture and repeated freeze thawing to ultrasonic disruption under ice bath condition, lysing the thallus, centrifuging, collecting the supernatant, adding sample buffer solution, boiling, centrifuging, cooling, and collecting the supernatant to obtain the final productGrCrude ApoE-His recombinant protein;
the purification comprises the following steps: taking a certain amount of thallus after induction culture, performing solid-liquid separation, collecting thallus, performing ultrasonic disruption and cracking to obtain supernatant and precipitate, using ammonium sulfate salt as supernatant sample, and performing Ni treatment2+Purifying with ion affinity chromatography column at flow rate of 10 times column volume/hr, and collecting flow-through liquid; washing the Ni ion affinity column with 15 times of column volume of binding buffer solution to elute the hybrid protein; the column was washed with 5 mL of the eluate again, and when a peak of the target protein appeared, the eluate containing the target protein was collected.
A polyclonal antibody is prepared by immunizing animals with the recombinant protein of apoE of gobiocyprisrarus rarus.
The preparation method of the polyclonal antibody takes the apoE recombinant protein of gobiocyprisrarus rarus as an antigen, prepares antiserum by adopting a conventional preparation method of the polyclonal antibody, and separates and purifies the antiserum to obtain the polyclonal antibody.
In some embodiments, a method for preparing an ApoE protein anti-rabbit polyclonal antibody of gobiocypris rarus comprises: injecting the apoE recombinant protein of gobiocyprisrarus as antigen into rabbit body, immunizing for four times, collecting rabbit blood, separating serum, and purifying to obtain the anti-rabbit polyclonal antibody of the apoE protein of gobiocyprisrarus.
Further, the preparation method of the gobiocyprisrarus apolipoprotein ApoE anti-rabbit polyclonal antibody comprises the following steps:
using 5 New Zealand white rabbits, diluting immunogen with physiological saline, adjusting the concentration to 1mg/ml, injecting as antigen, and then performing 1:1 mixing, mixing completely to form stable emulsion, and injecting subcutaneously and intramuscularly under skin and back thigh around shoulders of rabbit, wherein each area is about 0.2ml of immunogen in 1/4. Complete adjuvant was used for the first rabbit immunization, followed by incomplete adjuvant. The first rabbit can be injected at different points of the above parts of the two rabbits by back multipoint injection after 2 weeks (the adjacent point is not selected, otherwise the ulcer is not healed well). The time interval of the three rabbits is 7 days, namely, the ear artery blood can be taken to detect the antibody titer after one week of immunization, and the antibody titer generated by the initial immunization for several times is lower, so that the blood can be taken for the first two times for detection. After three immunizations, the amount of blood taken increased, but not too much. 7 days after the test is qualified, adding rabbits, and bleeding by carotid artery after one week. The antibody titer in rabbit serum is detected by ELISA (indirect method), and the ApoE gene fragment amplified by PCR is compared with the theoretical value. The affinity chromatography column protein g was then prepared using profile reductive amination, optimizing the reaction conditions. The antigen is purified from human serum using perchloric acid precipitation, ion exchange and affinity chromatography. And further verifying the molecular mass of the purified protein by SDS-PAGE and Western-blotting to compare with mass spectrometry analysis data.
Further, the detection method of the GrApoE-His polyclonal antibody comprises the following steps:
firstly, extracting serum total protein of gobiocypris rarus, carrying out SDS-PAGE electrophoresis, carrying out PVDF (polyvinylidene fluoride membrane) membrane transfer on the serum total protein for 1h under the condition of a wet transfer method, then placing the PVDF membrane in 5% BSA or skimmed milk powder confining liquid for treatment for 2h to block hydrophobic binding sites on the PVDF membrane, and carrying out antibody purification according to the weight ratio of 1: 1500 dilution, placing on a shaking table for primary antibody incubation overnight, washing the membrane with TBST for three to four times, each time for 5min, adding a goat anti-rabbit HRP labeled IgG secondary antibody and a PVDF membrane, placing on the shaking table for room temperature incubation for 2h after membrane washing, washing the membrane with TBST for six to seven times after incubation, finally, using an enhanced DAB color development kit for color development, placing in a gel imager for detection and observation.
Gobiocypris rarus (A)Gobiocypris rarus) Apolipoprotein ApoE gene is cDNA sequence with length 792 bp, type of double-stranded, linear, nucleic acid, the saidGrThe sequence of ApoE was amplified by PCR and sequenced. The specific sequence is shown as follows, SEQ ID No. 1:
cgtagcctgtttcaggcagatgcacctcagcctcgttgggaagaaatggttgaacgtttttgggagagcgttagcgaactgaatacccatgcagatggtgttgttcaaaatattaaaggtagccaactgagccgtgaactggataccctgattaccgataccattagtgaactgggtagttatagcgataatctgcaaacgcagctgaccccgtatgcaagtgacgcagccggccagctgagcaaagatctgcagctgctggcaggtaaactgcagaccgacatgaccgatgcaaaagaacgtagcacccagtacctgcaagaactgaaaaccatggttgaacaaaatgcagacgatgttaaaaatcgcgtcaatacctatacacgcaaactgaaaaagcgcctgaataaagataccgaagaaattcgcaataccgtagcaacctacctgggcgaactgcaaagccgtgcaagccagaacgccgatgcagtgaaagatcgcctggaaccgtacctgacccaagcccaagatggcgcaaatcagaaactgggagcaattagcgaactgatgaaaagccaagcacaagaaatgagcgaacagctggaagtacaggcaggtgctctgaaagaaaaactggaacagaccgcagaagatctgcgtacaagcctggaaggccgtgtggatgaactgaccagcctgctgaccccgtacagcgaaaaaattcgtgaacagctgaaaattgttatggataaaattaaagaagcaagcgcagcactgccgacccaggcataa。
to pairGrThe nucleotide sequence of ApoE is optimized by codon, and an Escherichia coli expression system is selected for carrying out codon optimization onGrCodon-optimized sequence of the ApoE sequence, labeled SEQ ID No.2:
cgtagcctgtttcaggcagatgcacctcagcctcgttgggaagaaatggttgaacgtttttgggagagcgttagcgaactgaatacccatgcagatggtgttgttcaaaatattaaaggtagccaactgagccgtgaactggataccctgattaccgataccattagtgaactgggtagttatagcgataatctgcaaacgcagctgaccccgtatgcaagtgacgcagccggccagctgagcaaagatctgcagctgctggcaggtaaactgcagaccgacatgaccgatgcaaaagaacgtagcacccagtacctgcaagaactgaaaaccatggttgaacaaaatgcagacgatgttaaaaatcgcgtcaatacctatacacgcaaactgaaaaagcgcctgaataaagataccgaagaaattcgcaataccgtagcaacctacctgggcgaactgcaaagccgtgcaagccagaacgccgatgcagtgaaagatcgcctggaaccgtacctgacccaagcccaagatggcgcaaatcagaaactgggagcaattagcgaactgatgaaaagccaagcacaagaaatgagcgaacagctggaagtacaggcaggtgctctgaaagaaaaactggaacagaccgcagaagatctgcgtacaagcctggaaggccgtgtggatgaactgaccagcctgctgaccccgtacagcgaaaaaattcgtgaacagctgaaaattgttatggataaaattaaagaagcaagcgcagcactgccgacccaggcataa。
saidGrApoE molecular type is protein, and the sequence characteristics are as follows: length 263aa, type amino acid, sequence information as follows, labeled SEQ ID No.3:
RSLFQADAPQPRWEEMVERFWESVSELNTHADGVVQNIKGSQLSRELDTLITDTISELGSYSDNLQTQLTPYASDAAGQLSKDLQLLAGKLQTDMTDAKERSTQYLQELKTMVEQNADDVKNRVNTYTRKLKKRLNKDTEEIRNTVATYLGELQSRASQNADAVKDRLEPYLTQAQDGANQKLGAISELMKSQAQEMSEQLEVQAGALKEKLEQTAEDLRTSLEGRVDELTSLLTPYSEKIREQLKIVMDKIKEASAALPTQA*。
the gobiocypris rarus of the inventionGobiocypris rarus) The preparation method of the apolipoprotein ApoE recombinant protein and the anti-rabbit polyclonal antibody comprises the following steps:
gobiocypris rarus (Gobiocypris rarus) Synthesis of apolipoprotein ApoE codon-optimized gene;
gobiocypris rarus (Gobiocypris rarus) Recombinant expression of apolipoprotein ApoE;
gobiocypris rarus (Gobiocypris rarus) A preparation method of apolipoprotein ApoE anti-rabbit polyclonal antibody.
The invention also provides the application of the gobiocyprisrarus apoE recombinant protein/the polyclonal antibody in apoE detection.
Has the advantages that:
the invention not only recombines and expresses the active ApoE protein and provides a basis for the function of the protein, but also provides a condition for detecting the content of the ApoE in the fish body by the produced polyclonal antibody and provides a condition for further scientific research by the produced antibody. The invention can obtain ApoE recombinant protein existing in a soluble way, the protein directly has biological activity, and the activity of the protein does not need to be obtained by methods such as renaturation and the like, so the production process is simpler and more convenient. The obtained polyclonal antibody against rabbit ApoE provides antibody support for researching the function of apolipoprotein in fish in the future.
The invention is toGrDirectly synthesizing ApoE codon optimized sequence SEQ ID No.2, connecting into pET30a vector, transforming into Escherichia coli competent cell BL21, selecting monoclonal, performing shake culture, performing IPTG induction culture, collecting thallus, performing SDS-PAGE protein detection, ultrasonically crushing and cracking bacteria, and performing protein detection with Ni2+And purifying the target protein by using an affinity chromatography column. Then in the purified formGrApoE recombinant protein is used as antigen, 5 New Zealand white rabbits are adopted for immunization, serum is collected, and the antibody titer in the rabbit serum is detected by ELISA (indirect assay). Then, the antibody is purified by using affinity chromatography column proteinG, and is applied to subsequent western blot and other experiments. By recombinant expressionGrThe ApoE protein can be further used for analyzing the structure and the function of the protein in vitro, and in addition, the preparation of the polyclonal antibody can lay a foundation for further detecting the content of the ApoE in the fish body. Through the traditional prokaryotic expression method, most of the recombinant protein exists in the form of inclusion body and has no biological activity, and in the technical method, the recombinant expression is realized under the conditions of low-concentration IPTG induction and low-rotation-speed induction at 30 ℃ and 100 rpmGrThe soluble expression of ApoE protein, recombinant protein in the supernatant of thallus lysate, directly has biological activity, and does not need renaturation, thus reducing the production process. The polyclonal antibody prepared by the invention can specifically recognize and bind ApoE protein, the specificity of the antibody is better, and the concentration of the antibody reaches 4.8 mg/mL through protein concentration measurement.
Drawings
In the context of figure 1, it is shown,Grcodon preference analysis after ApoE codon optimisation. The CAI of SEQ ID No.1 is 0.73 and the CAI of SEQ ID No.2 after codon optimization is 0.93. The closer the CAI value is to 1, the better the codon optimisation. After codon optimization, the SEQ ID No.2 sequence is more suitable for an Escherichia coli expression system.
In the context of figure 2, it is shown,Grand (4) carrying out SDS-PAGE electrophoresis detection on the ApoE recombinant protein. M represents protein marker, 1 represents a bacterial protein not induced by IPTG, 2 represents a bacterial protein induced by IPTG, and 3 represents Ni2+After purificationMrThy β 4 recombinant protein.
In the context of figure 3, it is shown,Grand (3) carrying out western blot detection on the ApoE anti-rabbit polyclonal antibody.
Detailed Description
Example 1
1. GrApoE-inducible expression of the His recombinant protein:
competent cells to Escherichia coliE. coliThe connection of the BL21 is pET30a- GrApoEAnd (3) gently mixing the recombinant plasmid uniformly without blowing, standing in a prepared ice bath for 30min, then placing in a water bath at 42-45 ℃ for heat shock for 90 s, quickly transferring to the ice bath and placing for 2-5min, and not shaking a sample centrifuge tube in the whole process. Adding 900 μ L sterile LB medium into each sample, gently mixing, placing on a shaking table, and performing shake culture at 37 deg.C for 60 min to recover thallus, wherein the shake culture time can be reduced if adjusting to 38 deg.C or increasing rotation speed. Then 100 mul of recovered bacterial liquid is sucked and coated on an LB solid culture medium containing kanamycin on a resistant plate, inversion is carried out after the liquid is absorbed and no water flows, the liquid is cultured overnight at 37 ℃ until bacterial colonies appear, and the liquid can be placed at 4 ℃ for a plurality of hours after the culture is finished, so that the blue white spots are fully developed. Selecting escherichia coli containing recombinant plasmids, adding a liquid culture medium, carrying out shake culture at 37 ℃ by a shaking table until the OD600 of a bacterial liquid is 0.4-0.6, adding isopropyl-beta-D-thiogalactoside with the final concentration of 1mM, carrying out induced expression for 4 hours at 19-25 ℃, collecting thalli, carrying out re-suspension by using sterilized water, freezing and storing at-80 ℃, and repeatedly freezing and thawing for 1-2 times; taking the re-suspended bacteria which are repeatedly frozen and thawed after induction culture, carrying out ultrasonic crushing under the ice bath condition, cracking the bacteria, centrifugally collecting the crushed supernatant, adding a loading buffer solution, boiling, centrifuging, cooling, taking the supernatant, and carrying out SDS-PAGE electrophoresis detection.
2. GrApoEPurification of the His recombinant protein:
to pairGrSeparating and purifying ApoE-His recombinant protein: taking a certain amount of thallus after induction culture, addingPerforming solid-liquid separation, collecting thallus, performing Ni treatment on supernatant sample after ultrasonication by using ammonium sulfate2+Purifying with ion affinity chromatography column at flow rate of 10 times of column volume/hr, and collecting flow-through liquid. The Ni ion affinity column was washed with 15 column volumes of Binding Buffer (20 mM Tris-HCl pH 7.9, 5 mM imidazole, 0.5M NaCl) to elute the contaminating proteins. The column was washed again with 5 mL of Elution Buffer (20 mM Tris-HCl pH 7.9, 500 mM imidazole, 0.5M NaCl) and when the peak of the target protein appeared, the eluate containing the target protein was collected. As shown in FIG. 2, lane 1 represents the non-induced protein, lane 2 represents the expressed protein after induction, and lane 3 represents the purified recombinant protein. It can be seen that after induction expression, a large amount of target protein is expressed, and after purification, the band is single and the purity is higher.
3. Anti-rabbitGrPreparation of ApoE-His polyclonal antibody:
adopting 5 New Zealand white rabbits, diluting immunogen with normal saline, adjusting the concentration of recombinant GrApoE protein to be 1mg/ml, injecting the recombinant GrApoE protein as antigen, and then performing 1:1 mixing, mixing completely to form stable emulsion, and injecting subcutaneously and intramuscularly under skin and back thigh around shoulders of rabbit, wherein each area is about 0.2ml of immunogen in 1/4. Complete adjuvant was used for the first rabbit immunization, followed by incomplete adjuvant. The first rabbit can be injected at different points of the above parts of the two rabbits by back multipoint injection after 2 weeks (the adjacent point is not selected, otherwise the ulcer is not healed well). The time interval of the three rabbits is 7 days, namely, the ear artery blood can be taken to detect the antibody titer after one week of immunization, and the antibody titer generated by the initial immunization for several times is lower, so that the blood can be taken for the first two times for detection. After three immunizations, the amount of blood taken increased, but not too much. 7 days after the test is qualified, adding rabbits, and bleeding by carotid artery after one week. The antibody titer in rabbit serum is detected by ELISA (indirect method), and the ApoE gene fragment amplified by PCR is compared with the theoretical value. The affinity chromatography column protein g was then prepared using profile reductive amination, optimizing the reaction conditions. The antigen is purified from human serum using perchloric acid precipitation, ion exchange and affinity chromatography. And further verifying the molecular mass of the purified protein by SDS-PAGE and Western-blotting to compare with mass spectrometry analysis data.
4. GrApoEWestern blot detection of His polyclonal antibodies:
firstly, extracting serum total protein of gobiocypris rarus, carrying out SDS-PAGE electrophoresis, carrying out PVDF (polyvinylidene fluoride membrane) membrane transfer on the serum total protein for 1h under the condition of a wet transfer method, then placing the PVDF membrane in 5% BSA or skimmed milk powder confining liquid for treatment for 2h to block hydrophobic binding sites on the PVDF membrane, and carrying out antibody purification according to the weight ratio of 1: 1500 dilution, placing on a shaking table for primary antibody incubation overnight, washing the membrane with TBST for three to four times, each time for 5min, adding a goat anti-rabbit HRP labeled IgG secondary antibody and a PVDF membrane, placing on the shaking table for room temperature incubation for 2h after membrane washing, washing the membrane with TBST for six to seven times after incubation, finally, using an enhanced DAB color development kit for color development, placing in a gel imager for detection and observation.
As shown in FIG. 3, it can be seen that the compound is preparedGrThe ApoE-His polyclonal antibody is subjected to a western blot experiment, can specifically recognize and bind to ApoE protein, shows that the specificity of the antibody is good, and in addition, the concentration of the antibody reaches 4.8 mg/mL through protein concentration measurement.
Sequence listing
<110> Yangzhou university
<120> ApoE gene of gobiocyprisrarus apolipoprotein, recombinant protein, polyclonal antibody, preparation method and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 792
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgtagcctgt ttcaggcaga tgcacctcag cctcgttggg aagaaatggt tgaacgtttt 60
tgggagagcg ttagcgaact gaatacccat gcagatggtg ttgttcaaaa tattaaaggt 120
agccaactga gccgtgaact ggataccctg attaccgata ccattagtga actgggtagt 180
tatagcgata atctgcaaac gcagctgacc ccgtatgcaa gtgacgcagc cggccagctg 240
agcaaagatc tgcagctgct ggcaggtaaa ctgcagaccg acatgaccga tgcaaaagaa 300
cgtagcaccc agtacctgca agaactgaaa accatggttg aacaaaatgc agacgatgtt 360
aaaaatcgcg tcaataccta tacacgcaaa ctgaaaaagc gcctgaataa agataccgaa 420
gaaattcgca ataccgtagc aacctacctg ggcgaactgc aaagccgtgc aagccagaac 480
gccgatgcag tgaaagatcg cctggaaccg tacctgaccc aagcccaaga tggcgcaaat 540
cagaaactgg gagcaattag cgaactgatg aaaagccaag cacaagaaat gagcgaacag 600
ctggaagtac aggcaggtgc tctgaaagaa aaactggaac agaccgcaga agatctgcgt 660
acaagcctgg aaggccgtgt ggatgaactg accagcctgc tgaccccgta cagcgaaaaa 720
attcgtgaac agctgaaaat tgttatggat aaaattaaag aagcaagcgc agcactgccg 780
acccaggcat aa 792
<210> 2
<211> 792
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cgtagcctgt ttcaggcaga tgcacctcag cctcgttggg aagaaatggt tgaacgtttt 60
tgggagagcg ttagcgaact gaatacccat gcagatggtg ttgttcaaaa tattaaaggt 120
agccaactga gccgtgaact ggataccctg attaccgata ccattagtga actgggtagt 180
tatagcgata atctgcaaac gcagctgacc ccgtatgcaa gtgacgcagc cggccagctg 240
agcaaagatc tgcagctgct ggcaggtaaa ctgcagaccg acatgaccga tgcaaaagaa 300
cgtagcaccc agtacctgca agaactgaaa accatggttg aacaaaatgc agacgatgtt 360
aaaaatcgcg tcaataccta tacacgcaaa ctgaaaaagc gcctgaataa agataccgaa 420
gaaattcgca ataccgtagc aacctacctg ggcgaactgc aaagccgtgc aagccagaac 480
gccgatgcag tgaaagatcg cctggaaccg tacctgaccc aagcccaaga tggcgcaaat 540
cagaaactgg gagcaattag cgaactgatg aaaagccaag cacaagaaat gagcgaacag 600
ctggaagtac aggcaggtgc tctgaaagaa aaactggaac agaccgcaga agatctgcgt 660
acaagcctgg aaggccgtgt ggatgaactg accagcctgc tgaccccgta cagcgaaaaa 720
attcgtgaac agctgaaaat tgttatggat aaaattaaag aagcaagcgc agcactgccg 780
acccaggcat aa 792
<210> 3
<211> 263
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Arg Ser Leu Phe Gln Ala Asp Ala Pro Gln Pro Arg Trp Glu Glu Met
1 5 10 15
Val Glu Arg Phe Trp Glu Ser Val Ser Glu Leu Asn Thr His Ala Asp
20 25 30
Gly Val Val Gln Asn Ile Lys Gly Ser Gln Leu Ser Arg Glu Leu Asp
35 40 45
Thr Leu Ile Thr Asp Thr Ile Ser Glu Leu Gly Ser Tyr Ser Asp Asn
50 55 60
Leu Gln Thr Gln Leu Thr Pro Tyr Ala Ser Asp Ala Ala Gly Gln Leu
65 70 75 80
Ser Lys Asp Leu Gln Leu Leu Ala Gly Lys Leu Gln Thr Asp Met Thr
85 90 95
Asp Ala Lys Glu Arg Ser Thr Gln Tyr Leu Gln Glu Leu Lys Thr Met
100 105 110
Val Glu Gln Asn Ala Asp Asp Val Lys Asn Arg Val Asn Thr Tyr Thr
115 120 125
Arg Lys Leu Lys Lys Arg Leu Asn Lys Asp Thr Glu Glu Ile Arg Asn
130 135 140
Thr Val Ala Thr Tyr Leu Gly Glu Leu Gln Ser Arg Ala Ser Gln Asn
145 150 155 160
Ala Asp Ala Val Lys Asp Arg Leu Glu Pro Tyr Leu Thr Gln Ala Gln
165 170 175
Asp Gly Ala Asn Gln Lys Leu Gly Ala Ile Ser Glu Leu Met Lys Ser
180 185 190
Gln Ala Gln Glu Met Ser Glu Gln Leu Glu Val Gln Ala Gly Ala Leu
195 200 205
Lys Glu Lys Leu Glu Gln Thr Ala Glu Asp Leu Arg Thr Ser Leu Glu
210 215 220
Gly Arg Val Asp Glu Leu Thr Ser Leu Leu Thr Pro Tyr Ser Glu Lys
225 230 235 240
Ile Arg Glu Gln Leu Lys Ile Val Met Asp Lys Ile Lys Glu Ala Ser
245 250 255
Ala Ala Leu Pro Thr Gln Ala
260

Claims (10)

1. ApoE gene of gobiocypris rarus, characterized in that the gene is namedGrApoE, the nucleotide sequence of which is SED ID NO: 1 is shown.
2. ApoE codon optimization gene of gobiocypris rarus is characterized in thatGrNucleotide sequence SED ID NO of ApoE: 1, the nucleotide sequence of which is codon optimized, such as SED ID NO: 2, respectively.
3. ApoE recombinant protein of gobiocypris rarus is characterized in that the amino acid sequence of the apoE recombinant protein is as shown in SED ID NO: 3, respectively.
4. A polyclonal antibody, which is prepared by immunizing an animal with the recombinant ApoE protein of gobiocypris rarus of claim 3 as an antigen.
5. Use of the polyclonal antibody of claim 4 in ApoE detection.
6. The method for preparing ApoE recombinant protein of gobiocyprisrarus as claimed in claim 3, which comprises:
constructing a recombinant plasmid: optimizing gene sequence SED ID NO of apoE codon of gobiocypris rarus: 2 into pET30a expression vector to obtain pET30a- GrAn ApoE recombinant plasmid;
induced expression of recombinant protein: pET30a- GrAnd (3) transforming the ApoE recombinant plasmid into escherichia coli, culturing, inducing, cracking and purifying to obtain the gobiocypris rarus ApoE recombinant protein.
7. The method for preparing ApoE recombinant protein of gobiocyprisrarus as claimed in claim 6, wherein the induced expression of the recombinant protein comprises: competent cells to Escherichia coliBL21 addition of pET30a- GrUniformly mixing ApoE recombinant plasmids, and coating the mixture to a solid culture medium for culture to obtain a colony of escherichia coli containing the recombinant plasmids; selecting Escherichia coli containing recombinant plasmid, adding liquid culture medium, shake culturing, adding isopropyl-beta-D-thiogalactoside (IPTG) for induction culture to obtainGrCollecting crude ApoE-His recombinant protein product, collecting thallus, cracking bacteria with an ultrasonic crusher, and purifying recombinant protein to obtain the recombinant protein;
and/or, the purifying comprises: taking a certain amount of thallus after induction culture, performing solid-liquid separation, collecting thallus, performing ultrasonic disruption and cracking to obtain supernatant and precipitate, using ammonium sulfate salt as supernatant sample, and performing Ni treatment2+Purifying with ion affinity chromatography column at flow rate of 10 times column volume/hr, and collecting flow-through liquid; washing the Ni ion affinity column with 15 times of column volume of binding buffer solution to elute the hybrid protein; the column was washed with 5 mL of the eluate again, and when a peak of the target protein appeared, the eluate containing the target protein was collected.
8. The method of producing a polyclonal antibody as defined in claim 4, wherein an antiserum is produced by using the apoE recombinant protein of gobiocyprisrarus as defined in claim 3 as an antigen and using a conventional method for producing a polyclonal antibody, and the antiserum is separated and purified to obtain the polyclonal antibody.
9. The method for producing a polyclonal antibody according to claim 8, comprising: injecting the apoE recombinant protein of gobiocyprisrarus as antigen into rabbit body, immunizing for four times, collecting rabbit blood, separating serum, and purifying to obtain the anti-rabbit polyclonal antibody of the apoE protein of gobiocyprisrarus.
10. The method for producing a polyclonal antibody according to claim 9, wherein ApoE recombinant protein concentration of gobiocypris rarus is adjusted to 1mg/mL for antigen injection; extracting adjuvant and antigen at a volume ratio of 1: 1; the first-time immunization adopts a complete adjuvant, and the second-time immunization adopts an incomplete adjuvant.
CN202011015704.8A 2020-09-24 2020-09-24 ApoE gene, recombinant protein, polyclonal antibody and preparation method and application of apoE gene and recombinant protein Pending CN112111496A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011015704.8A CN112111496A (en) 2020-09-24 2020-09-24 ApoE gene, recombinant protein, polyclonal antibody and preparation method and application of apoE gene and recombinant protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011015704.8A CN112111496A (en) 2020-09-24 2020-09-24 ApoE gene, recombinant protein, polyclonal antibody and preparation method and application of apoE gene and recombinant protein

Publications (1)

Publication Number Publication Date
CN112111496A true CN112111496A (en) 2020-12-22

Family

ID=73800586

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011015704.8A Pending CN112111496A (en) 2020-09-24 2020-09-24 ApoE gene, recombinant protein, polyclonal antibody and preparation method and application of apoE gene and recombinant protein

Country Status (1)

Country Link
CN (1) CN112111496A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113637689A (en) * 2021-09-09 2021-11-12 蚌埠医学院 Codon-optimized gene, recombinant expression vector, recombinant protein and polyclonal antibody preparation method and application

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008048773A2 (en) * 2006-10-13 2008-04-24 The Regents Of The University Of California Models of atherosclerosis, hyperlipidemia, lipoprotein oxidation and blood vessel inflammation and methods for making and using them
KR101475620B1 (en) * 2013-08-13 2014-12-22 영남대학교 산학협력단 Food or drug additive for improving inflammation or fatty liver comprising tagatose
CN107430131A (en) * 2014-12-22 2017-12-01 生物群组有限公司 Determine pathological tissue damage and the method for diagnosing infectious diseases in fish in fish
CN111499726A (en) * 2020-04-21 2020-08-07 扬州大学 Preparation method of gobiocyprisrarus apoA1 recombinant protein and anti-rabbit polyclonal antibody

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008048773A2 (en) * 2006-10-13 2008-04-24 The Regents Of The University Of California Models of atherosclerosis, hyperlipidemia, lipoprotein oxidation and blood vessel inflammation and methods for making and using them
US20100242123A1 (en) * 2006-10-13 2010-09-23 The Regents Of The University Of California Models of atherosclerosis, hyperlipidemia, lipoprotein oxidation and blood vessel inflammation and methods for making and using them
KR101475620B1 (en) * 2013-08-13 2014-12-22 영남대학교 산학협력단 Food or drug additive for improving inflammation or fatty liver comprising tagatose
CN107430131A (en) * 2014-12-22 2017-12-01 生物群组有限公司 Determine pathological tissue damage and the method for diagnosing infectious diseases in fish in fish
CN111499726A (en) * 2020-04-21 2020-08-07 扬州大学 Preparation method of gobiocyprisrarus apoA1 recombinant protein and anti-rabbit polyclonal antibody

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
KEUN-YONG KIM等: "Isolation and characterization of the apolipoprotein multigene family in Hemibarbus mylodon (Teleostei: Cypriniformes)", 《COMPARATIVE BIOCHEMISTRY AND PHYSIOLOGY, PART B》 *
KIM,K.Y.等: "Hemibarbus mylodon apolipoprotein E-2 (apoE-2) mRNA, complete cds", 《GENBANK DATABASE》 *
XUEMEI FANG等: "The identification of apolipoprotein genes in rare minnow (Gobiocypris rarus) and their expression following perfluorooctanoic acid exposure", 《COMPARATIVE BIOCHEMISTRY AND PHYSIOLOGY PART C: TOXICOLOGY & PHARMACOLOGY》 *
刘文泰: "《医学免疫学》", 28 February 2009, 北京：中国中医药出版社 *
梁运霞等: "《兽医基础》", 31 March 2005, 哈尔滨：黑龙江人民出版社 *
陈亚萍等: "香鱼ApoC-Ⅰ的克隆、序列分析及其镉胁迫下的表达", 《生物学杂志》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113637689A (en) * 2021-09-09 2021-11-12 蚌埠医学院 Codon-optimized gene, recombinant expression vector, recombinant protein and polyclonal antibody preparation method and application

Similar Documents

Publication Publication Date Title
WO2016188449A1 (en) Single-domain antibody targeting cd47
CN116023479B (en) Bovine viral diarrhea virus nano antibody and preparation method and application thereof
CN110628776B (en) Coding gene of scylla paramamosain allergenic protein and application thereof
CN111499726A (en) Preparation method of gobiocyprisrarus apoA1 recombinant protein and anti-rabbit polyclonal antibody
CN110218250A (en) A kind of preparation method of grass carp component 5 polyclonal antibody
CN111763256A (en) Cloning of chicken CR2 gene, expression and purification of protein and preparation of polyclonal antibody thereof
CN111840530A (en) Preparation method of Eimeria tenella recombinant polypeptide vaccine VNQS and application method thereof in chicken coccidiosis resistance
CN110172097B (en) Monoclonal antibody of mycobacterium tuberculosis CFP-10 protein and application thereof
CN110054687B (en) Grass carp ATG12 polyclonal antibody and preparation method thereof
CN112111496A (en) ApoE gene, recombinant protein, polyclonal antibody and preparation method and application of apoE gene and recombinant protein
CN117186230B (en) Bispecific antibody containing hydrophilic amino acid and used for anti-human BCMA nano antibody
CN110716035B (en) Echinococcosis-resistant high-throughput drug screening method based on echinococcosis tubulin as target spot
CN103509100B (en) A kind of IL-1 R antagonist mutant
CN112094853A (en) White spot syndrome virus VP28 gene, recombinant protein, polyclonal antibody, preparation method and application
CN115960227A (en) Anti-human MSH2 monoclonal antibody, preparation method and application thereof
CN111840529A (en) Preparation method of Eimeria tenella recombinant polypeptide vaccine VKVQ and application method thereof in chicken coccidiosis resistance
CN112458093A (en) Encoding gene of grapevine oyster allergenic protein TM and application thereof
CN111909949B (en) Preparation method and application of recombinant protein HSP70_5 of Sporothrix globosum
CN110205336A (en) A kind of recombinant expression method of Brevinin-2GUb polypeptide and application
CN111978382B (en) Preparation method and application of recombinant protein of Sporothrix globosum Gp70
CN117487770B (en) Methionine-tRNA synthetase related to crop development of breeding pigeons and application thereof
CN117986360B (en) Specific antibody of IL18 protein and preparation method and application thereof
JP3122963B2 (en) Monoclonal antibody
CN109970854B (en) Tyrophagus putrescentiae Der p10 monoclonal antibody and preparation method and application thereof
CN115948346A (en) Hybridoma cell strain capable of stably secreting anti-conotoxin mu-KIIIA-CTX monoclonal antibody

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20201222